WO2006077873A1 - Nouvelle enzyme de metabolisation de medicaments et acide nucleique codant pour elle - Google Patents

Nouvelle enzyme de metabolisation de medicaments et acide nucleique codant pour elle Download PDF

Info

Publication number
WO2006077873A1
WO2006077873A1 PCT/JP2006/300623 JP2006300623W WO2006077873A1 WO 2006077873 A1 WO2006077873 A1 WO 2006077873A1 JP 2006300623 W JP2006300623 W JP 2006300623W WO 2006077873 A1 WO2006077873 A1 WO 2006077873A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
monkey
seq
metabolism
drug
Prior art date
Application number
PCT/JP2006/300623
Other languages
English (en)
Japanese (ja)
Inventor
Yasuhiro Uno
Ryoichi Nagata
Go Kito
Original Assignee
Shin Nippon Biomedical Laboratories, Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shin Nippon Biomedical Laboratories, Ltd. filed Critical Shin Nippon Biomedical Laboratories, Ltd.
Priority to JP2006553924A priority Critical patent/JP4972413B2/ja
Publication of WO2006077873A1 publication Critical patent/WO2006077873A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0077—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with a reduced iron-sulfur protein as one donor (1.14.15)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates

Definitions

  • the present invention relates to a novel drug-metabolizing enzyme specifically possessed by monkeys, a nucleic acid encoding the same, and a method for evaluating a preclinical test using monkeys as model animals using the novel drug-metabolizing enzyme.
  • cytochrome P450 An enzyme called cytochrome P450 (CYP) is deeply involved in drug metabolism. CYP forms a gene family, and humans have been reported to have more than 50 CYP genes so far, and other mammals are known to have many CYP genes. CYP is a heme protein coordinated with iron ions. The structure of each CYP is very similar, but the substrate and metabolic activity are different.
  • CYPs are classified based on amino acid sequence homology, and each CYP is a family name (number), subfamily name (alphabet), proper name (number), for example “CYP1A 1”. It is specified by notation.
  • a compound that is metabolized by CYP molecular species with large individual differences is considered undesirable as a drug with a high possibility of different drug efficacy and side effects from person to person.
  • the molecular species of the candidate In advance, only candidates with specific polymorphisms, such as polymorphisms that have a medicinal effect or polymorphisms that are unlikely to cause side effects, are excluded, and candidates that have polymorphisms that are likely to cause side effects are excluded. It is necessary to take measures such as
  • Patent Document 1 Japanese Patent Laid-Open No. 2004-4
  • Non-patent literature l Nartimatsu S. et al., Chem Biol Interact (2000) 127: 73-90
  • Non-patent literature 2 Sharer JE. Et al., Drug Metab Dispos (1995) 23: 1231-1241
  • Non-patent literature 3 Stevens JC. Et al., Drg Metab Dispos (1993) 21: 753-760
  • Non-Patent Document 4 Weaver RJ. Et al., Xenobiotica (1999) 29: 467-482
  • the significance of the test results can be evaluated more accurately and effectively by taking into account differences between human CYPs and model animal CYPs, and polymorphisms between model animals. It is thought that it can be utilized. For example, if the metabolic pattern differs significantly between humans and force-quizal monkeys, and there are drug candidates that produce significant side effects in force-quisal monkeys, the difference in metabolic patterns may be due to differences in CYP between humans and force-quizal monkeys. If it can be confirmed that the same side effects do not occur in humans, it may be possible to continue and promote development as a human drug without wastefully stopping the development of the compound. There is.
  • an object of the present invention is to find a monkey-specific drug-metabolizing enzyme and a gene encoding it that are not found in mammals other than monkeys.
  • the present invention measures the metabolic activity of a drug by the monkey-specific drug metabolizing enzyme described above.
  • the purpose of this study is to provide a method for accurately evaluating the results of pharmacokinetic studies using monkeys as model animals and using them effectively.
  • the present inventors have conducted research to solve the above-mentioned problems and screened a cDNA library having a relatively high homology with the human CYP gene by screening a power-cynomolgus liver cDNA library! As a result of the determination of the full-length nucleotide sequence, 21 CYPs were successfully detected. In addition, it was found that the CYP2C gene, which is less homologous to human genes than other CYP genes, is included in this, and this gene is expressed in Old World and New World monkeys including force-cynomolgus monkeys. It was confirmed that expression was not observed in large apes including humans.
  • DNA having the nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 3, or the nucleotide sequence complementary to the nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 3 or a partial DNA thereof Monkey-derived DNA that encodes a protein that is a drug-metabolizing enzyme that is hybridized under stringent conditions with powerful DNA sequences;
  • a recombinant vector comprising the DNA according to [3];
  • a method for evaluating a cause of a difference in metabolism of the test substance which comprises the step B of measuring the presence or absence of involvement of the protein according to the above [1];
  • step B when the protein according to [1] is involved in metabolism of the test substance, the difference in metabolism of the test substance between the monkey and the mammal other than the monkey is The method according to [8] or [9], wherein the method is evaluated as being caused by a difference in species;
  • Step C for measuring the presence or absence of involvement of the drug, and if there is such involvement, the test results of metabolism, efficacy and Z or safety of the drug candidate compound using monkeys as model animals are as follows: A method for assessing metabolism, efficacy and Z or safety testing comprising the step D of predicting that the pharmaceutical compound differs from metabolism, efficacy and Z or safety in humans;
  • [13] A method for evaluating the feasibility of testing metabolism, drug efficacy and Z or safety of a human drug candidate compound using a monkey as a model animal, the method according to [1] A step of contacting the protein with the drug candidate compound, and a step F of measuring the degree of involvement of the protein according to [1] with respect to the authorization of the pharmaceutical compound. A negative evaluation of testing monkeys as model animals if
  • the protein according to the present invention is a monkey-specific drug-metabolizing enzyme that is expressed in old world monkeys such as power-cynomolgus monkeys, monkey monkeys, and African green monkeys, and in new world monkeys such as common marmoset.
  • old world monkeys such as power-cynomolgus monkeys, monkey monkeys, and African green monkeys
  • new world monkeys such as common marmoset.
  • the amino acid sequence of a novel CYP2C protein hereinafter referred to as “novel mfCYP2C” identified by Kino-Kisaruka et al. Is shown in SEQ ID NO: 2 (bottom of FIG. 1).
  • the inventors have found a novel mfCYP2C by the following method.
  • a clone with high homology to the human CYP gene was identified by screening a force-quizal liver cDNA library, and the nucleotide sequence of the cDNA was determined. This identified 21 force-cynomolgus CYP genes, including novel ones. Most of these CYP genes were found to have a homology of 94-95% with the corresponding human CYP gene and only one gene with a maximum of 79% homology with human CYP2C cDNA. This was designated as a new mfCYP2C.
  • the ability of the new mfCYP2C to be a monkey-specific gene In order to confirm whether human homologs have been identified so far, RT-PCR was performed using gene-specific primers, and others. The presence or absence of novel mfCYP2C in primates was investigated. As a result, the new mfCYP2C gene is present in all the measured Old World and New World monkeys, except primates except for humans, but not in humans or large apes such as chimpanzees and orangutans. It was confirmed. In addition, a blast search using the human and chimpanzee genome 'database did not reveal a novel CYP2C gene that showed 90% or more homology with mfCYP2C.
  • the protein of the present invention is monkey-specific. It was a result to support that.
  • the sample strength from each tissue was extracted from total RNA, and real-time RT-PCR was performed using a novel mfCYP2C gene-specific primer. The expression level of this gene was overwhelmingly large in the liver, and other CYP2C Was confirmed to be expressed in small amounts in the heart, muscle, brain, testis, etc., where it is not normally expressed.
  • the percentage of new mfCYP2C in the total CYP expressed in the force-cynomolgus liver calculated by dividing the number of copies of each CYP gene in the force-cynomolgus liver cDNA library by the number of copies of all CYP genes is 28.0%, which is very high, and the difference in the expression level between males and females was about twice.
  • a new mfCYP2C can be expressed and obtained by inserting a new mfCYP2C gene into an appropriate vector and transforming a host using this vector.
  • the present inventors have confirmed that the recombinant novel mfCYP2C protein strength thus obtained, Tolbutamide and testosterone, showed metabolic activity, but not taxol or S-mephenytoin. If a monkey-specific enzyme has metabolic activity for a certain drug, it is suggested that the metabolic pattern for the drug may differ between monkeys and humans.
  • the protein according to the present invention is a drug-metabolizing enzyme and has the same function as the protein consisting of the amino acid sequence shown in SEQ ID NO: 2, in the amino acid sequence shown in SEQ ID NO: 2, Several (for example, 1 to 10, preferably 1 to 5) amino acids may have substitutions, deletions, additions, and mutations such as Z or insertion. These mutations may be naturally occurring or artificially modified.
  • the drug-metabolizing enzyme means an enzyme that changes the chemical structure of a drug taken or administered from outside the body in vivo.
  • nucleic acid according to the present invention is a nucleic acid encoding the protein according to the present invention and is a force RNA that is DNA. As described above, it encodes a protein having an amino acid sequence in which a mutation such as substitution, deletion, addition and / or insertion of one or several amino acids has occurred in the amino acid sequence set forth in SEQ ID NO: 2. Such nucleic acids are also included in the present invention as long as the protein is a protein according to the present invention.
  • the novel mfCYP2C cDNA is shown in SEQ ID NO: 1 (upper part of FIG. 1), and the full length of the new mf CYP2C gene is shown in SEQ ID NO: 3.
  • nucleic acid according to the present invention is hybridized under stringent conditions with the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3, or a DNA sequence having a complementary nucleotide sequence to the partial DNA. It also includes monkey-derived nucleic acids that encode proteins that are drug-metabolizing enzymes.
  • the stringent conditions include, for example, 5% Denhardt's Solution (containing 0.1% Polycol 1 (Pharmacia), 0.1% polybutyrrolidone, 0.1% ushi serum albumin), 0.5% This refers to the conditions of washing at 65 ° C in 6X SSC solution containing SDS and 100 i ug / ml salmon sperm DNA (l X SSC is 0.15 M NaCl, 15 mM sodium citrate).
  • Stringency can be controlled by salt concentration (ionic strength), temperature, etc. Under conditions of higher stringency, i.e., conditions of lower salt concentration and higher temperature, only DNA with sufficiently high homology But no, it's going to give it.
  • a DNA that hybridizes under stringent conditions with a DNA sequence consisting of the base sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3 or a base sequence complementary to the DNA that is a part of the base sequence is encoded.
  • the amino acid sequence of the protein is considered to have high homology with the amino acid sequence set forth in SEQ ID NO: 2 and the same function.
  • Those skilled in the art can appropriately select stringent conditions by adjusting the temperature and salt concentration.
  • the origin of the protein and nucleic acid according to the present invention is not limited as long as it is understood that the protein and nucleic acid are included in the present invention by its amino acid sequence, base sequence and Z or function.
  • it is derived from power-old monkeys such as cynomolgus monkeys, monkey monkeys, and African green monkeys, and from new world monkeys such as common marmoset.
  • monkey means primates excluding large apes including old world monkeys, new world monkeys, and original monkeys.
  • the present invention also provides a vector into which the DNA according to the present invention is inserted.
  • the vector to be used is not particularly limited as long as it stably holds the inserted DNA.
  • plasmids derived from E. coli eg, pBR322, pBR325
  • Bacillus subtilis eg, pUB110, pTP5
  • yeast eg, pSH19, pSH15
  • E. coli is used as a host
  • pacteriophages such as ⁇ phage and M13 phage are often used.
  • viral DNAs such as SV40, papilloma virus, vaccinia virus, retrovirus, and baculovirus can be used as vectors.
  • a promoter sequence, an enhancer sequence, a Shine-Dalgarno sequence, a signal sequence, a poly A signal, etc. suitable for the host are appropriately selected so that the protein according to the present invention is efficiently expressed in the host, and the vector is used. Can be inserted.
  • the DNA of the present invention can be inserted into the vector by, for example, cleaving the vector with a restriction enzyme and ligating the DNA to the cleavage site by ligase reaction.
  • the present invention also includes a transformant transformed with the vector according to the present invention.
  • the transformant of the present invention can be obtained by selecting a host suitable for the vector into which the DNA of the present invention is inserted and introducing the vector into this host.
  • the host include Gram-negative bacteria such as E. coli and Pseudomonas aeruginosa, Gram-positive bacteria such as Bacillus subtilis, actinomycetes, yeast, filamentous fungi, animal and plant culture cells, and insect culture cells. preferable.
  • the salt-calcium calcium method is used as a method for introducing a vector.
  • the competent cell method When the host is Bacillus subtilis, the competent cell method, the lithium acetate method, Bacillus subtilis, actinomycetes, or yeast is used.
  • the protoplast method, methods widely used for animal and plant cells, yeast, bacteria, etc. should be selected as appropriate, such as calcium phosphate coprecipitation method, electopore position method, DEAE—a method of forming a complex with a polymer such as dextran or polypropylene. Can do. This can be done by using lipofectamine (Invitrogen) which forms a complex with the ribosome of the cationic lipid.
  • the present invention also includes a method for producing a protein, wherein the transformant is cultured to produce the protein according to the present invention.
  • the culture of the transformant can be selected according to the characteristics of the host cell, the characteristics of the expressed protein, the characteristics of the promoter, etc.
  • a known medium such as MEM medium, DMEM medium, Williams E medium (G3 ⁇ 4co) can be used.
  • MEM medium MEM medium
  • DMEM medium DMEM medium
  • Williams E medium G3 ⁇ 4co
  • IPTG is added to the medium. It can be added to induce expression.
  • the protein according to the present invention expressed by culturing the transformant thus obtained can be purified using a normal protein purification method, and depending on the expression system used, for example, various chromatography, It can be purified by a combination of external filtration, salting out, osmotic shock, and ultrasonic treatment.
  • chromatography method include ion exchange chromatography performed in an aqueous solution, gel filtration, hydrophobic chromatography, affinity chromatography, and reverse phase chromatography using an organic solvent.
  • the present invention also includes proteins purified using these purification methods.
  • the expressed protein can be modified or partially removed by using an appropriate protein modifying enzyme before or after purification, and these modified proteins are also included in the present invention. included.
  • protein modifying enzymes include trypsin, chymotrypsin, protein kinase dalcosidase, and the like. A person skilled in the art can easily change the expressed protein to a salt if it is released, or to a released state if it is obtained as a salt.
  • the present invention also provides an antibody that binds to the protein of the present invention or a partial peptide of the protein.
  • the antibody according to the present invention is a novel mfCYP2C protein, a protein functionally equivalent to the novel mfCYP2C (in the amino acid sequence described in SEQ ID NO: 2, one or several amino acids are substituted, deleted, added and / or A protein consisting of an inserted amino acid sequence and a protein that is a drug-metabolizing enzyme), or a polyclonal antibody that binds specifically to a partial peptide thereof, or a monoclonal antibody, .
  • humanized antibodies and antibodies obtained by genetic recombination are also specific for the protein according to the present invention or a partial peptide thereof. As long as they are combined, they are included in the present invention.
  • the antibody according to the present invention can be produced by a method known per se or a method analogous thereto, A typical method is illustrated below.
  • polyclonal antibodies immunize mammals, preferably primates such as rodents, maggots, monkeys such as mice and rats, using new mfCYP2C or its partial peptides, and obtain serum.
  • This serum can be obtained by purifying through a affinity column to which the novel mfCYP2C or a partial peptide thereof is immobilized.
  • Monoclonal antibodies can also be used to immunize mammals first, fuse antibody-producing cells obtained from these animals with highly proliferative myeloma cells, isolate individual fused cells, and test the ability to produce the desired antibodies.
  • cells can be produced by selecting cells that produce only one type of antibody molecule that specifically reacts with one epitope of the antigen, and culturing these cells.
  • a monoclonal antibody can also be obtained by a genetic engineering method by inserting a DNA encoding the amino acid sequence of a monoclonal antibody into a vector, introducing the vector into a host, and producing the vector.
  • Human antibodies can also be produced by immunizing a transgenic animal into which a human antibody gene has been introduced.
  • the antibody of the present invention may be a fragment or modified antibody as long as it specifically recognizes and binds to the protein or partial peptide of the present invention. Examples of antibody fragments include F (ab), F (ab ') 2, Fc fragments, and single chain Fv.Modified antibodies include, for example, antibodies bound to compounds such as polyethylene glycol. Is mentioned.
  • the antibody of the present invention can be used for purification, detection, and quantification of a novel mfCYP2C, and when it has an action of enhancing or suppressing the biological activity of the novel mfCYP2C, it is an agonist or antagonist. It can be.
  • the novel mfCYP2C according to the present invention is a monkey-specific protein
  • the metabolic patterns of monkeys and large apes differ for the compounds involved in the metabolism of the novel mfCYP2C. Probability is high. Therefore, before conducting a metabolic test, efficacy test, or safety test for a drug candidate compound, confirm whether the new mfCYP2C is involved in the metabolism of the candidate compound in vitro. Thus, it is possible to evaluate whether or not a monkey can be tested as a model animal.
  • the metabolism of the candidate compound in humans may be significantly different from that in monkeys, and it is not desirable to test monkeys as model animals. It is evaluated as a thing.
  • the novel mfCYP2C is not involved in the metabolism of the candidate compound, it is suggested that the candidate compound may be metabolized by another metabolic enzyme with high homology with humans. It is considered possible to estimate the metabolism in humans using the results of tests using monkeys as model animals.
  • a new mfCYP2C is a drug that has a different metabolic pattern in humans and monkeys. It is presumed that the possibility of being involved in metabolism is high. Therefore, the cause of this difference in metabolic patterns is assessed by contacting drugs with different metabolic patterns in humans and monkeys with new mfCYP2C, incubating under appropriate conditions, and measuring the involvement of new mfCYP2C in the drug metabolism. Is possible.
  • the test will be restrained by the test results using monkeys as model animals and the test will be continued and stopped quickly. It is possible.
  • the present invention further provides a kit containing a novel mfCYP2C, which is used for evaluation of metabolism, efficacy and Z or safety of a human drug candidate compound using a monkey as a model animal.
  • the profitable kit may contain reagents, containers, devices, etc. necessary for the new mfCYP2C to metabolize the substrate.
  • Such a kit can be used to estimate whether results similar to those obtained using a monkey as a model animal can be obtained in a human test, to investigate the cause of a test result that differs between a human and a monkey, Can be used to examine whether or not to test as a model animal.
  • Tissue samples consisted of 6 force-quizzed monkeys (3 males and 3 females), 2 akage monkeys (male), 2 Collected from Mon 'marmoset.
  • Orangutan and chimpanzee tissue samples were also prepared.
  • COS1 cells obtained from ATCC
  • H-marked G2 cells obtained from RIKEN
  • RNA extraction from cells and subsequent DNase I treatment were performed using the RNeasy Mini Kit (QIAGEN) according to the product instructions.
  • clones with high homology to human CYP were identified by screening a force-quizal liver cDNA library. For the identified clones, the entire length of the insert was amplified by PCR. PCR was performed in a total volume of 201 containing the following.
  • RV 5'-TGTGGGAGGTTTTTTCTCTA-3 '(SEQ ID NO: 5)
  • the obtained sequence data was imported into DNASIS Pro (Hitachi Software) for sequence analysis. After trimming the vector sequences, all data were visually inspected to remove regions with inadequate sequence quality before combining each sequence.
  • Homolone 1 ⁇ ⁇ 1 ⁇ ⁇ was performed by BLAS ⁇ program (National and enter for Biotechnology Information). In order to identify highly homologous CYP cDNA sequences, multiple alignments using Clustral W were performed on cDNA and amino acid sequences.
  • FIG. 2 shows the results of the multiple alignment of mfCYP2C9vl, mfCYP2C9v3 and new mfCYP2C, and mfCYP2C20, which is a known force-quizal CYP gene, among 21 CYPs of the force-quizal monkeys found by the inventors. From the top, m! CYP2C20 (SEQ ID NO: 6), mf CYP2C9vl (SEQ ID NO: 7), mfCYP2C9v3 (SEQ ID NO: 8), and new mfCYP2C (SEQ ID NO: 9).
  • CYP2C76 CYP2C43, and CYP2C75, respectively, by the Committee on Standarized P450 Nomenclature, and registered as accession numbers DQ074806, DQ074805, and DQ074807, respectively.
  • the nucleotide sequence of the novel m! CYP2C cDNA (SEQ ID NO: 1) is shown in FIG.
  • the new m! CYP2C cDNA has an open 'reading' frame with an amino acid power of 489, one residue less than all known human and monkey CYP2C.
  • the amino acid sequence deduced from the base sequence includes the N-terminus, which has a very high hydrophobicity, a heme binding region, six substrate recognition sites (Gotoh, (1992), J. Biol Chem 267: 83-90), and other It contained an amino acid sequence common to CYP2C molecules.
  • Bf search (UCSC Genome Bioinformatics) of mfCYP2C homologue was also performed on human and chimpanzee genomes.
  • CYP2C9vl and mfCYP2C9v3 showed about 92% homology to the amino acids of human CYP2C, which was at the same level as CYP2C20 and other known force-cynomolgus CYP2C genes.
  • the new mfCYP2C amino acid is only about 71% homologous to any human CYP2C amino acid, and there was no human cDNA showing any more homology in the GenBank database.
  • New mfCYP2C homologues from other species of monkeys were identified by RT-PCR using RNA samples derived from liver (rhesus monkey, common 'marmoset, orangutan and chimpanzee) or COS1 cells (African green monkey).
  • RT reaction was performed using M-MLV reverse transcriptase (Toyobo), 1 g of total RNA and oligo (dT) primer or random ply. For 1 hour at 37 ° C. The obtained RT product was diluted 25 times and subjected to PCR.
  • a commercially available liver RT product (BD Biosciences) was used.
  • the CYP2C homologue cDNAs of rhesus monkey, green monkey, and common marmoset were able to be amplified by primer pairs having the following base sequences, respectively.
  • RV mlCYP2C (3polyA2a) 5'— TGCCTAGACAGGTAGATAGGAGTG— 3' (SEQ ID NO: 11)
  • mfCYP2C 5ex2a) 5'- GTATTTTCTGGCCGAGGGAG-3 '(SEQ ID NO: 13)
  • RV mlCYP2C (3ex4a) 5'- ACAGGGAACACAACCCAGAA-3' (SEQ ID NO: 14)
  • Amplification was performed using KOD Plus DNA polymerase (Toyobo) Using the MJ Research thermal cycler (MJ Research), the first denaturation was performed at 95 ° C for 2 minutes, followed by 30 cycles of 95 ° C for 20 seconds, 55 ° C for 20 seconds, 72 ° C for 2 minutes, The final extension was 72 ° C for 10 minutes.
  • the PCR product was cloned into a vector using TOPO TA Cloning Kit (Invitrogen). Subsequently, using the ABI Prism BigDye Terminator v3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems), the base sequence analysis of the insert was performed, and the electricity was analyzed using the ABI PRISM 3730 DNA Analyzer (Applied Biosystems). Electrophoresis was performed.
  • FIGs. Figures 4 and 5 show the nucleotide sequence of the new m! CYP2C cDNA, respectively. From the top, force-cynomolgus monkey (SEQ ID NO: 15), lizard monkey (SEQ ID NO: 16), daffodil green monkey (SEQ ID NO: 17) and common marmoset (SEQ ID NO: 18).
  • Figure 6 shows the amino acid sequence of the novel mfCYP2C protein. From the top, force-cynomolgus (SEQ ID NO: 2), Rhesus monkey (SEQ ID NO: 19), African green monkey (SEQ ID NO: 20), and common marmoset (SEQ ID NO: 21). ).
  • PCR was denatured at 95 ° C for 2 minutes, and then cycled at 95 ° C for 20 seconds, 55 ° C for 30 seconds, and 72 ° C for 5 minutes 35 times for a final extension of 72. C20 minutes were done. Electrophoresis on 0.8% agarose gel After that, the PCR product was gel-purified, cloned into a vector using TOPO TA or XL cloning kit (Invitrogen) according to the product instructions, and sequenced.
  • RV M13RV 5 -CAGGAAACAGCTATGAC-3 '(SEQ ID NO: 39)
  • the novel mfCYP2C has a length of about 19.6 kb (SEQ ID NO: 3) and is a gene having 9 exons as in all human CYP2C (FIG. 7).
  • the sizes of exon and intron were 142-693bp and 937-4307bp, respectively.
  • most of the boundaries of the exon (lowercase) intron (uppercase) followed the GU-AC rule (bold), but in the 5 'splice site of intron 8, GU was replaced by GC.
  • BACPAC rhesus monkey BAC library
  • the probe is in the presence of [] 32 P-dCTP (Amersham Biosciences), and RadPrime DNA labeling system (Invitrogen) Was synthesized.
  • the identified BAC clone was obtained from BACPAC, and BAC DNA was purified using DNA PhasePrep TM BAC DNA Kit (Sigma-Aldrich).
  • DNA PhasePrep TM BAC DNA Kit Sigma-Aldrich
  • PCR was performed using olymerase (Applied Biosystems) and primers specific for the 5 'and 3' ends of each gene.
  • Primer pairs were designed in exons 1 and 9 of each gene, and the position was determined by comparing macaque cDNA with the human CYP2C gene. High homology! With CYP2C9vl and CYP2C9 v3, the designed primers did not show gene-specific amplification patterns. Therefore, we searched the macaque genome data to identify gene-specific indels of these genes, and designed primers that recognize these indels (insertion / deletion).
  • the primers used are shown in Table 4. According to the method of Gray et al. (Gray IC et al., Genomics, (1995) 28: 328-332), the arrangement of CYP2C genes in the genome was determined using the amplification pattern. For the same purpose, DNA was also used for BAC end sequencing and restriction enzyme mapping with BamHI or EcoRI according to BACPAC instructions.
  • RNA from brain, lung, heart, liver, kidney, adrenal gland, jejunum, testis, ovary and uterus was performed.
  • the probe was labeled with FAM fluorescence reporter dye at the 5 ′ end.
  • the RT reaction was performed using random primers, and the resulting reaction product was diluted 25-fold and subjected to PCR.
  • PCR was performed using Aq Prism 7700 sequence detection system (Applied Biosystems) using TaqMan Universal PCR Master Mix (Applied Biosystems) in a total volume of 25 ⁇ l.
  • the final concentration of each primer was 0.3 ⁇ M for CYP2C20 and CYP2C9vl, 0.9 ⁇ for CYP2C9v3, and 0.1 ⁇ for new m! CYP2C.
  • the final probe concentration was 0.25 ⁇ ⁇ ⁇ ⁇ ⁇ for all CYP2C.
  • the conditions for the thermal cycler were 50 ° C for 2 minutes, 95 ° C for 10 minutes, 95 ° C for 15 seconds, and 60 ° C for 1 minute for 40 cycles.
  • the 5 'flanking region was identified by Inverse PCR. The method will be described below. First, 1 ⁇ g of genomic DNA derived from each force-cynomolgus monkey was digested at 37 ° C in the presence of Pstl. This product was extracted and purified with a solvent of phenol: chloroform (1: 1), followed by ethanol precipitation. The obtained DNA was self-ligated at 16 ° C. using Ligation high (Toyobo) and then purified by the same method. The purified DNA was subjected to PCR together with two primers shown below based on KOD plus DNA polymerase (Toyobo) and the 5 'end of the novel mfCYP2C cDNA sequence.
  • Toyobo KOD plus DNA polymerase
  • FW mfCYP2C (5inv3) 5'-TCCTCTCCCCGTTATTGGAA-3 '(SEQ ID NO: 88)
  • RV mlCYP2C (3inv2) 5'- CACCAGGATGATGAAGAGATCC-3' (SEQ ID NO: 8)
  • the amplified DNA was gel purified on a 1% agarose gel and then sequenced using m! CYP2C (5inv3) to determine the base sequence at the end of the 5 ′ flanking region. Two primers were further designed based on this sequence.
  • RV mlCYP2C (3flklaH) 5'— CCCAAGCTTGCTGGGCTCTTTGAAAAC— 3 ′ (SEQ ID NO: 91)
  • PCR was performed as described above, and the PCR product was cloned into pGL3-basic vector (Promega). After determining the base sequence of the full length of the insert, a regulatory element search using TRANS FAC was performed on the determined sequence, and the construct was used for reporter assembly.
  • HepG2 cells were purchased from RIKEN, Dulbecco's modified Eagle's Medium (Nissui Pharmaceutical Co., Ltd.), 10% urine fetal serum (Cambrex Bioscience Walkersville), non-essential amino acids (ICN) The cells were cultured in a medium supplemented with ImM sodium pyruvate (Invitrogen) at 37 ° C with 5% CO. 2 x 10 5 on 12 well plate
  • the cells were incubated for 24 hours.
  • HNF1a HNF3 ⁇ and HNF4a, which are the major transcription factors of the liver, were selected as necessary.
  • each protein was expressed according to the method of Iwata et al. (Iwata, H. et al., Biochem Pharmacol (1998) 55: 1315-1325).
  • each cDNA's open reading frame (ORF) is amplified by using the primers shown in Table 6 and KOD Plus DNA polymerase (Toyobo).
  • KOD Plus DNA polymerase Toyobo
  • MALLLAVF MALLLAVF, which is the N-terminal 8 residues of ushi CYP17 (Barnes, HJ et al., Proc Natl Acad Sci USA (1991) 88: 5597-5601).
  • the pCW vector (Barnes, HJ., Methods Enzymol (1996) 272) can be used to co-express PCR products with Iwata et al. : 3) Cloned directly to the vector prepared based on 14).
  • Nocteria was cultured in Luria-bertani broth containing 100 g / ml ampicillin and then prepared according to the method of Iwata et al. (1998). After diluting 100 times with Terrific Broth, the cells were cultured in the presence of 200 ⁇ g / ml ampicillin at 30 ° C for 6 to 12 hours until the OD was about 0.6 to 0.8.
  • IPTG isopropyl-BD-thiogalatatoside
  • the cultured cells were collected and a cell membrane fraction was prepared. Then, the concentrations of P450 and NAPDH-P450 reductase were measured according to the method of Iwata et al. (1998).
  • CYP2C proteins All of the recombinant CYP2C proteins were used to analyze the metabolic activities of novel m! CYP2C, CYP2C20, CYP2C9vl, and CYP2C9v3 against four substrates, taxol, tolbutamide, S-methylentoin and testosterone.
  • the reaction mixture was prepared as follows. First, “C-taxol (6 ⁇ M),” C-tolbutamide (1 00 ⁇ M) ⁇ 14 C— testosterone (50 ⁇ M) ⁇ “C—S—mephenytoin (50 ⁇ M), monkey liver microzoa Or purified recombinant CYP2C was prepared in a tube and incubated for 5 minutes at 37 ° C.
  • Taxol and testosterone are incubated at 37 ° for 15 minutes, 3 ⁇ 4—mephenytoin is incubated for 45 minutes, tolbu tamide is incubated for 60 minutes, and after 60 minutes of incubation, an equal amount of methanol is added to react. Stopped. In the case of recombinant m! CYP2C protein, Bastion was 30 minutes. After completion of the reaction, the sample was centrifuged, and each aliquot was evaporated to dryness and the residue was dissolved in 15 ⁇ l of methanol.
  • the developing solvent was dichloromethane acetone (4: 1, v / v), and 16 cm was developed.
  • nydroxytolbutamide can be obtained according to the method of Ludwig et al. (Ludwig, E. et al., J Chromatogr B Biomed Sci Appl (1998) 707: 347-350) and the developing solvent is toluene acetone-formic acid (60: 39: l, v / v / v) and expanded 10 cm.
  • the TLC plate was dried and allowed to stand for 12 hours in contact with phosphor imaging plate (IP). Changes in the amount of compounds and metabolites were measured using BAS-2500 (Fuji Film). The Rf values for radioactive metabolites were clearly identified compared to unlabeled standards. The results are shown in FIG. Lane 1 is monkey liver microsome, lane 2 is CYP2C20, lane 3 is CYP2C9vl, lane 4 is CYP2C9v3, and lane 5 is new mfCYP2C.
  • the new m! CYP2C is able to metabolize tolbutamide and testosterone out of four substrates.
  • mfCYP2C20 has the ability to metabolize taxol and has no metabolic activity against other compounds. It was also confirmed that m! LYP2 and 9v3iitolbutamiae, 3 ⁇ 4-mephenytoin, testosterone, and mlCYP2C9vl metabolize S-mephenytoin and testosterone.
  • the new m! CYP2C, mfCYP2C9vl, and mfCYP2C9v3 all showed metabolic activity using testosterone as a substrate, but the metabolites were not identical.
  • Neo MPS San Diego, Calif.
  • the synthesized peptide was purified, bound to Keyhol Limpet Hemocyanin (carrier protein) via the thiol group of the C-terminal cysteine residue, and immunized with New Zealand White Rabbit to obtain a rabbit anti-new mfCYP2C antibody (Fig. 15). ).
  • CYP2C antibody (1: 250) and a donkey anti-usagi IgG antibody conjugated to horseradish peroxidase (SantaCruz Biotechnology) 7 lines. The effect of the mouth of the product is not visible. [Visualization with ECL Western Blotting detection reagent (Amersham Biosciences)] Only when the antibody (A) is used, only the band strength corresponding to the new mfC YP2C (CYP2C76) is obtained. And immunospecificity was confirmed (Fig. 16 (A)) 0
  • Immunohistochemical staining with anti-novel mfCYP2C antibody was performed using a section of force-cynomolgus liver according to standard methods.
  • the primary antibody was diluted 50-fold, brought into contact with the section and left at 4 ° C.
  • the bound antibody was detected using EnVision + System and liquid diaminobenzidine (both from DakoCytomation) according to the product instructions. Slides were control stained with harr is hematoxylin. Usagi preimmune serum was used in place of the primary antibody as a negative control.
  • the antibody was pre-cured at 4 ° C with an excess of novel m!
  • CYP2C-specific peptide (0.05 mg / ml) and used in place of the primary antibody. did. As a result, hepatocytes were strongly stained, and the 1S bile duct and vascular cells were not stained. No staining was seen in the presence of blocking peptide or preimmune serum (Figure 17), suggesting that the staining is specific for the novel mfCYP2C.
  • FIG. 1 The upper part of FIG. 1 shows the base sequence of the novel mfCYP2C cDNA (SEQ ID NO: 1), and the lower part shows the amino acid sequence of the novel m! CYP2C protein (SEQ ID NO: 2).
  • the region surrounded by the frame is the region estimated to be a hem coupling region.
  • the extension (281 bases) of the transcript variant with a long 3 'non-translated region is underlined by alternative polyadenylation.
  • the amino acid sequence drawn with a broken line is the sequence of the peptide used to produce the anti-new mfCYP2C antibody.
  • the cDNA is 1666 bases long and contains an open 'reading' frame of 489 amino acid residues.
  • FIG. 2 Multiple alignment of amino acid sequences of four monkey CYP2C proteins. From the top, the amino acid sequences of CYP2C20 (SEQ ID NO: 11), mfCYP2C9vl (SEQ ID NO: 12), mfCYP2C9v3 (SEQ ID NO: 13), and novel mfCYP2C (SEQ ID NO: 14) are shown.
  • the new m! CYP2 C has 489 amino acid residues and is one residue shorter than other monkey CYP2C and human CYP2C proteins.
  • FIG.3 Amino acid sequences of CYP2C in chick (c), chick Kh), pig (pig), inu (dog), rabbit (rab), mouse), force-quizal (mf), rat (r) It is a molecular evolutionary phylogenetic tree drawn using. The sequence of the new m! CYP2C was shown to be more similar to that of other animal species than humans.
  • FIG.4 Multiple alignment of new m! CYP2C homolog cDNAs in other monkeys is there. From the top, the base sequences of cDNAs of Riki quizal (part of SEQ ID NO: 1), monkey (SEQ ID NO: 15), African monkey (SEQ ID NO: 16), and common 'marmoset (SEQ ID NO: 17) are shown. . Due to the species differences, only the akage monkey was able to completely amplify the coding region, and exon 1-4 and exon 2-4 were amplified for African green monkey and common 'marmoset, respectively. Among the species, only a few residues differed, and close to 100% showed homology.
  • FIG. 5 is a continuation of FIG. 15 and shows multiple alignment of cDNA of a novel mfCYP2C homolog in other monkeys.
  • FIG. 6 Multiple alignment of amino acid sequences of proteins of a novel m! CYP2C homolog in other monkeys. From the top, the amino acid sequence of a new m! CYP2C protein homologue of force-quizal (SEQ ID NO: 2), akage monkey (SEQ ID NO: 18), African green monkey (SEQ ID NO: 19), common marmoset (SEQ ID NO: 20) Indicates.
  • FIG. 7 A novel mfCYP2C exon-intron structure determined by long-distance PCR using gene-specific primers designed on each exon and analyzing the sequence of all introns. The new m! CYP2C gene was confirmed to contain 9 exons, similar to the human CYP2C gene.
  • FIG. 8 shows the PCR amplification pattern of CYP2C BAC clones, restriction enzyme mapping, and the structure of the monkey CYP2C gene determined by end sequencing.
  • CYP2C9vl and CYP2C9v3 are drawn in a tentative order because they have the power to determine positions on the genome that are highly homologous to each other.
  • the new monkey-specific mf CYP2C (denoted CYP2C76 in the figure) is a force located at the end of the CYP2C cluster. This position is the region between genes in the corresponding region of the human genome.
  • Broken lines indicate BAC clones that did not undergo clear amplification.
  • FIG. 9 shows the tissue distribution of monkey CYP2C gene expression.
  • Real-time RT-PCR was performed using total RNA from 10 tissue samples.
  • the new mfCYP2C (CYP2C76) with the highest expression in the liver was most prominent.
  • FIG. 10 shows the results of measuring the difference in the expression level of new m! CYP2C in males and females. Male expression was approximately twice that of females.
  • FIG. 11 DNA binding elements for major liver-specific transcription factors (HNF1 a, HNF3 ⁇ , HNF4 a) identified by the TRNASFAC program (threshold score ⁇ 75.0). The position of each element is calculated with the transfer start point as zero.
  • FIG. 12 The 5 ′ flanking region of about 1 kb was analyzed by luciferase assay. Atsei performed using the pGL-lkb construct in HepG2 cells and added transcription factors as needed. All factors, Tokuko HNF1a, markedly enhanced the expression of novel mfCYP2C.
  • FIG. 13 CO-differentience spectra confirming the expression of recombinant novel m! CYP2C protein in E. coli. A peak peculiar to P450 protein (450 nm) can be confirmed.
  • FIG. 14 shows the metabolic activity of monkey CYP2C expressed in E. coli.
  • Lanes 1-5 show monkey liver microsomes, CYP2C20, CYP2C9vl, CYP2C9v3, and new mfCYP2C, respectively.
  • FIG. 15 shows an antibody prepared by immunizing a rabbit with a synthetic peptide having the amino acid sequence shown in FIG. Figure 25A shows the peptide H-CQLNTKNISKSISMLA-NH (SEQ ID NO: 29).
  • Fig. B shows the peptide H-CLYNAFPHLRVL-NH (SEQ ID NO: 30) as the antigen.
  • FIG. 16 shows the results of immunoblotting using A.anti-new mfCYP2C antibody.
  • Eight types of monkey and human P450 were electrophoresed and then transferred to PVDF filters to bind anti-new m! CYP2C antibody. Only the new m! CYP2C (CYP2C76) band could be detected.
  • B. A novel mfCYP2C homologue in liver microsomes of multiple animals was searched for in the same manner as A. The PDI protein as a control was the force detected in all samples. The novel m! CYP2C protein was detected only in the force-quizal and the keystone.
  • FIG. 17 shows the results of immunohistochemical staining of novel m! CYP2C protein in the liver.
  • A shows immunostaining with an anti-new mfCYP2C antibody
  • B shows the results of pretreatment with peptide blocking
  • C shows the results of preimmune staining. Strong and staining were confirmed in hepatocytes, but not in bile duct (arrow) and vein (triangle) epithelial cells.
  • B) and (C) hardly stained.
  • the solid scale shows 100 m.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Toxicology (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

L'invention concerne une nouvelle enzyme de métabolisation de médicaments, spécifique au singe, et un gène codant pour elle. L'invention concerne également un procédé pour évaluer la fiabilité ou la sécurité d'un test de métabolisme ou similaire en utilisant le singe en tant qu'animal modèle, avec l'utilisation de la nouvelle enzyme de métabolisation de médicaments: (a) une protéine comprenant une séquence d'acides aminés représentée par SEQ ID NO: 2 ou (b) une protéine qui est une enzyme de métabolisation de médicaments et qui comprend une séquence d'acides aminés dans laquelle un ou plusieurs résidus d'acides aminés ont été remplacés, supprimés, ajoutés et/ou insérés dans la séquence d'acides aminés représentées par SEQ ID NO: 2, et un acide nucléique les codant. En outre, l'invention concerne un procédé pour évaluer un test de métabolisme ou similaire utilisant le singe en tant qu'animal modèle, qui utilise la protéine conformément à l'invention.
PCT/JP2006/300623 2005-01-18 2006-01-18 Nouvelle enzyme de metabolisation de medicaments et acide nucleique codant pour elle WO2006077873A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2006553924A JP4972413B2 (ja) 2005-01-18 2006-01-18 サルの新規薬物代謝酵素、およびそれをコードする核酸

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
JP2005010996 2005-01-18
JP2005-010996 2005-01-18
JP2005-311249 2005-10-26
JP2005311249 2005-10-26
JP2005340133 2005-11-25
JP2005-340133 2005-11-25

Publications (1)

Publication Number Publication Date
WO2006077873A1 true WO2006077873A1 (fr) 2006-07-27

Family

ID=36692262

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2006/300623 WO2006077873A1 (fr) 2005-01-18 2006-01-18 Nouvelle enzyme de metabolisation de medicaments et acide nucleique codant pour elle

Country Status (2)

Country Link
JP (1) JP4972413B2 (fr)
WO (1) WO2006077873A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2012055274A (ja) * 2010-09-10 2012-03-22 Shin Nippon Biomedical Laboratories Ltd サルの新規薬物代謝酵素
JP2014158478A (ja) * 2014-03-28 2014-09-04 Shin Nippon Biomedical Laboratories Ltd サルの新規薬物代謝酵素
JP2014158479A (ja) * 2014-03-28 2014-09-04 Shin Nippon Biomedical Laboratories Ltd サルの新規薬物代謝酵素

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002053775A2 (fr) * 2000-12-28 2002-07-11 Epidauros Biotechnologie Ag Identification des determinants genetiques de l'expression polymorphe de cyp3a5
WO2002066635A1 (fr) * 2001-02-23 2002-08-29 Gencom Corporation Animal transgenique possedant un gene du metabolisme des medicaments et utilisation correspondante

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002053775A2 (fr) * 2000-12-28 2002-07-11 Epidauros Biotechnologie Ag Identification des determinants genetiques de l'expression polymorphe de cyp3a5
WO2002066635A1 (fr) * 2001-02-23 2002-08-29 Gencom Corporation Animal transgenique possedant un gene du metabolisme des medicaments et utilisation correspondante

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
IGARASHI T. ET AL.: "Marmoset liver cytochrome P450s: study for expression and molecular cloning of their cDNAs", ARCH. BIOCHEM. BIOPHYS., vol. 339, no. 1, 1997, pages 85 - 91, XP004500189 *
WEAVER R.J. ET AL.: "A comparison of basal and induced hepatic microsomal cytochrome P450 monooxygenase activities in the cynomolgus monkey (Macaca fascicularis) and man", XEOBIOTICA, vol. 29, no. 5, 1999, pages 467 - 482, XP002998005 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2012055274A (ja) * 2010-09-10 2012-03-22 Shin Nippon Biomedical Laboratories Ltd サルの新規薬物代謝酵素
JP2014158478A (ja) * 2014-03-28 2014-09-04 Shin Nippon Biomedical Laboratories Ltd サルの新規薬物代謝酵素
JP2014158479A (ja) * 2014-03-28 2014-09-04 Shin Nippon Biomedical Laboratories Ltd サルの新規薬物代謝酵素

Also Published As

Publication number Publication date
JPWO2006077873A1 (ja) 2008-06-19
JP4972413B2 (ja) 2012-07-11

Similar Documents

Publication Publication Date Title
Kanigicherla et al. Anti-PLA2R antibodies measured by ELISA predict long-term outcome in a prevalent population of patients with idiopathic membranous nephropathy
US11035003B2 (en) TRPC6 involved in glomerulonephritis
BROWN et al. Cloning and production of antisera to human placental 11 β-hydroxysteroid dehydrogenase type 2
JP7458785B2 (ja) ヒドロキシステロイド１７－βデヒドロゲナーゼ１３（ＨＳＤ１７Ｂ１３）バリアント及びその使用
Stanley et al. Immunochemical detection of arylamine N-acetyltransferase in normal and neoplastic bladder.
CA2437021A1 (fr) Proteine associee a l'adiponectine
Mubiru et al. Alternative spliced variants of the alpha-methylacyl-CoA racemase gene and their expression in prostate cancer
JP4972413B2 (ja) サルの新規薬物代謝酵素、およびそれをコードする核酸
US20060088828A1 (en) Polycystic kidney disease nucleic acids and proteins
EP1854881B1 (fr) PROCEDES D'IDENTIFICATION D'UN GENE Corl2 CIBLANT LES CELLULES DE PURKINJE
US20090053723A1 (en) Peripherin and Neurofilament Light Protein Splice Variants in Amyotrophic Lateral Sclerosis (ALS)
Liu et al. PRRSV infection facilitates the shedding of soluble CD163 to induce inflammatory responses
JP5063117B2 (ja) サル薬物代謝酵素をコードする遺伝子の多型、およびその利用
US8323916B2 (en) Method of detecting endometrial cancer comprising measuring levels of fibrocystin-L
JP5782544B2 (ja) サルの新規薬物代謝酵素
WO2012029722A1 (fr) Procédé de criblage
JP2014158479A (ja) サルの新規薬物代謝酵素
JP2012055274A (ja) サルの新規薬物代謝酵素
ITRM950434A1 (it) Polipeptide per la riparazione di informazione genetica, sequenza nucleotidica che codifica per esso e procedimento per la sua
US9200262B2 (en) Method for the diagnosis of the presence of an ovarian cancer
CN114317730A (zh) Ttpal作为胃癌监测或预后判断标志物的应用
JP2006512075A (ja) イヌｃｙｐ１ａ２配列
JP2004331570A (ja) 乳房の疾患、障害または状態の診断、予防、治療および予後のための方法、組成物およびシステム
PENG et al. ALTERNATIVELY SPLICED hBRF VARIANTS FUNCTION AT DIFFERENT RNA POLYMERASE III PROMOTERS
WO2006122214A2 (fr) Nouvelle 5-alpha-steroide-reductase

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2006553924

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06711892

Country of ref document: EP

Kind code of ref document: A1

WWW Wipo information: withdrawn in national office

Ref document number: 6711892

Country of ref document: EP