WO2006077873A1

WO2006077873A1 - Novel drug metabolizing enzyme in monkey and nucleic acid encoding the same

Info

Publication number: WO2006077873A1
Application number: PCT/JP2006/300623
Authority: WO
Inventors: Yasuhiro Uno; Ryoichi Nagata; Go Kito
Original assignee: Shin Nippon Biomedical Laboratories, Ltd.
Priority date: 2005-01-18
Filing date: 2006-01-18
Publication date: 2006-07-27
Also published as: JP4972413B2; JPWO2006077873A1

Abstract

It is intended to provide a novel drug metabolizing enzyme specific for a monkey and a gene encoding the same. It is also intended to provide a method of evaluating reliability or safety of a metabolism test or the like using a monkey as a model animal with the use of the novel drug metabolizing enzyme. (a) A protein comprising an amino acid sequence represented by SEQ ID NO: 2 or (b) a protein being a drug metabolizing enzyme and comprising an amino acid sequence in which one or several amino acid residues are replaced, deleted added and/or inserted in the amino acid sequence represented by SEQ ID NO: 2; and a nucleic acid encoding the same are provided. Further, a method of evaluating a metabolism test or the like using a monkey as a model animal with the use of the protein according to the invention is provided.

Description

Novel drug metabolizing enzyme of monkey and nucleic acid encoding it

Technical field

[0001] The present invention relates to a novel drug-metabolizing enzyme specifically possessed by monkeys, a nucleic acid encoding the same, and a method for evaluating a preclinical test using monkeys as model animals using the novel drug-metabolizing enzyme. Background art

[0002] Conventionally, in the process of new drug development, since the pattern of metabolism is very similar to that of humans, pharmacokinetic tests, drug effects tests, safety tests, etc. including metabolic tests using monkeys as model animals have been widely conducted. It has been broken. Recently, however, it has been reported that for some drugs, monkey metabolic patterns may differ from human metabolic patterns (Non-Patent Documents 1 to 4).

An enzyme called cytochrome P450 (CYP) is deeply involved in drug metabolism. CYP forms a gene family, and humans have been reported to have more than 50 CYP genes so far, and other mammals are known to have many CYP genes. CYP is a heme protein coordinated with iron ions. The structure of each CYP is very similar, but the substrate and metabolic activity are different.

CYPs are classified based on amino acid sequence homology, and each CYP is a family name (number), subfamily name (alphabet), proper name (number), for example “CYP1A 1”. It is specified by notation.

In addition to the different substrates of each CYP, recently, it has been reported that the metabolic activity and substrate specificity differ for each CYP gene polymorphism (for example, JP 2004-4; Patent Document 1). Studies on the molecular species and polymorphisms of CYP are underway as one of the causes of individual differences, gender differences, age differences, species differences, and racial differences in the development of toxicity.

In general, a compound that is metabolized by CYP molecular species with large individual differences is considered undesirable as a drug with a high possibility of different drug efficacy and side effects from person to person. When developing such compounds as pharmaceuticals, the molecular species of the candidate In advance, only candidates with specific polymorphisms, such as polymorphisms that have a medicinal effect or polymorphisms that are unlikely to cause side effects, are excluded, and candidates that have polymorphisms that are likely to cause side effects are excluded. It is necessary to take measures such as

Patent Document 1: Japanese Patent Laid-Open No. 2004-4

Non-patent literature l: Nartimatsu S. et al., Chem Biol Interact (2000) 127: 73-90 Non-patent literature 2: Sharer JE. Et al., Drug Metab Dispos (1995) 23: 1231-1241 Non-patent literature 3 : Stevens JC. Et al., Drg Metab Dispos (1993) 21: 753-760

Non-Patent Document 4: Weaver RJ. Et al., Xenobiotica (1999) 29: 467-482

Disclosure of the invention

Problems to be solved by the invention

When conducting metabolic studies using model animals, the significance of the test results can be evaluated more accurately and effectively by taking into account differences between human CYPs and model animal CYPs, and polymorphisms between model animals. It is thought that it can be utilized. For example, if the metabolic pattern differs significantly between humans and force-quizal monkeys, and there are drug candidates that produce significant side effects in force-quisal monkeys, the difference in metabolic patterns may be due to differences in CYP between humans and force-quizal monkeys. If it can be confirmed that the same side effects do not occur in humans, it may be possible to continue and promote development as a human drug without wastefully stopping the development of the compound. There is.

As described above, since the metabolic pattern of force-cynomolgus monkeys is very similar to that of humans, the activity of drug metabolizing enzymes was considered to be almost the same as that of humans. However, six types of CYP cDNA have been reported to GenBank and have not been reported to GenBank, and little is known about differences in substrate with human CYP and between individual monkeys. There wasn't.

On the other hand, it has been clarified that there are actually drugs with different metabolic patterns between humans and power-quizal.

Therefore, an object of the present invention is to find a monkey-specific drug-metabolizing enzyme and a gene encoding it that are not found in mammals other than monkeys.

Furthermore, the present invention measures the metabolic activity of a drug by the monkey-specific drug metabolizing enzyme described above. The purpose of this study is to provide a method for accurately evaluating the results of pharmacokinetic studies using monkeys as model animals and using them effectively.

Means for solving the problem

The present inventors have conducted research to solve the above-mentioned problems and screened a cDNA library having a relatively high homology with the human CYP gene by screening a power-cynomolgus liver cDNA library! As a result of the determination of the full-length nucleotide sequence, 21 CYPs were successfully detected. In addition, it was found that the CYP2C gene, which is less homologous to human genes than other CYP genes, is included in this, and this gene is expressed in Old World and New World monkeys including force-cynomolgus monkeys. It was confirmed that expression was not observed in large apes including humans.

Furthermore, a novel CYP2C protein was expressed using E. coli, and it was clarified that there is a difference in metabolic activity against certain drugs between human CYP2C and other CYP2Cs of force-quizals, and the present invention was completed. It came to do.

That is, the present invention

[1] The following protein (a) or (b):

(a) a protein having the amino acid sequence ability described in SEQ ID NO: 2,

(b) a protein which is a drug-metabolizing enzyme having an amino acid sequence ability in which one or several amino acids are substituted, deleted, added and Z or inserted in the amino acid sequence of SEQ ID NO: 2;

[2] a nucleic acid encoding the protein according to [1];

[3] DNA having the nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 3, or the nucleotide sequence complementary to the nucleotide sequence described in SEQ ID NO: 1 or SEQ ID NO: 3 or a partial DNA thereof Monkey-derived DNA that encodes a protein that is a drug-metabolizing enzyme that is hybridized under stringent conditions with powerful DNA sequences;

[4] A recombinant vector comprising the DNA according to [3];

[5] A transformant comprising the recombinant vector according to [4];

[6] The method for producing the protein according to [1], wherein the transformant according to [5] is cultured, and the protein according to [1] is purified from the culture; [7] an antibody against the protein according to [1];

[8] Step A in which the protein according to [1] and the test substance are brought into contact with each other when the metabolism of the test substance is different between a monkey and a mammal other than the monkey, and the metabolism of the test substance A method for evaluating a cause of a difference in metabolism of the test substance, which comprises the step B of measuring the presence or absence of involvement of the protein according to the above [1];

[9] The method according to [8], wherein the protein according to [1] used in the step A is produced by the protein production method according to [7];

[10] In the step B, when the protein according to [1] is involved in metabolism of the test substance, the difference in metabolism of the test substance between the monkey and the mammal other than the monkey is The method according to [8] or [9], wherein the method is evaluated as being caused by a difference in species;

[11] The protein according to [1] with respect to metabolism of the drug candidate compound when testing metabolism, drug efficacy and Z or safety of the drug candidate compound for humans using monkeys as model animals. Step C for measuring the presence or absence of involvement of the drug, and if there is such involvement, the test results of metabolism, efficacy and Z or safety of the drug candidate compound using monkeys as model animals are as follows: A method for assessing metabolism, efficacy and Z or safety testing comprising the step D of predicting that the pharmaceutical compound differs from metabolism, efficacy and Z or safety in humans;

[12] The method according to [11], wherein the step C force is performed in vitro;

[13] A method for evaluating the feasibility of testing metabolism, drug efficacy and Z or safety of a human drug candidate compound using a monkey as a model animal, the method according to [1] A step of contacting the protein with the drug candidate compound, and a step F of measuring the degree of involvement of the protein according to [1] with respect to the authorization of the pharmaceutical compound. A negative evaluation of testing monkeys as model animals if

[14] A kit containing the protein according to [1], which is used for evaluation of metabolism, efficacy and Z or safety of a human drug candidate compound using monkeys as model animals, It is about. The invention's effect

[0005] Since the protein and gene according to the present invention exist specifically in monkeys, whether the metabolic activity is unique to monkeys by measuring the influence of the protein on the metabolic activity of a drug. It is possible to predict what is common to other animals such as humans. Based on this prediction, it is possible to evaluate the pros and cons of using monkeys as model animals for metabolic tests of certain drugs.

BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, embodiments of the present invention will be described in detail.

The protein according to the present invention is a monkey-specific drug-metabolizing enzyme that is expressed in old world monkeys such as power-cynomolgus monkeys, monkey monkeys, and African green monkeys, and in new world monkeys such as common marmoset. The amino acid sequence of a novel CYP2C protein (hereinafter referred to as “novel mfCYP2C”) identified by Kino-Kisaruka et al. Is shown in SEQ ID NO: 2 (bottom of FIG. 1).

The inventors have found a novel mfCYP2C by the following method.

First, a clone with high homology to the human CYP gene was identified by screening a force-quizal liver cDNA library, and the nucleotide sequence of the cDNA was determined. This identified 21 force-cynomolgus CYP genes, including novel ones. Most of these CYP genes were found to have a homology of 94-95% with the corresponding human CYP gene and only one gene with a maximum of 79% homology with human CYP2C cDNA. This was designated as a new mfCYP2C.

The ability of the new mfCYP2C to be a monkey-specific gene In order to confirm whether human homologs have been identified so far, RT-PCR was performed using gene-specific primers, and others. The presence or absence of novel mfCYP2C in primates was investigated. As a result, the new mfCYP2C gene is present in all the measured Old World and New World monkeys, except primates except for humans, but not in humans or large apes such as chimpanzees and orangutans. It was confirmed. In addition, a blast search using the human and chimpanzee genome 'database did not reveal a novel CYP2C gene that showed 90% or more homology with mfCYP2C. This also indicates that the protein of the present invention is monkey-specific. It was a result to support that. In addition, the sample strength from each tissue was extracted from total RNA, and real-time RT-PCR was performed using a novel mfCYP2C gene-specific primer. The expression level of this gene was overwhelmingly large in the liver, and other CYP2C Was confirmed to be expressed in small amounts in the heart, muscle, brain, testis, etc., where it is not normally expressed.

Furthermore, the percentage of new mfCYP2C in the total CYP expressed in the force-cynomolgus liver calculated by dividing the number of copies of each CYP gene in the force-cynomolgus liver cDNA library by the number of copies of all CYP genes is 28.0%, which is very high, and the difference in the expression level between males and females was about twice.

A new mfCYP2C can be expressed and obtained by inserting a new mfCYP2C gene into an appropriate vector and transforming a host using this vector.

The present inventors have confirmed that the recombinant novel mfCYP2C protein strength thus obtained, Tolbutamide and testosterone, showed metabolic activity, but not taxol or S-mephenytoin. If a monkey-specific enzyme has metabolic activity for a certain drug, it is suggested that the metabolic pattern for the drug may differ between monkeys and humans.

As long as the protein according to the present invention is a drug-metabolizing enzyme and has the same function as the protein consisting of the amino acid sequence shown in SEQ ID NO: 2, in the amino acid sequence shown in SEQ ID NO: 2, Several (for example, 1 to 10, preferably 1 to 5) amino acids may have substitutions, deletions, additions, and mutations such as Z or insertion. These mutations may be naturally occurring or artificially modified.

Here, the drug-metabolizing enzyme means an enzyme that changes the chemical structure of a drug taken or administered from outside the body in vivo.

It does not matter whether the nucleic acid according to the present invention is a nucleic acid encoding the protein according to the present invention and is a force RNA that is DNA. As described above, it encodes a protein having an amino acid sequence in which a mutation such as substitution, deletion, addition and / or insertion of one or several amino acids has occurred in the amino acid sequence set forth in SEQ ID NO: 2. Such nucleic acids are also included in the present invention as long as the protein is a protein according to the present invention. As an example of such a nucleic acid, the novel mfCYP2C cDNA is shown in SEQ ID NO: 1 (upper part of FIG. 1), and the full length of the new mf CYP2C gene is shown in SEQ ID NO: 3.

In addition, the nucleic acid according to the present invention is hybridized under stringent conditions with the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3, or a DNA sequence having a complementary nucleotide sequence to the partial DNA. It also includes monkey-derived nucleic acids that encode proteins that are drug-metabolizing enzymes. A nucleic acid that hybridizes under stringent conditions with a DNA sequence that also has a base sequence ability complementary to the base sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3 or a part thereof, is SEQ ID NO: 1 or It is considered that a protein encoded with high homology with the base sequence described in SEQ ID NO: 3 is likely to have the same function. The stringent conditions include, for example, 5% Denhardt's Solution (containing 0.1% Polycol 1 (Pharmacia), 0.1% polybutyrrolidone, 0.1% ushi serum albumin), 0.5% This refers to the conditions of washing at 65 ° C in 6X SSC solution containing SDS and 100 _i ug / ml salmon sperm DNA (l X SSC is 0.15 M NaCl, 15 mM sodium citrate). Stringency can be controlled by salt concentration (ionic strength), temperature, etc. Under conditions of higher stringency, i.e., conditions of lower salt concentration and higher temperature, only DNA with sufficiently high homology But no, it's going to give it. Accordingly, a DNA that hybridizes under stringent conditions with a DNA sequence consisting of the base sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3 or a base sequence complementary to the DNA that is a part of the base sequence is encoded. The amino acid sequence of the protein is considered to have high homology with the amino acid sequence set forth in SEQ ID NO: 2 and the same function. Those skilled in the art can appropriately select stringent conditions by adjusting the temperature and salt concentration.

[0008] The origin of the protein and nucleic acid according to the present invention is not limited as long as it is understood that the protein and nucleic acid are included in the present invention by its amino acid sequence, base sequence and Z or function. Preferably, it is derived from power-old monkeys such as cynomolgus monkeys, monkey monkeys, and African green monkeys, and from new world monkeys such as common marmoset.

In the present specification, “monkey” means primates excluding large apes including old world monkeys, new world monkeys, and original monkeys.

[0009] The present invention also provides a vector into which the DNA according to the present invention is inserted. In the present invention The vector to be used is not particularly limited as long as it stably holds the inserted DNA. For example, plasmids derived from E. coli (eg, pBR322, pBR325), plasmids derived from Bacillus subtilis (eg, pUB110, pTP5), Examples include plasmids derived from yeast (eg, pSH19, pSH15). When E. coli is used as a host, pacteriophages such as λ phage and M13 phage are often used. When animal cells are used as hosts, viral DNAs such as SV40, papilloma virus, vaccinia virus, retrovirus, and baculovirus can be used as vectors.

Furthermore, a promoter sequence, an enhancer sequence, a Shine-Dalgarno sequence, a signal sequence, a poly A signal, etc. suitable for the host are appropriately selected so that the protein according to the present invention is efficiently expressed in the host, and the vector is used. Can be inserted.

The DNA of the present invention can be inserted into the vector by, for example, cleaving the vector with a restriction enzyme and ligating the DNA to the cleavage site by ligase reaction.

[0010] The present invention also includes a transformant transformed with the vector according to the present invention. The transformant of the present invention can be obtained by selecting a host suitable for the vector into which the DNA of the present invention is inserted and introducing the vector into this host. Examples of the host include Gram-negative bacteria such as E. coli and Pseudomonas aeruginosa, Gram-positive bacteria such as Bacillus subtilis, actinomycetes, yeast, filamentous fungi, animal and plant culture cells, and insect culture cells. preferable. As a method for introducing a vector, when the host is Escherichia coli, the salt-calcium calcium method is used. When the host is Bacillus subtilis, the competent cell method, the lithium acetate method, Bacillus subtilis, actinomycetes, or yeast is used. The protoplast method, methods widely used for animal and plant cells, yeast, bacteria, etc. should be selected as appropriate, such as calcium phosphate coprecipitation method, electopore position method, DEAE—a method of forming a complex with a polymer such as dextran or polypropylene. Can do. This can be done by using lipofectamine (Invitrogen) which forms a complex with the ribosome of the cationic lipid.

[0011] The present invention also includes a method for producing a protein, wherein the transformant is cultured to produce the protein according to the present invention. The culture of the transformant can be selected according to the characteristics of the host cell, the characteristics of the expressed protein, the characteristics of the promoter, etc. For example, a known medium such as MEM medium, DMEM medium, Williams E medium (G¾co) can be used. For example, when a plasmid having antibiotic resistance is used, the expression of the target protein can be regulated by adding the antibiotic to the medium, and when a ratatose-dependent plasmid is used, IPTG is added to the medium. It can be added to induce expression.

The protein according to the present invention expressed by culturing the transformant thus obtained can be purified using a normal protein purification method, and depending on the expression system used, for example, various chromatography, It can be purified by a combination of external filtration, salting out, osmotic shock, and ultrasonic treatment. Examples of the chromatography method include ion exchange chromatography performed in an aqueous solution, gel filtration, hydrophobic chromatography, affinity chromatography, and reverse phase chromatography using an organic solvent.

. The present invention also includes proteins purified using these purification methods.

In addition, the expressed protein can be modified or partially removed by using an appropriate protein modifying enzyme before or after purification, and these modified proteins are also included in the present invention. included. Examples of protein modifying enzymes include trypsin, chymotrypsin, protein kinase dalcosidase, and the like. A person skilled in the art can easily change the expressed protein to a salt if it is released, or to a released state if it is obtained as a salt.

The present invention also provides an antibody that binds to the protein of the present invention or a partial peptide of the protein. The antibody according to the present invention is a novel mfCYP2C protein, a protein functionally equivalent to the novel mfCYP2C (in the amino acid sequence described in SEQ ID NO: 2, one or several amino acids are substituted, deleted, added and / or A protein consisting of an inserted amino acid sequence and a protein that is a drug-metabolizing enzyme), or a polyclonal antibody that binds specifically to a partial peptide thereof, or a monoclonal antibody, . In addition to antibodies obtained by immunizing mammals other than humans with this protein, humanized antibodies and antibodies obtained by genetic recombination are also specific for the protein according to the present invention or a partial peptide thereof. As long as they are combined, they are included in the present invention. The antibody according to the present invention can be produced by a method known per se or a method analogous thereto, A typical method is illustrated below.

First, polyclonal antibodies immunize mammals, preferably primates such as rodents, maggots, monkeys such as mice and rats, using new mfCYP2C or its partial peptides, and obtain serum. This serum can be obtained by purifying through a affinity column to which the novel mfCYP2C or a partial peptide thereof is immobilized.

Monoclonal antibodies can also be used to immunize mammals first, fuse antibody-producing cells obtained from these animals with highly proliferative myeloma cells, isolate individual fused cells, and test the ability to produce the desired antibodies. Thus, cells can be produced by selecting cells that produce only one type of antibody molecule that specifically reacts with one epitope of the antigen, and culturing these cells. A monoclonal antibody can also be obtained by a genetic engineering method by inserting a DNA encoding the amino acid sequence of a monoclonal antibody into a vector, introducing the vector into a host, and producing the vector. Human antibodies can also be produced by immunizing a transgenic animal into which a human antibody gene has been introduced. A cDNA encoding the antigen-binding site of a mouse monoclonal antibody and a gene encoding the constant region of a human IgG gene. It is also possible to produce chimeric antibody molecules by linking them and introducing them into B lymphocytes, and these antibodies are also included in the present invention. The antibody of the present invention may be a fragment or modified antibody as long as it specifically recognizes and binds to the protein or partial peptide of the present invention. Examples of antibody fragments include F (ab), F (ab ') 2, Fc fragments, and single chain Fv.Modified antibodies include, for example, antibodies bound to compounds such as polyethylene glycol. Is mentioned. The antibody of the present invention can be used for purification, detection, and quantification of a novel mfCYP2C, and when it has an action of enhancing or suppressing the biological activity of the novel mfCYP2C, it is an agonist or antagonist. It can be.

As described above, since the novel mfCYP2C according to the present invention is a monkey-specific protein, the metabolic patterns of monkeys and large apes (humans, chimpanzees, orangutans, etc.) differ for the compounds involved in the metabolism of the novel mfCYP2C. Probability is high. Therefore, before conducting a metabolic test, efficacy test, or safety test for a drug candidate compound, confirm whether the new mfCYP2C is involved in the metabolism of the candidate compound in vitro. Thus, it is possible to evaluate whether or not a monkey can be tested as a model animal. For example, if the new mfCYP2C is deeply involved in metabolism, it is suggested that the metabolism of the candidate compound in humans may be significantly different from that in monkeys, and it is not desirable to test monkeys as model animals. It is evaluated as a thing. On the other hand, if the novel mfCYP2C is not involved in the metabolism of the candidate compound, it is suggested that the candidate compound may be metabolized by another metabolic enzyme with high homology with humans. It is considered possible to estimate the metabolism in humans using the results of tests using monkeys as model animals.

By using the new mfCYP2C in this way, it is possible to eliminate unnecessary tests and speed up the tests.

[0014] Furthermore, since no monkey CYP gene with low homology with human CYP has been found so far than new mfCYP2C, a new mfCYP2C is a drug that has a different metabolic pattern in humans and monkeys. It is presumed that the possibility of being involved in metabolism is high. Therefore, the cause of this difference in metabolic patterns is assessed by contacting drugs with different metabolic patterns in humans and monkeys with new mfCYP2C, incubating under appropriate conditions, and measuring the involvement of new mfCYP2C in the drug metabolism. Is possible.

If it is found that the difference in metabolic pattern is due to the new mfCYP2C by such a method, the test will be restrained by the test results using monkeys as model animals and the test will be continued and stopped quickly. It is possible.

[0015] The present invention further provides a kit containing a novel mfCYP2C, which is used for evaluation of metabolism, efficacy and Z or safety of a human drug candidate compound using a monkey as a model animal. To do. The profitable kit may contain reagents, containers, devices, etc. necessary for the new mfCYP2C to metabolize the substrate. Such a kit can be used to estimate whether results similar to those obtained using a monkey as a model animal can be obtained in a human test, to investigate the cause of a test result that differs between a human and a monkey, Can be used to examine whether or not to test as a model animal.

Example

[0016] [Tissue sample preparation and RNA extraction]

Tissue samples consisted of 6 force-quizzed monkeys (3 males and 3 females), 2 akage monkeys (male), 2 Collected from Mon 'marmoset.

Orangutan and chimpanzee tissue samples were also prepared.

In order to prevent RNA degradation, all samples were frozen with liquid nitrogen immediately after collection, and ground with a mortar and pestle in the presence of liquid nitrogen to form a powder.

Subsequently, using Polytron PT1200E (Kinematica), the powdered tissue was homogenized in TRIzol (Invitrogen), and the total RNA was extracted according to the product instructions. The integrity was confirmed. The extracted total RNA was treated with DNase I (Takara) and then purified with GenElute Mammalian Total RNA Mini Kit (Sigma-Aldrich).

On the other hand, COS1 cells (obtained from ATCC) as samples of African green monkeys and H-marked G2 cells (obtained from RIKEN) as samples of human hepatocytes (Saito et al. , J Biol Chem, (2001) 276: 38010-38022). RNA extraction from cells and subsequent DNase I treatment were performed using the RNeasy Mini Kit (QIAGEN) according to the product instructions.

[Strength-quizal CYP2C cDNA isolation]

First, clones with high homology to human CYP were identified by screening a force-quizal liver cDNA library. For the identified clones, the entire length of the insert was amplified by PCR. PCR was performed in a total volume of 201 containing the following.

'Primers (0.4 M each)

FW: 5, -TCAGTGGATGTTGCCTTTAC-3 '(SEQ ID NO: 4)

RV: 5'-TGTGGGAGGTTTTTTCTCTA-3 '(SEQ ID NO: 5)

· ΆΝΤΡ (0.22 ^ Μ)

MgCl (2mM)

2

Ampli faq uold Taq polymerase (Applied Biosystems 1 unit)

As the reaction conditions, after the first denaturation was performed at 95 ° C for 10 minutes, a cycle of 95 ° C for 20 seconds, 55 ° C for 20 seconds and 72 ° C for 3 minutes was repeated 35 times, and the final extension was 72 ° C for 10 minutes.

After analysis on a 1% agarose gel, the PCR product is purified, ABI Prism BigDye Terrain ator νό.Ο Ready Reaction ycle Sequencing Kit (Applied Biosystems) After being used for sequence analysis, electrophoresis was performed using ABI-3730 DNA Analyzer (Applied Biosystems).

Homoto column analysis)

The obtained sequence data was imported into DNASIS Pro (Hitachi Software) for sequence analysis. After trimming the vector sequences, all data were visually inspected to remove regions with inadequate sequence quality before combining each sequence.

Homolone ¹ ~~ · ¹ ~ ~ was performed by BLAS Γ program (National and enter for Biotechnology Information). In order to identify highly homologous CYP cDNA sequences, multiple alignments using Clustral W were performed on cDNA and amino acid sequences.

FIG. 2 shows the results of the multiple alignment of mfCYP2C9vl, mfCYP2C9v3 and new mfCYP2C, and mfCYP2C20, which is a known force-quizal CYP gene, among 21 CYPs of the force-quizal monkeys found by the inventors. From the top, m! CYP2C20 (SEQ ID NO: 6), mf CYP2C9vl (SEQ ID NO: 7), mfCYP2C9v3 (SEQ ID NO: 8), and new mfCYP2C (SEQ ID NO: 9).

The new mfCYP2C, mfCYP2C9vl, and m! CYP2C9v3 were named CYP2C76, CYP2C43, and CYP2C75, respectively, by the Committee on Standarized P450 Nomenclature, and registered as accession numbers DQ074806, DQ074805, and DQ074807, respectively.

The nucleotide sequence of the novel m! CYP2C cDNA (SEQ ID NO: 1) is shown in FIG.

The new m! CYP2C cDNA has an open 'reading' frame with an amino acid power of 489, one residue less than all known human and monkey CYP2C. The amino acid sequence deduced from the base sequence includes the N-terminus, which has a very high hydrophobicity, a heme binding region, six substrate recognition sites (Gotoh, (1992), J. Biol Chem 267: 83-90), and other It contained an amino acid sequence common to CYP2C molecules.

Using the cDNA sequence, Bf search (UCSC Genome Bioinformatics) of mfCYP2C homologue was also performed on human and chimpanzee genomes.

The results of the homology search are shown in Table 1.

[table 1]

m! CYP2C9vl and mfCYP2C9v3 showed about 92% homology to the amino acids of human CYP2C, which was at the same level as CYP2C20 and other known force-cynomolgus CYP2C genes.

However, the new mfCYP2C amino acid is only about 71% homologous to any human CYP2C amino acid, and there was no human cDNA showing any more homology in the GenBank database.

The base sequence results were also used to draw molecular evolution lines using PHYLIP with default 'parameters. Figure 3 shows the molecular evolution line. As a result, it was found that the new mfCYP2C (CYP2C76) belongs to a distant clade from all human CYP2C and other force-cynomolgus CYP2C.

[Cloning of cDNA corresponding to novel mfCYP2C in other primates]

Therefore, in order to confirm whether the gene exists specifically in the new mfCYP2C-powered monkey or whether a human homologue has been found in the past, it was necessary to use RT with several gene-specific primers. -PCR was performed to determine the presence of the novel mfCYP2C orthologus gene in other primates.

New mfCYP2C homologues from other species of monkeys were identified by RT-PCR using RNA samples derived from liver (rhesus monkey, common 'marmoset, orangutan and chimpanzee) or COS1 cells (African green monkey). RT reaction was performed using M-MLV reverse transcriptase (Toyobo), 1 g of total RNA and oligo (dT) primer or random ply. For 1 hour at 37 ° C. The obtained RT product was diluted 25 times and subjected to PCR. For humans, a commercially available liver RT product (BD Biosciences) was used. When several primer pairs were tested, the CYP2C homologue cDNAs of rhesus monkey, green monkey, and common marmoset were able to be amplified by primer pairs having the following base sequences, respectively.

Akagezanole

FW: mfCYP2C (5rt2) 5 and CCCAGCAATGGATCTCTTCA-3 '(SEQ ID NO: 10) RV: mlCYP2C (3polyA2a) 5'— TGCCTAGACAGGTAGATAGGAGTG— 3' (SEQ ID NO: 11)

African green monkey

FW: mfCYP2C (5rt2) 5 and CCCAGCAATGGATCTCTTCA-3 '(SEQ ID NO: 10) RV: mlCYP2C (3ex4b) 5' -GAAAAGTGGGATC AC AGGGA-3 '(SEQ ID NO: 12) Common marmoset

FW: mfCYP2C (5ex2a) 5'- GTATTTTCTGGCCGAGGGAG-3 '(SEQ ID NO: 13) RV: mlCYP2C (3ex4a) 5'- ACAGGGAACACAACCCAGAA-3' (SEQ ID NO: 14) Amplification was performed using KOD Plus DNA polymerase (Toyobo) Using the MJ Research thermal cycler (MJ Research), the first denaturation was performed at 95 ° C for 2 minutes, followed by 30 cycles of 95 ° C for 20 seconds, 55 ° C for 20 seconds, 72 ° C for 2 minutes, The final extension was 72 ° C for 10 minutes.

After adding 3'A-overhang, the PCR product was cloned into a vector using TOPO TA Cloning Kit (Invitrogen). Subsequently, using the ABI Prism BigDye Terminator v3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems), the base sequence analysis of the insert was performed, and the electricity was analyzed using the ABI PRISM 3730 DNA Analyzer (Applied Biosystems). Electrophoresis was performed.

As a result, amplification products were found in Old World monkeys (Power-Cyrus monkeys, Rhesus monkeys, African green monkeys) and New World monkeys (Common 'marmoset), and these monkeys have new mfCYP2C homologues that are % Homology was confirmed. This result shows that these monkeys are evolutionary phylogenetic close and species.

The results are shown in Figs. Figures 4 and 5 show the nucleotide sequence of the new m! CYP2C cDNA, respectively. From the top, force-cynomolgus monkey (SEQ ID NO: 15), lizard monkey (SEQ ID NO: 16), daffodil green monkey (SEQ ID NO: 17) and common marmoset (SEQ ID NO: 18). Figure 6 shows the amino acid sequence of the novel mfCYP2C protein. From the top, force-cynomolgus (SEQ ID NO: 2), Rhesus monkey (SEQ ID NO: 19), African green monkey (SEQ ID NO: 20), and common marmoset (SEQ ID NO: 21). ).

On the other hand, and human, sample force from great apes such as chimpanzees and orangutans also did not give detectable band (data not shown) ₀ Furthermore, in the genome 'Database searches of the human and chimpanzee by Blast, the new MfCYP2C 90 Since no genes with a homology of more than% were found, the new m! CYP2C was shown to be monkey-specific.

[New m! CYP2C gene structure]

To determine the structure of exons and introns, compare the nucleotide sequences of four mlCYP2C (miCYP2C9vl, mfC YP2C9v3, CYP2C20 and new m! CYP2C) cDNAs and design gene-specific primers on each exon. The intron was amplified by long PCR. For PCR, LA Taq PCR kit (Takara) was used, 5p mole forward and reverse primers (Table 2), 0.5mM dNTP ゝ 2mM MgCl, 1 unit LA Taq polymerase.

2

(Takara Co., Ltd.) was used for a total amount of 20 μ1.

[Table 2]

¾JIJH3 <is j¾id ssn SJU SO A SUOJn XIUd 3UIisds¾0sbsso S3ul3-

PJ Θ3.19ΛJ5AJO

s-(, ε,) s (--9) t f ¾3us9nCT9 eolfcnl

oe) KdAi (¾eeE

0ΟDimensionε) 3ΛΙΛ * e0i () 3dAge χθΕes

(9g) 02dAyecjex

½)

3UV¾W-! UVUUS

PCR was denatured at 95 ° C for 2 minutes, and then cycled at 95 ° C for 20 seconds, 55 ° C for 30 seconds, and 72 ° C for 5 minutes 35 times for a final extension of 72. C20 minutes were done. Electrophoresis on 0.8% agarose gel After that, the PCR product was gel-purified, cloned into a vector using TOPO TA or XL cloning kit (Invitrogen) according to the product instructions, and sequenced.

Sequence analysis was performed according to the method described above, and for initial sequencing, the following M13 forward and reverse primers were used.

Primer

FW: M13FW 5 -GTAAAACGACGGCCAG-3 '(SEQ ID NO: 38)

RV: M13RV 5 -CAGGAAACAGCTATGAC-3 '(SEQ ID NO: 39)

The base sequences of all introns were completely determined by the primer walking method, and the sequences were integrated into the full length of each intron from DNASIS Pro (Hitachi Software).

As a result, it was confirmed that the novel mfCYP2C has a length of about 19.6 kb (SEQ ID NO: 3) and is a gene having 9 exons as in all human CYP2C (FIG. 7). The sizes of exon and intron were 142-693bp and 937-4307bp, respectively. As shown in Table 3, most of the boundaries of the exon (lowercase) intron (uppercase) followed the GU-AC rule (bold), but in the 5 'splice site of intron 8, GU was replaced by GC.

[Table 3]

l≤ UOX uou L '' c c ί ί '' -u

o ao o

S dimension in

D

w w

Wi

5 ¥: L.1SV 44-Wef> @

6219- 卜 οε dimension

ρυβΡΒϋ,-

10 卜

air ajr ajr

Three

ο C οto οm co- c to go ooo SS

ΛΙ

[Genomic structure of the monkey CYP2C locus]

To confirm the species specificity of the new m! CYP2C, we analyzed the novel m! CYP2C locus in the genome using monkey CYP2C BAC clones. Force-quizal BAC library Lee was not available, so we used the Rhesus monkey BAC library instead. The rhesus monkey BAC library (BACPAC) was screened using CYP2C9v3 and a novel mfCYP2C cDNA as probes, and a BAC clone containing CYP2C was isolated. Hybridization with the library ~ · filter is performed according to the instructions of BACPAC. The probe is in the presence of [] ³² P-dCTP (Amersham Biosciences), and RadPrime DNA labeling system (Invitrogen) Was synthesized. The identified BAC clone was obtained from BACPAC, and BAC DNA was purified using DNA PhasePrep ™ BAC DNA Kit (Sigma-Aldrich). To identify the CYP2C gene contained in each BAC DNA, use AmpliTaq Gold DNA p

PCR was performed using olymerase (Applied Biosystems) and primers specific for the 5 'and 3' ends of each gene.

Primer pairs were designed in exons 1 and 9 of each gene, and the position was determined by comparing macaque cDNA with the human CYP2C gene. High homology! With CYP2C9vl and CYP2C9 v3, the designed primers did not show gene-specific amplification patterns. Therefore, we searched the macaque genome data to identify gene-specific indels of these genes, and designed primers that recognize these indels (insertion / deletion).

The primers used are shown in Table 4. According to the method of Gray et al. (Gray IC et al., Genomics, (1995) 28: 328-332), the arrangement of CYP2C genes in the genome was determined using the amplification pattern. For the same purpose, DNA was also used for BAC end sequencing and restriction enzyme mapping with BamHI or EcoRI according to BACPAC instructions.

[Table 4]

() s ¾5usben †

P-3SJ3> Jeyvsl

-g & leg) 賺 &-leg αο I 1) ¾ΗυϋisΗ l

(Keiichi) iichi:

co 9 卜 s / k

-ε & eevSivss! -v VSDW-v (1) uuwuisi si ivslcluushl-u-l-size--.

In the course of this experiment, the sequence of a part of the genome of the monkey monkey was clarified, and it was found that there was a gene having a very high homology with the base sequence of the human CYP2C1 gene. There Thus, a primer specific to this CYP2C18-like gene was designed and used to amplify the BAC clone.

From the amplification pattern of each gene, it was found that five CYP2C genes exist in one cluster in the monkey genome (Fig. 8). In addition, BAC end sequencing and restriction enzyme mapping confirmed that the new mfCYP2C (represented by CYP2C76 in the figure) is located at the end of the cluster, ie, the region between the CYP2C cluster and the adjacent gene in the human genome. It was. This result strongly supports the existence of a novel m! CYP2C gene in a species-specific manner.

[Tissue distribution analysis of gene expression]

Real-time RT using RNA from brain, lung, heart, liver, kidney, adrenal gland, jejunum, testis, ovary and uterus to determine tissue distribution of new m! CYP2C, CYP2C20, CYP2C9vl, and CYP2C9v3 gene expression -PCR was performed.

Primers specific to each gene and TaqMan (registered trademark) MGB probe were prepared by Primer Express sftware (Applied Biosystems) and synthesized by Applied Biosystems. Shown in 5.

[Table 5]

Gene Direction Sequence (5 → 3 ')

CYP2C20 Forward TTTCTGGAAGAGGCATTTTGC (SEQ ID NO: 76)

Reverse TCCATCTCTTTCCATTGCTGG (SEQ ID NO: 77)

Probe AACGGACTTGGAATCA (SEQ ID NO: 78)

CYP2C43 Forward GCCATTTCCCACTGTTTGAAA (SEQ ID NO: 79)

Reverse GCAGCGTCATGAGGGAGAA (SEQ ID NO: 80)

Probe ACAATTCCAAATCTTCT (SEQ ID NO: 81)

CYP2C75 Forward TTCCATTGGCTGACAGAGCTAA (SEQ ID NO: 82)

Reverse CCGCAGTGTCATGAGGGAA (SEQ ID NO: 83)

Probe CGATTCCAAATCCT (SEQ ID NO: 84)

CYP2C76 Forward TGGCCGAGGGAGTTTTCC (SEQ ID NO: 85)

Reverse AGAGAGAAACGC CGAAT T GC (SEQ ID NO: 86)

Probe CCAAGGATTCGGAGTTA (SEQ ID NO: 87)

The probe was labeled with FAM fluorescence reporter dye at the 5 ′ end. The RT reaction was performed using random primers, and the resulting reaction product was diluted 25-fold and subjected to PCR. PCR was performed using Aq Prism 7700 sequence detection system (Applied Biosystems) using TaqMan Universal PCR Master Mix (Applied Biosystems) in a total volume of 25 μl. The final concentration of each primer was 0.3 μM for CYP2C20 and CYP2C9vl, 0.9 μΜ for CYP2C9v3, and 0.1 μΜ for new m! CYP2C. The final probe concentration was 0.25 μ プローブ for all CYP2C. The conditions for the thermal cycler were 50 ° C for 2 minutes, 95 ° C for 10 minutes, 95 ° C for 15 seconds, and 60 ° C for 1 minute for 40 cycles.

For all CYP2C genes, Atsy's specificity can be confirmed by confirming that the desired PCR product of the expected size appears on the gel as a single band, and that the target gene cDNA plasmid strength against other CYP2C genes. This was done by making sure that it was amplified at least 500 times. The relative expression level of each gene was standardized by measuring 18S ribosomal RNA levels using a kit manufactured by Applied Byiosystems. At least three amplifications were performed for each gene. The results are shown in FIG. New mfCYP2C (represented by CYP2C76 in the figure) and liver expression were overwhelmingly numerous, but expression was also observed in other tissues. Furthermore, additional analysis shows that new mfCYP2C is expressed in various tissues that do not normally express P450, such as the heart, muscle, and brain, and that there is a difference in the expression level between males and females by about a factor of two. Was observed (Figure 10). [Construction and sequence analysis of a reporter plasmid for a novel m! CYP2C gene]

The 5 'flanking region was identified by Inverse PCR. The method will be described below. First, 1 μg of genomic DNA derived from each force-cynomolgus monkey was digested at 37 ° C in the presence of Pstl. This product was extracted and purified with a solvent of phenol: chloroform (1: 1), followed by ethanol precipitation. The obtained DNA was self-ligated at 16 ° C. using Ligation high (Toyobo) and then purified by the same method. The purified DNA was subjected to PCR together with two primers shown below based on KOD plus DNA polymerase (Toyobo) and the 5 'end of the novel mfCYP2C cDNA sequence.

Primer

FW: mfCYP2C (5inv3) 5'-TCCTCTCCCCGTTATTGGAA-3 '(SEQ ID NO: 88) RV: mlCYP2C (3inv2) 5'- CACCAGGATGATGAAGAGATCC-3' (SEQ ID NO: 8)

9)

The amplified DNA was gel purified on a 1% agarose gel and then sequenced using m! CYP2C (5inv3) to determine the base sequence at the end of the 5 ′ flanking region. Two primers were further designed based on this sequence.

Primer

FW: mfCYP2C (5flklaK) 5 and CGGGGTACCGCAGGCCAACATTCAAATTC— 3 '(SEQ ID NO: 90)

RV: mlCYP2C (3flklaH) 5'— CCCAAGCTTGCTGGGCTCTTTGAAAAC— 3 ′ (SEQ ID NO: 91)

PCR was performed as described above, and the PCR product was cloned into pGL3-basic vector (Promega). After determining the base sequence of the full length of the insert, a regulatory element search using TRANS FAC was performed on the determined sequence, and the construct was used for reporter assembly.

Analysis by the TRANSFAC program found binding sites for major liver transcription factors. (Threshold score≥75.0) (Figure 11). The location of each binding site is indicated with the transcription initiation site as zero.

[Reporter assembly of the 5 'flanking region of the novel m! CYP2C gene]

HepG2 cells were purchased from RIKEN, Dulbecco's modified Eagle's Medium (Nissui Pharmaceutical Co., Ltd.), 10% urine fetal serum (Cambrex Bioscience Walkersville), non-essential amino acids (ICN) The cells were cultured in a medium supplemented with ImM sodium pyruvate (Invitrogen) at 37 ° C with 5% CO. 2 x 10 ⁵ on 12 well plate

2

After inoculating the cells / well, the cells were incubated for 24 hours.

These cells were then transformed with a reporter construct (0.45 g), pRL-SV40 (0.05 g; Promega; internal standard) (using FuGENE6 (Roche Diagnostics)). During the assembly, the overexpression vectors of HNF1a, HNF3β and HNF4a, which are the major transcription factors of the liver, were selected as necessary.

After 48 hours, these cells are washed with phosphate buffered saline and subjected to X aual-luciferase assay (Promega) according to the product instructions.

The results are shown in FIG.

All transcription factors markedly enhanced the expression of the novel mfCYP2C, with HNF1a being the most effective. These results indicate that these transcription factors play important functions in regulating the expression of the novel mfCYP2C gene. In addition, in the tissue analyzed by the new mfCYP2C force RT-PCR, it is consistent with the result that the expression was very high in the liver.

[Expression of four monkey CYP2C proteins in E. coli]

Using the new m! CYP2C, mfCYP2C9vl, mfCYP2c9v3 and CYP2C20 cDNAs, each protein was expressed according to the method of Iwata et al. (Iwata, H. et al., Biochem Pharmacol (1998) 55: 1315-1325). . To increase the level of protein expression, each cDNA's open reading frame (ORF) is amplified by using the primers shown in Table 6 and KOD Plus DNA polymerase (Toyobo). Were replaced with MALLLAVF, which is the N-terminal 8 residues of ushi CYP17 (Barnes, HJ et al., Proc Natl Acad Sci USA (1991) 88: 5597-5601).

[Table 6]

By using forward and reverse primers containing an Ndel recognition site and an Xbal recognition site, respectively, the pCW vector (Barnes, HJ., Methods Enzymol (1996) 272) can be used to co-express PCR products with Iwata et al. : 3) Cloned directly to the vector prepared based on 14). We have used this construct for each cDNA. Due to their origin, they were named pCW-CYP2C20 / OR, pCW-mfCYP2C9vl / OR, pCW-m! CYP2C9v2 / OR, and pCW-new m! CYP2C / OR.

After transformation of DH5 a competent cells (Invitrogen), the nucleotide sequence and orientation of the insert were confirmed by sequencing. Nocteria was cultured in Luria-bertani broth containing 100 g / ml ampicillin and then prepared according to the method of Iwata et al. (1998). After diluting 100 times with Terrific Broth, the cells were cultured in the presence of 200 µg / ml ampicillin at 30 ° C for 6 to 12 hours until the OD was about 0.6 to 0.8.

600

Subsequently, isopropyl-BD-thiogalatatoside (IPTG) was added to the culture solution to a final concentration of 1.5 mM. After 16 to 20 hours, according to known methods (Omura, T. et al, J Biol Chem (1964) 239: 2379-2385), using a U-3000 spectrophotometer (Shimadzu), P450 of the culture The spectrum was determined. The results are shown in FIG.

After confirming the expression of P450, the cultured cells were collected and a cell membrane fraction was prepared. Then, the concentrations of P450 and NAPDH-P450 reductase were measured according to the method of Iwata et al. (1998).

[Metabolic activity of four monkeys CYP2C]

All of the recombinant CYP2C proteins were used to analyze the metabolic activities of novel m! CYP2C, CYP2C20, CYP2C9vl, and CYP2C9v3 against four substrates, taxol, tolbutamide, S-methylentoin and testosterone.

The reaction mixture was prepared as follows. First, “C-taxol (6 μM),” C-tolbutamide (1 00 μM) ゝ¹⁴ C— testosterone (50 μM) ゝ “C—S—mephenytoin (50 μM), monkey liver microzoa Or purified recombinant CYP2C was prepared in a tube and incubated for 5 minutes at 37 ° C. Subsequently, 1.3 mM NADP +, 3.3 mM Darcos- A NADPH regeneration system containing 100 mM sodium phosphate buffer in which 6-phosphate, 0.4 U / ml glucose-6-phosphate dehydrogenase, and 3.3 mM magnesium chloride was dissolved was added, and the final concentration was lmg protein. / mL, or 200 pmol P450 / mL.

Taxol and testosterone are incubated at 37 ° for 15 minutes, ¾—mephenytoin is incubated for 45 minutes, tolbu tamide is incubated for 60 minutes, and after 60 minutes of incubation, an equal amount of methanol is added to react. Stopped. In the case of recombinant m! CYP2C protein, Bastion was 30 minutes. After completion of the reaction, the sample was centrifuged, and each aliquot was evaporated to dryness and the residue was dissolved in 15 μl of methanol.

6 α-hydroxytaxol and 3-hydroxytaxol were analyzed according to the method of Fujino et al. (Fujino, H. et al., J Chromatogr B Biomed Sci Appl (2001) 757: 143-150). 2 μl of each supernatant is spotted onto a TLC plate (Silicagel 60F254, 20x20 cm, Merck), and with a developing solvent (toluene-acetone-formic acid (60: 39: l, v / _V / v)) Expanded 12cm into a horizontal TLC tank saturated with steam.

In the case of 6 β-hydroxytestosterone, the developing solvent was dichloromethane acetone (4: 1, v / v), and 16 cm was developed.

4— nydroxytolbutamide can be obtained according to the method of Ludwig et al. (Ludwig, E. et al., J Chromatogr B Biomed Sci Appl (1998) 707: 347-350) and the developing solvent is toluene acetone-formic acid (60: 39: l, v / v / v) and expanded 10 cm.

b-mephenytoin 4—hydroxylase? tongue 'was measured according to the method of Shimada et al. (himada, T. et al., Anal Biochem (1985) 147: 174-179), and the developing solvent was black mouth form methanol 28% ammonia (90: 10: 1, v / v / v) and expanded 12 cm.

The TLC plate was dried and allowed to stand for 12 hours in contact with phosphor imaging plate (IP). Changes in the amount of compounds and metabolites were measured using BAS-2500 (Fuji Film). The Rf values for radioactive metabolites were clearly identified compared to unlabeled standards. The results are shown in FIG. Lane 1 is monkey liver microsome, lane 2 is CYP2C20, lane 3 is CYP2C9vl, lane 4 is CYP2C9v3, and lane 5 is new mfCYP2C.

The new m! CYP2C is able to metabolize tolbutamide and testosterone out of four substrates.

In contrast, mfCYP2C20 has the ability to metabolize taxol and has no metabolic activity against other compounds. It was also confirmed that m! LYP2 and 9v3iitolbutamiae, ¾-mephenytoin, testosterone, and mlCYP2C9vl metabolize S-mephenytoin and testosterone.

The new m! CYP2C, mfCYP2C9vl, and mfCYP2C9v3 all showed metabolic activity using testosterone as a substrate, but the metabolites were not identical.

Based on the above, a new monkey-specific mfCYP2C protein is metabolized against certain drugs. It was confirmed to show activity. This suggests that the novel m! CYP2C contributes to the metabolic pattern differences between monkeys and other primates.

[Preparation of anti-new m! CYP2C antibody and immunoblotting]

A novel polyclonal antibody against m! CYP2C was produced by Neo MPS (San Diego, Calif.) By synthesizing a peptide having a specific amino acid sequence of this protein and immunizing a rabbit with this peptide. First, the following two peptides were synthesized based on specific amino acid sequences selected by comparing the sequences of four m! CYP2Cs.

(A) H-CQLNTKNISKSISMLA-NH (SEQ ID NO: 98)

2

(B) H-CLYNAFPHLRVL-NH (SEQ ID NO: 99)

2

The synthesized peptide was purified, bound to Keyhol Limpet Hemocyanin (carrier protein) via the thiol group of the C-terminal cysteine residue, and immunized with New Zealand White Rabbit to obtain a rabbit anti-new mfCYP2C antibody (Fig. 15). ).

As recombinant P450 proteins, monkey CYP2C to CYP2C20, CYP2C9vl, CYP 2C9v3, and new m! CYP2C, and human CYP2C to CYP2C8, CYP2C9, CYP2C18, and CYP2C19 (each l.Opmol) in 10% SDS polyacrylamide gel. Electrophoresis and transfer onto Hybond-P filter (Amersham Biosciences). Using this filter, immunoblotting using a rabbit anti-new m! CYP2C antibody (1: 250) and a donkey anti-usagi IgG antibody conjugated to horseradish peroxidase (SantaCruz Biotechnology) 7 lines. The effect of the mouth of the product is not visible. [Visualization with ECL Western Blotting detection reagent (Amersham Biosciences)] Only when the antibody (A) is used, only the band strength corresponding to the new mfC YP2C (CYP2C76) is obtained. And immunospecificity was confirmed (Fig. 16 (A)) ₀

In addition, immunoblotting with an anti-new mfCYP2C (CYP2C76) antibody was performed using liver microsomes prepared from five primate primates, human, chimpanzee, orangutan, force-quizal, and akage monkey. Band power of the expected size-confirmed only in samples of cynomolgus monkey and monkey monkey, and obtained results consistent with the expression pattern of the novel m! CYP2C gene (Fig. 16 (B)).

[Immunohistochemistry] Immunohistochemical staining with anti-novel mfCYP2C antibody was performed using a section of force-cynomolgus liver according to standard methods. The primary antibody was diluted 50-fold, brought into contact with the section and left at 4 ° C. The bound antibody was detected using EnVision + System and liquid diaminobenzidine (both from DakoCytomation) according to the product instructions. Slides were control stained with harr is hematoxylin. Usagi preimmune serum was used in place of the primary antibody as a negative control. To verify the immunohistochemical specificity, the antibody was pre-cured at 4 ° C with an excess of novel m! CYP2C-specific peptide (0.05 mg / ml) and used in place of the primary antibody. did. As a result, hepatocytes were strongly stained, and the 1S bile duct and vascular cells were not stained. No staining was seen in the presence of blocking peptide or preimmune serum (Figure 17), suggesting that the staining is specific for the novel mfCYP2C.

Brief Description of Drawings

[FIG. 1] The upper part of FIG. 1 shows the base sequence of the novel mfCYP2C cDNA (SEQ ID NO: 1), and the lower part shows the amino acid sequence of the novel m! CYP2C protein (SEQ ID NO: 2). The region surrounded by the frame is the region estimated to be a hem coupling region. The extension (281 bases) of the transcript variant with a long 3 'non-translated region is underlined by alternative polyadenylation. The amino acid sequence drawn with a broken line is the sequence of the peptide used to produce the anti-new mfCYP2C antibody. The cDNA is 1666 bases long and contains an open 'reading' frame of 489 amino acid residues.

[Fig. 2] Multiple alignment of amino acid sequences of four monkey CYP2C proteins. From the top, the amino acid sequences of CYP2C20 (SEQ ID NO: 11), mfCYP2C9vl (SEQ ID NO: 12), mfCYP2C9v3 (SEQ ID NO: 13), and novel mfCYP2C (SEQ ID NO: 14) are shown. The new m! CYP2 C has 489 amino acid residues and is one residue shorter than other monkey CYP2C and human CYP2C proteins.

[Fig.3] Amino acid sequences of CYP2C in chick (c), chick Kh), pig (pig), inu (dog), rabbit (rab), mouse), force-quizal (mf), rat (r) It is a molecular evolutionary phylogenetic tree drawn using. The sequence of the new m! CYP2C was shown to be more similar to that of other animal species than humans.

[Fig.4] Multiple alignment of new m! CYP2C homolog cDNAs in other monkeys is there. From the top, the base sequences of cDNAs of Riki quizal (part of SEQ ID NO: 1), monkey (SEQ ID NO: 15), African monkey (SEQ ID NO: 16), and common 'marmoset (SEQ ID NO: 17) are shown. . Due to the species differences, only the akage monkey was able to completely amplify the coding region, and exon 1-4 and exon 2-4 were amplified for African green monkey and common 'marmoset, respectively. Among the species, only a few residues differed, and close to 100% showed homology.

FIG. 5 is a continuation of FIG. 15 and shows multiple alignment of cDNA of a novel mfCYP2C homolog in other monkeys.

[Fig. 6] Multiple alignment of amino acid sequences of proteins of a novel m! CYP2C homolog in other monkeys. From the top, the amino acid sequence of a new m! CYP2C protein homologue of force-quizal (SEQ ID NO: 2), akage monkey (SEQ ID NO: 18), African green monkey (SEQ ID NO: 19), common marmoset (SEQ ID NO: 20) Indicates.

[FIG. 7] A novel mfCYP2C exon-intron structure determined by long-distance PCR using gene-specific primers designed on each exon and analyzing the sequence of all introns. The new m! CYP2C gene was confirmed to contain 9 exons, similar to the human CYP2C gene.

FIG. 8 shows the PCR amplification pattern of CYP2C BAC clones, restriction enzyme mapping, and the structure of the monkey CYP2C gene determined by end sequencing. Note that CYP2C9vl and CYP2C9v3 (represented as CYP2C43 and CYP2C75 in the figure, respectively) are drawn in a tentative order because they have the power to determine positions on the genome that are highly homologous to each other. The new monkey-specific mf CYP2C (denoted CYP2C76 in the figure) is a force located at the end of the CYP2C cluster. This position is the region between genes in the corresponding region of the human genome. Broken lines indicate BAC clones that did not undergo clear amplification.

FIG. 9 shows the tissue distribution of monkey CYP2C gene expression. Real-time RT-PCR was performed using total RNA from 10 tissue samples. For all CYP2C, the new mfCYP2C (CYP2C76) with the highest expression in the liver was most prominent.

FIG. 10 shows the results of measuring the difference in the expression level of new m! CYP2C in males and females. Male expression was approximately twice that of females. [FIG. 11] DNA binding elements for major liver-specific transcription factors (HNF1 a, HNF3 β, HNF4 a) identified by the TRNASFAC program (threshold score ≥ 75.0). The position of each element is calculated with the transfer start point as zero.

[FIG. 12] The 5 ′ flanking region of about 1 kb was analyzed by luciferase assay. Atsei performed using the pGL-lkb construct in HepG2 cells and added transcription factors as needed. All factors, Tokuko HNF1a, markedly enhanced the expression of novel mfCYP2C.

[FIG. 13] CO-differentience spectra confirming the expression of recombinant novel m! CYP2C protein in E. coli. A peak peculiar to P450 protein (450 nm) can be confirmed.

FIG. 14 shows the metabolic activity of monkey CYP2C expressed in E. coli. Lanes 1-5 show monkey liver microsomes, CYP2C20, CYP2C9vl, CYP2C9v3, and new mfCYP2C, respectively.

FIG. 15 shows an antibody prepared by immunizing a rabbit with a synthetic peptide having the amino acid sequence shown in FIG. Figure 25A shows the peptide H-CQLNTKNISKSISMLA-NH (SEQ ID NO: 29).

2

Fig. B shows the peptide H-CLYNAFPHLRVL-NH (SEQ ID NO: 30) as the antigen.

2

It is the antibody obtained by doing.

FIG. 16 shows the results of immunoblotting using A.anti-new mfCYP2C antibody. Eight types of monkey and human P450 were electrophoresed and then transferred to PVDF filters to bind anti-new m! CYP2C antibody. Only the new m! CYP2C (CYP2C76) band could be detected. B. A novel mfCYP2C homologue in liver microsomes of multiple animals was searched for in the same manner as A. The PDI protein as a control was the force detected in all samples. The novel m! CYP2C protein was detected only in the force-quizal and the keystone.

FIG. 17 shows the results of immunohistochemical staining of novel m! CYP2C protein in the liver. (A) shows immunostaining with an anti-new mfCYP2C antibody, (B) shows the results of pretreatment with peptide blocking, and (C) shows the results of preimmune staining. Strong and staining were confirmed in hepatocytes, but not in bile duct (arrow) and vein (triangle) epithelial cells. (B) and (C) hardly stained. The solid scale shows 100 m.

Claims

The scope of the claims

[1] The following protein (a) or (b):

(a) A protein having the amino acid sequence ability described in SEQ ID NO: 2.

(b) A protein that is a drug-metabolizing enzyme, in which one or several amino acids are substituted, deleted, added and Z or inserted in the amino acid sequence set forth in SEQ ID NO: 2.

[2] A nucleic acid encoding the protein according to claim 1.

[3] DNA of (c) or (d) below.

(c) DNA having a base sequence ability described in SEQ ID NO: 1 or SEQ ID NO: 3,

(d) a drug-metabolizing enzyme that has been hybridized under stringent conditions with a DNA sequence having a nucleotide sequence complementary to the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3 or its partial DNA Monkey-derived DNA encoding a protein that is

[4] A recombinant vector comprising the DNA according to claim 3.

[5] A transformant comprising the recombinant vector according to claim 4.

[6] The method for producing a protein according to claim 1, wherein the transformant according to claim 5 is cultured, and the protein according to claim 1 is purified from the culture.

[7] An antibody against the protein according to claim 1.

[8] When the metabolism of the test substance is different between monkeys and non-monkey mammals,

A step A for contacting the protein according to claim 1 and the test substance, and a step B for measuring the presence or absence of the protein according to claim 1 with respect to metabolism of the test substance,

A method for evaluating the cause of different metabolism of the test substance.

[9] The method according to claim 8, wherein the protein according to claim 1 used in the step A is produced by the method for producing a protein according to claim 6.

[10] In the step B, when the protein according to claim 1 is involved in metabolism of the test substance,

The method according to claim 8 or 9, wherein the metabolic difference of the test substance between the monkey and the mammal other than the monkey is evaluated to be due to a difference in species.

[11] Using monkeys as model animals, the metabolism, efficacy and efficacy of human drug candidates

Z or when testing safety

Measuring the presence or absence of the involvement of the protein of claim 1 in the metabolism of the drug candidate compound, c.

In the case of the above-mentioned involvement, the metabolism, drug efficacy and Z or safety test results of the drug candidate compound using monkeys as model animals are the results of the metabolism, drug efficacy and Z or safety of the drug compound in humans. A method for evaluating metabolism, efficacy and Z or safety testing, including Step D, which is predicted to be different from safety.

[12] The method according to claim 11, wherein the step C is performed in vitro.

[13] A method for evaluating the feasibility of testing the metabolism, efficacy and Z or safety of a human drug candidate compound using monkeys as model animals,

A step E of contacting the protein of claim 1 with the drug candidate compound; a step F of measuring the degree of involvement of the protein of claim 1 with respect to metabolism of the drug compound; Including

A method in which a negative evaluation is made for testing a monkey as a model animal when the participation is greater than or equal to a predetermined level.

[14] A kit comprising the protein according to claim 1, which is used for evaluation of metabolism, efficacy and Z or safety of a human drug candidate compound using a monkey as a model animal.