WO2006082253A2 - Verfahren zum beschichten von oberflächen mit hydrophobinen - Google Patents

Verfahren zum beschichten von oberflächen mit hydrophobinen Download PDF

Info

Publication number
WO2006082253A2
WO2006082253A2 PCT/EP2006/050723 EP2006050723W WO2006082253A2 WO 2006082253 A2 WO2006082253 A2 WO 2006082253A2 EP 2006050723 W EP2006050723 W EP 2006050723W WO 2006082253 A2 WO2006082253 A2 WO 2006082253A2
Authority
WO
WIPO (PCT)
Prior art keywords
hydrophobin
fusion
coating
hydrophobins
formulation
Prior art date
Application number
PCT/EP2006/050723
Other languages
English (en)
French (fr)
Other versions
WO2006082253A3 (de
Inventor
Thomas Subkowski
Marvin Karos
Claus Bollschweiler
Ulf Baus
Patrick RÜDIGER
Michael Lang
Thorsten Montag
Alexandra Brandt
Original Assignee
Basf Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE200510005737 external-priority patent/DE102005005737A1/de
Priority claimed from DE200510007480 external-priority patent/DE102005007480A1/de
Priority claimed from DE200510051515 external-priority patent/DE102005051515A1/de
Application filed by Basf Aktiengesellschaft filed Critical Basf Aktiengesellschaft
Priority to US11/883,755 priority Critical patent/US20080319168A1/en
Priority to EP06708070A priority patent/EP1848734A2/de
Publication of WO2006082253A2 publication Critical patent/WO2006082253A2/de
Publication of WO2006082253A3 publication Critical patent/WO2006082253A3/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B05—SPRAYING OR ATOMISING IN GENERAL; APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D—PROCESSES FOR APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D5/00—Processes for applying liquids or other fluent materials to surfaces to obtain special surface effects, finishes or structures
    • B05D5/04—Processes for applying liquids or other fluent materials to surfaces to obtain special surface effects, finishes or structures to obtain a surface receptive to ink or other liquid
    • C—CHEMISTRY; METALLURGY
    • C03—GLASS; MINERAL OR SLAG WOOL
    • C03C—CHEMICAL COMPOSITION OF GLASSES, GLAZES OR VITREOUS ENAMELS; SURFACE TREATMENT OF GLASS; SURFACE TREATMENT OF FIBRES OR FILAMENTS MADE FROM GLASS, MINERALS OR SLAGS; JOINING GLASS TO GLASS OR OTHER MATERIALS
    • C03C17/00—Surface treatment of glass, not in the form of fibres or filaments, by coating
    • C03C17/28—Surface treatment of glass, not in the form of fibres or filaments, by coating with organic material
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K17/00—Carrier-bound or immobilised peptides; Preparation thereof
    • C—CHEMISTRY; METALLURGY
    • C14—SKINS; HIDES; PELTS; LEATHER
    • C14C—CHEMICAL TREATMENT OF HIDES, SKINS OR LEATHER, e.g. TANNING, IMPREGNATING, FINISHING; APPARATUS THEREFOR; COMPOSITIONS FOR TANNING
    • C14C13/00—Manufacture of special kinds or leather, e.g. vellum
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B05—SPRAYING OR ATOMISING IN GENERAL; APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D—PROCESSES FOR APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D2201/00—Polymeric substrate or laminate
    • B05D2201/02—Polymeric substrate
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B05—SPRAYING OR ATOMISING IN GENERAL; APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D—PROCESSES FOR APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D2202/00—Metallic substrate
    • B05D2202/20—Metallic substrate based on light metals
    • B05D2202/25—Metallic substrate based on light metals based on Al
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B05—SPRAYING OR ATOMISING IN GENERAL; APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D—PROCESSES FOR APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D2203/00—Other substrates
    • B05D2203/24—Leather
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B05—SPRAYING OR ATOMISING IN GENERAL; APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D—PROCESSES FOR APPLYING FLUENT MATERIALS TO SURFACES, IN GENERAL
    • B05D7/00—Processes, other than flocking, specially adapted for applying liquids or other fluent materials to particular surfaces or for applying particular liquids or other fluent materials
    • B05D7/12—Processes, other than flocking, specially adapted for applying liquids or other fluent materials to particular surfaces or for applying particular liquids or other fluent materials to leather
    • C—CHEMISTRY; METALLURGY
    • C03—GLASS; MINERAL OR SLAG WOOL
    • C03C—CHEMICAL COMPOSITION OF GLASSES, GLAZES OR VITREOUS ENAMELS; SURFACE TREATMENT OF GLASS; SURFACE TREATMENT OF FIBRES OR FILAMENTS MADE FROM GLASS, MINERALS OR SLAGS; JOINING GLASS TO GLASS OR OTHER MATERIALS
    • C03C2217/00—Coatings on glass
    • C03C2217/70—Properties of coatings
    • C03C2217/76—Hydrophobic and oleophobic coatings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a process for coating surfaces with fusion hydrophobins at a pH> 4 as well as surfaces having a coating comprising fusion hydrophobins.
  • Hydrophobins are small proteins of about 100 to 150 amino acids, which are characteristic of filamentous fungi, for example Schizophyllum commune. They usually have 8 cysteine units. Hydrophobins can be isolated, for example, from natural sources.
  • Hydrophobins have a marked affinity for interfaces and are therefore suitable for coating surfaces.
  • Teflon can be coated by means of hydrophobins to obtain a hydrophilic surface.
  • WO 96/41882 proposes the use of hydrophobins obtained from edible fungi as emulsifiers, thickeners, surface-active substances, for hydrophilizing hydrophobic surfaces, for improving the water resistance of hydrophilic substrates, for producing oil-in-water emulsions or for water-in Oil emulsions. Furthermore, pharmaceutical applications such as the production of ointments or creams and cosmetic applications such as skin protection or the production of hair shampoos or hair rinses are proposed.
  • EP-B 1 252 516 discloses the coating of windows, contact lenses, biosensors, medical devices, containers for carrying out experiments or for storage, hulls, solid particles or frame or body of passenger cars with a solution containing hydrophobins at a temperature of 30 to 80 0 C.
  • a surface-active substance is additionally used as a coating aid.
  • a type SC3 hydrophobin obtained from fungi (Schizophyllumford) is used.
  • To prepare the solution for coating freeze-dried SC3 is used, dissolved with trifluoroacetic acid, the mixture dried in a stream of nitrogen and then dissolved in water or a buffer solution. This procedure is cumbersome.
  • WO 2005/068087 proposes, as an alternative to heating, the coating in the acidic pH range.
  • the document discloses a method for coating surfaces with hydrophobins at a pH of less than 7, preferably less than 4 and particularly preferably less than 2. Further, a method for optimizing the coating conditions under variation of the parameters pH value, incubation time, concentration and the presence of a buffer proposed.
  • a hydrophobin of type SC3 from natural sources is used.
  • the present application relates to the coating of surfaces with a novel class of non-naturally occurring hydrophobins.
  • These are fusion hydrophobins in which naturally occurring hydrophobins are linked to at least 20 amino acid long peptide sequences which are not naturally linked to a hydrophobin.
  • Such fusion hydrophobins are also suitable for coating surfaces.
  • fusion hydrophobins which have the following general structural formula (I),
  • X is any of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Me Met, Thr, Asn, Lys, VaI, Ala, Asp, Glu, Gly) can.
  • X may be the same or different.
  • the indices standing at X each represent the number of amino acids, C stands for cysteine, alanine, serine, glycine, methionine or threonine, wherein at least four of the radicals named C are cysteine.
  • indices n and m independently of one another represent natural numbers of 0 and 500, preferably of 15 to 300, with the proviso that at least one of the peptide sequences designated X n and X m represents a peptide sequence of at least 5, preferably at least 20 amino acids naturally not associated with a hydrophobin.
  • the polypetides according to formula (I) are further characterized by the property that at room temperature after coating a glass surface they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 ° and particularly preferably 30 °, in each case compared with the contact angle of an equal drop of water with the uncoated glass surface.
  • the amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C 1 to C 8 should consist of cysteines.
  • Cysteines can either be reduced in the proteins used according to the invention or form disulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those with at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.
  • cysteines, serines, alanines, glycines, methionines or threonines are also used in the positions indicated by X, the numbering of the individual C-positions in the general formulas may change accordingly.
  • X, C and the indices standing at X and C are as defined above, however, the indices n and m are numbers between 0 and 300, and the proteins are further characterized by the above-mentioned contact angle change, with the proviso that at least one of the peptide sequences designated X n and X m is an at least 15, preferably at least 35 amino acid long peptide sequence which is not naturally linked to a hydrophobin.
  • the proteins are further characterized by the above-mentioned contact angle change, provided that at least one of the peptide sequences designated X n and X m is a peptide sequence which is at least 20 amino acids long, preferably at least 50 amino acids, which is not naturally linked to a hydrophobin, and at least 6 of the radicals named C are cysteine. Most preferably, all C radicals are cysteine.
  • the residues not naturally associated with a hydrophobin are also referred to below as fusion partners. This is to say that the proteins can consist of at least one hydrophobin part and one fusion partner, which do not occur together in nature in this form.
  • the fusion partner can be selected from a variety of proteins. It is also possible to link a plurality of fusion partners with a hydrophobin part, for example at the amino terminus (X n ) and at the carboxy terminus (X m ) of the hydrophobin part. However, it is also possible, for example, to link two fusion partner parts to one position (X n or X m ) of the hydrophobin.
  • fusion partner parts are proteins which occur naturally in microorganisms, in particular in E. coli or Bacillus subtilis.
  • fusion partner parts are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NO: 17 and 18) and thioredoxin.
  • fragments or derivatives of these sequences which comprise only a part, for example 70 to 99%, preferably 5 to 50% and particularly preferably 10 to 40% of said sequences, or in which individual amino acids or nucleotides are opposite the said sequence are changed, wherein the percentages in each case refers to the number of amino acids.
  • the fusion hydrophobin in addition to the fusion partner, also has a so-called affinity domain (affinity tag / affinity tail) as a group X n or X m .
  • affinity domains include (His) k, (Arg) k , (Asp) k, (Phe) k or (Cys) k groups, wherein k is generally a natural number from 1 to 10. It may preferably be a (His) k group, where k is 4 to 6.
  • fusion hydrophobins used according to the invention may also be modified in their polypeptide sequence, for example by glycosylation, acetylation or else by chemical crosslinking, for example with glutaraldehyde.
  • An essential property of the fusion proteins used in the invention is the change of surface properties when the surfaces are coated with the fusion proteins.
  • the change in the surface properties can be determined experimentally by measuring the contact angle of a water drop before and after coating the surface with the protein and determining the difference between the two measurements.
  • the implementation of contact angle measurements is known in principle to the person skilled in the art. The measurements refer to room temperature and water drops of 5 ⁇ l and the use of glass slides as substrate. The exact experimental conditions for an exemplary method for measuring the contact angle are shown in the experimental part.
  • the fusion proteins used according to the invention have the property of increasing the contact angle by at least 20 °, preferably at least 25 °, particularly preferably at least 30 °, in each case compared with the contact angle of a water droplet of the same size with the uncoated glass surface.
  • Preferred fusion hydrophobins for carrying out the present invention are those having a hydrophobic moiety of the type dewA, rodA, hypA, hypB, sc3, basfi, basf2, which are structurally characterized in the sequence listing below. It may also be just parts or derivatives thereof. It is also possible to link together a plurality of hydrophobic parts, preferably 2 or 3, of the same or different structure.
  • fusion proteins with the polypeptide sequences shown in SEQ ID NO: 20, 22, 24 and the nucleic acid sequences coding therefor, in particular the sequences according to FIG.
  • proteins which, starting from the SEQ ID NO. 20, 22 or 24 shown by exchange, insertion or deletion of at least one, up to 10, preferably 5, more preferably 5% of all amino acids, and still have at least 50% of the biological property of the starting proteins particularly preferred embodiments.
  • the biological property of the proteins is hereby understood to be the already described enlargement of the contact angle by at least 20 °.
  • fusion hydrophobins used according to the invention can be prepared chemically by known methods of peptide synthesis, for example by Merrifield solid-phase synthesis.
  • the preparation of the fusion hydrophobins preferably takes place by genetic engineering processes in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that in a host organism by gene expression of the combined nucleic acid sequence the desired fusion Hydrophobin is produced.
  • Suitable host organisms (production organisms) for said production process may be prokaryotes (including archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus. megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and others.
  • prokaryotes including archaea
  • eukaryotes especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, more preferably Escherichia coli, Bacillus subtilis, Bacillus. megaterium, As
  • the invention furthermore relates to the use of expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for a polypeptide used according to the invention, as well as vectors comprising at least one of these expression constructs.
  • constructs employed include a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream, and optionally other common regulatory elements, each operably linked to the coding sequence.
  • “Operational linkage” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended in the expression of the coding sequence.
  • operably linked sequences are targeting sequences as well as enhancers, polyadenylation signals and the like.
  • Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. As described in Goeddel, Gene Expression Technolgy: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
  • a preferred nucleic acid construct advantageously also contains one or more of the "enhancer" sequences already mentioned, functionally linked to the promoter, which allow increased expression of the nucleic acid sequence. Additional advantageous sequences can also be inserted at the 3 'end of the DNA sequences, such as further regulatory elements or terminators.
  • the nucleic acids may be contained in one or more copies in the construct.
  • the construct may also contain further markers such as antibiotic resistance or auxotrophic complementing genes, optionally for selection on the construct.
  • Advantageous regulatory sequences for the method are, for example, in promoters such as cos, tac, trp, tet, trp tet, lpp, lac, lpp-lac, Iaclq T7, T5, T3, gal , trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter, which are advantageously used in gram-negative bacteria.
  • promoters amy and SP02 in the yeast or fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH.
  • the nucleic acid construct, for expression in a host organism is advantageously inserted into a vector, such as a plasmid or a phage, which allows for optimal expression of the genes in the host.
  • a vector such as a plasmid or a phage
  • all other vectors known to the person skilled in the art ie, z.
  • viruses such as SV40, CMV, baculovirus and adenovirus, Transposons.lS elements, phasmids, cosmids, and linear or circular DNA, as well as the Agrobacterium system to understand.
  • vectors can be replicated autonomously in the host organism or replicated chromosomally. These vectors represent a further embodiment of the invention.
  • Suitable plasmids are described, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, plN-III "3-B1, tgt11 or pBdCI, in Streptomycespl J101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium for pSA77 or pAJ667, in fungi pALS1, pIL12 or pBB116, in yeasts 2alpha, pAG-1,
  • nucleic acid construct for expression of the further genes contained additionally 3'- and / or 5'-terminal regulatory sequences to increase the expression, which are selected depending on the selected host organism and gene or genes for optimal expression.
  • regulatory sequences are intended to allow the targeted expression of genes and protein expression. Depending on the host organism, this may mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
  • the regulatory sequences or factors can thereby preferably influence the gene expression of the introduced genes positively and thereby increase.
  • enhancement of the regulatory elements can advantageously be achieved at the transcriptional level by using strong transcription signals such as promoters and / or enhancers.
  • an enhancement of the translation is possible by, for example, the stability of the mRNA is improved.
  • the vector containing the nucleic acid construct or the nucleic acid can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination.
  • This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
  • an expression cassette is carried out by fusion of a suitable promoter with a suitable coding nucleotide sequence and a terminator or polyadenylation signal.
  • common recombination and cloning techniques are used, as described, for example, in T. Maniatis, EFFritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Coed Spring Harbor Laboratory, ColD Spring Harbor, NY (1989) and in TJ Silhavy , ML Berman and LW Enquist, Experiments with Gene Fusions, CoId Spring Harbor Laboratory, ColD Spring Harbor, NY (1984) and in Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
  • the recombinant nucleic acid construct or gene construct is inserted for expression in a suitable host organism, advantageously into a host-specific vector which enables optimal expression of the genes in the host.
  • Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels P.H. et al., Eds. Elsevier, Amsterdam-New York-Oxford, 1985).
  • recombinant microorganisms can be produced, which are transformed, for example, with at least one vector and can be used to produce the proteins used in the invention.
  • the recombinant constructs described above are introduced into a suitable host system and expressed.
  • Homologously recombined microorganisms can also be produced.
  • a vector is produced which contains at least a portion of a gene or a coding sequence to be used according to the invention, in which optionally at least one amino acid deletion, addition or substitution has been introduced in order to modify the sequence, e.g. B. functionally disrupted ("knockout" - vector).
  • the introduced sequence can, for. Also be a homologue from a related microorganism or be derived from a mammalian, yeast or insect source.
  • the vector used for homologous recombination may be designed such that the endogenous gene is mutated or otherwise altered upon homologous recombination but still encodes the functional protein (eg, the upstream regulatory region may be altered such that expression the endogenous protein is changed).
  • the altered portion of the gene used according to the invention is in the homologous recombination vector.
  • suitable vectors for homologous recombination is e.g. As described in Thomas, K.R. and Capecchi, M.R. (1987) Cell 51: 503.
  • prokaryotic or eukaryotic organisms are suitable as recombinant host organisms for the nucleic acid or nucleic acid construct used according to the invention.
  • microorganisms such as bacteria, fungi or yeast are used as host organisms.
  • Gram-positive or Gram-negative bacteria preferably bacteria of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, more preferably bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus are used.
  • the organisms used in the production process for fusion hydrophobins are attracted or cultivated, depending on the host organism, in a manner known to the person skilled in the art.
  • Microorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and optionally vitamins, at temperatures between 0 and 100 0 C, preferably between 10 to 60 0 C attracted under oxygen fumigation.
  • the pH of the nutrient fluid can be kept at a fixed value, that is, regulated during the cultivation or not.
  • the cultivation can be "batch”, “semi-batch” or continuous respectively.
  • Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously.
  • the enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.
  • Fusion proteins or functional, biologically active fragments thereof used according to the invention can be produced by means of a recombinant process in which a protein-producing microorganism is cultivated, if appropriate, the expression of the proteins is induced and these are isolated from the culture.
  • the proteins can thus also be produced on an industrial scale, if desired.
  • the recombinant microorganism can be cultured and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 0 C and a pH of 6 to 9. Specifically, suitable culturing conditions are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Colard Spring Harbor Laboratory, ColD Spring Harbor, NY (1989).
  • the cells are disrupted and the product is recovered from the lysate by known protein isolation methods.
  • the cells can optionally by high-frequency ultrasound, by high pressure, such as. B. in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by combining several of the listed methods are digested.
  • Purification of the fusion proteins used according to the invention can be achieved by known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, and by other conventional methods, such as ultrafiltration, crystallization, salting out, Dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, F.G., Biochemische Harvey Méen, Verlag Water de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
  • fusion hydrophobins with special anchor groups to facilitate isolation and purification, which can bind to corresponding complementary groups on solid supports, in particular suitable polymers.
  • Such solid carriers can be used, for example, as a filling for chromatography columns, and in this way the efficiency of the separation can generally be significantly increased.
  • separation methods are also known as affinity chromatography.
  • vector systems or oligonucleotides can be used in the production of the proteins, which extend the cDNA by certain nucleotide sequences and thus encode altered proteins or fusion proteins. Proteins modified for ease of purification include so-called "tags" acting as anchors, such as the modification known as hexa-histidine anchors.
  • fusion-hydrophobins modified with histidine anchors can be chromatographically purified using columnar-packed nickel-Sepharose.
  • the fusion hydrophobin can then be eluted from the column by suitable means for elution, such as an imidazole solution.
  • refurbishment methods can also be combined with each other. For example, it is possible first to separate by means of chromatography, and then to purify the solution obtained by means of dialysis of substances used for elution.
  • the cells are first separated by means of a suitable method from the Fermetationsbrühe, for example by microfiltration or by centrifugation. Subsequently, the cells can be disrupted by suitable methods, for example by means of the methods already mentioned above, and the cell debris can be separated from the inclusion bodies. The latter can be done advantageously by centrifuging. Finally, the inclusion bodies can be disrupted in a manner known in principle in order to liberate the fusion hydrophobins. This can be done for example by acids, bases and / or detergents.
  • the inclusion bodies with the fusion hydrophobins used according to the invention can generally be completely dissolved within about 1 h already using 0.1 M NaOH.
  • the purity of the fusion hydrophobins obtained by this simplified process is generally from 60 to 80% by weight with respect to the amount of all proteins.
  • the solutions obtained by the described, simplified purification process can be used without further purification for coating surfaces. As a rule, the secondary components do not disturb and at most have a negligible effect on the coating result.
  • the resulting hydrophobin solutions usually have a concentration of 0.1 mg / ml to 50 mg / ml of fusion hydrophobins.
  • the fusion hydrophobins can also be isolated from the solutions as a solid. This can be done, for example, in a manner known in principle by freeze-drying or spray-drying. In a preferred embodiment of the invention, the isolation can be carried out by means of spray drying.
  • the spray drying can be carried out with the solution purified by chromatography, but it is also possible with preference to use the solutions obtained by the purification process of the inclusion bodies (inclusion bodies).
  • the solutions can optionally be neutralized.
  • a pH range of 7 to 9 has been found to be particularly advantageous.
  • the solution can be spray-dried in a manner known in principle. Suitable apparatuses for spray drying are commercially available. The optimum spray drying conditions vary with device type and desired throughput. Input temperatures of 130 to 180 0 C and outlet temperatures of 50 to 80 ° C have been found in hydrophobin solutions to be favorable.
  • spray-drying auxiliaries such as, for example, sugar, manganese, dextran or maltodextrin can be used. An amount of from 0 to 30% by weight, preferably from 5 to 20% by weight, of such auxiliaries with respect to the hydrophobin has proven useful.
  • a formulation (F) which comprises at least water or aqueous solvent mixture and a fusion hydrophobin.
  • Suitable aqueous solvent mixtures include water and one or more water-miscible solvents.
  • the selection of such components is limited only insofar as the fusion hydrophobins and the other components must be sufficiently soluble in the mixture.
  • such mixtures comprise at least 50% by weight, preferably at least 65% by weight and more preferably at least 80% by weight, of water. Most preferably, only water is used.
  • the person skilled in the art will make a suitable choice among the water-miscible solvents, depending on the desired properties of the formulation F.
  • water-miscible solvents examples include monoalcohols, such as methanol, ethanol or propanol, higher alcohols, such as ethylene glycol or polyetherpolyols, and also ether alcohols, such as butylglycol or methoxypropanol.
  • monoalcohols such as methanol, ethanol or propanol
  • higher alcohols such as ethylene glycol or polyetherpolyols
  • ether alcohols such as butylglycol or methoxypropanol.
  • the formulation used for the treatment has a pH of> 4, preferably> 6 and particularly preferably> 7.
  • the pH may be 4, 5, 6, 7, 8, 9, 10, 11.
  • the pH is in the range of 4 to 11, preferably 6 to 10, particularly preferably 7 to 9.5 and very particularly preferably 7.5 to 9.
  • the pH may be 7.5 to 8.5 or 8.5 to 9.
  • the formulation preferably comprises a suitable buffer.
  • a suitable buffer depending on the pH range intended for the coating. Examples include potassium dihydrogen phosphate buffer, tris (hydroxymethyl) aminomethane buffer (Tris buffer), borax buffer, sodium bicarbonate buffer or sodium hydrogen phosphate buffer. Preferred is Tris buffer.
  • the concentration of the buffer in the solution will be determined by the skilled person depending on the desired properties of the formulation. The skilled person will usually pay attention to a sufficient buffer capacity to achieve the most constant coating conditions. A concentration of 0.001 mol / l to 1 mol / l, preferably 0.005 mol / l to 0.1 mol / l and particularly preferably 0.01 mol / l to 0.05 mol / l, has proven useful.
  • the formulation comprises at least one fusion hydrophobin.
  • Fusion hydrophobins and preferred fusion hydrophobins have already been mentioned at the outset.
  • mixtures of different fusion hydrophobins can be used.
  • Particularly suitable for carrying out the present invention is the fusion hydrophobin yaad-Xa-dewA-his (SEQ ID NO: 20), or derived therefrom, in which the fusion partner yaad is shortened.
  • concentration of the fusion hydrophobins in the solution will be selected by one skilled in the art according to the desired properties of the coating. With higher concentrations, a faster coating can usually be achieved.
  • formulation F may optionally comprise further components or additives.
  • Suitable surfactants are, for example, nonionic surfactants which comprise polyalkoxy groups, in particular polyethylene oxide groups. Examples include polyoxyethylene stearates, alkoxylated phenols and the like. Further examples of suitable surfactants include polyethyl neglycol (20) sorbitan monolaurate (Tween® 20), polyethylene glycol (20) sorbitan monopalmitate (Tween® 40), polyethylene glycol (20) sorbitan monostearate (Tween® 60), poly (ethylene glycol) (20) sorbitan monooleate ( Tween® 80), cyclohexylmethyl-.beta.-D-maltoside, cyclohexyl-ethyl-.beta.-D-maltoside, cyclohexyl-n-hexyl-.beta.-D-maltoside, n-undecyl-.beta.-D-maltoside si
  • surfactants are disclosed, for example, in WO 2005/68087 page 9, line 10 to page 10, line 2.
  • concentration of surfactants is generally 0.001% by weight to 0.5% by weight, preferably 0.01% by weight to 0.25% by weight and particularly preferably 0.1% by weight to 0.2% by weight. %, in each case based on the amount of all components of the formulation.
  • metal ions in particular divalent metal ions
  • Metal ions can contribute to a more uniform coating.
  • suitable divalent metal ions include, for example
  • Alkaline earth metal ions such as Ca 2+ ions.
  • Such metal ions may preferably be added as formulation-soluble salts, for example in the form of chlorides, nitrates or carbonate, acetate, citrate, gluconate, hydroxide, lactate, sulfate, succinate, tartrate.
  • CaCb or MgCb can be added.
  • the solubility can optionally also be increased by suitable auxiliaries, for example complexing agents. If present, the concentration of such metal ions is generally 0.01 mmol / l to 10 mmol / l, preferably 0.1 mmol / l to 5 mmol / l and particularly preferably 0.5 mmol / l to 2 mmol / l.
  • Additional components may also be naturally occurring hydrophobins which are used in admixture with the fusion hydrophobins.
  • formulations F it is possible in principle to use those solutions which are obtained in the preparation or processing of the hydrophobins. It may be both chromatographically purified fusion hydrophobins, or to the solutions which are obtained by completing the inclusion bodies. Such solutions may contain, in addition to the fusion hydrophobin, further components from the workup, for example buffers, residues of the auxiliaries used for the elution or auxiliaries from the spray drying. Unless such components interfere with the coating process, they need not be removed.
  • the workup solutions generally have a significantly higher hydrophobin concentration than required for coating. They can be diluted to the desired concentration by adding water, further water-miscible solvents or buffer solutions.
  • solid fusion hydrophobins are used to prepare the formulation F, preferably the abovementioned fusion hydrophobins prepared by spray-drying.
  • the spray-dried fusion hydrophobin can be particularly advantageously used in water or in water Dissolve the solvent mixture slightly. This is a distinct advantage over solid, naturally occurring hydrophobins which must be solved in the art using trifluoroacetic acid (TFA) or formic acid.
  • TFA / formic acid is undesirable for the coating of a number of substrates, so that TFA or formic acid must again be removed in a costly manner after dissolving the hydrophobin.
  • ком ⁇ онент can be dissolved in the formulation, for example by simply stirring. Of course, it is also possible to trigger additional components and then combine the solutions.
  • Various spray-dried materials can be mixed before dissolving.
  • the spray-dried fusion hydrophobin can also be provided with additional components in a further step, e.g. by spraying other compounds and then drying. Conversely, it is also possible to apply fusion hydrophobin to existing particles of auxiliaries. A modification of the spray-dried hydrophobin e.g. in the form of granulation is also possible.
  • the surface to be coated is treated with the formulation for coating.
  • surfaces are not limited here. It can be either smooth surfaces or surfaces with a pronounced surface structure. It may, for example, the surfaces of moldings such as plates, films or the like.
  • the surfaces may, for example, be made of plastics such as Teflon, polyethylene, polypropylene, polystyrene, polymethyl methacrylate or other polymeric materials, of metals such as steel, aluminum, zinc, tin, copper or metal alloys such as brass, natural or modified natural materials such as leather, Textiles (eg cotton), paper, as well as surfaces relevant to cosmetics (eg skin, hair, teeth, mucous membranes), made of glass or of ceramic materials.
  • Articles to be coated may also have surfaces of different materials, for example combinations of glass, metal and plastics.
  • the surfaces to be coated may, for example, also be the surfaces of finely divided inorganic or organic substances, in particular inorganic or organic pigments or, for example, also latex particles.
  • examples include typical dye or effect pigments or typical fillers.
  • the method of treating the surface is chosen by the skilled person depending on the type of surface.
  • the article to be coated may be dipped in the formulation, or the formulation may be sprayed on the surface will be applied.
  • This type of surface treatment is suitable for both flat and irregular shaped surfaces.
  • Flat shaped articles such as, for example, sheets or films can furthermore advantageously be treated by coating or rolling.
  • Excess formulation can be removed again by means of suitable methods, for example by doctoring or squeezing.
  • the coating can be carried out by means of spraying. Suitable spray apparatuses are known to the person skilled in the art.
  • Finely divided pigments and / or fillers can advantageously be coated by first dispersing the pigments in a suitable solvent and then adding the fusion hydrophobins and, optionally, further auxiliaries for coating this dispersion.
  • pigment dispersions it is also possible with advantage to use dispersions which are obtained in the wet-chemical preparation of pigments without the pigments being previously separated, provided that further substances present in the dispersion do not disturb the coating process.
  • a certain exposure time is required to deposit the fusion hydrophobins on the surface.
  • the person skilled in the art will choose a suitable exposure time depending on the desired result. Examples of typical exposure times are from 0.1 to 12 h, without the invention being restricted thereto.
  • the reaction time depends on the temperature as well as on the concentration of the fusion hydrophobin in the solution.
  • the temperature in the course of the coating process may be at room temperature or it may be elevated temperatures.
  • temperatures may be 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or 120 ° C.
  • Preference is given to temperatures of 15 to 120 0 C, more preferably 20 to 100 ° C, and for example 40 to 100 ° C or 70 to 9O 0 C.
  • the temperature can for example by heating the bath, in which the object to be coated immersed, are introduced. But you can also heat a submerged object later, for example using IR emitters. For pigment dispersions, the dispersion can be heated.
  • solvent still present in the coating is removed from the coating. This can be done for example by simple evaporation in air. However, the removal of the solvent can also be facilitated by raising the temperature and / or with suitable gas streams and / or applying a vacuum. The evaporation can be facilitated by, for example, heated objects in a drying oven or blown with a heated gas stream. The methods can also be combined, for example by it is dried in a convection oven or a drying tunnel. Furthermore, the coating for removing the solvent can also be heated by means of radiation, in particular IR radiation. For this purpose, all types of broadband IR emitters, for example. NIR, MIR or NIR steel can be used. However, it is also possible, for example, to use IR lasers. Such radiation sources are commercially available in various radiation geometries. Pigment dispersions can also be dried by means of spray drying, for example.
  • the temperature and the drying time in the course of drying is determined by the person skilled in the art. Has proven to have a drying temperature of 30 to 130 ° C, preferably 50 to 12O 0 C, more preferably 70 to 110 0 C, most preferably 75 to 105 ° C and for example 85 to 100 ° C. This refers to the temperature of the coating itself.
  • the temperature in a dryer can of course also be higher. Of course, the drying time is shorter, the higher the drying temperature is.
  • the temperature treatment in the course of coating and drying can advantageously be combined with one another.
  • a surface can first be treated with the formulation F at room temperature and then dried and tempered at elevated temperatures.
  • elevated temperature is applied at least in one of the two steps "treatment” or “drying".
  • higher temperature than room temperature is used in both steps.
  • a surface coated with fusion hydrophobins which comprises the material of the surface and a layer located immediately thereafter which has at least one fusion hydrophobin and optionally further constituents of the formulation.
  • the entire surface may be covered with the hydrophobin, or even only part of the surface.
  • the quality can be assessed by various methods, for example by means of the contact angle measurement already mentioned. The contact angle changes significantly as in the case of coating with naturally occurring hydrophobins. Other methods are known to those skilled in the art from the cited prior art (e.g., "AFM" atomic force microscopy for direct detection of the protein layer on the surface).
  • the fusion hydrophobin layer may be further chemically modified before or after removal of the solvent.
  • suitable crosslinkers include glutardialdehyde, formaldehyde, and other homo and heterobifunctional protein crosslinkers known in protein chemistry.
  • the stability of the layer can be increased.
  • proteinaceous substrates such as leather
  • certain In addition, the connection to the substrate can be additionally improved for textiles, as well as for surfaces relevant to cosmetics.
  • the crosslinking can be carried out, for example, by treating the layer with the fusion hydrophobin after coating with a second solution with the crosslinker and then drying.
  • pretreat protein-containing but also other substrates such that protein-reactive functional groups are formed on the surface of the substrate.
  • This can be used, for example, the above-mentioned crosslinkers, but other chemicals such as ozone, peroxides or aldehydes.
  • Another possibility is to link or strengthen the coupling via metal ions.
  • Corresponding protein sequences with affinity for metal ions are known to the person skilled in the art (eg His ⁇ to Ni, Co, Fe, etc.) and can be attached to the hydrophobins by standard molecular biological techniques or protein-chemical coupling.
  • the metal ions may be coupled in advance to the surface to be coated or used simultaneously with the hydrophobin coupling.
  • Oligonucleotides Hal570 and Hal571 were used to perform a polymerase chain reaction.
  • the PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site.
  • the PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII.
  • This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BglI.
  • the thus obtained vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used for the expression of proteins consisting of, YAAD :: HIS6 or YAAE :: HIS6.
  • Hal570 gcgcgcccatggctcaaacaggtactga
  • Hal571 gcagatctccagccgcgttcttgcatac
  • Hal572 ggccatgggattaacaataggtgtactagg
  • Hal573 gcagatcttacaagtgccttttgcttatattcc
  • the oligonucleotides KaM 416 and KaM 417 Using the oligonucleotides KaM 416 and KaM 417, a polymerase chain reaction was carried out.
  • the template DNA used was genomic DNA of the mold Aspergillus nidulans.
  • the resulting PCR fragment contained the coding sequence of the hydrophobin gene dewA and an N-terminal factor Xa proteinase cleavage site.
  • the PCR fragment was purified and cut with the restriction endonuclease BamHI. This DNA fragment was used as an insert and cloned into the vector pQE60YAAD # 2 previously linearized with the restriction endonuclease BgIII.
  • the thus constructed vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS6.
  • KaM416 GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • plasmid # 513 The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
  • KaM434 GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
  • plasmid # 507 The cloning of plasmid # 507 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
  • Plasmid # 506 The cloning of plasmid # 506 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 417 and KaM 418.
  • KaM417 CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-
  • Plasmid # 526 was analogous to plasmid # 508 using the oligonucleotides KaM464 and KaM465.
  • the template DNA used was Schyzophyllum commune cDNA (see Appendix).
  • KaM464 CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
  • KaM465 GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
  • 100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended.
  • the suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then degraded for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) the nucleic acids are incubated.
  • filter with a glass cartridge P1.
  • two homogenizer runs are carried out at 1500 bar (Microfluidizer M-110EH, Microfluidics Corp.).
  • the homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , centrifugation and resuspending are repeated 3 times, with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g).
  • the hydrophobin is contained in the supernatant after the final centrifugation ( Figure 1).
  • the experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells.
  • 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml nickel-Sepharose High Performance 17-5268-02 column (Amersham) which has been equilibrated with 50 mM Tris-Cl pH 8.0 buffer.
  • the column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin subsequently eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole.
  • the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.
  • Figure 1 shows the purification of the prepared fusion hydrophobin
  • Lanes 3 - 5 OD 280 maxima of the elution fractions
  • the fusion hydrophobin of Figure 1 has a molecular weight of about 53 kD.
  • the smaller bands partially represent degradation products of hydrophobin.
  • Example 10 The E. coli cell pellet obtained in Example 7 in water is forced through a nozzle at 1000 bar. The cells are completely disrupted. By means of centrifugation, the hydrophobin arising in inclusion bodies will be separated from the remaining cell debris. At a g-number of 5000, 2 phases separate after 30 minutes. The lower, fusion hydrophobin-containing phase is resuspended with water and centrifuged as above. The inclusion bodies are then incubated in 0.1 M NaOH for 60 minutes and dissolved completely. The pH is adjusted to 8 with phosphoric acid and the protein concentration is adjusted to 20 mg / ml. The purity (based on total protein) of the fusion hydrophobin thus produced is 70%.
  • Example 10 The purity (based on total protein) of the fusion hydrophobin thus produced is 70%.
  • Example 9 The hydrophobin solution obtained in Example 9 is further processed in a commercial spray dryer.
  • the spray drying is carried out with an addition of 10% w / w mannitol at an inlet temperature of 16O 0 C and outlet temperatures of 70 0 C. It was obtained a finely powdered product.
  • Spray-dried hydrophobin according to Example 10 in an aqueous buffer solution (5OmM Tris, pH 8 + 0.1 mM CaCl 2 (final concentration) + 0.1% polyvinyl lyoxyethylen (20) sorbitan monolaurate (Tween ® 20)) and added to aqueous buffer solution
  • the samples are dried in air and the contact angle (in degrees) of a drop of 5 ⁇ l of water at room temperature is determined.
  • the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
  • Example 8 a solution of yaad-Xa-dewA-his obtained according to Example 8 (SEQ ID NO: 20) was used.
  • the solution also contained sodium phosphate buffer at a concentration of 50 mM.
  • the concentration of the fusion hydrophobin in the solution was 11, 23 mg / ml, the pH of the solution 7.5.
  • the solutions were diluted approximately 100-fold to a concentration of 100 ⁇ g / ml of fusion hydrophobin.
  • the following solutions or solvents were used in each case:
  • the aluminum sheets were sprayed with the solution 10-1 (water only) and 10-2 (fusion hydrophobin in Tris buffer), dried and rinsed with deionized water.
  • the consumption of solution was 150 ml (100 ⁇ g / ml) for 1.2 m 2 plate, this corresponds to about 12.5 mg hydrophobin / m 2 .
  • Tab. 2 Coating of aluminum plates with fusion hydrophobins It can be seen a slight hydrophobization of the aluminum surface by means of contact angle measurement. With regard to the film formation of water on the aluminum surface, a clear modification can be seen.
  • Substrate leather (Wet Blue)
  • Spray-dried hydrophobin is taken up in water and adjusted to a concentration of 100 ⁇ g / ml - incubation of pieces of leather overnight (at room temperature) in 50 mM Tris pH 8 + 0.1 nriM CaCl 2 (final concentration) + 0.1% polyoxyethylene ( 20) sorbitan monolaurate (Tween® 20) then wash coating in distilled water
  • hydrophilization There is a significant hydrophilization of the leather, which gains additional mechanical stability through the crosslinking.
  • the hydrophilization can be determined in a known manner by means of water drop recording. While a drop of water on untreated leather took about 4 minutes to be drawn in, an equal drop of water absorbed the hydrophobin-treated leather in less than 1 minute.
  • Spray-dried hydrophobin according to Example 9 is taken up in 1 OmM Tris pH 8 and adjusted to a concentration of 50 ⁇ g / ml. Glass slides are wetted with the hydrophobin solution and dried by IR radiation (IR125R from Philips) within 10 minutes.
  • the contact angle (in degrees) of a drop of 5 ⁇ l of water is determined at room temperature.
  • the contact angle measurement was performed on a device Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002). The measurement was carried out according to the manufacturer's instructions.
  • Untreated glass gave a contact angle of 30 ⁇ 5 °; the treated glass gave a contact angle of 75 ⁇ 15 °.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Manufacturing & Machinery (AREA)
  • Geochemistry & Mineralogy (AREA)
  • Materials Engineering (AREA)
  • Mycology (AREA)
  • Peptides Or Proteins (AREA)
  • Paints Or Removers (AREA)

Abstract

Verfahren zum Beschichten von Oberflächen mit Fusions-Hydrophobinen bei einem pH-Wert von > 4 sowie Oberfläche mit einer Beschichtung, welche mindestens ein Fusions-Hydrophobin umfasst.

Description

Verfahren zum Beschichten von Oberflächen mit Hydrophobinen
Beschreibung
Die vorliegende Erfindung betrifft ein Verfahren zum Beschichten von Oberflächen mit Fusions-Hydrophobinen bei einem ph-Wert >4 sowie Oberflächen mit einer Beschich- tung, welche Fusions-Hydrophobine umfassen.
Hydrophobine sind kleine Proteine von etwa 100 bis 150 Aminosäuren, die charakteris- tisch für filamentöse Pilze, beispielsweise Schizophyllum commune, sind. Sie weisen in aller Regel 8 Cystein-Einheiten auf. Hydrophobine können beispielsweise aus natürlichen Quellen isoliert werden.
Hydrophobine weisen eine ausgeprägte Affinität zu Grenzflächen auf und eignen sich daher zur Beschichtung von Oberflächen. So lässt sich beispielsweise Teflon mittels Hydrophobinen unter Erhalt einer hydrophilen Oberfläche beschichten.
Im Stand der Technik ist die Verwendung von Hydrophobinen für verschiedene Anwendungen vorgeschlagen worden.
WO 96/41882 schlägt die Verwendung von aus essbaren Pilzen gewonnenen Hydrophobinen als Emulgatoren, Verdicker, oberflächenaktive Substanzen, zum Hydrophilie- ren hydrophober Oberflächen, zur Verbesserung der Wasserbeständigkeit hydrophiler Substrate, zur Herstellung von ÖI-in-Wasser-Emulsionen oder von Wasser-in-ÖI-Emul- sionen vor. Weiterhin werden pharmazeutische Anwendungen wie die Herstellung von Salben oder Cremes sowie kosmetische Anwendungen wie Hautschutz oder die Herstellung von Haarshampoos oder Haarspülungen vorgeschlagen.
EP-B 1 252 516 offenbart die Beschichtung von Fenstern, Kontaktlinsen, Biosensoren, medizinischen Vorrichtungen, Behältern zur Durchführung von Versuchen oder zur Lagerung, Schiffrümpfen, festen Teilchen oder Rahmen oder Karosserie von Personenkraftwagen mit einer Hydrophobine enthaltenden Lösung bei einer Temperatur von 30 bis 8O0C. Bevorzugt wird zusätzlich eine oberflächenaktive Substanz als Beschich- tungshilfsmittel eingesetzt. In den Beispielen wird ein aus Pilzen (Schizophyllum com- mune) gewonnenes Hydrophobin vom Typ SC3 eingesetzt. Zum Ansetzen der Lösung zum Beschichten wird gefriergetrocknetes SC3 eingesetzt, mit Trifluoressigsäure gelöst, die Mischung in einem Stickstoffstrom getrocknet und anschließend in Wasser oder einer Pufferlösung gelöst. Diese Vorgehensweise ist umständlich.
WO 2005/068087 schlägt als Alternative zum Erwärmen die Beschichtung im sauren pH-Bereich vor. Die Schrift offenbart ein Verfahren zum Beschichten von Oberflächen mit Hydrophobinen bei einem pH-Wert kleiner 7, bevorzugt kleiner 4 und besonders bevorzugt kleiner 2. Weiterhin wird ein Verfahren zum Optimieren der Beschichtungs- bedingungen unter Variation der Parameter pH-Wert, Inkubationszeit, Konzentration sowie der Anwesenheit eines Puffers vorgeschlagen. In den Beispielen wird ein Hydrophobin vom Typ SC3 aus natürlichen Quellen eingesetzt.
Die vorliegende Anmeldung betrifft die Beschichtung von Oberflächen mit einer neuartigen Klasse von nicht natürlich vorkommenden Hydrophobinen. Es handelt sich hierbei um Fusions-Hydrophobine, bei denen natürlich vorkommende Hydrophobine mit mindestens 20 Aminosäuren langen Peptidsequenzen verknüpft sind, welche natürlicherweise nicht mit einem Hydrophobin verknüpft sind. Auch derartige Fusions-Hydropho- bine eignen sich zum Beschichten von Oberflächen.
Überraschenderweise wurde gefunden, dass die Qualität der mit Fusions-Hydropho- binen erhaltenen Beschichtungen auch bei erhöhten pH-Werten nicht abnimmt. Dieses zu natürlich vorkommenden Hydrophobinen inverse Verhalten ermöglicht es, auch im alkalischen Bereich qualitativ hochwertige Beschichtungen mit Hydrophobinen zu erhalten.
Zu der Erfindung ist im Einzelnen das Folgende auszuführen:
Zur Ausführung der vorliegenden Erfindung werden „Fusions-Hydrophobine" eingesetzt, welche die folgende, allgemeine Strukturformel (I) aufweisen,
Xn-C1-X1-50-C2-X0-5-C3-Xi-i00-C4-Xi-100-C5-Xi-50-C6-X0-5-C7-X1-50-C8-Xm (I)
wobei X für jede der 20 natürlich vorkommenden Aminosäuren (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, GIn, Arg, Me Met, Thr, Asn, Lys, VaI, AIa, Asp, GIu, GIy) stehen kann. Dabei können X jeweils gleich oder verschieden sein. Hierbei stellen die bei X stehenden Indizes jeweils die Anzahl der Aminosäuren dar, C steht für Cystein, Alanin, Serin, Glycin, Methionin oder Threonin, wobei mindestens vier der mit C benannten Reste für Cystein stehen. Die Indizes n und m stehen unabhängig voneinander für natürliche Zahlen von 0 und 500, bevorzugt von 15 bis 300, mit der Maßgabe, dass wenigstens eine der mit Xn und Xm bezeichneten Peptidsequenzen für eine mindestens 5, bevorzugt mindestens 20 Aminosäuren lange Peptidsequenz steht, die natürlicherweise nicht mit einem Hydrophobin verknüpft ist.
Die Polypetide gemäß Formel (I) sind weiterhin durch die Eigenschaft charakterisiert, dass sie bei Raumtemperatur nach Beschichten einer Glasoberfläche eine Vergrößerung des Kontaktwinkels eines Wassertropfens von mindestens 20°, bevorzugt mindestens 25° und besonders bevorzugt 30° bewirken, jeweils verglichen mit dem Kontakt- winkel eines gleich großen Wassertropfens mit der unbeschichteten Glasoberfläche. Die mit C1 bis C8 benannten Aminosäuren sind bevorzugt Cysteine; sie können aber auch durch andere Aminosäuren ähnlicher Raumerfüllung, bevorzugt durch Alanin, Serin, Threonin, Methionin oder Glycin ersetzt werden. Allerdings sollen mindestens vier, bevorzugt mindestens 5, besonders bevorzugt mindestens 6 und insbesondere mindestens 7 der Positionen C1 bis C8 aus Cysteinen bestehen. Cysteine können in den erfindungsgemäß verwendeten Proteinen entweder reduziert vorliegen oder miteinander Disulfidbrücken ausbilden. Besonders bevorzugt ist die intramolekulare Ausbildung von C-C Brücken, insbesondere die mit mindestens einer, bevorzugt 2, besonders bevorzugt 3 und ganz besonders bevorzugt 4 intramolekularen Disulfidbrücken. Bei dem oben beschriebenen Austausch von Cysteinen durch Aminosäuren ähnlicher Raumerfüllung werden vorteilhaft solche C-Positionen paarweise ausgetauscht, die intramolekulare Disulfidbrücken untereinander ausbilden können.
Falls in den mit X bezeichneten Positionen auch Cysteine, Serine, Alanine, Glycine, Methionine oder Threonine verwendet werden, kann sich die Nummerierung der einzelnen C-positionen in den allgemeinen Formeln entsprechend verändern.
Bevorzugt werden Fusions-Hydrophobine der allgemeinen Formel (II)
Xn-C1-X3-25-C2-X0-2-C3-X5-50-C4-X2-35-C5-X2-15-C6-X0-2-C7-X3-35-C8-Xm (II)
zur Ausführung der vorliegenden Erfindung eingesetzt, wobei X, C und die bei X und C stehenden Indizes die obige Bedeutung haben, jedoch stehen die Indizes n und m für Zahlen zwischen 0 und 300, und sich die Proteine weiterhin durch die oben erwähnte Kontaktwinkeländerung auszeichnen, mit der Maßgabe, dass wenigstens eine der mit Xn und Xm bezeichneten Peptidsequenzen für eine mindestens 15, bevorzugt mindestens 35 Aminosäuren lange Peptidsequenz steht, die natürlicherweise nicht mit einem Hydrophobin verknüpft ist.
Besonders bevorzugt werden Fusions-Hydrophobine der allgemeinen Formel (IM)
Xn-C1-X5-9-C2-C3-Xi i-39-C4-X2-23-C5-X5-9-C6-C7-X6-18-C8-Xm (IM)
eingesetzt, wobei X, C und die bei X und C stehenden Indizes die obige Bedeutung haben, die Indizes n und m für Zahlen zwischen 0 und 200 stehen, und sich die Proteine weiterhin durch die oben erwähnte Kontaktwinkeländerung auszeichnen, mit der Maßgabe, dass wenigstens eine der mit Xn und Xm bezeichneten Peptidsequenzen für eine mindestens 20 Aminosäuren, bevorzugt mindestens 50 Aminosäuren lange Peptidsequenz steht, die natürlicherweise nicht mit einem Hydrophobin verknüpft ist, und es sich weiterhin bei mindestens 6 der mit C benannten Reste um Cystein handelt. Besonders bevorzugt handelt es sich bei allen Reste C um Cystein. Die natürlicherweise nicht mit einem Hydrophobin verknüpften Reste sollen im Folgenden auch als Fusionspartner bezeichnet werden. Damit soll ausgedrückt werden, dass die Proteine aus mindestens einem Hydrophobinteil und einem Fusionspartner bestehen können, die in der Natur nicht zusammen in dieser Form vorkommen.
Der Fusionspartner kann aus einer Vielzahl von Proteinen ausgewählt werden. Es können auch mehrere Fusionspartner mit einem Hydrophobinteil verknüpft werden, beispielsweise am Aminoterminus (Xn) und am Carboxyterminus (Xm) des Hydropho- binteils. Es können aber auch beispielsweise zwei Fusionspartnerteile mit einer Positi- on (Xn oder Xm) des Hydrophobins verknüpft werden.
Besonders geeignete Fusionspartnerteile sind Proteine, die natürlicherweise in Mikroorganismen, insbesondere in E. coli oder Bacillus subtilis vorkommen. Beispiele für solche Fusionspartnerteile sind die Sequenzen yaad (SEQ ID NO: 15 und 16), yaae (SEQ ID NO:17 und 18) und Thioredoxin. Gut geeignet sind auch Fragmente o- der Derivate dieser genannten Sequenzen, die nur einen Teil, beispielsweise 70 bis 99 % bevorzugt 5 bis 50 % und besonders bevorzugt 10 bis 40 % der genannten Sequenzen umfassen, oder bei denen einzelne Aminosäuren, bzw. Nukleotide gegenüber der genannten Sequenz verändert sind, wobei sich die Prozentangaben jeweils auf die Anzahl der Aminosäuren bezieht.
In einer weiterhin bevorzugten Ausführungsform weist das Fusion-Hydrophobin neben dem Fusionspartner als eine Gruppe Xn oder Xm noch eine sogenannte Affinitätsdomäne (affinity tag / affinity tail) auf. Hierbei handelt es sich in prinzipiell bekannter Art und Weise um Ankergruppen, welche mit bestimmten komplementären Gruppen wechselwirkend können und der leichteren Aufarbeitung und Reinigung der Proteine dienen können. Beispiele derartiger Affinitätsdomänen umfassen (His)k- , (Arg)k-, (Asp)k-, (Phe)k- oder (Cys)k-Gruppen, wobei k im allgemeinen für eine natürliche Zahl von 1 bis 10 steht. Bevorzugt kann es sich um eine (His)k-Gruppe handeln, wobei k für 4 bis 6 steht.
Die erfindungsgemäß eingesetzten Fusions-Hydrophobine können auch noch in ihrer Polypeptidsequenz modifiziert sein, beispielsweise durch Glycosilierung, Acetylierung oder auch durch chemische Quervernetzung beispielsweise mit Glutardialdehyd.
Eine wesentliche Eigenschaft der erfindungsgemäß verwendeten Fusionsproteine ist die Änderung von Oberflächeneigenschaften, wenn die Oberflächen mit den Fusionsproteinen beschichtet werden. Die Änderung der Oberflächeneigenschaften lässt sich experimentell dadurch bestimmen, dass der Kontaktwinkel eines Wassertropfens vor und nach der Beschichtung der Oberfläche mit dem Protein gemessen wird und die Differenz der beiden Messungen ermittelt wird. Die Durchführung von Kontaktwinkelmessungen ist dem Fachmann prinzipiell bekannt. Die Messungen beziehen sich auf Raumtemperatur sowie Wassertropfen von 5 μl und die Verwendung von Glasplättchen als Substrat. Die genauen experimentellen Bedingungen für eine beispielhaft geeignete Methode zur Messung des Kontaktwinkels sind im experimentellen Teil dargestellt. Unter den dort genannten Bedingungen besitzen die erfindungsgemäß verwendeten Fusionsproteine die Eigenschaft, den Kontaktwinkel um mindestens 20°, bevorzugt mindestens 25°, besonders bevorzugt mindestens 30° zu vergrößern, jeweils verglichen mit dem Kontaktwinkel eines gleich großen Wassertropfens mit der unbeschichteten Glasoberfläche.
Bevorzugte Fusions-Hydrophobine zur Ausführung der vorliegenden Erfindung sind solche mit einem Hydrophobinteil des Typs dewA, rodA, hypA, hypB, sc3, basfi , basf2, die im nachfolgenden Sequenzprotokoll strukturell charakterisiert sind. Es kann sich auch nur um Teile oder Derivate davon handeln. Es können auch mehrere Hydropho- binteile, bevorzugt 2 oder 3, gleicher oder unterschiedlicher Struktur miteinander verknüpft werden.
Besonders geeignet zur Durchführung der vorliegenden Erfindung sind die Fusionsproteine mit den in SEQ ID NO: 20, 22, 24 dargestellten Polypeptidsequenzen sowie den dafür codierenden Nukleinsäuresequenzen, insbesondere den Sequenzen gemäss
SEQ ID NO: 19, 21 , 23. Auch Proteine, die sich ausgehend von den in SEQ ID NO. 20, 22 oder 24 dargestellten Polypeptidsequenzen durch Austausch, Insertion oder Deleti- on von mindestens einer, bis hin zu 10. bevorzugt 5, besonders bevorzugt 5 % aller Aminosäuren ergeben, und die die biologische Eigenschaft der Ausgangsproteine noch zu mindestens 50 % besitzen, sind besonders bevorzugte Ausführungsformen. Unter biologischer Eigenschaft der Proteine wird hierbei die bereits beschriebene Vergrößerung des Kontaktwinkels um mindestens 20° verstanden.
Die erfindungsgemäß verwendeten Fusions-Hydrophobine lassen sich durch bekannte Verfahren der Peptidsynthese, beispielsweise durch Festphasensynthese nach Merri- field, chemisch herstellen.
Bevorzugt erfolgt die Herstellung der Fusions-Hydrophobine durch gentechnische Verfahren, bei denen eine für den Fusionspartner und eine für den Hydrophobinteil codie- rende Nukleinsäuresequenz, insbesondere DNA-Sequenz, so kombiniert werden, dass in einem Wirtsorganismus durch Genexpression der kombinierten Nukleinsäuresequenz das gewünschte Fusions-Hydrophobin erzeugt wird.
Geeignete Wirtsorganismen (Produktionsorganismen) für das genannte Herstellverfah- ren können dabei Prokaryonten (einschließlich der Archaea) oder Eukaryonten sein, besonders Bakterien einschliesslich Halobacterien und Methanococcen, Pilze, Insektenzellen, Pflanzenzellen und Säugerzellen, besonders bevorzugt Escherichia coli, Bacillus subtilis, Bacillus. megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec, Lactobacillen, Hansenula poly- morpha, Trichoderma reesei, SF9 (bzw. verwandte Zellen) u.a..
Gegenstand der Erfindung ist außerdem die Verwendung von Expressionskonstrukten, enthaltend unter der genetischen Kontrolle regulativer Nukleinsäuresequenzen, eine für ein erfindungsgemäß verwendetes Polypeptid kodierende Nukleinsäuresequenz, sowie Vektoren, umfassend wenigstens eines dieser Expressionskonstrukte.
Vorzugsweise umfassen eingesetzte Konstrukte 5'-stromaufwärts von der jeweiligen kodierenden Sequenz einen Promotor und 3'-stromabwärts eine Terminatorsequenz sowie gegebenenfalls weitere übliche regulative Elemente, und zwar jeweils operativ verknüpft mit der kodierenden Sequenz.
Unter einer "operativen Verknüpfung" versteht man die sequentielle Anordnung von Promotor, kodierender Sequenz, Terminator und gegebenenfalls weiterer regulativer Elemente derart, dass jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann.
Beispiele für operativ verknüpfbare Sequenzen sind Targeting-Sequenzen sowie En- hancer, Polyadenylierungssignale und dergleichen. Weitere regulative Elemente umfassen selektierbare Marker, Amplifikationssignale, Replikationsursprünge und dergleichen. Geeignete regulatorische Sequenzen sind z. B. beschrieben in Goeddel, Gene Expression Techno- logy : Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
Zusätzlich zu diesen Regulationssequenzen kann die natürliche Regulation dieser Sequenzen vor den eigentlichen Strukturgenen noch vorhanden sein und gegebenenfalls genetisch verändert worden sein, so dass die natürliche Regulation ausgeschaltet und die Expression der Gene erhöht wurde.
Ein bevorzugtes Nukleinsäurekonstrukt enthält vorteilhaft auch eine oder mehrere der schon erwähnten "Enhancer"-Sequenzen, funktionell verknüpft mit dem Promotor, die eine erhöhte Expression der Nukleinsäuresequenz ermöglichen. Auch am 3'-Ende der DNA-Sequenzen können zusätzliche vorteilhafte Sequenzen inseriert werden, wie weitere regulatorische Elemente oder Terminatoren.
Die Nukleinsäuren können in einer oder mehreren Kopien im Konstrukt enthalten sein. Im Konstrukt können noch weitere Marker, wie Antibiotikaresistenzen oder Auxo- trophien komplementierende Gene, gegebenenfalls zur Selektion auf das Konstrukt enthalten sein. Vorteilhafte Regulationssequenzen für das Verfahren sind beispielsweise in Promotoren wie cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-,lpp-lac-, Iaclq-T7- , T5-, T3-, gal-, trc-, ara-, rhaP(rhaPBAD) SP6-, lambda-PR-oder imlambda-P-Promotor enthalten, die vorteilhaft in gram-negativen Bakterien Anwendung finden. Weitere vorteilhafte Regulati- onssequenzen sind beispielsweise in den gram-positiven Promotoren amy und SP02, in den Hefe-oder Pilzpromotoren ADC1 , MFalpha, AC, P-60, CYC1 , GAPDH, TEF, rp28, ADH enthalten.
Es können auch künstliche Promotoren für die Regulation verwendet werden.
Das Nukleinsäurekonstrukt wird zur Expression in einem Wirtsorganismus vorteilhafterweise in einen Vektor, wie beispielsweise einem Plasmid oder einem Phagen inseriert, der eine optimale Expression der Gene im Wirt ermöglicht. Unter Vektoren sind außer Plasmiden und Phagen auch alle anderen dem Fachmann bekannten Vektoren, also z. B. Viren, wie SV40, CMV, Baculovirus und Adenovirus, Transposons.lS- Elemente, Phasmide, Cosmide, und lineare oder zirkuläre DNA, sowie das Agrobacterium- System zu verstehen.
Diese Vektoren können autonom im Wirtsorganismus repliziert oder chromosomal rep- liziert werden. Diese Vektoren stellen eine weitere Ausgestaltung der Erfindung dar. Geeignete Plasmide sind beispielsweise in E. coli pLG338, pACYC184, pBR322, pUC18,pUC19, pKC30, pRep4, pHS1 , pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290,plN-lll"3-B1 , tgt11 oder pBdCI, in StreptomycesplJ101 , plJ364,plJ702 oderplJ361 , in Bacillus pUB110, pC194 oder pBD214, in Corynebacteri- um pSA77 oder pAJ667, in Pilzen pALS1 , plL2 oder pBB116, in Hefen 2alpha, pAG-1 , YEp6, YEp13 oder pEMBLYe23 oder in Pflanzen pLGV23,pGHIac+, pBIN19, pAK2004 oder pDH51. Die genannten Plasmide stellen eine kleine Auswahl der möglichen Plasmide dar. Weitere Plasmide sind dem Fachmann bekannt und können beispielsweise aus dem Buch Cloning Vectors (Eds. Pouwels P. H. et al. Elsevier, Amsterdam- New York-Oxford, 1985, ISBN 0 444 904018) entnommen werden.
Vorteilhaft enthält das Nukleinsäurekonstrukt zur Expression der weiteren enthaltenen Gene zusätzlich noch 3'-und/oder 5'-terminale regulatorische Sequenzen zur Steigerung der Expression, die je nach ausgewähltem Wirtorganismus und Gen oder Gene für eine optimale Expression ausgewählt werden.
Diese regulatorischen Sequenzen sollen die gezielte Expression der Gene und der Proteinexpression ermöglichen. Dies kann beispielsweise je nach Wirtsorganismus bedeuten, dass das Gen erst nach Induktion exprimiert oder überexprimiert wird, oder dass es sofort exprimiert und/oder überexprimiert wird. Die regulatorischen Sequenzen bzw. Faktoren können dabei vorzugsweise die Genexpression der eingeführten Gene positiv beeinflussen und dadurch erhöhen. So kann eine Verstärkung der regulatorischen Elemente vorteilhafterweise auf der Transkriptionsebene erfolgen, indem starke Transkriptionssignale wie Promotoren und/oder "En- hancer" verwendet werden. Daneben ist aber auch eine Verstärkung der Translation möglich, indem beispielsweise die Stabilität der mRNA verbessert wird.
In einer weiteren Ausgestaltungsform des Vektors kann der das Nukleinsäurekonstrukt oder die Nukleinsäure enthaltende Vektor auch vorteilhaft in Form einer linearen DNA in die Mikroorganismen eingeführt werden und über heterologe oder homologe Rekombination in das Genom des Wirtsorganismus integriert werden. Diese lineare DNA kann aus einem linearisierten Vektor wie einem Plasmid oder nur aus dem Nukleinsäurekonstrukt oder der Nukleinsäure bestehen.
Für eine optimale Expression heterologer Gene in Organismen ist es vorteilhaft die Nukleinsäuresequenzen entsprechend des im Organismus verwendeten spezifischen "codon usage"zu verändern. Der "codon usage" lässt sich anhand von Computerauswertungen anderer, bekannter Gene des betreffenden Organismus leicht ermitteln.
Die Herstellung einer Expressionskassette erfolgt durch Fusion eines geeigneten Promotors mit einer geeigneten kodierenden Nukleotidsequenz sowie einem Terminatoroder Polyadenylierungssignal. Dazu verwendet man gängige Rekombinations- und Klonierungstechniken, wie sie beispielsweise in T. Maniatis, E. F.Fritsch und J. Sambrook, Molecular Cloning : A Laboratory Manual, CoId Spring Harbor Labora- tory, CoId Spring Harbor, NY (1989) sowie in T. J. Silhavy, M. L. Berman und L. W. Enquist, Experiments with Gene Fusions, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1984) und in Ausubel, F. M. etal., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987) beschrieben sind.
Das rekombinante Nukleinsäurekonstrukt bzw. Genkonstrukt wird zur Expression in einem geeigneten Wirtsorganismus, vorteilhaft in einen wirtsspezifischen Vektor inser- tiert, der eine optimale Expression der Gene im Wirt ermöglicht. Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus "Cloning Vectors" (Pouwels P. H. et al., Hrsg, Elsevier, Amsterdam-New York-Oxford, 1985) entnommen werden.
Mit Hilfe der Vektoren sind rekombinante Mikroorganismen herstellbar, welche beispielsweise mit wenigstens einem Vektor transformiert sind und zur Produktion der erfindungsgemäß verwendeten Proteine eingesetzt werden können. Vorteilhafterweise werden die oben beschriebenen rekombinanten Konstrukte in ein geeignetes Wirtssys- tem eingebracht und exprimiert. Dabei werden vorzugsweise dem Fachmann bekannte geläufige Klonierungs- und Transfektionsmethoden, wie beispielsweise Co-Präzipita- tion, Protoplastenfusion, Elektroporation, retrovirale Transfektion und dergleichen, ver- wendet, um die genannten Nukleinsäuren im jeweiligen Expressionssystem zur Expression zu bringen. Geeignete Systeme werden beispielsweise in Current Protocols in Molecular Biology, F.Ausubel etal., Hrsg., Wiley Interscience, New York 1997, oder Sambrook et al. Molecular Cloning : A Laboratory Manual. 2. Aufl., CoId Spring Harbor Laboratory, CoId Spring Harbor Laboratory Press, CoId Spring Harbor, NY, 1989 beschrieben.
Es sind auch homolog rekombinierte Mikroorganismen herstellbar. Dazu wird ein Vektor hergestellt, der zumindest einen Abschnitt eines erfindungsgemäß zu verwenden- den Gens oder einer kodierenden Sequenz enthält, worin gegebenenfalls wenigstens eine Aminosäure-Deletion, -Addition oder -Substitution eingebracht worden ist, um die Sequenz zu verändern, z. B. funktionell zu disruptieren ("Knockout"- Vektor). Die eingebrachte Sequenz kann z. B. auch ein Homologes aus einem verwandten Mikroorganismus sein oder aus einer Säugetier-, Hefe- oder Insektenquelle abgeleitet sein. Der zur homologen Rekombination verwendete Vektor kann alternativ derart ausgestaltet sein, dass das endogene Gen bei homologer Rekombination mutiert oder anderweitig verändert ist, jedoch noch das funktionelle Protein kodiert (z. B. kann der stromaufwärts gelegene regulatorische Bereich derart verändert sein, dass dadurch die Expression des endogenen Proteins verändert wird). Der veränderte Abschnitt des erfin- dungsgemäß verwendeten Gens ist im homologen Rekombinationsvektor. Die Konstruktion geeigneter Vektoren zur homologen Rekombination ist z. B. beschrieben in Thomas, K. R. und Capecchi, M. R. (1987) Cell 51 : 503.
Als rekombinante Wirtsorganismen für die erfindungsgemäß verwendete Nukleinsäure oder dem Nukleinsäurekonstrukt kommen prinzipiell alle prokaryontischen oder euka- ryontischen Organismen in Frage. Vorteilhafterweise werden als Wirtsorganismen Mikroorganismen wie Bakterien, Pilze oder Hefen verwendet. Vorteilhaft werden grampositive oder gram-negative Bakterien, bevorzugt Bakterien der Familien Enterobacte- riaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae oder Nocardiaceae, besonders bevorzugt Bakterien der Gattungen Escherichia, Pseudomonas, Streptomy- ces, Nocardia, Burkholderia, Salmonella, Agrobacterium oder Rhodococcus verwendet.
Die im Herstellverfahren für Fusions-Hydrophobine verwendeten Organismen werden je nach Wirtsorganismus in dem Fachmann bekannter Weise angezogen bzw. gezüch- tet. Mikroorganismen werden in der Regel in einem flüssigen Medium, das eine Kohlenstoffquelle meist in Form von Zuckern, eine Stickstoffquelle meist in Form von organischen Stickstoffquellen wie Hefeextrakt oder Salzen wie Ammoniumsulfat, Spurenelemente wie Eisen-, Mangan- und Magnesiumsalze sowie gegebenenfalls Vitamine enthält, bei Temperaturen zwischen 0 und 100 0C, bevorzugt zwischen 10 bis 60 0C unter Sauerstoffbegasung angezogen. Dabei kann der pH-Wert der Nährflüssigkeit auf einem festen Wert gehalten werden, das heißt während der Anzucht reguliert werden oder nicht. Die Anzucht kann "batch"-weise, "semi-batch"-weise oder kontinuierlich erfolgen. Nährstoffe können zu Beginn der Fermentation vorgelegt oder semikontinuierlich oder kontinuierlich nachgefüttert werden. Die Enzyme können nach dem in den Beispielen beschriebenen Verfahren aus den Organismen isoliert werden oder als Rohextrakt für die Reaktion verwendet werden.
Erfindungsgemäß verwendete Fusionsproteine oder funktionelle, biologisch aktive Fragmente davon, können mittels eines rekombinanten Verfahrens hergestellt werden, bei dem man einen Proteine-produzierenden Mikroorganismus kultiviert, gegebenenfalls die Expression der Proteine induziert und diese aus der Kultur isoliert. Die Protei- ne können so auch in großtechnischem Maßstab produziert werden, falls dies erwünscht ist. Der rekombinante Mikroorganismus kann nach bekannten Verfahren kultiviert und fermentiert werden. Bakterien können beispielsweise in TB-oder LB-Medium und bei einer Temperatur von 20 bis 400C und einem pH-Wert von 6 bis 9 vermehrt werden. Im Einzelnen werden geeignete Kultivierungsbedingungen beispielsweise in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning : A Laboratory Manual, CoId Spring Harbor Laboratory, CoId Spring Harbor, NY (1989) beschrieben.
Die Zellen werden dann, falls die erfindungsgemäß verwendeten Proteine nicht in das Kulturmedium sezerniert werden, aufgeschlossen und das Produkt nach bekannten Proteinisolierungsverfahren aus dem Lysat gewonnen. Die Zellen können wahlweise durch hochfrequenten Ultraschall, durch hohen Druck, wie z. B. in einer French-Druck- zelle, durch Osmolyse, durch Einwirkung von Detergenzien, lytischen Enzymen oder organischen Lösungsmitteln, durch Homogenisatoren oder durch Kombination mehrerer der aufgeführten Verfahren aufgeschlossen werden.
Eine Aufreinigung der erfindungsgemäß verwendeten Fusionsproteine kann mit bekannten chromatographischen Verfahren erzielt werden, wie Molekularsieb-Chromatographie (Gelfiltration), wie Q- Sepharose-Chromatographie, lonenaustausch-Chroma- tographie und hydrophobe Chromatographie, sowie mit anderen üblichen Verfahren wie Ultrafiltration, Kristallisation, Aussalzen, Dialyse und nativer Gelelektrophorese. Geeignete Verfahren werden beispielsweise in Cooper, F. G., Biochemische Arbeitsmethoden, Verlag Water de Gruyter, Berlin, New York oder in Scopes, R., Protein Puri- fication, Springer Verlag, New York, Heidelberg, Berlin beschrieben.
Besonders vorteilhaft kann es sein, die Fusions-Hydrophobine zur Erleichterung der Isolierung und Reinigung mit speziellen Ankergruppen zu versehen, die an entsprechende komplementäre Gruppen an festen Trägern, insbesondere geeigneten Polymeren anbinden können. Derartige feste Träger können beispielsweise als Füllung für Chromatographiesäulen verwendet werden, und auf diese Art und Weise kann die Effi- zienz der Trennung in der Regel deutlich gesteigert werden. Solche Trennverfahren sind auch als Affinitätschromatographie bekannt. Zum Einbau der Ankergruppen kann man bei der Herstellung der Proteine Vektorsysteme oder Oligonukleotide verwenden, die die cDNA um bestimmte Nukleotidsequenzen verlängern und damit veränderte Proteine oder Fusionsproteine kodieren. Zur leichteren Reinigung modifierte Proteine umfassen als Anker fungierende sogenannte "Tags", wie beispielsweise die als Hexa- Histidin-Anker bekannte Modifikation. Mit Histidin-Ankern modifizierte Fusions-Hydro- phobine lassen sich beispielsweise unter Verwendung von Nickel-Sepharose als Säulenfüllung chromatographisch reinigen. Das Fusions-Hydrophobin kann anschließend mittels geeigneten Mitteln zum Eluieren, wie beispielsweise einer Imidazol-Lösung, wieder von der Säule eluiert werden.
Aufarbeitungsmethoden können selbstverständlich auch miteinander kombiniert werden. Beispielsweise kann man zunächst mittels Chromatographie trennen, und die erhaltene Lösung anschließend mittels Dialyse von zum Eluieren verwendeten Stoffen reinigen.
In einem vereinfachten Reinigungsverfahren kann auf die chromatographische Reinigung verzichtet werden. Hierzu werden die Zellen zunächst mittels einer geeigneten Methode aus der Fermetationsbrühe abgetrennt, beispielsweise durch Mikrofiltration oder durch Zentrifugieren. Anschließend können die Zellen mittels geeigneter Methoden, beispielsweise mittels der bereits oben genannten Methoden, aufgeschlossen, und die Zelltrümmer von den Einschlusskörpern (inclusion bodies) getrennt werden. Letzteres kann vorteilhaft durch Zentrifugieren erfolgen. Schließlich können die Einschlusskörper in prinzipiell bekannter Art und Weise aufgeschlossen werden, um die Fusions - Hydrophobine freizusetzen. Dies kann beispielsweise durch Säuren, Basen und/oder Detergentien erfolgen. Die Einschlusskörper mit den erfindungsgemäß ver- wendeten Fusion-Hydrophobinen können in der Regel schon unter Verwendung von 0,1 m NaOH innerhalb von ca. 1 h vollständig gelöst werden. Die Reinheit der nach diesem vereinfachten Verfahren erhaltenen Fusions-Hydrophobine liegt in der Regel bei 60 bis 80 Gew. % bzgl. der Menge aller Proteine. Die nach dem beschriebenen, vereinfachten Reinigungsverfahren erhaltenen Lösungen können ohne weitere Reini- gung zum Beschichten von Oberflächen eingesetzt werden. In aller Regel stören die Nebenkomponenten nicht und beeinflussen das Beschichtungsergebnis allenfalls unwesentlich.
Die erhaltenen Hydrophobin-Lösungen weisen üblicherweise eine Konzentration von 0,1 mg/ml bis 50 mg/ml an Fusions-Hydrophobinen auf.
Die Fusions-Hydrophobine können aus den Lösungen auch als Feststoff isoliert werden. Dies kann beispielsweise in prinzipiell bekannter Art und Weise durch Gefrier- oder Sprühtrocknen erfolgen. In einer bevorzugten Ausführungsform der Erfindung kann die Isolierung mittels Sprüh- trocknen erfolgen. Das Sprühtrocknen kann mit der chromatographisch gereinigten Lösung vorgenommen werden, bevorzugt können aber auch die nach dem vereinfachten Reinigungsverfahren durch Aufbereitung der Einschlusskörper (inclusion bodies) erhaltenen Lösungen eingesetzt werden.
Zur Durchführung des Sprühtrocknens können die Lösungen ggf. neutralisiert werden. Ein pH-Bereich von 7 bis 9 hat sich als besonders vorteilhaft herausgestellt.
Weiterhin empfiehlt es sich im Regelfalle, die Ausgangslösungen etwas aufzukonzent- rieren. Bewährt hat sich in der Ausgangslösung eine Feststoffkonzentration von bis zu 30 Gew. %. Ein Feststoffanteil von > 5% führt im Allgemeinen zu einem feinpulverigem Produkt. Anschließend kann die Lösung in prinzipiell bekannter Art und Weise sprühgetrocknet werden. Geeignete Apparaturen zum Sprühtrocknen sind kommerziell er- hältlich. Die optimalen Sprühtrocknungsbedingungen variieren mit Gerätetyp und angestrebtem Durchsatz. Eingangstemperaturen von 130 bis 1800C und Ausgangstemperaturen von 50 bis 80°C haben sich bei Hydrophobinlösungen als günstig herausgestellt. Optional können zum Sprühtrocknen Hilfsstoffe wie beispielsweise Zucker, Man- nitol, Dextran oder Maltodextrin eingesetzt werden. Bewährt hat sich eine Menge von 0 bis 30 Gew. %, bevorzugt 5 bis 20 Gew. % derartiger Hilfsstoffe bezüglich des Hydrophobins.
Zur Ausführung des erfindungsgemäßen Verfahrens zum Beschichten mit wird eine Formulierung (F) eingesetzt, welche mindestens Wasser oder wässriges Lösemittel- gemisch sowie ein Fusions-Hydrophobin umfasst.
Geeignete wässrige Lösemittelgemische umfassen Wasser sowie eines oder mehrere, mit Wasser mischbare Lösemittel. Die Auswahl derartiger Komponenten ist nur insofern beschränkt, als die Fusions-Hydrophobine und die anderen Komponenten im Ge- misch in ausreichendem Maße löslich sein müssen. Im Regelfalle umfassen derartige Gemische zumindest 50 Gew. %, bevorzugt mindestens 65 Gew. % und besonders bevorzugt mindestens 80 Gew. % Wasser. Ganz besonders bevorzugt wird nur Wasser eingesetzt. Der Fachmann trifft unter den mit Wasser mischbaren Lösemitteln je nach den gewünschten Eigenschaften der Formulierung F eine geeignete Auswahl. Beispiele geeigneter, mit Wasser mischbarer Lösemittel umfassen Monoalkohole wie Methanol, Ethanol oder Propanol, höhere Alkohole wie Ethylenglykol oder Polyetherpo- lyole sowie Etheralkohole wie Butylglykol oder Methoxypropanol.
Erfindungsgemäß weist die zur Behandlung eingesetzte Formulierung einen pH-Wert > 4, bevorzugt > 6 und besonders bevorzugt > 7 auf. Beispielsweise kann der pH-Wert 4, 5, 6, 7, 8, 9, 10,11 betragen. Insbesondere liegt der pH-Wert im Bereich von 4 bis 11 , bevorzugt 6 bis 10, besonders bevorzugt 7 bis 9,5 und ganz besonders bevorzugt 7,5 bis 9. Beispielsweise kann der pH-Wert 7,5 bis 8,5 oder 8,5 bis 9 betragen.
Zur Einstellung des pH-Wertes umfasst die Formulierung bevorzugt einen geeigneten Puffer. Der Fachmann wählt je nach dem zum Beschichtung vorgesehenen pH-Bereich einen geeigneten Puffer. Zu nennen sind beispielsweise Kaliumdihydrogenphosphat- Puffer, Tris(hydroxymethyl)aminomethan-Puffer (Tris-Puffer), Borax-Puffer, Natrium- hydrogencarbonat-Puffer oder Natriumhydrogenphosphat-Puffer. Bevorzugt ist Tris- Puffer.
Die Konzentration des Puffers in der Lösung wird vom Fachmann je nach den gewünschten Eigenschaften der Formulierung bestimmt. Der Fachmann wird in der Regel auf eine ausreichende Pufferkapazität achten, um möglichst konstante Beschichtungs- bedingungen zu erreichen. Bewährt hat sich eine Konzentration von 0,001 mol/l bis 1 mol/l, bevorzugt 0,005 mol/l bis 0,1 mol/l und besonders bevorzugt 0,01 mol/l bis 0,05 mol/l.
Weiterhin umfasst die Formulierung mindestens ein Fusions-Hydrophobin. Fusions- Hydrophobine sowie bevorzugte Fusions-Hydrophobine wurden bereits eingangs ge- nannt. Selbstverständlich können auch Gemische verschiedener Fusions-Hydrophobine eingesetzt werden. Besonders geeignet zur Ausführung der vorliegenden Erfindung ist das Fusions-Hydrophobin yaad-Xa-dewA-his (SEQ ID NO: 20), bzw. davon abgeleitete Proteine, bei denen der Fusionsartner yaad verkürzt ist.
Die Konzentration der Fusions-Hydrophobine in der Lösung wird vom Fachmann je nach den gewünschten Eigenschaften der Beschichtung gewählt. Mit höheren Konzentrationen lässt sich in der Regel eine schnellere Beschichtung erreichen. Bewährt hat sich im Regelfalle eine Konzentration von 0,1 μg/ml bis 1000 μg/ml, bevorzugt 1 μg/ml bis 500 μg/ml, besonders bevorzugt 10 μg/ml bis 250 μg/ml, ganz besonders bevorzugt 30 μg/ml bis 200 μg/ml und beispielsweise 50 bis 100 μg/ml.
Die Formulierung F kann darüber hinaus optional weitere Komponenten bzw. Additive umfassen.
Beispiele zusätzlicher Komponenten umfassen Tenside. Geeignete Tenside sind beispielsweise nichtionische Tenside, welche Polyalkoxygruppen, insbesondere Polyethy- lenoxidgruppen umfassen. Beispiele umfassen Polyoxyethylenstearate, alkoxylierte Phenole und dergleichen. Weitere Beispiele geeigneter Tenside umfassen Polyethyle- neglycol(20)sorbitanmonolaurat (Tween® 20), Polyethyleneglycol(20)sorbitanmono- palmitat (Tween® 40), Polyethyleneglycol(20)sorbitanmonostearat (Tween® 60), PoIy- ethyleneglycol(20)sorbitanmonooleat (Tween® 80), Cyclohexyl-methyl-ß D-Maltosid, Cyclohexyl-ethyl-ß D-Maltosid, Cyclohexyl-n-hexyl-ß D-Maltosid, n-Undecyl-ß D-Malto- sid, n-Octyl-ß D-Maltopyranosid, π-Octyl-ß D-Glucopyranosid, n-Octyl-α D-Glucopy- ranosid, n-Dodecanoylsucrose. Weitere Tenside sind beispielsweise in WO 2005/68087 Seite 9, Zeile 10 bis Seite 10, Zeile 2 offenbart. Die Konzentration an Tensiden beträgt in der Regel 0,001 Gew. % bis 0,5 Gew. %, bevorzugt 0,01 Gew. % bis 0,25 Gew. %und besonders bevorzugt 0,1 Gew. % bis 0,2% Gew. %, jeweils bezogen auf die Menge aller Komponenten der Formulierung.
Weiterhin können der Formulierung noch Metallionen, insbesondere zweiwertige Metallionen zugegeben werden. Metallionen können zu einer gleichmäßigeren Beschichtung beitragen. Beispiele geeigneter zweiwertiger Metallionen umfassen, beispielsweise
Erdalkalimetallionen wie Ca2+-lonen. Derartige Metallionen können bevorzugt als in der Formulierung lösliche Salze zugegeben werden, beispielsweise in Form von Chloriden, Nitraten oder Carbonat, Acetat, Citrat, Gluconat, Hydroxid, Lactat, Sulfat, Succinat, Tartrat. Beispielsweise können CaCb oder MgCb zugegeben werden. Die Löslichkeit kann optional auch durch geeignete Hilfsmittel, beispielsweise Komplexbildner gesteigert werden. Falls vorhanden, beträgt die Konzentration derartiger Metallionen in der Regel 0,01 mmol/l bis 10 mmol/l, bevorzugt 0,1 mmol/l bis 5 mmol/l und besonders bevorzugt 0,5 mmol/l bis 2 mmol/l.
Bei zusätzlichen Komponenten kann es sich weiterhin auch um natürlich vorkommende Hydrophobine handeln, welche im Gemisch mit den Fusions-Hydrophobinen eingesetzt werden.
Zum Herstellen der Formulierungen F können prinzipiell diejenigen Lösungen verwen- det werden, die bei der Herstellung bzw. Aufarbeitung der Hydrophobine anfallen. Es kann sich dabei sowohl um chromatographisch gereinigte Fusions-Hydrophobine handeln, oder auch um die Lösungen, welche durch Abschluss der incluion bodies erhalten werden. Derartige Lösungen können neben dem Fusions-Hydrophobin auch noch weitere Komponenten aus der Aufarbeitung enthalten, beispielsweise Puffer, Reste der zum Eluieren verwendeten Hilfsmittel oder Hilfsstoffe aus der Sprühtrocknung. Sofern derartige Komponenten den Beschichtungsvorgang nicht stören, brauchen sie nicht entfernt zu werden.
Die Lösungen aus der Aufarbeitung weisen in der Regel eine deutlich höhere Hydro- phobin-Konzentration auf, als zum Beschichten erforderlich. Sie können durch Zugabe von Wasser, weiterer, mit Wasser mischbarer Lösemittel oder Pufferlösungen auf die gewünschte Konzentration verdünnt werden.
In einer bevorzugten Ausführungsform des Verfahren werden zum Herstellen der For- mulierung F feste Fusions-Hydrophobine eingesetzt, bevorzugt die vorstehend genannten, durch Sprühtrocknen hergestellten Fusions-Hydrophobine. Besonders vorteilhaft lässt sich das sprühgetrocknete Fusions-Hydrophobin in Wasser oder im wässrigen Lösemittelgemisch leicht lösen. Dies ist ein deutlicher Vorteil zu festen, natürlich vorkommenden Hydrophobinen, welche nach dem Stand der Technik unter Verwendung von Trifluoressigsäure (TFA) oder Ameisensäure gelöst werden müssen. TFA/Ameisensäure ist aber für die Beschichtung einer Reihe von Substraten uner- wünscht, so dass TFA bzw. Ameisensäure nach dem Lösen des Hydrophobins wieder aufwändig entfernt werden muss.
Weitere Komponenten können in der Formulierung gelöst werden, beispielsweise durch einfaches Einrühren. Selbstverständlich ist es auch möglich, zusätzliche Kompo- nenten vorzulösen und dann die Lösungen zu vereinigen. Verschiedene sprühgetrocknete Materialien lassen sich vor dem Auflösen mischen. Das sprühgetrocknete Fusi- ons-Hydrophobin kann auch in einem weiteren Schritt mit zusätzlichen Komponenten versehen werden, z.B. durch Aufsprühen anderer Verbindungen und anschließendem Trocknen. Umgekehrt kann auch Fusions-Hydrophobin auf schon bestehende Partikel von Hilfsstoffen aufgebracht werden. Eine Modifizierung des sprühgetrockneten Hydrophobins z.B. in Form von Granulierung ist ebenfalls möglich.
Erfindungemäß wird zur Beschichtung die zu beschichtende Oberfläche mit der Formulierung behandelt.
Die Auswahl der Oberflächen ist hierbei nicht beschränkt. Es kann sich sowohl um glatte Oberflächen oder um Oberflächen mit ausgeprägter Oberflächenstruktur handeln. Es kann sich beispielsweise um die Oberflächen von Formkörpern wie Platten, Folien oder dergleichen handeln. Die Oberflächen können beispielsweise aus Kunststoffen wie Teflon, Polyethylen, Polypropylen, Polystyrol, Polymethylmethacrylat oder anderen polymeren Materialien, aus Metallen wie beispielsweise Stahl, Aluminium, Zink, Zinn, Kupfer oder Metalllegierungen wie beispielsweise Messing, aus natürlichen oder veränderten natürlichen Materialien wie beispielsweise Leder, Textilien (z.B. Baumwolle), Papier, sowie für die Kosmetik relevante Oberflächen (z.B. Haut, Haar, Zähne, Schleimhäute) , aus Glas oder aus keramischen Materialien bestehen. Zu beschichtende Gegenstände können auch Oberflächen aus verschiedenen Materialien aufweisen, beispielsweise Kombinationen aus Glas, Metall und Kunststoffen.
Bei den zu beschichtenden Oberflächen kann es sich beispielsweise auch um die O- berflächen von feinteiligen anorganischen oder organischen Stoffen, insbesondere anorganische oder organische Pigmente oder beispielsweise auch Latex-Partikel handeln. Beispiele umfassen typische Färb- oder Effektpigmente oder auch typische Füllstoffe.
Die Methode zur Behandlung der Oberfläche wird vom Fachmann je nach der Art der Oberfläche gewählt. Beispielsweise kann der zu beschichtende Gegenstand in die Formulierung eingetaucht werden, oder die Formulierung kann durch Aufsprühen auf die Oberfläche aufgebracht werden. Diese Art der Oberflächenbehandlung eignet sich sowohl für ebene wie für unregelmäßig geformte Oberflächen. Flächige Formkörper wie beispielsweise Platten oder Folien können weiterhin auch vorteilhaft durch Beschichten oder Aufwalzen behandelt werden. Überschüssige Formulierung kann mittels geeigneter Methoden wieder entfernt werden, beispielsweise durch Abrakeln oder An- quetschen. Besonders bevorzugt kann die Beschichtung mittels Sprühen vorgenommen werden. Geeignete Sprühapparaturen sind dem Fachmann bekannt.
Feinteilige Pigmente und/oder Füllstoffe können vorteilhaft beschichtet werden, indem man die Pigmente zunächst in einem geeigneten Lösemittel dispergiert und dann die Fusions-Hydrophobine sowie optional weitere Hilfsstoffe zur Beschichtung dieser Dispersion zugibt. Als Pigmentdispersionen können auch vorteilhaft Dispersionen eingesetzt werden, die bei der nasschemischen Herstellung von Pigmenten anfallen, ohne dass die Pigmente vorher abgetrennt werden, sofern weiteren in der Dispersion vor- handenen Stoffe den Beschichtungsvorgang nicht stören.
In der Regel ist eine gewisse Einwirkzeit erforderlich, um die Fusions-Hydrophobine auf der Oberfläche abzuscheiden. Der Fachmann wählt je nach dem gewünschten Ergebnis eine geeignete Einwirkzeit. Beispiele typischer Einwirkzeiten liegen bei 0,1 bis 12 h, ohne dass die Erfindung hierauf beschränkt sein soll.
Im Regelfalle ist die Einwirkzeit von der Temperatur sowie von der Konzentration des Fusions-Hydrophobins in der Lösung abhängig. Je höher die Temperatur und je höher die Konzentration im Zuge des Beschichtungsvorganges, desto kürzer kann die Ein- wirkzeit sein. Die Temperatur im Zuge des Beschichtungsvorganges kann bei Raumtemperatur liegen oder aber es kann sich um erhöhte Temperaturen handeln. Beispielsweise kann es sich um Temperaturen von 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, oder 120°C handeln. Bevorzugt handelt es sich um Temperaturen von 15 bis 1200C, besonders bevorzugt 20 bis 100°C, und beispielsweise 40 bis 100°C oder 70 bis 9O0C. Die Temperatur kann beispielsweise durch Erwärmen des Bades, in welches der zu beschichtende Gegenstand eingetaucht wird, eingebracht werden. Man kann aber auch einen eingetauchten Gegenstand nachträglich erwärmen, beispielsweise mithilfe von IR-Strahlern. Bei Pigmentdispersionen kann die Dispersion erwärmt werden.
Nach dem Beschichten wird noch in der Beschichtung vorhandenes Lösemittel aus der Beschichtung entfernt. Dies kann beispielsweise durch einfaches Abdampfen an Luft erfolgen. Das Entfernen des Lösemittels kann aber auch durch Erhöhen der Temperatur und/oder mit geeigneten Gasströmen und/oder Anlegen eines Vakuums erleichtert werden. Das Abdampfen kann erleichtert werden, indem man beispielsweise beschichtete Gegenstände in einem Trockenschrank erwärmt oder mit einem erwärmten Gasstrom anbläst. Die Methoden können auch kombiniert werden, beispielsweise indem man in einem Umlufttrockenschrank oder einem Trockenkanal trocknet. Weiterhin kann die Beschichtung zum Entfernen des Lösemittels auch mittels Strahlung, insbesondere IR-Stahlung erwärmt werden. Hierzu können alle Arten von breitbandigen IR-Strahlern, bspw. NIR-, MIR- oder NIR-Stahler eingesetzt werden. Es können aber beispielsweise auch IR-Laser eingesetzt werden. Derartige Strahlungsquellen sind in diversen Strahlungsgeometrien kommerziell erhältlich. Pigmentdispersionen können beispielsweise auch mittels Sprühtrocknung getrocknet werden.
Die Temperatur sowie die Trockenzeit im Zuge des Trocknens wird vom Fachmann festgelegt. Bewährt hat sich eine Trocknungstemperatur von 30 bis 130°C, bevorzugt 50 bis 12O0C, besonders bevorzugt 70 bis 1100C, ganz besonders bevorzugt 75 bis 105°C und beispielsweise 85 bis 100°C. Gemeint ist hierbei die Temperatur der Beschichtung selbst. Die Temperatur in einem Trockner kann selbstverständlich auch höher sein. Die Trockenzeit ist naturgemäß umso kürzer, je höher die Trockentempera- tur ist.
Die Temperaturbehandlung im Zuge des Beschichtens und die Trocknung können vorteilhaft miteinander kombiniert werden. So kann beispielsweise eine Oberfläche zunächst mit der Formulierung F bei Raumtemperatur behandelt werden und anschlie- ßend bei erhöhten Temperaturen getrocknet und getempert werden. In einer bevorzugten Ausführungsform des Verfahrens wird mindestens in einem der beiden Schritte „Behandlung" oder „Trocknung" erhöhte Temperatur angewandt. Bevorzugt wird in beiden Schritten höhere Temperatur als Raumtemperatur angewandt.
Durch das Behandeln der Oberfläche mit dem erfindungsgemäßen Verfahren ist eine mit Fusions-Hydrophobinen beschichtete Oberfläche erhältlich, welche das Material der Oberfläche sowie eine sich unmittelbar darauf befindliche Schicht umfasst, die mindestens ein Fusions-Hydrophobin sowie ggf. weitere Bestandteile der Formulierung aufweist. Es kann hierbei die gesamte Oberfläche mit dem Hydrophobin bedeckt sein, oder auch nur ein Teil der Oberfläche. Die Qualität kann mittels verschiedener Methoden beurteilt werden, beispielsweise mittels der bereits erwähnten Kontaktwinkelmessung. Der Kontaktwinkel verändert sich wie bei der Beschichtung mit natürlich vorkommenden Hydrophobinen deutlich. Weitere Methoden sind dem Fachmann aus dem eingangs zitierten Stand der Technik bekannt (z.B. „AFM" atomic force microscopy zum direkten Nachweis der Proteinschicht auf der Oberfläche).
Die Fusions-Hydrophobin-Schicht kann vor oder nach dem Entfernen des Lösemittels noch weiter chemisch modifiziert werden. Es ist beispielsweise möglich, die Schicht mithilfe geeigneter Vernetzer zu vernetzen. Beispiele geeigneter Vernetzer umfassen Glutardialdehyd, Formaldehyd sowie weitere, aus der Proteinchemie bekannte homo- und heterobifunktionelle Proteinvernetzer. Hierdurch kann die Stabilität der Schicht gesteigert werden. Bei proteinhaltigen Substraten wie beispielsweise Leder, bestimm- ten Textilien, sowie für die Kosmetik relevanten Oberflächen kann außerdem die Anbindung an das Substrat zusätzlich verbessert werden. Die Vernetzung kann beispielsweise so vorgenommen werden, indem man die Schicht mit dem Fusions-Hydrophobin nach dem Beschichten mit einer zweiten Lösung mit dem Vernetzer behandelt und anschließend trocknet. Weiterhin ist es auch möglich, proteinhaltige aber auch andere Substrate so vorzubehandeln, dass Protein-reaktive funktionelle Gruppen auf der Oberfläche des Substrates gebildet werden. Eingesetzt werden können hierzu beispielsweise die oben genannten Vernetzer, aber andere Chemikalien wie z.B. Ozon, Peroxide oder Aldehyde. Eine weitere Möglichkeit besteht in einer Kopplung bzw. Ver- Stärkung der Kopplung über Metallionen. Entsprechende Protein-Sequenzen mit Affinität zu Metallionen sind dem Fachmann bekannt (z.B. Hisε zu Ni, Co, Fe etc.) und können mittels molekularbiologischer Standardtechniken bzw. proteinchemische Kopplung an die Hydrophobine angebracht werden. Die Metallionen können dabei vorab an die zu beschichtende Oberfläche gekoppelt sein oder gleichzeitig mit der Hydrophobin- kopplung eingesetzt werden.
Die folgenden Beispiele sollen die Erfindung näher illustrieren:
Teil A) Herstellung der erfindungemäß verwendeten Fusions-Hydrophobine
Beispiel 1
Vorarbeiten für die Klonierung von yaad-HiS6/ yaaE-HiS6
Mit Hilfe der Oligonukleotide Hal570 und Hal571 (HaI 572/ HaI 573) wurde eine PoIy- merase Kettenreaktion durchgeführt. Als Template DNA wurde genomische DNA des Bakteriums Bacillus subtilis verwendet. Das erhaltene PCR Fragment enthielt die codierende Sequenz des Gens yaaD / yaaE aus Bacillus subtilis, und an den Enden je eine Ncol bzw. BgIII Restriktionsschnittstelle. Das PCR Fragment wurde gereinigt und mit den Restriktionsendonukleasen Ncol und BgIII geschnitten. Dieses DNA Fragment wurde als Insert verwendet, und in den zuvor mit den Restriktionsendonukleasen Ncol und BgIII linearisierten Vektor pQE60 der Firma Qiagen kloniert. Die so erstandenen Vektoren pQE60YAAD#2 / pQE60YaaE#5 können zur Expression von Proteinen bestehend aus, YAAD::HIS6 bzw. YAAE::HIS6 verwendet werden.
Hal570: gcgcgcccatggctcaaacaggtactga Hal571 : gcagatctccagccgcgttcttgcatac Hal572: ggccatgggattaacaataggtgtactagg Hal573: gcagatcttacaagtgccttttgcttatattcc
Beispiel 2
Klonierung von yaad-Hydrophobin DewA-His6
Mit Hilfe der Oligonukleotide KaM 416 und KaM 417 wurde eine Polymerase Kettenre- aktion durchgeführt. Als Template DNA wurde genomische DNA des Schimmelpilzes Aspergillus nidulans verwendet. Das erhaltene PCR Fragment enthielt die codierende Sequenz des Hydrophobin Gens dewA und einer N-Terminalen FaktorXa Proteinase Schnittstelle. Das PCR Fragment wurde gereinigt und mit der Restriktionsendonuklea- se BamHI geschnitten. Dieses DNA Fragment wurde als Insert verwendet, und in den zuvor mit der Restriktionsendonuklease BgIII linearisierten Vektor pQE60YAAD#2 kloniert.
Der so erstandene Vektor #508 kann zur Expressions eines Fusionsproteins bestehend aus, YAAD::Xa::dewA::HIS6 verwendet werden. KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT- GAAGTTCTCCGTCTCCGC
Beispiel 3
Klonierung von yaad-Hydrophobin RodA-HiS6
Die Klonierung des Plasmids #513 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 434 und KaM 435.
KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
Beispiel 4
Klonierung von yaad-Hydrophobin BASF1-His6
Die Klonierung des Plasmids #507 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418.
Als Template DNA wurde ein künstlich synthetisierte DNA Sequenz - Hydrophobin BASF1 -eingesetzt (siehe Anhang).
KaM417:CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT- GAAGTTCTCCGTCTCCGC
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
Beispiel 5
Klonierung von yaad-Hydrophobin BASF2-HJS6
Die Klonierung des Plasmids #506 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418.
Als Template DNA wurde ein künstlich synthetisierte DNA Sequenz - Hydrophobin BASF2 -eingesetzt (siehe Anhang).
KaM417:CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-
GAAGTTCTCCGTCTCCGC
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG Beispiel 6
Klonierung von yaad-Hydrophobin SC3-HJS6
Die Klonierung des Plasmids #526 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM464 und KaM465.
Als Template DNA wurde cDNA von Schyzophyllum commune eingesetzt (siehe Anhang).
KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
Beispiel 7
Fermentation des rekombinanten E.coli Stammes yaad-Hydrophobin DewA-HiS6
Inokulation von 3 ml LB Flüssigmedium mit einem yaad-Hydrophobin DewA-Hisε expri- mierenden E.coli Stamm in 15 ml Greiner Röhrchen. Inkubation für 8h bei 370C auf einem Schüttler mit 200 UpM. Je 2 11 Erlenmeyer Kolben mit Schikanen und 250 ml LB Medium (+ 100 μg/ml Ampicillin) werden mit jeweils 1 ml der Vorkultur angeimpft und 9h bei 37°C auf einem Schüttler mit 180 UpM inkubiert.
13.51 LB-Medium (+100 μg/ml Ampicillin) in einem 20 I Fermenter mit 0,5 I Vorkultur (OD6oonm 1 :10 gegen H∑O gemessen) animpfen. Bei einer ODεonm von -3.5 Zugabe von 140ml 10OmM IPTG. Nach 3h Fermenter auf 100C abkühlen und Fermentationsbrühe abzentrifugieren. Zellpellet zur weiteren Aufreinigung verwenden.
Beispiel 8
Reinigung des rekombinanten Hydrohobin-Fusionsproteins (Reinigung von Hydrophobin-Fusionsproteinen, die ein C-terminales His6-tag besitzen)
100 g Zellpellet (100 - 500 mg Hydrophobin) werden mit 50 mM Natriumphosphatpuf- fer, pH 7,5 auf 200 ml Gesamtvolumen aufgefüllt und resuspendiert. Die Suspension wird mit einem Ultraturrax Typ T25 (Janke und Kunkel; IKA-Labortechnik) für 10 Minu- ten behandelt und anschließend für 1 Stunde bei Raumtemperatur mit 500 Einheiten Benzonase (Merck, Darmstadt; Best.-Nr. 1.01697.0001) zum Abbau der Nukleinsäuren inkubiert. Vor dem Zellaufschluss wird mit einer Glaskartusche (P1 ) filtriert. Zum Zellaufschluß und für das Scheren der restlichen genomischen DNA werden zwei Homogenisatorläufe bei 1.500 bar durchgeführt (Microfluidizer M-110EH; Microfluidics Corp.). Das Homogenisat wird zentrifugiert (Sorvall RC-5B, GSA-Rotor, 250 ml Zentrifugenbecher, 60 Minuten, 4°C, 12.000 Upm, 23.000 g), der Überstand auf Eis gestellt und das Pellet in 100 ml Natriumphosphatpuffer, pH 7,5 resuspendiert. Zentrifugation und Resuspendieren werden dreimal wiederholt, wobei der Natriumphosphatpuffer bei der dritten Wiederholung 1 % SDS enthält. Nach der Resuspension wird für eine Stunde gerührt und eine abschliessende Zentrifugation durchgeführt (Sorvall RC-5B, GSA- Rotor, 250 ml Zentrifugenbecher, 60 Minuten, 4°C, 12.000 Upm, 23.000 g). Gemäß SDS-PAGE Analyse ist das Hydrophobin nach der abschließenden Zentrifugation im Überstand enthalten (Abbildung 1). Die Versuche zeigen, dass das Hydrophobin wahrscheinlich in Form von Einschlusskörpern in den entsprechenden E. coli Zellen enthalten ist. 50 ml des Hydrophobin-enthaltenden Überstandes werden auf eine 50 ml Ni- ckel-Sepharose High Performance 17-5268-02 Säule aufgetragen (Amersham), die mit 50 mM Tris-Cl pH 8,0 Puffer äquilibriert wurde. Die Säule wird mit 50 mM Tris-Cl pH 8,0 Puffer gewaschen und das Hydrophobin anschließend mit 50 mM Tris-Cl pH 8,0 Puffer, der 200 mM Imidazol enthält, eluiert. Zur Entfernung des Imidazols wird die Lösung gegen 50 mM Tris-Cl pH 8,0 Puffer dialysiert.
Abbildung 1 zeigt die Reinigung des hergestellten Fusions-Hydrophobins:
Spur 1 : Auftrag Nickel-Sepharose Säule (1 :10 Verdünnung)
Spur 2: Durchlauf = Eluat Waschschritt
Spuren 3 - 5: OD 280 Maxima der Elutionsfraktionen
Das Fusions-Hydrophobin der Abbildung 1 besitzt ein Molekulargewicht von ca. 53 kD. Die kleineren Banden repräsentieren zum Teil Abbauprodukte des Hydrophobins.
Beispiel 9
Vereinfachtes Reinigungsverfahren
Der in Beispiel 7 erhaltene E. co//-Zellpellet in Wasser wird mit 1000 bar durch eine Düse gepresst. Hierbei werden die Zellen vollständig aufgeschlossen. Mittels Zentrifu- gation wird das in Einschlusskörpern (inclusion bodies) anfallende Hydrophobin von den restlichen Zelltrümmeren abgetrennt werden. Bei einer g-Zahl von 5000 separieren sich nach 30 Minuten 2 Phasen. Die untere, Fusions-Hydrophobin-enthaltende Phase wird noch einmal mit Wasser suspendiert und wie oben zentrifugiert. Die inclusion bodies werden anschließend in 0,1 M NaOH für 60 Minuten inkubiert und so vollständig gelöst. Der pH-Wert wird mit Phosphorsäure auf 8 eingestellt und die Proteinkonzentration auf 20 mg/ml eingestellt. Die Reinheit (bezogen auf Gesamtprotein) des so produzierten Fusions-Hydrophobins liegt bei 70%. Beispiel 10
Sprühtrocknung von Hydrophobin
Die in Beispiel 9 erhaltene Hydrophobinlösung wird in einem handelsüblichen Sprühtrockner weiter verarbeitet.
Die Sprühtrocknung erfolgt mit einem Zusatz von 10 % w/w Mannitol bei einer Eingangstemperaturen von 16O0C und Ausgangstemperaturen von 700C. Es wurde ein feinpulvriges Produkt erhalten.
Beispiel 11
Anwendungstechnische Prüfung; Charakterisierung des Fusions-Hydrophobins durch Kontaktwinkeländerung eines Wassertropfens auf Glas
Substrat:
Glas (Fensterglas, Süddeutsche Glas, Mannheim):
Sprühgetrocknetes Hydrophobin gemäß Beispiel 10 wird in einer wässrigen Pufferlösung (5OmM Tris, pH 8 + 0,1 mM CaCI2 (Endkonzentration) + 0,1 % Po- lyoxyethylen(20)sorbitanmonolaureat (Tween® 20)) aufgenommen und auf eine
Konzentration von 100 μg/mL eingestellt
Inkubation von Glasplättchen über Nacht (Temperatur 800C) danach Beschich- tung waschen in destilliertem Wasser - danach Inkubation 10min / 8O0C / 1 % Natrium-Dodecylsulfat (SDS) -Lösung in dest. Wasser - Waschen in dest. Wasser
Die Proben werden an der Luft getrocknet und der Kontaktwinkel (in Grad) eines Trop- fens von 5 μl Wasser bei Raumtemperatur bestimmt.
Die Kontaktwinkelmessung wurde auf einem Gerät Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002) bestimmt. Die Messung erfolgte gemäss den Herstellerangaben.
Unbehandeltes Glas ergab einen Kontaktwinkel von 30 ± 5°; das beschichte Glas wies einen Kontaktwinkel von 75 ± 5° auf. Beispiel 12
Beschichtungsversuche mit dem Fusions-Hydrophobin mittels Sprühen:
1. Besprühen von Polyethylen - Platten:
Für die Versuche wurde eine gemäß Beispiel 8 erhaltene Lösung von yaad-Xa-dewA- his (SEQ ID NO: 20) eingesetzt. Die Losung enthielt außerdem Natriumphosphat- Puffer in einer Konzentration von 50 mM. Die Konzentration des Fusion-Hydrophobins in der Lösung betrug 11 ,23 mg/ml, der pH-Wert der Lösung 7,5.
Weiterhin wurde die gemäß dem vereinfachten Reinigungsverfahren gemäß Beispiel 9 erhaltene Losung eingesetzt.
Für die Sprühversuche wurden die Lösungen etwa 100-fach auf eine Konzentration von 100 μg/ ml Fusionshydrophobin verdünnt Zum Verdünnen wurden jeweils die folgenden Lösungen bzw. Lösungsmittel eingesetzt:
Figure imgf000026_0001
Diese Lösungen 10-1 bis 10-5 wurden nun mit einem Laborsprühgerät (Desaga SG1) so auf Polyethylen - Platten (Simona® PE-HWU) aufgesprüht, so dass ein dünner, gleichmaßiger Film auf der Oberfläche entstand. Dieser Flüssigkeitsfilm trocknete innerhalb von 2 h bei RT vollständig ab. Nach einer Ruhezeit von weiteren 2 Stunden wurden die Platten sorgfältig mit viel Wasser gespult, und über Nacht an Luft getrocknet.
Zur Beurteilung der Qualität wurde der Kontaktwinkel der beschichteten Oberfläche wie oben beschrieben gemessen. Weiterhin wurde die Filmbildung von Wasser auf der Oberflache optisch beurteilt. Die Ergebnisse sind in Tabelle 1 zusammengestellt.
Figure imgf000027_0001
Tab. 1 : Beschichtung von Polyethylen-Platten mit Fusions-Hydrophobinen
Mit allen Lösungen der Fusions-Hydrophobine ließ sich eine Hydrophilierung der Oberflächen erreichen. Dabei ist der Effekt mit einer gepufferten Lösung, aber ohne Tensid am deutlichsten.
2. Besprühen von Aluminiumblechen
Für die Versuche wurden handelsübliche Aluminium-Bleche verwendet (Fa. Elasto- gran).
Auf die gleiche Weise wie oben beschrieben wurden die Aluminiumbleche mit der Lösung 10-1 (nur Wasser) bzw. 10-2 (Fusions-Hydrophobin inTris-Puffer) besprüht, getrocknet und mit entionisiertem Wasser gespült. Der Verbrauch an Lösung betrug 150 mL (100 μg/ml) für 1 ,2 m2 Blech, dies entspricht etwa 12,5 mg Hydrophobin/m2.
Figure imgf000027_0002
Tab. 2: Beschichtung von Aluminium-Platten mit Fusions-Hydrophobinen Es ist eine leichte Hydrophobierung der Aluminium-Oberfläche mittels Kontaktwinkelmessung zu erkennen. Hinsichtlich der Filmbildung von Wasser auf der Aluminiumoberfläche ist eine deutliche Modifizierung ersichtlich.
Die beiden unterschiedlich aufgearbeiteten Lösungen des Fusions-Hydrophobins unterscheiden sich nicht hinsichtlich ihrer Wirksamkeit.
Beispiel 13
Quervernetzung von Oberflächen und Hydrophobin
Substrat: Leder (Wet Blue)
Sprühgetrocknetes Hydrophobin wird in Wasser aufgenommen und auf eine Konzentration von 100 μg/mL eingestellt - Inkubation von Lederstücken über Nacht (bei Raumtemperatur) in 5OmM Tris pH 8 + 0,1 nriM CaCI2 (Endkonzentration) + 0,1 % Polyoxyethy- len(20)sorbitanmonolaureat (Tween® 20) danach Beschichtung waschen in destilliertem Wasser
- danach Inkubation 10min / 800C / 1 % Natrium-Dodecylsulfat (SDS) -Lösung in dest. Wasser
- Waschen in dest. Wasser
Inkubation mit 0,01 % Glutardialdehydlösung in Wasser (2 Stunden bei Raumtemperatur)
- Waschen in dest. Wasser
Es kommt zu einer signifikanten Hydrophilisierung des Leders, das durch die Quervernetzung zusätzliche mechanische Stabilität gewinnt. Die Hydrophilierung kann in bekannter Art und Weise mittels Wassertropfenaufnahme bestimmt werden. Während ein Wassertropfen auf unbehandeltem Leder ca. 4 min bis zum Einziehen brauchte, zog ein gleich großer Wassertropfen innerhalb von weniger als 1 min in das mit Hydrophobin behandelte Leder ein.
Beispiel 15
Trocknung mittels IR-Strahlung
Substrat:
Glas (Fensterglas, Süddeutsche Glas, Mannheim):
- Sprühgetrocknetes Hydrophobin gemäß Beispiel 9 wird in 1 OmM Tris pH 8 aufgenommen und auf eine Konzentration von 50 μg/mL eingestellt. Glasplättchen werden mit der Hydrophobinlösung benetzt und mittels IR- Strahlung (IR125R von der Marke Philips) innerhalb von 10 min getrocknet.
Temperatur der Oberfläche ca. 100 bis 12O0C
Der Kontaktwinkel (in Grad) eines Tropfens von 5 μl Wasser wird bei Raumtemperatur bestimmt.
Die Kontaktwinkelmessung wurde auf einem Gerät Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002) bestimmt. Die Messung erfolgte gemäss den Herstellerangaben.
Unbehandeltes Glas ergab einen Kontaktwinkel von 30 ± 5°; das behandelte Glas ergab einen Kontaktwinkel von 75 ± 15°.
Zuordnung der Sequenznamen zu DNA- und Polypeptidsequenzen im Sequenzprotokoll
Figure imgf000030_0001

Claims

Patentansprüche
1. Verfahren zum Beschichten von Oberflächen mit Hydrophobinen umfassend mindestens die folgenden Verfahrensschritte:
(1 ) Bereitstellen einer Formulierung (F) umfassend Wasser oder ein wässriges Lösemittelgemisch sowie ein Hydrophobin,
(2) Behandeln der Oberfläche mit der Formulierung, sowie
(3) Entfernen des Lösemittels,
dadurch gekennzeichnet, dass es sich bei dem Hydrophobin um ein Fusions- Hydrophobin handelt und die Formulierung einen pH-Wert > 4 aufweist.
2. Verfahren gemäß Anspruch 1 , dadurch gekennzeichnet, dass die Formulierung einen pH-Wert > 7 aufweist.
3. Verfahren gemäß Anspruch 1 oder 2, dadurch gekennzeichnet, dass die Formulierung weiterhin einen Puffer umfasst.
4. Verfahren gemäß einem der Ansprüche 1 bis 3, dadurch gekennzeichnet, dass man die Formulierung durch Lösen vom festem Fusions-Hydrophobin erhält.
5. Verfahren gemäß Anspruch 4, dadurch gekennzeichnet, dass es sich um sprühgetrocknetes Fusions-Hydrophobin handelt.
6. Verfahren gemäß einem der Ansprüche 1 bis 3, dadurch gekennzeichnet, dass man zur Herstellung der Formulierung eine Lösung einsetzt, welche durch Abtrennen der Zellen aus der Fermentationsbrühe, Aufschluss der Zellen sowie Auflösen der Einschlusskörper (inclusion bodies) hergestellt wird.
7. Verfahren gemäß einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, dass man das Beschichten bei 15 bis 120°C vornimmt.
8. Verfahren gemäß einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, dass man das Beschichten bei 20 bis 1000C vornimmt.
9. Verfahren gemäß einem der Ansprüche 1 bis 8, dadurch gekennzeichnet, dass man die Trocknung bei 30 - 130 0C vornimmt.
10. Verfahren gemäß einem der Ansprüche 1 bis 9, dadurch gekennzeichnet, dass man die Beschichtung in einem zusätzlichen Verfahrensschritt vernetzt.
11. Verfahren gemäß einem der Ansprüche 1 bis 10, dadurch gekennzeichnet, dass man es sich bei dem Fusions-Hydrophobin um yaad-Xa-dewA-his6 (SEQ ID NO: 20), oder um ein Protein mit einem verkürzten yaad-Fusionspartner handelt.
12. Oberfläche, umfassend eine Beschichtung umfassend mindestens ein Fusions- Hydrophobin.
13. Oberfläche gemäß Anspruch 12, dadurch gekennzeichnet, dass die Beschichtung vernetzt ist.
14. Oberfläche gemäß Anspruch 12 oder 13, dadurch gekennzeichnet, dass es sich bei dem Fusions-Hydrophobin um yaad-Xa-dewA-his (SEQ ID NO: 20), oder um ein Protein mit einem verkürzten yaad-Fusionspartner handelt.
PCT/EP2006/050723 2005-02-07 2006-02-07 Verfahren zum beschichten von oberflächen mit hydrophobinen WO2006082253A2 (de)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US11/883,755 US20080319168A1 (en) 2005-02-07 2006-02-07 Method for Coating Surfaces with Hydrophobins
EP06708070A EP1848734A2 (de) 2005-02-07 2006-02-07 Verfahren zum beschichten von oberflächen mit hydrophobinen

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
DE102005005737.3 2005-02-07
DE200510005737 DE102005005737A1 (de) 2005-02-07 2005-02-07 Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005007480.4 2005-02-17
DE200510007480 DE102005007480A1 (de) 2005-02-17 2005-02-17 Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005051515.0 2005-10-26
DE200510051515 DE102005051515A1 (de) 2005-10-26 2005-10-26 Verfahren zum Beschichten von Oberflächen mit Hydrophobinen

Publications (2)

Publication Number Publication Date
WO2006082253A2 true WO2006082253A2 (de) 2006-08-10
WO2006082253A3 WO2006082253A3 (de) 2006-12-28

Family

ID=36763579

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2006/050723 WO2006082253A2 (de) 2005-02-07 2006-02-07 Verfahren zum beschichten von oberflächen mit hydrophobinen

Country Status (4)

Country Link
US (1) US20080319168A1 (de)
EP (1) EP1848734A2 (de)
TW (1) TW200639179A (de)
WO (1) WO2006082253A2 (de)

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007014897A1 (de) * 2005-08-01 2007-02-08 Basf Se Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche
WO2008110456A2 (en) * 2007-03-12 2008-09-18 Basf Se Method of treating cellulosic materials with hydrophobins
WO2008142111A1 (de) * 2007-05-24 2008-11-27 Basf Se Verwendung von hydrophobinen als hilfsmittel bei der kristallisation von feststoffen
EP2042155A1 (de) 2007-09-28 2009-04-01 Basf Se Verfahren zum Entfernen von wasserunlöslichen Substanzen von Substratoberflächen
WO2009101017A1 (de) 2008-02-14 2009-08-20 Basf Se Verwendung von hydrophobinen zur verhinderung der eisbildung auf oberflächen
WO2010072665A1 (de) 2008-12-23 2010-07-01 Basf Se Modifizierung von nano- oder mesofasern oder textilen flächengebilden hergestellt mittels elektrospinnen mit amphiphilen proteinen
WO2010092088A2 (de) 2009-02-10 2010-08-19 Basf Se Verwendung von hydrophobin als spreitmittel
WO2010102934A1 (de) 2009-03-09 2010-09-16 Basf Se Verwendung einer mischung aus wasserloslichen polymeren und hydrophobinen zum verdicken wässriger phasen
US7799741B2 (en) 2005-04-01 2010-09-21 Basf Se Drilling mud containing hydrophobin
WO2011015530A2 (en) 2009-08-03 2011-02-10 Basf Se Process for deposition of thin layers of metal oxides
US7892788B2 (en) 2005-02-07 2011-02-22 Basf Se Hydrophobin fusion products, production and use thereof
US7910699B2 (en) 2005-06-10 2011-03-22 Basf Se Cysteine-depleted hydrophobin fusion proteins, their production and use thereof
WO2011101457A1 (en) 2010-02-18 2011-08-25 B.R.A.I.N. Biotechnology Research And Information Network Ag Chimeric surface active proteins
EP2371844A1 (de) 2010-03-25 2011-10-05 B.R.A.I.N. Biotechnology Research and Information Network AG Chimäre oberflächenaktive Proteine
WO2011121009A1 (en) 2010-03-31 2011-10-06 Basf Se Coated stents and process for coating with protein
WO2012004255A1 (de) 2010-07-07 2012-01-12 Basf Se Zusammensetzung enthaltend ein hydrophobin und verfahren zum reinigen von hydrophoben oberflächen
US8096484B2 (en) 2006-08-15 2012-01-17 Basf Se Method for the production of dry free-flowing hydrophobin preparations
WO2012013508A1 (en) 2010-07-30 2012-02-02 Basf Se Amphiphilic protein in printed electronics
WO2012049250A2 (de) 2010-10-13 2012-04-19 Basf Se Verfahren zum immobilisieren kationischer wirkstoffe auf oberflächen
US8173716B2 (en) 2007-03-06 2012-05-08 Basf Se Open-cell foam modified with hydrophobines
WO2012137147A1 (en) 2011-04-08 2012-10-11 Danisco Us, Inc. Compositions
US8535535B2 (en) 2005-04-01 2013-09-17 Basf Se Use of hydrophobin as a phase stabilizer
EP2676680A1 (de) 2007-09-13 2013-12-25 Basf Se Verwendung von Hydrophobin-Polipeptiden als Penetrationsverstärker
WO2014063097A1 (en) 2012-10-19 2014-04-24 Danisco Us Inc. Stabilization of biomimetic membranes
US8859106B2 (en) 2005-03-31 2014-10-14 Basf Se Use of polypeptides in the form of adhesive agents
WO2015094527A1 (en) 2013-12-19 2015-06-25 Danisco Us Inc. Use of hydrophobins to increase gas transferin aerobic fermentation processes

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102005033002A1 (de) * 2005-07-14 2007-01-18 Basf Ag Wässrige Monomeremulsionen enthaltend Hydrophobin

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996041882A1 (en) * 1995-06-12 1996-12-27 Proefstation Voor De Champignoncultuur Hydrophobins from edible fungi, genes, nucleotide sequences and dna-fragments encoding for said hydrophobins, and expression thereof
WO2001057528A1 (en) * 2000-02-04 2001-08-09 Applied Nanosystems, B.V. Method of treating a surface of an object with a hydrophobin-containing solution

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2399161A (en) * 1942-06-30 1946-04-30 Claude R Wickard Process for producing glues and adhesives from keratin protein materials
GB1278924A (en) * 1970-02-06 1972-06-21 Ici Ltd Improvements in synthetic film materials
DE2609104A1 (de) * 1976-03-05 1977-09-15 Basf Ag Verfahren zur herstellung von styrol-suspensionspolymerisaten
DE2638839A1 (de) * 1976-08-28 1978-03-02 Basf Ag Verfahren zur herstellung von styrol-suspensionspolymerisaten
US5049504A (en) * 1986-11-24 1991-09-17 Genex Corporation Bioadhesive coding sequences
JPH03203838A (ja) * 1989-12-29 1991-09-05 Matsushita Electric Ind Co Ltd 回転体に対する処理装置
DE4024871A1 (de) * 1990-08-06 1992-02-13 Basf Ag Perlfoermige antistatische expandierbare styrolpolymerisate
DE4220225A1 (de) * 1992-06-20 1993-12-23 Basf Ag Verfahren zur Herstellung von perlförmigen expandierbaren Styrolpolymerisaten
IL110938A (en) * 1994-09-12 2001-01-28 Haber Meir Adhesive proteins isolated from mature macro and microalgae
DE19956802A1 (de) * 1999-11-25 2001-06-13 Cognis Deutschland Gmbh Waschmitteltabletten
GB0002660D0 (en) * 2000-02-04 2000-03-29 Biomade B V Method of stabilizing a hydrophobin-containing solution and a method of coatinga surface with a hydrophobin
WO2002020651A2 (en) * 2000-09-06 2002-03-14 Zymogenetics, Inc. Human phermone polypeptide
FR2833490B1 (fr) * 2001-12-14 2004-12-10 Oreal Utilisition cosmetique d'au moins une hydrophobine pour le traitement des matieres keratiniques et compositions mises en oeuvre
DE10342794A1 (de) * 2003-09-16 2005-04-21 Basf Ag Sekretion von Proteinen aus Hefen
US7241734B2 (en) * 2004-08-18 2007-07-10 E. I. Du Pont De Nemours And Company Thermophilic hydrophobin proteins and applications for surface modification
US7892788B2 (en) * 2005-02-07 2011-02-22 Basf Se Hydrophobin fusion products, production and use thereof
EP1891261A2 (de) * 2005-06-06 2008-02-27 Basf Aktiengesellschaft Verfahren zur beschichtung von oberflächen von faserigen substraten
DE102005027139A1 (de) * 2005-06-10 2006-12-28 Basf Ag Neue Cystein-verarmte Hydrophobinfusionsproteine, deren Herstellung und Verwendung

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996041882A1 (en) * 1995-06-12 1996-12-27 Proefstation Voor De Champignoncultuur Hydrophobins from edible fungi, genes, nucleotide sequences and dna-fragments encoding for said hydrophobins, and expression thereof
WO2001057528A1 (en) * 2000-02-04 2001-08-09 Applied Nanosystems, B.V. Method of treating a surface of an object with a hydrophobin-containing solution

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ANANICHEV A V ET AL: "IMMOBILIZATION OF GLUCOSE ISOMERASE ON POROUS SILOCHROME IN VACUUM" PRIKLADNAYA BIOKHIMIYA I MIKROBIOLOGIYA, Bd. 20, Nr. 4, 1984, Seiten 458-463, XP001247329 ISSN: 0555-1099 *
BELITSKY BORIS R: "Physical and enzymological interaction of Bacillus subtilis proteins required for de novo pyridoxal 5'-phosphate biosynthesis." JOURNAL OF BACTERIOLOGY, Bd. 186, Nr. 4, Februar 2004 (2004-02), Seiten 1191-1196, XP002386768 ISSN: 0021-9193 -& DATABASE UniProt 1. Oktober 1994 (1994-10-01), XP002386773 gefunden im EBI Database accession no. P37527 -& DATABASE UniProt 1. Oktober 1994 (1994-10-01), XP002386774 gefunden im EBI Database accession no. P37528 *
JANSSEN M I ET AL: "Coating with genetic engineered hydrophobin promotes growth of fibroblasts on a hydrophobic solid" BIOMATERIALS, ELSEVIER SCIENCE PUBLISHERS BV., BARKING, GB, Bd. 23, Nr. 24, Dezember 2002 (2002-12), Seiten 4847-4854, XP004380887 ISSN: 0142-9612 *
LINDER MARKUS ET AL: "Surface adhesion of fusion proteins containing the hydrophobins HFBI and HFBII from Trichoderma reesei" PROTEIN SCIENCE, Bd. 11, Nr. 9, September 2002 (2002-09), Seiten 2257-2266, XP002386767 ISSN: 0961-8368 *
STRINGER M A ET AL: "DEWA ENCODES A FUNGAL HYDROPHOBIN COMPONENT OF THE ASPERGILLUS SPORE WALL" MOLECULAR MICROBIOLOGY, BLACKWELL SCIENTIFIC, OXFORD, GB, Bd. 16, Nr. 1, 1995, Seiten 33-44, XP000770242 ISSN: 0950-382X -& DATABASE UniProt 1. Oktober 1996 (1996-10-01), XP002386772 gefunden im EBI Database accession no. P52750 *
WOESTEN H A B: "HYDROPHOBINS: MULTIPURPOSE PROTEINS" ANNUAL REVIEW OF MICROBIOLOGY, ANNUAL REVIEWS INC., PALO ALTO, CA, US, Bd. 55, 2001, Seiten 625-646, XP008003420 ISSN: 0066-4227 *

Cited By (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7892788B2 (en) 2005-02-07 2011-02-22 Basf Se Hydrophobin fusion products, production and use thereof
US8859106B2 (en) 2005-03-31 2014-10-14 Basf Se Use of polypeptides in the form of adhesive agents
US8535535B2 (en) 2005-04-01 2013-09-17 Basf Se Use of hydrophobin as a phase stabilizer
US7799741B2 (en) 2005-04-01 2010-09-21 Basf Se Drilling mud containing hydrophobin
US7910699B2 (en) 2005-06-10 2011-03-22 Basf Se Cysteine-depleted hydrophobin fusion proteins, their production and use thereof
WO2007014897A1 (de) * 2005-08-01 2007-02-08 Basf Se Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche
US8096484B2 (en) 2006-08-15 2012-01-17 Basf Se Method for the production of dry free-flowing hydrophobin preparations
US8173716B2 (en) 2007-03-06 2012-05-08 Basf Se Open-cell foam modified with hydrophobines
US8455107B2 (en) 2007-03-12 2013-06-04 Basf Se Method of treating cellulosic materials with hydrophobins
WO2008110456A3 (en) * 2007-03-12 2009-05-22 Ciba Holding Inc Method of treating cellulosic materials with hydrophobins
US20100330384A1 (en) * 2007-03-12 2010-12-30 Ciba Corporation Method of treating cellulosic materials with hydrophobins
WO2008110456A2 (en) * 2007-03-12 2008-09-18 Basf Se Method of treating cellulosic materials with hydrophobins
WO2008142111A1 (de) * 2007-05-24 2008-11-27 Basf Se Verwendung von hydrophobinen als hilfsmittel bei der kristallisation von feststoffen
EP2676680A1 (de) 2007-09-13 2013-12-25 Basf Se Verwendung von Hydrophobin-Polipeptiden als Penetrationsverstärker
EP2042155A1 (de) 2007-09-28 2009-04-01 Basf Se Verfahren zum Entfernen von wasserunlöslichen Substanzen von Substratoberflächen
WO2009101017A1 (de) 2008-02-14 2009-08-20 Basf Se Verwendung von hydrophobinen zur verhinderung der eisbildung auf oberflächen
CN102015955A (zh) * 2008-02-14 2011-04-13 巴斯夫欧洲公司 疏水蛋白在防止表面结冰中的应用
US7981313B2 (en) 2008-02-14 2011-07-19 Basf Se Use of hydrophobins to prevent ice from forming on surfaces
WO2010072665A1 (de) 2008-12-23 2010-07-01 Basf Se Modifizierung von nano- oder mesofasern oder textilen flächengebilden hergestellt mittels elektrospinnen mit amphiphilen proteinen
WO2010092088A3 (de) * 2009-02-10 2011-01-20 Basf Se Verwendung von hydrophobin als spreitmittel
WO2010092088A2 (de) 2009-02-10 2010-08-19 Basf Se Verwendung von hydrophobin als spreitmittel
WO2010102934A1 (de) 2009-03-09 2010-09-16 Basf Se Verwendung einer mischung aus wasserloslichen polymeren und hydrophobinen zum verdicken wässriger phasen
WO2011015530A3 (en) * 2009-08-03 2011-04-14 Basf Se Process for deposition of thin layers of metal oxides
WO2011015530A2 (en) 2009-08-03 2011-02-10 Basf Se Process for deposition of thin layers of metal oxides
WO2011101457A1 (en) 2010-02-18 2011-08-25 B.R.A.I.N. Biotechnology Research And Information Network Ag Chimeric surface active proteins
EP2371844A1 (de) 2010-03-25 2011-10-05 B.R.A.I.N. Biotechnology Research and Information Network AG Chimäre oberflächenaktive Proteine
WO2011121009A1 (en) 2010-03-31 2011-10-06 Basf Se Coated stents and process for coating with protein
WO2012004255A1 (de) 2010-07-07 2012-01-12 Basf Se Zusammensetzung enthaltend ein hydrophobin und verfahren zum reinigen von hydrophoben oberflächen
WO2012013508A1 (en) 2010-07-30 2012-02-02 Basf Se Amphiphilic protein in printed electronics
WO2012049250A2 (de) 2010-10-13 2012-04-19 Basf Se Verfahren zum immobilisieren kationischer wirkstoffe auf oberflächen
WO2012137147A1 (en) 2011-04-08 2012-10-11 Danisco Us, Inc. Compositions
WO2014063097A1 (en) 2012-10-19 2014-04-24 Danisco Us Inc. Stabilization of biomimetic membranes
US10226744B2 (en) 2012-10-19 2019-03-12 Danisco Us Inc Stabilization of biomimetic membranes
US10413871B2 (en) 2012-10-19 2019-09-17 Danisco Us Inc Stabilization of biomimetic membranes
WO2015094527A1 (en) 2013-12-19 2015-06-25 Danisco Us Inc. Use of hydrophobins to increase gas transferin aerobic fermentation processes

Also Published As

Publication number Publication date
TW200639179A (en) 2006-11-16
WO2006082253A3 (de) 2006-12-28
EP1848734A2 (de) 2007-10-31
US20080319168A1 (en) 2008-12-25

Similar Documents

Publication Publication Date Title
WO2006082253A2 (de) Verfahren zum beschichten von oberflächen mit hydrophobinen
EP1866150B1 (de) Metallische substrate mit polypeptiden als haftvermittler
EP1848733B1 (de) Neue hydrophobinfusionsproteine, deren herstellung und verwendung
EP1866401B1 (de) Verwendung von hydrophobinen zur schmutzabweisenden behandlung von harten oberflächen
EP1904534B1 (de) Wässrige monomeremulsionen enthaltend hydrophobin
EP1913123B1 (de) Verwendung von grenzflächenaktiven, nicht-enzymatischen proteinen für die textilwäsche
EP1866106B1 (de) Verwendung von hydrophobinen zur oberflächenbehandlung von gehärteten mineralischen baustoffen, naturstein, kunststein und keramiken
EP1893675B9 (de) Hydrophobin als beschichtungsmittel für expandierbare oder expandierte, thermoplastische polymerpartikel
EP1869138B1 (de) Bohrspülung enthaltend hydrophobin
EP1893639A2 (de) Neue cystein-verarmte hydrophobinfusionsproteine, deren herstellung und verwendung
WO2006103251A1 (de) Verwendung von proteinen als demulgatoren
EP1891261A2 (de) Verfahren zur beschichtung von oberflächen von faserigen substraten
WO2006103252A2 (de) Verwendung von hydrophobin als phasen-stabilisator
EP1941009A2 (de) Verwendung von proteinen als antischaum-komponente in kraftstoffen
WO2006128877A1 (de) Verfahren zur verringerung der verdunstungsgeschwindigkeit von flüssigkeiten
DE102005015043A1 (de) Verwendung von Polypeptiden als Haftvermittler
DE102005051515A1 (de) Verfahren zum Beschichten von Oberflächen mit Hydrophobinen
DE102005007480A1 (de) Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005005737A1 (de) Neue Hydrophobinfusionsproteine, deren Herstellung und Verwendung
DE102005045770A1 (de) Verwendung von Polypeptiden als Haftvermittler
DE102005030786A1 (de) Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
DE102005026143A1 (de) Verfahren zur Beschichtung von Oberflächen von faserigen Substraten
DE102005014844A1 (de) Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen

Legal Events

Date Code Title Description
DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2006708070

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 11883755

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWP Wipo information: published in national office

Ref document number: 2006708070

Country of ref document: EP