WO2006070024A2 - E1 -minus adenoviren und deren verwendung - Google Patents
E1 -minus adenoviren und deren verwendung Download PDFInfo
- Publication number
- WO2006070024A2 WO2006070024A2 PCT/EP2006/000010 EP2006000010W WO2006070024A2 WO 2006070024 A2 WO2006070024 A2 WO 2006070024A2 EP 2006000010 W EP2006000010 W EP 2006000010W WO 2006070024 A2 WO2006070024 A2 WO 2006070024A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- virus
- promoter
- nucleic acid
- cells
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10032—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10041—Use of virus, viral particle or viral elements as a vector
- C12N2710/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10341—Use of virus, viral particle or viral elements as a vector
- C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
- C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES
Definitions
- the invention relates to El -minus adenoviruses, as well as nucleic acids coding therefor and their use.
- replication-selective oncolytic viruses has created a new platform for the treatment of tumors.
- a selective intratumoral replication of a viral agent is brought about, which leads to the virus replication, lysis of the infected tumor cell and spreading of the virus on adjacent tumor cells. Due to the restriction of the ability of the virus to replicate on tumor cells, normal tissue is spared from replication and hence lysis by the virus.
- Onyx-015 is an adenovirus in which the ElB 55kDa gene is completely deleted.
- the complete deletion of the adenovirus ElB55kDa protein is based on the observation that in such an adenoviral vector the replication and thus the lysis of cells with defective p53 is possible (Kirn, D. et al., 5 Proc. Am. Clin. Oncol., 17, 391a, 1998), normal cells are not damaged.
- the ElB 55kDa gene product is involved in inhibiting p53, transporting viral mRNA, and shutting down host cell protein synthesis.
- the inhibition of p53 is carried out by forming a complex of p53 and the adenovirally encoded ElB-55kDa protein and / or complex consisting of ElB-55kDA and E4orf6.
- P53, encoded by TP53 exerts a complex regulatory mechanism (Zambetti, GP et al., FASEB J. 7, 855-865, 1993), which, among other things, results in efficient replication of viruses such as adenoviruses in the cell is suppressed.
- the TP53 gene is deleted or mutated in approximately 50% of all human tumors with the result that there is no - desired - apoptosis as a result of chemotherapy or a radiation therapy comes and thus the success of these tumor treatments is normally omitted.
- tumor lytic viruses Another concept of tumor lytic viruses is based on the observation that when the E1A protein is deleted in a particular manner or has one or more mutations that do not interfere with the binding of Rb / E2F and / or ⁇ 107 / E2F and / or pI30 / E2F Such adenoviruses do not induce entry of the infected cells into the S phase and are capable of replicating in tumor cells that do not have a functional Rb protein.
- the EIA protein may be deleted at the N-terminus or comprise one or more mutations in the region of amino acid positions 1 to 76 of the El A protein to inhibit the binding of ElA to p300, thus allowing for more selective replication in tumor cells accomplish.
- adenoviral systems for oncolysis known in the prior art thus have certain deletions in the ElA protein, this deletion being carried out under the assumption that intact Rb proteins or complexes consisting of intact Rb protein and E2F enable efficient replication in vivo and to ensure adenoviral replication in vivo only in Rb-negative / mutant cells.
- These prior art adenoviral systems are based on ElA to direct in vivo replication by means of the E2 early promoter and free E2F (Dyson, N. Genes & Development, 12, 2245-2262 , 1998).
- tumor lytic adenoviral systems relies on the use of selective promoters to specifically express the viral oncogene ElA, allowing for selective replication in tumor cells (Rodriguez, R. et al., Cancer Res. 57, 2559-2563, 1997). ,
- adenoviral tumor-lytic viruses depend on the selection of a suitable cellular background for the mechanism of action on which the particular concept is based.
- the various currently known adenoviral systems for tumor lysis can be applied only in the presence of certain molecular biological conditions. This limits the application of such systems to certain groups of patients.
- a particular problem in the treatment of tumor diseases arises when the patients suffering from the tumor disease develop a so-called multidrug resistance (MDR), which represents a particularly well-researched form of resistance of tumors to cytostatics (Gottesman and Pastan , Annu., Rev. Biochem., 62, 385-427, 1993).
- MDR multidrug resistance
- YB-I enters the cell nucleus through various stress conditions, such as UV irradiation, cytostatics application (Koike, K. et al., FEBS Lett 17, 390-394, 1997) and hyperthermia (Stein, U et al., JBC 276, 28562-69, 2001).
- MRP multidrug resistance-related protein
- the object according to the invention is also solved by a virus, preferably adenovirus, wherein the virus comprises:
- a transporter for the transport of YB-I into the nucleus of a cell infected with the virus.
- the virus comprises a nucleic acid encoding protein IX and expressing protein IX.
- the missing wild-type functional El region is ElA-minus.
- the missing wild-type functional El region is ElB-minus.
- the missing wild-type El region is ElB55K-minus and / or ElB19K-minus and / or protein is IX-minus.
- the transporter is a transporter provided by the virus.
- the transporter is a viral transporter.
- the transporter comprises the protein E4orf6.
- the transporter comprises the protein E1B55K. In one embodiment of the first aspect, it is contemplated that the transporter comprises a complex of E4orf4 and E1B55K.
- the transporter is encoded by a nucleic acid, wherein the nucleic acid is under the control of a promoter.
- the transporter is a complex of at least two factors and each factor is encoded by a nucleic acid, wherein the two nucleic acids are controlled by a common promoter.
- the two coding nucleic acids are linked to one another by an expression-strength-regulating element, wherein the element is preferably selected from the group comprising IRES.
- the transporter is a complex of at least two factors and each factor is encoded by a nucleic acid, wherein the two nucleic acids are each controlled by their own promoter.
- the promoter is different from the E4 promoter, in particular the adenoviral E4 promoter, and different from the EIB promoter, in particular the adenoviral EIB promoter.
- the promoter is selected from the group comprising tissue-specific promoters, tumor-specific promoters, the CMV promoter, viral promoters, in particular adenoviral promoters, provided that these are different from the E4 promoter, the EIB promoter and preferably also different from the E2 late promoter.
- the nucleic acid coding for the transporter has a 3 'UTR of E1B55K at the 3' end of ElB 55K. In one embodiment of the first aspect, it is provided that when the missing wild-type El region E1B55K is positive, the nucleic acid coding for the transporter comprises no nucleic acid coding for E1B55K.
- the nucleic acid coding for the transporter encodes E1B55K and E1B19K.
- the nucleic acid coding for the transporter encodes protein IX.
- nucleic acids coding for E1B55K and E1B19K are under the control of a promoter.
- the nucleic acid coding for E1B55K and / or E1B19K and / or protein IX is under the control of a promoter, wherein the promoter is preferably different from an ElA-dependent promoter.
- the missing functional wild-type El region is ElA13S-minus and / or El A12S-minus.
- the missing functional wild-type El region is ElA13S-minus.
- the missing wild-type El region is ElA13S-minus and ElA12S-minus
- the virus comprising a nucleic acid encoding the E1A12S protein, wherein the nucleic acid is preferably a heterologous nucleic acid ,
- the nucleic acid coding for the E1A12S protein is under the control of a promoter, wherein the promoter is preferably a YB-I-dependent promoter and is more preferably selected from the group comprising the adenoviral E2A promoter. Late promoter, the MDR promoter and the DNA polymerase alpha promoter.
- the nucleic acid (s) coding for the transporter encode / encode E4orf6 and E1B55K.
- the virus comprises a nucleic acid coding for the protein IX, wherein preferably the nucleic acid coding for the ElAl 2S and the nucleic acid coding for the protein IX are under the control of a common promoter More preferably, the two coding nucleic acids are linked together by an expression regulating element, more preferably the element is selected from the group comprising IRES.
- the nucleic acid coding for the E1A12S protein and the nucleic acid coding for the protein IX are each under the control of a promoter, wherein the promoter is preferably the same promoter.
- the promoter is a YB-I dependent promoter, which is preferably selected from the group comprising the adenoviral E2 late promoter, the MDR promoter and the DNA polymerase alpha promoter includes.
- the virus comprises a YB-I-encoding nucleic acid.
- the coding for the E1A12S protein nucleic acid and the nucleic acid coding for YB-I are under the control of a common promoter, wherein preferably the two coding nucleic acids by an expression regulating element, the element being more preferably selected from the group comprising IRES.
- the nucleic acid coding for YB-I and the nucleic acid coding for the E1A12S protein are each under the control of a promoter, wherein the promoter is preferably the same promoter.
- the promoter is a YB-I dependent Promo gate, which is preferably selected from the group comprising the adenoviral E2 late promoter, the MDR promoter and the DNA polymerase alpha - promoter ,
- the nucleic acid coding for the E1A12S is cloned into the E3 region or E4 region.
- the nucleic acid coding for the E1A12S and the nucleic acid coding for protein IX or the nucleic acid coding for YB-I are cloned into the E3 region or the E4 region.
- the expression of the nucleic acid coding for protein IX is controlled via a promoter other than ElB, via ElB 19K or via El A12S.
- the virus comprises at least one transgene which is preferably cloned into the E3 region.
- the virus comprises at least one transgene which is preferably cloned into the E4 region.
- the virus comprises a nucleic acid coding for an RGD motif, wherein the RGD motif is preferably cloned into the HI-loop domain of the fiber knob.
- the virus further comprises MLP genes and / or E2A genes and E2B genes and / or E3 genes and / or E4 genes. In one embodiment of the first aspect, it is contemplated that it is replication-deficient in cells that do not have YB-1 in the nucleus.
- the virus is replicable in cells which have YB-1 in the nucleus, in particular YB-I independently of the cell cycle in the nucleus.
- the virus is replicable in cells in or in which YB-I is deregulated.
- tumor cells in particular tumor cells which have a resistance to cytostatics and / or radiation.
- the cells have a multiple resistance.
- the object is achieved according to the invention by a nucleic acid coding for a virus according to the first aspect of the invention.
- the object is achieved according to the invention by the use of a virus according to the first aspect or a nucleic acid according to the second aspect or a vector containing it or a replication system containing this or a part of the nucleic acid for the production of a medicament.
- the object is achieved by the use of a virus according to the first aspect or a nucleic acid according to the second aspect for replication in cells, wherein the cells have YB-I in the nucleus, preferably independently of the cell cycle in the nucleus, or Cells have deregulated YB-I, or the cells are tumor cells, in particular tumor cells that have a resistance to cytostatics and / or radiation.
- the cells have YB-I in the core after or as a result of a measure applied or has been applied to the cell and is selected from the group comprising irradiation, administration of cytostatics and hyperthermia.
- the medicament is for the treatment of tumors and / or cancerous disease (s) and / or for restoring the sensitivity of cells to cytostatic agents and / or radiation, which cells are preferably tumor cells have a resistance to cytostatics and / or radiation.
- At least a portion of the tumor-forming cells are cells having core YB-I, preferably having core YB-I independent of the cell cycle, or at least a portion of the tumor-forming cells deregulated YB-I or at least part of the tumor-forming cells are tumor cells, in particular tumor cells which have a resistance to cytostatics and / or radiation.
- the cells in particular the cells forming the tumor or parts thereof, have a resistance, in particular multiple resistance or multiple resistance to pharmacologically active substances, preferably antitumor agents and more preferably cytostatics.
- the cells show expression, preferably overexpression of the membrane-bound transport protein P-glycoprotein.
- the cells have YB-1 in the core, in particular the cells YB-1 forming the tumor or a part thereof in the nucleus.
- the tumor contains YB-1 in the nucleus after induction of the transport of YB-I into the nucleus.
- the transport of YB-I into the core is triggered by at least one measure, the is selected from the group comprising radiation, administration of cytostatics and hyperthermia.
- the measure is applied to a cell, an organ or an organism.
- the object is achieved according to the invention by the use of a viral replication system, in particular an adenoviral replication system, comprising a nucleic acid coding for a virus, in particular an adenovirus, according to the first aspect or a part thereof, and comprising a helper virus nucleic acid wherein the helper virus nucleic acid comprises a nucleic acid sequence encoding YB-I and optionally complementing the virus, preferably for the manufacture of a medicament, preferably for the treatment of tumors and / or cancer (s) and / or for the restoration of the sensitivity of Cells to cytostatics and / or radiation, wherein the cells are preferably tumor cells having a resistance to cytostatics and / or radiation.
- a viral replication system in particular an adenoviral replication system, comprising a nucleic acid coding for a virus, in particular an adenovirus, according to the first aspect or a part thereof, and comprising a helper virus nucleic acid
- the viral nucleic acid preferably the adenoviral nucleic acid and / or the helper virus nucleic acid, is present as a replicable vector.
- the object is achieved according to the invention by the use of a nucleic acid encoding a virus, preferably an adenovirus, according to the first aspect for the preparation of a medicament, preferably for the manufacture of a medicament for the treatment of tumors and / or for the restoration of sensitivity Cytostatic cells and / or radiation, wherein the cells are preferably tumor cells having a resistance to cytostatics and / or radiation.
- a virus preferably an adenovirus
- the cells in particular the cells forming the tumor or parts thereof, have a resistance, in particular a multiple resistance to pharmacologically active substances, preferably antitumor agents, and more preferably cytostatics.
- a vector comprising a nucleic acid according to the second aspect, preferably for use according to the third and fourth aspects.
- the object is achieved according to the invention by the use of a YB-I interacting agent for characterizing cells, cells of a tumor tissue or patient to determine whether they have a virus, in particular an adenovirus, according to the first Aspect or nucleic acid can be contacted and / or treated according to the second aspect.
- the agent is selected from the group comprising antibodies, high affinity binding peptides, anticalins, aptamers, aptazymes and spiegelmers.
- the object is achieved according to the invention by a pharmaceutical composition
- a pharmaceutical composition comprising a virus according to the first aspect, or a nucleic acid according to the second aspect or a viral replication system as described in the fifth aspect.
- the composition contains at least one further pharmaceutically active compound.
- the pharmaceutically active compound is selected from the group comprising cytokines, metalloproteinase inhibitors, angiogenesis inhibitors, cytostatics, cell cycle inhibitors, proteosome inhibitors, recombinant antibodies, signal transduction cascade inhibitors and protein kinases includes.
- the composition comprises a combination of at least two compounds, wherein preferably each compound is individually and independently selected from the group comprising cytostatic agents.
- At least two of the compounds attack different target molecules.
- at least two of the connections are active via a different mechanism of action.
- At least one compound increases the infertility of a cell by the virus in which the virus replicates.
- At least one compound affects the availability of a component of the cell, preferably increasing the availability of the component, which component mediates the uptake of the virus into one or the cell in which the virus preferably replicates.
- At least one compound mediates, preferably increases, the transport of YB-I into the cell nucleus.
- At least one compound is a histone deacylase inhibitor.
- the histone deacylase inhibitor is selected from the group comprising trichostatin A, FR 901228, MS-27-275, NVP-LAQ824, PXD101 apicidin and Scriptaid.
- At least one compound is selected from the group comprising trichostatin A, FR 901228, MS-27-275, NVP-LAQ824, PXD101 apicidin, and scriptaid.
- At least one compound is a topoisomerase inhibitor.
- the topoisomerase inhibitor is selected from the group comprising camptothecin, mnotecan, topotecan, DX-895If, SN-38, 9-aminocamptothecin, 9-nitrocamptothecin, daunorubicn and etoposide.
- the composition comprises trichostatin A and irinotecan.
- the virus preferably a virus according to the first aspect of the present invention, is separate from one or both or all of the at least two compounds.
- At least one unit dose of the virus is separated from at least one unit dose by the or each further pharmaceutically active compound (s) or one or at least two compounds.
- kits comprising a virus, preferably a virus according to the first aspect of the present invention, a virus according to any one of the preceding claims, and at least two pharmaceutically active compounds, wherein each pharmaceutically active compound is individually and independently is selected from the group comprising cytostatics.
- the present invention is based on the surprising finding that the viruses according to the invention, i. Viruses lacking a functional El region as contained in the wild-type adenovirus and which simultaneously comprise and in particular encode a transporter capable of transporting or translocating YB-I into the cell nucleus, being able to replicate in cells which have either cell-cycle independent YB-I in the nucleus, or cells that have deregulated YB-I.
- the viruses according to the invention can also replicate independently of E1A13S, in particular if the replication is mediated by YB-I.
- the replication occurs in particular in the cells described above.
- cells containing YB-1 in the nucleus preferably independently of the cell cycle in the nucleus, are also those containing YB-1 in the nucleus due to the use of the viruses of the invention and in particular the infection of cells therewith.
- protein IX is an important factor, in particular, for the efficacy of the viruses of the present invention when used as oncolytic viruses, and the constructions disclosed herein provide for expression of that factor which results in high particle formation also in YB -I mediated El A13S leading to independent viral replication.
- Cells having YB-I in a deregulated form are those having at least one of the following properties and / or having YB-I, wherein the YB-I has at least one of the following properties: (1) YB-I overexpressed in the cells, preferably overexpressed independently of the cell cycle, wherein the expression of YB-I in normal cells is preferably used as a measure of the expression, ie Cells other than tumor cells, or cells or cell lines such as the following: hepatocytes and the fibroblast cell lines WI38 and CCD32-Lu.
- overexpression is present when the expression is increased by the factor range of about 2 to 10, preferably 5 to 10.
- Methods for measuring expression, and in particular overexpression are known to those skilled in the art and include, but are not limited to: measuring protein concentration, in particular YB-I, measuring RNA, in particular YB-I, Western blot analysis, Northern blot analysis and RT-PCR, preferably each of YB-I.
- surrogate markers as described herein may also be used.
- Examples of cell lines which show overexpression of YB-I represent, for example, the following cell lines: colon carcinoma cell line 257RDB, pancreatic carcinoma cell line 181RDB, mammary carcinoma cell line MCF-7Adr, prostate carcinoma cell line DU145, prostate carcinoma cell line PC3, glial cell line U373, glioma cell line U87, lung carcinoma cell line A549, liver carcinoma cell lines Hep3B and HepG2.
- the present in the cell YB-I allows the replication of the viruses of the invention. It is preferred in the context of the present invention if the replication efficiency under these conditions is different from a greatly reduced replication.
- the term functional wild-type E1 region refers to an E1 region as contained in wild-type adenovirus Ad5.
- the term missing functional wild-type E1 region refers to an E1 region that does not or not fully exhibit one or more functions and functionalities of the E1 region present in wild-type adenoviruses.
- the Functionality or function hereinafter generally referred to as function, is represented or mediated by a nucleic acid or a protein, preferably a protein.
- the absence of the function may be due to the fact that it is not active at the level of translation, i. H. the function mediating protein is not present, although the nucleic acids coding for it are still contained in the viral genome.
- This can be achieved, for example, by the fact that the translation-controlling regulatory elements, which may be present, for example, on the 3'UTR of the mRNA, which are among other things responsible for the stability of the mRNA, are not active, preferably no longer in the regulatory and controlling context as it is present in wild-type viruses for that particular function.
- the absence of the function may alternatively or additionally be caused by the fact that it is not active at the level of transcription, i. H. the function-mediating protein is not present, and the nucleic acids coding for it is not or not completely contained in the viral genome.
- the encoding nucleic acid has one or more mutations leading to the loss of function. Such mutations are preferably point mutations and / or multiple base deletions and / or a complete deletion of the open reading frame or nucleic acid encoding the protein.
- the measure of activity used is the amount of replication achieved under these circumstances, which is preferably different from strongly different replication.
- Li of a preferred embodiment of the present invention lacks a function even if the function is contained in a different regulatory context in the virus compared to the wild-type virus.
- a changed regulatory context is one in which the function is expressed at a different time compared to other functions and / or under the control of one another, the transcription and / or translation controlling or influencing element is.
- One of the like element is in a particular embodiment of the promoter.
- greatly reduced replication herein means, in particular, such replication that is reduced by a factor of 2, preferably by a factor of 5, more preferably by a factor of 10, and most preferably by a factor of 100, compared to the wild type.
- replication refers in particular to particle formation.
- the extent of the synthesis of viral nucleic acid can be understood as a measure of the replication. Methods for determining the extent of viral nucleic acid synthesis, as well as methods for determining particle formation, are known to those skilled in the art.
- the viruses of the invention comprise a transporter for the transport of YB-I into the cell nucleus.
- the transporter is a protein, preferably a viral protein.
- the YB-I that is transported by the transporter into the cell nucleus of a cell is preferably deregulated YB-I, in particular such as defined herein.
- the YB-I is one which, as an alternative or in addition to the deregulated YB-I, is encoded by the virus according to the invention and expressed by it in the cell infected by the virus becomes.
- the cells in which the transporter of the viruses of the invention transports YB-I into the nucleus are preferably those containing deregulated YB-I.
- a cell which YB-I does not have Zellzyldus-independent in the nucleus such as the cervical carcinoma cell line HeLa or the osteosarcoma cell line U2OS be used and then determined whether as a result of infection and the subsequent replication of the virus, the correspondingly infected cell YB-I in the nucleus.
- the cell used is a cell having deregulated YB-I.
- Nuclear YB-I detection under these experimental conditions can be performed by those skilled in the art using the agents described herein, particularly an anti-YB-I antibody. If it is detected in the cell nucleus under the influence of the virus YB-I, the tested virus has one or the transporter.
- the El region with respect to one or both of the protein groups encoded by the El region is "minus" as described above EIA proteins, in particular the ElA 13S protein, also referred to herein as ElA 13S, and the E1A12S protein, also referred to herein as E1A12S, and the group of the EIB proteins, in particular the E1B55K protein, also referred to herein as E1B55K, the E1B19K protein, also referred to herein as E1B19K, and comprising protein IX.
- the virus is E1A13S minus when it is under the control of a promoter other than the ElA promoter, preferably the adenoviral EIA promoter and more preferably the adenoviral EIA promoter of wild-type; that the virus is ElA12S-minus when under the control of a promoter other than the EIA promoter, preferably the adenoviral EIA promoter and more preferably the wild-type adenoviral EIA promoter; that the virus is ElB55K-minus when it is under the control of a promoter other than the EIB promoter, preferably the adenoviral EIA promoter and more preferably the wild type adenoviral EIB promoter; that the virus is ElB19K-minus when under the control of a promoter other than the EIB promoter, preferably the adenoviral EIB promoter and more preferably the wild type adenoviral EIB promoter;
- the virus is E1A13S minus. In another embodiment, the virus is also ElA12 minus. It is particularly preferred if the virus E1A12S is under the control of a promoter which is controlled in its activity by YB-I, in particular by YB-I is activated. These promoters are also referred to herein as YB-I dependent promoters. A particularly preferred YB-I-dependent promoter is the adeno viral E2 late promoter. This construction ensures that E1A12S is not activated in viral replication until YB-I is present in the nucleus.
- the present invention relates to the use of protein IX and / or a nucleic acid coding therefor for the formation of viral, in particular adenoviral particles in YB-I-dependent replicating viruses, in particular adenoviruses. Furthermore, the present invention relates to the use of YB-dependent replicating viruses, preferably adenoviruses, for the production of a medicament, wherein the viruses comprise protein IX and / or a nucleic acid coding therefor. In a preferred embodiment, the medicament is for the treatment of tumors and cancers as described herein.
- the medicament is for the abrogation of resistance in animal cells as described herein and / or for the restoration of the susceptibility of cells to cytostatic agents and / or irradiation, the cells being preferably tumor cells having resistance, in particular as described herein, preferably a resistance to cytostatics and radiation, as specifically described herein.
- the various transgenes can be enclelled at appropriate locations within the viral genome.
- the ranges El, E2A, E2B, E3 and E4 are particularly preferred.
- the cloning of the transporter into the El region is particularly preferred. It will be appreciated by those skilled in the art that with the cloning of the transgenes into said sites of the viral genome, the genes encoded by these sites may be partially or completely inactivated or deleted. However, it is also within the scope of the present invention that the genes encoded by the respective site may remain partially or completely active.
- viruses according to the invention are preferably adenoviruses.
- treatment of a disorder or disease in a preferred embodiment also includes the prevention of this disease or disease.
- the adenoviral protein DC cements the capsid structure and is important for the packaging of viral DNA into virions (Boulanger et al., Journal of Virology, 44, 783-800, 1979; Jones and Shenk, Cell, 17, 683-689, 1979).
- the gene is located in the viral genome between positions 3581 and 4071 (Colby and Shenk T, Journal of Virology, 1981, 39, 977-980), the gene for Protein IX is only expressed from replicated DNA molecules (Matsui T et al., Molecular and Cellular Biology, 1986, 6, 4149-4154).
- the virus Xvir03-3'UTR expresses the viral proteins ElB55k and E4orf6 mediated by the introduced in Xvir 03-3'UTR, heterologous CMV promoter (Clontech: Plasmid pShuttle).
- those promoters described herein may also be used as disclosed in connection with the expression of ElA.
- the open reading frame of both genes is linked together via a so-called IRES sequence (Pellets, J. and Sonenberg, N. Nature, 1988, 334, 320-325).
- This element (company Novagen: pCITE) allows the expression of two proteins from a rnRNA.
- Another way of expressing two proteins from an RNA is to use short peptides (2A) derived from the foot-and-mouth disease virus (Pablo de Felipe, Genetic Vaccines and Therapy, 2004, 2, 13). In principle, this element can be used in the various embodiments described herein as an alternative to the IRES regulatory sequence.
- the independent promoter is preferably one which is different from the ElBDC promoter. More preferably, the independent promoter selected from the group includes tissue-specific, tumor-specific, YB-I dependent and viral promoters. 2. Control of the expression of protein IX by E1A12S. Expression of the El A12S protein results in S-phase induction of the infected cell, which causes the protein IX to be activated by its natural promoter.
- promoters which are different from the promoter which controls the expression of the transporter in the wild-type virus.
- the promoter is one which is ElA independent, i. whose activity is not influenced by ElA.
- Preferred promoters are thus tissue-specific promoters, tumor-specific promoters and viral promoters and in particular non-adenoviral, preferably those as described herein.
- YB-I dependent promoters that can be used in the present invention include, but are not limited to, the adenoviral E2 late promoter, the MDR promoter [Stein et al, J. Biol. Chem, 2001, 276 , 28562-28569;] as well as the DNA polymerase alpha promoter [En-Nia et al, J. Biol. Chem., 2004, Epub ahead of print].
- Non-adenoviral promoters useful in the present invention may be selected from the group consisting of cytomegalovirus promoter, RSV (Rous sarcoma virus) promoter, adenovirus-based promoter Va I and the non-viral YB-1 promoter (Makino Y. et al., Nucleic Acids Res. 1996, 15, 1873-1878).
- telomerase promoter alpha-fetoprotein (AFP) promoter
- CEA cecinoembryonic antigen promoter
- L-plastin promoter Choung, L, Schwartz, PE., Crystal, RC, Pizzorno, G, Leavitt, J., Deisseroth, AB, Cancer Gene Therapy, 6, 99-106, 1999
- arginine vasopressin promoter Coulson, JM, Staley, J., Wool, PJ, British J.
- E2f promoter Teukada et al., Cancer Res , 62, 3428-3477
- uroplakin U promoter Zhang et al., Cancer Res., 62, 3743-3750, 2002
- PSA promoter Hallenbeck PL, Chang, YN, Hay, C, Golightly, D., Stewart, D., Lin, J., Phipps, S., Chiang, YL, Human Gene Therapy, 10, 1721-1733, 1999
- the YB-I-dependent E2-late promoter of adenoviruses described in the German patent application DE 101 50 984.7 represents a promoter, as can be used in the context of the present invention.
- telomerase promoter With regard to the telomerase promoter, it is known that this is of central importance in human cells. Thus, telomerase activity is regulated by the transcriptional control of the telomerase reverse transcriptase gene (hTERT), which is the catalytic subunit of the enzyme. The expression of telomerase is active in 85% of the human tumor cells. In contrast, it is inactive in most normal cells. The exceptions are germ cells and embryonic tissue (Braunstein, I. et al., Cancer Research, 61, 5529-5536, 2001, Majumdar, A.S., et al., Gene Therapy 8, 568-578, 2001).
- hTERT telomerase reverse transcriptase gene
- Such a promoter should also allow the expression of the modified oncogene of the virus according to the invention, preferably the EIA oncogene protein, only in tumor cells.
- the expression of a transgene especially one selected from the group comprising E4orf6, ElB55kD, ADP and YB-I, is provided in an adenoviral vector under one of these promoters in one embodiment.
- the reading frame of the transactivating oncogene protein, in particular the EIA protein is in frame with one or more of the gene products of the adenoviral system
- the reading frame of the transactivating EIA protein may be but also be independent of it.
- transgenes encompasses all those genes which are either present in the virus, in particular wild-type adenovirus and more preferably adenovirus Ad5 wild-type, not or in any other regulatory context, in particular as defined herein.
- the gene present or present in such other regulatory context is also referred to herein as a heterologous gene. It is within the scope of one embodiment of the present invention that one or several of the transgenes as described herein are encoded and / or expressed by one or more helper genes.
- wild-type replication can already be achieved at an infection rate of 1 to 10 pfu / cell compared to 10 to 100 pfu / cell according to the prior art.
- the viruses according to the invention permit a considerably higher particle formation compared with the YB-I-dependent viruses of the prior art.
- the particle formation is increased by a factor of 2 to 50, preferably by a factor of 10 to 50.
- the adenoviruses used according to the invention are deficient in terms of ElB, in particular with respect to ElB 19K-deficient.
- the term deficient is generally understood to mean a state in which ElB does not have the entirety of the properties inherent in the wild-type and at least one of these properties is lacking.
- the adenovirus BCL2 homolog ElB19k prevents the ElA-induced apoptosis by interacting with the pro-apoptotic proteins Bak and Bax. This allows for maximum replication and / or particle formation in infected cells (Ramya Sundararajan and Eileen White, Journal of Virology 2001, 75, 7506-7516).
- deletions can, for. B relates to nucleic acid encoding part of E3 and E4 as also described herein.
- E4orf6 that is to say encode the adenovirus E4orf6 to be used according to the invention.
- these adenoviral nucleic acids can still be packaged in the viral capsid and thus form infectious particles. The same applies to the use according to the invention of the nucleic acids.
- the adenoviral systems may be deficient in terms of single or multiple expression products. It should be noted that this may be based, on the one hand, on the fact that the nucleic acid coding for the expression product is completely or mutated or deleted in such a way that substantially no expression product is formed, or that regulative or expression-controlling elements as promoters or transcription factors are missing or are active other than in the wild type, whether at the level of the nucleic acid (absence of a promoter, cis-acting element) or at the level of the translation or transcription system (trans-acting elements). Especially the latter aspect may depend on the particular cellular background.
- the YB-I-dependent replication of the viruses according to the invention takes place before the background of the replication behavior of wild-type adenoviruses described below.
- the replication of adenoviruses is a very complex process and usually relies on the human transcription factor E2F.
- E2F human transcription factor
- the "early genes" El, E2, E3 and E4 are first expressed, and the "late gene” group is responsible for the synthesis of viral structural proteins.
- the El region consisting of two transcription units ElA and ElB 5, which code for different ElA and EIB proteins, plays a crucial role, as it prevents the transcription of the E2, E3, E4 proteins.
- Induce genes Nevins, JR, Cell 26, 213-220, 1981.
- the EIA proteins in dormant cells can induce DNA synthesis and thus initiate their entry into S phase (see Boulanger and Blair, 1991).
- E2F factors can then bind to the respective promoter regions of both cellular and viral genes (especially the adenoviral E2 early promoter). and initiate transcription and thus replication (Nevins, JR, Science 258, 424-429, 1992).
- E2 early E2F dependent also referred to herein as E2 early promoter or early E2 promoter
- E2 late The Molecular Repertoire of Adenoviruses III: Current Topics in Microbiology and Immunology, Vol 199, 177-194, Springer Verlag 1995.
- E4 early E2F dependent also referred to herein as E2 early promoter or early E2 promoter
- E2 late promoter The Molecular Repertoire of Adenoviruses III: Current Topics in Microbiology and Immunology, Vol 199, 177-194, Springer Verlag 1995.
- the products of the E4 region together with the ElA and ElB 55kDa proteins play an important role in the activity of E2F and the stability of p53, respectively.
- E4 region encoded E4orf6 / 7 protein with the heterodimer consisting of E2F and DPI further transactivates the E2 promoter (Swaminathan and Thimmapaya, JBC 258, 736-746, 1996).
- p53 is inactivated by the complex consisting of ElB-55kDa and E4orf6 (Steegenga, W.T. et al., Oncogene 16, 349-357, 1998) to undergo a successful lytic infection cycle.
- ElB-55kDa protein has another important function in that, in interaction with the E4orf6 protein, it requires the export of the viral RNA from the cell nucleus, whereas the cell's own RNAs are retained in the nucleus (Bridge and Ketner, Virology 174, 345). 353, 1990). Another important observation is that the protein complex consisting of ElB-55kDa / E4orf6 is localized in the so-called "viral inclusion bodies.” These structures are believed to represent sites of replication and transcription (Ornelles and Shenk, J. Virology 65 , 424-429, 1991).
- the E3 region contains the genetic information for a variety of relatively small proteins that are not essential for the adenoviral infection cycle in vitro, ie, in cell culture. However, they play a significant role in the survival of the virus during acute and / or latent infection in vivo, as they possess, inter alia, immunoregulatory and apoptotic function (s) (Marshall S. Horwitz, Virololgie, 279, 1-8, 2001; Russell, supra). It could be shown that a protein with a size of approx. 11.6 kDa induces cell death.
- ADP Tollefson, J. Virology, 70, 2296-2306, 1996) for its function as ADP.
- the protein primarily becomes late in the infection cycle educated. Furthermore, overexpression of the protein leads to better lysis of the infected cells (Doronin et al., J. Virology, 74, 6147-6155, 2000). Accordingly, these genes or proteins are still present in the viruses according to the invention.
- adenoviruses as medicaments and particular in systemic application can be improved by a suitable targeting of the adenoviruses.
- the infection of tumor cells by adenoviruses depends, to a certain extent, among other things on the presence of the coxsackievirus adenovirus receptor CAR and certain integrins. Once these are strongly expressed in cells, especially tumor cells, infection is possible even at very low titers (pfu / cell).
- Various strategies have heretofore been carried out to achieve so-called re-targeting of the recombinant adenoviruses, e.g.
- the various transgenes including ElB55kD, E4orf6, ADP and the like, especially if they are viral genes, can in principle be cloned from any corresponding virus, preferably adenovirus and more preferably adenovirus Ad5.
- the prior art moreover describes a multiplicity of plasmids which contain the corresponding genes and from which these can then be taken and inserted into the adenoviruses according to the invention as well as into the viruses to be used according to the invention.
- An example of a plasmid expressing ElB55kD is described, for example, by Dobbelstein, M. et al., EMBO Journal, 16, 4276-4284, 1997.
- the coding region of the E1B55K gene, together with the 3 'non-coding Region of the E1B55K gene (this 3'UTR region preferably lies approximately at the base position 3507-4107 in the adenovirus wild-type genome), for example from this gene be cut out of the plasmid pDCREIB using Bam HI.
- the corresponding fragment comprising the ElB55kD gene and the 3'-non-coding region corresponds to the nucleotides 2019 to 4107 of the adenovirus type 5.
- the ElB55kD gene by means of the restriction enzymes Bam HI and Bfrl or Xbal is cut from this plasmid and then cloned into the adenovirus.
- analogs thereof, and in particular analogs of the 3'UTR region are also used in the context of the present invention.
- An analog or analog to the 3 'UTR region means any sequence that has the same effect as the 3' UTR region, particularly the same effect on the expression of a gene, preferably the ElB55kD gene.
- Such analogs may be determined by those skilled in the art in the context of routine experimentation, for example, by extending and shortening the 3 'UTR region by one or more nucleotides, and then checking whether the thus-obtained analogue is still the same Has activity as the 3 '-UTR region, as previously described.
- the term 3 'URR region includes any analogue thereto.
- viruses according to the invention are those in which preferably, under the control of a specific promoter, in particular a tumor or tissue-specific promoter, therapeutic genes or transgenes are cloned in a preferred embodiment.
- a specific promoter in particular a tumor or tissue-specific promoter
- therapeutic genes or transgenes are cloned in a preferred embodiment.
- the region E4 is functionally inactive, preferably deleted.
- the transgenes described herein can also be cloned into the E4 region, which can be done alternatively or in addition to cloning the transgenes into the E3 region or the E3 region remains partially or completely intact.
- Transgenes, as used herein can be viral genes, preferably adenoviral genes, which preferably do not exist in the wild-type adenovirus at the genome or site in the genome where they now reside in the particular virus, or therapeutic genes.
- Therapeutic genes may be prodrug genes, genes for cytokines, apoptosis-inducing genes, tumor suppressor genes, genes for metalloproteinase inhibitors and / or angiogenesis inhibitors.
- siRNA, aptamers, antisense and ribozymes can be expressed which are directed against cancer-relevant target molecules.
- the single or multiple target molecules are selected from the group consisting of resistance-related factors, anti-inflammatory Apoptosis factors, oncogenes, angiogenic factors, DNA synthesis enzymes, DNA repair enzymes, growth factors and their receptors, translational factors, metalloproteinases, particularly matrix metalloproteinases, and urokinase-type plasminogen activator. Preferred embodiments thereof are already disclosed herein.
- the resistance-relevant factors are preferably selected from the group comprising P-glycoprotein, MRP and GST, and also include the nucleic acids coding therefor.
- prodrug genes which can be used in preferred embodiments are, for example, cytosine deaminase, thymidine kinase, carboxypeptida.se, uracil phosphoribosyltransferase; Purine Nucleoside Phosphorylase (PNP); Kirn et al, Trends in Molecular Medicine, Volume 8, No.4 (Suppl), 2002; Wybranietz W.A. et al., Gene Therapy, 8, 1654-1664, 2001; Niculescu-Duvaz et al., Curr. Opin. Mol.
- cytokines which can be used in preferred embodiments are for example GM-CSF, TNF-alpha, 11-12, 11-2, 11-6, CSF, interferon-gamma; Gene Therapy, Advances in Pharmacology, Volume 40, Editor: J. Thomas August, Academic Press; Zhang and Degroot, Endocrinology, 144, 1393-1398, 2003; Descamps et al., J. Mol. Med., 74, 183-189, 1996; Majumdar et al., Cancer Gene Therapy, 7, 1086-1099, 2000.
- the anti-apoptotic factors are selected from the group comprising BCL2 and also include the nucleic acids encoding it.
- the oncogenes are selected from the group comprising Ras, in particular mutated Ras, Rb and Myc, and also comprise the nucleic acids coding therefor.
- the angiogenesis factors are selected from the group comprising VEGF and HMG proteins, and also include the nucleic acids encoding it.
- the DNA synthesis enzymes are selected from the group comprising telomerase and also comprise the nucleic acids coding therefor.
- the DNA repair enzymes are selected from the group comprising Ku-80 and also include the nucleic acids encoding them.
- the Growth factors selected from the group comprising PDGF, EGF and M-CSF, and also include the nucleic acids coding therefor.
- the receptors are in particular those of the growth factors, wherein the growth factors are preferably selected from the group consisting of PDGF, EGF and M-CSF, and also include the nucleic acids coding therefor.
- the transcription factor is selected from the group comprising YB-I, and also include the nucleic acids coding therefor.
- the metalloproteinases are in particular matrix metalloproteinases.
- the matrix metalloproteinases are selected from the group comprising MMP-1 and MMP-2, and also include the nucleic acids coding therefor.
- the urokinase-type plasma gas activators are selected from the group comprising uPa-R and also include the nucleic acids encoding them.
- Possible apoptosis-inducing genes are, for example, Decorin: Tralhao et al., FASEB J, 17, 464-466, 2003; Retinoblastoma 94: Zhang et al., Cancer Res., 63, 760-765, 2003; Bax and Bad: Zhang et al, Hum. Gene Ther., 20, 2051-2064, 2002; Apoptin: Noteborn and Pietersen, Adv. Exp. Med.
- Possible tumor suppressor genes that can be used in preferred embodiments are, for example, ElA, p53, p16, p21, p27, MDA-7. Opalka et al., Cell Tissue Organs, 172, 126-132, 2002, Ji et al., Cancer Res., 59, 3333-3339, 1999, Su et al., Oncogene, 22, 1164-1180, 2003.
- Possible angiogenesis inhibitors which can be used in preferred embodiments are, for example, dostatin, angiostatin: Hajitou et al., FASEB J., 16, 1802-1804, 2002, and antibodies against VEGF (Ferrara, N., Semin Oncol 2002 Dec; 29 (6 Suppl 16): 10-4.
- Possible metalloproteinase inhibitors which can be used in preferred embodiments are, for example, Timp-3, Ahonen et al, Mol Therapy, 5, 705-715, 2002; PAI-1; Söff et al., J. Clin. Invest., 96, 2593-2600, 1995; Timp-1, Brandt K. Curr. Gene Therapy, 2, 255-271, 2002.
- transgenes for the purposes of the present invention which can be expressed by the viruses according to the invention, are also tyrosinlcinase inhibitors.
- exemplary tyrosine kinases are the EGFR (epidermal growth factor receptor) [oncology, development and progression of malignant tumors; Author: Christoph Wagner, Georg Thieme Verlag, Stuttgart, 1999].
- a preferred tyrosine kinase inhibitor is Herceptin [Zhang H et al., Cancer Biol Ther. 2003, Jul-Aug; 2 (4 Suppl 1): S 122-6].
- SiRNA short interfering RNA
- siRNA consists of two, preferably two separate RNA strands, which hybridize to one another by base complementarity, ie, are substantially base-paired, and preferably has a length of up to 50 Nucleotides, preferably between 18 and 30 nucleotides, more preferably less than 25 nucleotides, and most preferably 21, 22 or 23 nucleotides, said numbers being based on a single strand of siRNA, in particular the length of the region of a single strand containing one, more particularly the second single strand hybridized or basenpart relate.
- siRNA specifically induces or mediates the degradation of rnRNA.
- siRNA is a biological strategy for cells to inhibit certain alleles during development and to protect against viruses.
- the siRNA-mediated RNA interference is used as a method to specifically suppress or even eliminate expression of a protein by introducing a gene-specific double-stranded RNA.
- a 19 to 23 nucleotide siRNA is particularly suitable because it does not lead to the activation of the nonspecific defense reaction, the so-called interleukin response.
- vectors which have an endogenous siRNA expression are also used in the prior art allow.
- oligonucleotides with a length of 64 nucleotides which include the 19 nucleotide target sequence, both in sense and in antisense orientation, separated by a example 9 nucleotide spacer sequence, are incorporated into the vector.
- the resulting transcript folds into a hairpin structure with a stem of, for example, 19 base pairs.
- the loop is rapidly cleaved to give a functional siRNA (Brummelkamp et al., Science, 296, 550-553, 2002).
- the present invention relates to a medicament containing at least one virus according to the present invention.
- the present invention relates to the use of the viruses of the invention for the manufacture of a medicament.
- the drug is intended for the treatment of tumors and cancers.
- the tumors and cancers are preferably those described herein.
- the tumors and cancers are those that are resistant or have resistance.
- the resistance is as described herein, more preferably multi-resistance, multiple resistance to cytostatics and / or radiation.
- the medicament is for restoring the susceptibility of cells to cytostatic agents and / or radiation, which cells are preferably tumor cells having resistance to cytostatic agents and / or radiation.
- Sensitivity restoration is a process known in English as "restoration of drug sensitivity".
- the medicament further contains at least one pharmaceutically active compound.
- the pharmaceutically active compound is selected from the group consisting of cytokines, metalloproteinase inhibitors, Angiogenesis inhibitors, cytostatic agents such as irinotecan and CPT-II for colorectal carcinoma and daunorubicin for leukemias, cell cycle inhibitors such as CYC202, which inhibits CDO / cyclinE-l ⁇ nas activity and can be used against colorectal tumors (McClue SJ, Int. J. Cancer 2002, 102, 463-468) and BAY 43-9006, which inhibits Raf-1 and is effective, for example, against mammary carcinoma (Wilhelm SM et al., Cancer Res.
- cytokines metalloproteinase inhibitors
- Angiogenesis inhibitors cytostatic agents such as irinotecan and CPT-II for colorectal carcinoma and daunorubicin for leukemias
- cell cycle inhibitors such as CYC202, which inhibits CDO
- proteosome inhibitors such as PS-341 which inhibits 26S proteasome activity and is used against head and neck squamous cell carcinoma (Fribley A et al., Mol Cell Biol 2004 Nov; 24 (22): 9695-704), recombinant antibodies against, for example, the EGF receptor (Herceptin for mammary carcinoma and Prostatic tumors; HG van der Poel, European Urology 2004, 1-17; Erbitux for cervical head tumors; Bauman M et al., Radiother.
- EGF receptor Herceptin for mammary carcinoma and Prostatic tumors
- HG van der Poel European Urology 2004, 1-17
- Erbitux for cervical head tumors
- Bauman M et al. Radiother.
- STI 57 1 signal transduction cascade inhibitors
- ABT-627 which is an endothelin inhibitor, which can be used inter alia against prostate tumors
- SU5416 which inhibits the phosphorylation of the VEGF tyrosine kinase receptor and can be used, inter alia, against glioblastoma and prostate cancer
- adenoviruses described herein or the adenoviruses to be used herein in accordance with the invention may be used in principle for any indication described herein in connection therewith. In a particularly preferred embodiment, the indication is as described for each of the aforementioned pharmaceutically active compounds.
- cytostatic agents are, in particular, chemical or biological compounds which, during or after administration to a cell or organism containing a cell or cells, cause the cell to cease to grow and / or cease to grow divides or slow down cell division and / or cell growth. Cytostatic agents are also those compounds which only become in the cell or in the organism containing them to a cytostatic in the sense described above. In that regard, the term cytostatic also includes pre-cytostatics.
- Cytostatics are preferably classified according to their mechanism of action.
- the following groups are distinguished, which in principle can all be used in the context of the present invention:
- Alkylating agents i. chemical compounds that cause their cytotoxic effect by alkylation of phosphate, amio, sulfhydryl, carboxyl and hydroxyl groups of the nucleic acid and protein. Such compounds themselves are often carcinogenic. Typical examples of this group of cytostatics are cisplatin or platinum derivatives, cyclophosphamide, dacarbazine, mitomycin, procarbazine.
- Antimetabolites i. Compounds that block or interfere with a metabolic process due to structural similarity or ability to bind.
- Structure-altering antimetabolites bind the metabolite, preventing its function or absorption, or chemically modifying the metabolite.
- Indirect antimetabolites interfere with the function of the metabolite, for example via binding of ions.
- Typical examples of this group are folic acid antagonists, e.g. Methotrexate, pyrimidine analogs such as e.g. Fluorouracil, purine analogues such as e.g. Azathioprine and mercaptopurine.
- Mitosis inhibitors ie inhibit cell division.
- cell division toxins ie cell division toxins
- spindle toxins ie cell division toxins
- chromosome toxins Typical examples of this group are taxanes and vinca alkaloids.
- the Taxana can in turn be divided into the two main groups taxols and Taxotere, with a particularly preferred taxol is paclitaxel and a particularly preferred taximeter docetaxel.
- Antibiotics with an inhibitory effect on the DNA-dependent RNA polymerase are the anthracyclines, such as bleomycin, daunorabicin, doxorubicin and mitomycin.
- Topoisomerase inhibitors are chemical compounds that determine the tertiary structure of DNA by catalyzing the change in DNA turnover number in a three-step process. Essentially, two forms of topoisomerases are distinguished. Type I topoisomerases cleave only one DNA strand and are ATP-independent, whereas type II topoisomerases cleave both strands of a DNA, which are ATP-dependent. Typical examples are n ⁇ notecan and topotecan for topoisomerase I inhibitors and etoposide and daunorubicin for topoismerase II inhibitors.
- At least one and preferably two agents are selected from the above group, but it is also within the scope of the present invention that in particular also three, four or five different agents are selected.
- the following embodiments are made for the embodiment of the present invention in which only one and preferably two agents are used together with the virus. The statements apply mutatis mutandis to the embodiment in which more than two agents are used.
- the agents differ in that they attack different target molecules or are described in the literature as acting on different molecules. It is within the scope of the present invention that the agent also comprises two or more different compounds which bind to the same target molecule. However, it is also within the scope of the present invention that one agent binds to a first location of the target molecule while the second agent binds to a second location of the target molecule. It is also within the scope of the present invention that at least two of the agents are active via a different mechanism of action. Active in a preferred embodiment that the cell growth and / or cell division inhibiting or retarding effect of the chemical compound in each case via a different Wirkmecham ' smus is active.
- the term "active" means that it increases the efficiency of replication of a virus, in particular the virus of the invention, the viruses described herein and / or the viruses disclosed herein as compared to a situation where one and / or both of the funds are not used.
- the efficiency of virus replication it is preferable to indicate the number of viruses required for cell lysis, more preferably expressed as p col / cell.
- one of the at least two agents is one which is intended to selectively affect the infectivity of the cell in which the replication of the virus is to take place, with the virus, preferably the virus described herein and / or according to the invention used virus, increased.
- the virus preferably the virus described herein and / or according to the invention used virus
- This can be done, for example, by increasing the uptake of the virus by the cell.
- Uptake of the virus, particularly adenovirus is mediated, for example, by the coxsackievirus adenovirus receptor (CAR) (Mizuguchi and Hayakawa, GENE 285, 69-77, 2002).
- Increased expression of CAR is caused, for example, by trichostatin A (Vigushin et al., Clinical Cancer Research, 7, 971-976, 2001).
- one of the at least two agents is one which increases the availability of a component within the cell, the component being one which replicates the virus, preferably the virus described herein and / or the virus to be used herein , elevated.
- one of the at least two agents is one which mediates the transport of YB-I into the nucleus.
- Such agent may be selected from the group comprising topoisomerase inhibitors, alkylating agents, antimetabolites and mitotic inhibitors.
- Preferred topoisomerase inhibitors are camptothecin, ⁇ rinotecan, etoposide and their respective analogs.
- Preferred mitosis inhibitors are daunorubicin, doxorubicin paclitaxel and docetaxel.
- Preferred alkylating agents are cisplatin and its analogs.
- Preferred antimetabolites are fluorouracil and methotrexate.
- one of the at least two agents is one which increases the cell's infectivity, in particular increases the expression of CAR, and the second of the at least two agents enhances the transport of YB-1 into the cell nucleus , wherein it is more preferable to use as a chemical compound one having the corresponding required property, as preferably mentioned above.
- An example of a class of expression enhancing CAR is the histone deacetylase inhibitors, and an example of a class of YB-I nuclear enhancing transport is the topoisomerase inhibitor.
- one of the at least two agents is a histone deacylase inhibitor and the other of the at least two agents is a topoismerase inhibitor.
- the one of the at least two agents is a histone deacylase inhibitor.
- a preferred histone deacylase inhibitor is one selected from the group comprising trichostatin A, FR901228, MS-27-275, NVP-LAQ824 and PXD101.
- Trichostatin A is described, for example, in Vigushin et al., Clinical Cancer Research, 7, 971-976, 2001;
- FR901228 is described, for example, in Kitazono et al., Cancer Res., 61, 6328-6330, 2001; MS-27-275 described in Jaboin et al., Cancer Res., 62, 6108-6115, 2002; PXD101 described in Plumb et al., Mol. Cancer Ther., 8, 721-728, 2003; NVP-LAQ824 described in Atadja et al., Cancer Res., 64, 689-695, 2004.
- At least one agent is selected from the group comprising trichostatin A (against glioblastoma, Kim JH et al., Int. J. Radiation Oncology Biol. Phys. 2004, 59, 1174-1180), FR 901228 (against pancreatic tumors, Sato N et al., Int J. Oncol 2004, 24, 679-685; MS-27-275 (against Prastatatumore; Camphausen K et al., Clinical Canver Research 2004, 10, 6066-6071) , NVP-LAQ824 (for leukemias; Nimmanapalli R et al., Cancer Res.
- trichostatin A as wellst glioblastoma, Kim JH et al., Int. J. Radiation Oncology Biol. Phys. 2004, 59, 1174-1180
- FR 901228 against pancreatic tumors, Sato N et al., Int
- the one of the at least two agents is a topoisomerase inhibitor, preferably in topoisomerase I inhibitor.
- a preferred topoisomerase inhibitor is one selected from the group comprising camptothecins, mnotecan, topotecan, SN-38, 9-aminocamptothecin, 9-nitrocamptothecin DX-895If and daunorubicin.
- Irinotecan and SN-38 are described, for example, in Gilbert et al., Clinical Cancer Res., 9, 2940-2949, 2003; DX-895IF is described in van Hattum et al, British Journal of Cancer, 87, 665-672, 2002; Camptothecin described in Avemann et al., Mol. Cell. Biol., 8, 3026-3034, 1988; 9-aminocamotothecin, and 9-nitrocamropytocine are described in Rajendra et al., Cancer Res., 63, 3228-3233, 2003; Daunorubicin is described in M. Binaschi et al., Mol. Pharmacol., 51, 1053-1059.
- the topoisomerase inhibitor is selected from the group comprising camptothecin, irinotecan, topotecan, DX-895K, SN-38, 9-aminocamptothecin, 9-nitrocamptothecin, etoposide and daunorubicin. These can be used against various tumors, for example colorectal tumors, pancreatic tumors, ovarian cancers and prostate cancers. The fields of application are described inter alia in Recchia F et al., British J. Cancer 2004, 91, 1442-1446; Cantore M et al., Oncology 2004, 67, 93-97; Maurel J.
- the indication is as described for each of the aforementioned pharmaceutically active compounds.
- the further pharmaceutical agent is selected from the group comprising cytokines, metalloproteinase inhibitors, angiogenesis inhibitors, cytostatics such as mnotecan and CPT-II for colorectal carcinoma and daunorubicin for leukemia, Cell cycle inhibitors such as CYC202, which inhibits CDK2 / cyclinE kinase activity and can be used against colorectal tumors (McClue SJ, Int.J.
- ABT-627 an endothelin inhibitor, which can be used, inter alia, against prostate tumors (HG van der Poel, European Urology 2004, 45, 1-17), SU5416 which inhibits the phosphorylation of the VEGF tyrosine kinase receptor and used, inter alia, against cervical / head tumors (Cooney et al., Cancer Chemother.Pharmacol 2004), ZD 1839, which inhibits EGFR tyrosinase activity and can be used, inter alia, against prostate tumors (HG van der Poel, European Urology 2004, 45, 1-17); Rapamycin derivatives such as CCI-779 and RADOO1, which inhibit mTOR and can be used against prostate tumors (HG van der Poel, European Urology 2004, 45, 1-17).
- the various viruses described herein or the viruses to be used herein in accordance with the invention may be used in principle for any indication described herein in connection therewith.
- the indication is as described for each of the aforementioned pharmaceutically active compounds.
- the medicament according to the invention and / or the medicament prepared according to the invention separate the virus from one or more of the at least one and preferably at least two agents which are associated with the virus are combined according to the invention contains.
- the agents are preferably pharmaceutically active compounds.
- the virus be separated from any agent that combines with the virus.
- the separation is a spatial separation.
- the spatial separation can be carried out so that the virus is present in a different packaging than the / the means.
- the packaging is a single dose, ie the virus and the agent (s) are packaged in unit doses. The individual doses can in turn be combined into a pack.
- the single doses of the virus are combined or packaged with one or more unit doses of one or more of the agents.
- the type of packaging depends on the mode of administration in the manner known to those skilled in the art.
- the virus will be present as a lyophilisate or in a suitable liquid phase.
- the agents will be in solid form, e.g. as tablets or capsules, but are not limited thereto. Alternatively, the agents may also be in liquid form.
- the virus is administered systemically or locally. It is also within the scope of the present invention that the agents combined with the virus are administered individually or jointly, systemically or locally. Those skilled in the art are aware of other forms of administration.
- the virus and the agent (s) combined with it are administered separately in time or simultaneously.
- the agent (s) be administered prior to administration of the virus.
- the length of time that the agent (s) are previously administered will depend on the nature of the agent (s) used and will be apparent to those skilled in the art from the mode of action of the agent (s) used.
- the administration of the at least two agents can again take place simultaneously or at different times.
- the time points again result from the mechanisms of action underlying the agents and can be determined by those skilled in the art on the basis thereof.
- kits include the virus and / or agent (s) in a form ready for use, and more preferably an instruction manual.
- the embodiments made herein apply to an aspect in general for all other aspects of the present invention and, in particular, to the embodiments of the viruses according to the invention also for the viruses, nucleic acids and the nucleic acids used according to the invention to be used according to the present invention, described herein or disclosed herein, and the replication systems according to the invention and the nucleic acids coding therefor or the replication systems used according to the invention and the nucleic acids used for this purpose according to the invention and vice versa.
- the medicament in the context of which or in the manufacture of which the viruses described here, in particular adenoviruses, are used according to the invention, it is provided that this is as a rule systemically administered, although it is also within the scope of the present invention if it is administered locally or is delivered.
- the application is made with the intention that in particular those cells are infected with the virus, and in particular there is a replication of viruses in which a participation, preferably causally, the formation of a condition, typically a disease, is present for their diagnosis and / or prevention and / or treatment the erfmdungswashe drug is used or can be used.
- Such a medicament is preferably provided for the treatment of tumor diseases.
- tumor diseases in which either YB-I is already present in the nucleus as a result of the underlying mechanism of the tumor disease, in particular the underlying pathological mechanism, deregulated YB-I, or by external Measures the presence of YB-I is determined in the nucleus, the measures are suitable to transfer YB-I into the nucleus, there to induce or express there.
- the term tumor or tumor disease is intended to denote both malignant and benign tumors and corresponding diseases.
- the medicament contains at least one further pharmaceutically active compound. The nature and extent of these other pharmaceutically active compounds will depend on the type of indication for which the drug is used.
- cytostatic agents such as cis-platin and taxol, daunoblastin, daunorubicin, adriamycin (doxorabicin) and / or mitoxantrone or others cytostatic agents or groups of cytotoxic agents described herein.
- the medicament according to the invention can be present in various formulations, preferably in a liquid form.
- the medicament will contain adjuvants such as stabilizers, buffers, preservatives and the like known to those skilled in the galenical art.
- the present inventor has surprisingly found that the viruses of the invention with particularly high success rate can be used in those tumors in which YB-I occurs independently of the cell cycle in the nucleus and those tumors that have deregulated YB-I.
- YB-I is present in the cytoplasm, especially in the perinuclear plasma.
- YB-1 is found in the nucleus of both normal and tumor cells.
- This is not sufficient to accomplish viral oncolysis using such modified adenoviruses.
- the comparatively low efficacy of such attenuated adenoviruses described in the prior art is ultimately based on their incorrect application.
- adenoviral systems especially with greater effectiveness, where the molecular-biological prerequisites for a viral oncolysis using these attenuated or modified adenoviruses described herein are given.
- These conditions are present in the tumor diseases described above, ie in those tumor diseases whose cells have a cell cycle-independent nuclear localization of YB-I or deregulated YB-I.
- This form of nuclear localization may be due to the nature of the tumor itself, or by the agents of the invention described herein, including herein .
- Viruses described, or measures are effected.
- the present invention thus defines a new group of tumors or tumor diseases and thus also of patients who can still be treated effectively with the viruses according to the invention, but especially with the attenuated or modified adenoviruses already described in the prior art.
- Akt which is a serine / threonm kinase, promotes growth of tumor cells by phosphorylation of transcription factors and cell cycle proteins (Nicholson KM and Anderson NG, Cell.
- Akt also phosphorylates YB-I, however, also weakens its cap-binding capacity, facilitating translational activation of silent mRNA species (Evdokimova V et al., Molecular and Cellular Biology, 26, 277-292, 2006). Since Akt is not active in normal cells, YB-I is not in the phosphorylated form, whereas YB-I is deregulated in such cells, i. H. phosphorylated and / or overexpressed.
- Another group of tumors or tumor diseases and thus of patients that can be treated using the viruses according to the invention and thus the medicament containing them are those in which it is ensured by applying or realizing certain conditions that YB-I in the nucleus migrates or is induced there or transported there, including using the invention or the viruses used in the invention.
- This use of the viruses in these tumors or this patient group is based on the finding that the induction of viral replication is based on the nuclear localization of YB-I with subsequent binding of YB-I to the E2-late promoter.
- This also applies to those cells that are YB-I core-positive and / or in cells in which YB-I is deregulated for the purposes of the present invention.
- viruses particularly adenoviruses
- adenoviruses are thus those that are YB-I nuclear positive and / or YB-I nuclear positive as a result of the treatments described below and / or those patients having any of those described herein
- YB-I core-positive patients are those patients, especially in a number of the one
- Tumor-forming cells have YB-I independent of the cell cycle in the nucleus.
- Measures include the administration of cytostatic agents as described herein in their entirety and / or used in the context of tumor therapy. Continue to belong to this
- Irradiation means in particular the irradiation with high-energy radiation, preferably with radioactive radiation, more preferably as it is used in the context of tumor therapy.
- Hyperthermia or the onset of hyperthermia is, preferably hyperthermia, as used in the context of tumor therapy. In a very preferred
- Embodiment is provided that the hyperthermia is applied locally.
- the hormone treatment in particular the hormone treatment, as used in the treatment of tumors.
- Hormone treatment uses anti-estrogens and / or anti-androgens. It will be appreciated that
- Anti-estrogens such as tamoxifen, especially used in the therapy of breast cancer and anti-androgens, such as flutamide or cyproterone acetate, in the
- YB-I either inherently or after induction or active imports into the nucleus have there or deregulated with respect to YB-I according to the present disclosure.
- YB-I nucleus-positive cells or cells in which YB-I is deregulated.
- the nuclear localization of YB-I can by Stress from the outside or locally applied stress induced.
- This induction can be effected, for example, by irradiation, in particular UV irradiation, use of cytostatics, as also disclosed, inter alia, herein, and hyperthermia.
- hyperthermia it is remarkable that this can be realized in the meantime very specifically, in particular locally specific, and thus also specifically can cause a nuclear transport of YB-1 into the cell nucleus and consequently the prerequisites for a replication of the adenovirus and thus of a cell and tumor lysis, which is preferably local restricted (Stein U, Jurchott K, Walther W, Bergmann S, Schlag PM, Royer HD, J Biol Chem., 2001, 276 (30): 28562-9; Hu Z, Jin S , Scotto KW, J Biol Chem., 2000 Jan 28; 275 (4): 2979-85; Ohga T, Uchiumi T, Makino Y, Koike K, Wada M, Kuwano M, Kohno K. J Biol Chem. 1998
- Resistance preferably denotes a resistance to cytostatics and in particular the cytostatic agents and / or radiation described herein.
- This multiple resistance is preferably associated with the expression, preferably overexpression of the membrane-bound transport protein P-glycoprotein, which can be used as a marker for the determination of appropriate cells and thus also of tumors or corresponding patient groups.
- resistance encompasses both resistance, also referred to as classic resistance, mediated by P-glycoprotein, as well as resistance, also referred to as atypical resistance, that mediated by MRP or other, non-P-glycoprotein mediated resistances.
- Further resistances as referred to herein and characteristic of the tumors or patients to be treated according to the invention, are those mediated by the following genes, but are not limited thereto: MDR, MRP, topoisomerase, BCL2, glutathione-S- Transferase (GST), protein kinase C (PKC).
- apoptosis-relevant genes plays a significant role in the development of resistance, so that the following factors are relevant in this regard, namely Fas, the BCL2 family, HSP 70 and EGFR [Kim et al., Cancer Chemther. Pharmacol. 2002, 50, 343-352].
- Another marker that correlates with the expression of YB-I is the topoisomerase II alpha.
- the viruses described can be treated with a view to success, instead of or in addition to the determination of YB-1 in the nucleus or deregulated YB-I, the expression of topoisomerase II alpha or any of the other markers described herein be used.
- a marker that can be used basically similar to the P-glycoprotein is MRP.
- Another marker, at least to the extent that colorectal carcinoma cells or patients with a colorectal carcinoma are or can be identified, is PCNA (proliferating cell nuclear antigen) (Hasan S. et al, Nature, 15, 387 391, 2001.), as described, for example, by Shibao K.
- MDR multiple drug resistance
- Another possible marker that can be used according to the invention is p73 (Kamiya, M., Nakazatp, Y., J Neurooncology 59, 143-149 (2002), Stiewe et al., J. Biol. Chem., 278, 14230-14236, 2003).
- tumor also generally refers herein to any tumor or cancer disease that either inherently contains YB-I in the nucleus or deregulated YB-I or by implementing exogenous measures, as disclosed herein. Y B-I in the nucleus, preferably independent of the cell cycle.
- viruses described herein can be used to treat tumors in principle.
- the tumors that can be specifically treated by the viruses described herein are also preferably those tumors selected from the group consisting of neoplastic tumors, ocular tumors, tumors of the skin, tumors of the soft tissues, gastrointestinal Tumors, respiratory system tumors, skeletal tumors, endocrine tumors, female genital tumors, mammary gland tumors, male genital tumors, urinary tract tumors, haematopoietic system tumors, and mixed and embryonic tumors. It is within the scope of the present invention that these tumors are, in particular, resistant tumors, as defined in particular herein.
- the group of tumors of the nervous system preferably comprises:
- tumors of the cranial cavity and the brain more preferably astrocytoma, oligodendroglioma, menigioma, neuroblastoma, ganglioneuroma, ependymoma, schwannoma, neurofibroma, hemangioblastoma, lipoma, craniopharyngioma, teratoma and chondroma;
- tumors of the spinal cord and spinal canal more preferably glioblastoma, meningioma, neuroblastoma, neurofibroma, osteosarcoma, chondrosarcoma, hemangiosarcoma, fibrosarcoma and multiple myelomas; and
- Peripheral nerve tumors more preferably schwannoma, neurofibroma, neurofibrosarcoma and perineural fibroblastomas.
- the group of ocular tumors preferably comprises:
- tumors of the eyelids and the eyelids more preferably adenoma, adenocarcinoma, papilloma, histiocytoma, mast cell tumor, basal cell tumor, melanoma, squamous cell carcinoma, fibroma and fibrosarcoma;
- conjunctival and pitchkin tumors more preferably squamous cell carcinoma, hemangioma, hemangiosarcoma, adenoma, adenocarcinoma, fibrosarcoma, melanoma and papilloma; and
- tumors of the orbit, the optic nerve and the eyeball more preferably retinoblastoma, osteosarcoma, mast cell tumor, meningioma, reticulocellular tumor, glioma, Schwannoma, chondroma, adenocarcinoma, squamous cell carcinoma, plasma cell tumor, lymphoma, rhabdomyosarcoma and melanoma.
- Uppe of the tumors of the skin preferably comprises:
- Upp the tumors of the soft tissues preferably comprises:
- PNET neuroectodermal tumors
- ppe of the gastrointestinal tumor preferably comprises:
- tumors of the oral cavity and tongue more preferably squamous cell carcinoma, fibrosarcoma, melanoma, inductive fibroblastoma, fibroma, fibrosarcoma, viral papillomatosis, idiopathic papillomatosis, nasopharyngeal polyps, leiomyosarcoma, myoblastoma and mast cell tumor;
- tumors of the salivary glands more preferably adenocarcinoma
- Tumors of the esophagus more preferably squamous cell carcinoma, leiomyosarcoma, fibrosarcoma, osteosarcoma, Barrett's carcinoma and paraoesophageal tumors;
- tumors of the stomach more preferably adenocarcinoma, leiomyoma, leiomyosarcoma and fibrosarcoma.
- Upp of the tumors of the respiratory system preferably comprises:
- tumors of the nose and nasal cavity, larynx and trachea more preferably squamous cell carcinoma, fibrosarcoma, fibroma, lymphosarcoma, lymphoma, hemangioma, hemangiosarcoma, melanoma, mast cell tumor, osteosarcoma, chondrosarcoma, oncozytoma (rhabdomyoma), adenocarcinomas and myoblastoma; and
- tumors of the lung more preferably squamous cell carcinoma, fibrosarcoma, fibroma, lymphosarcoma, lymphoma, hemangioma, hemangiosarcoma, melanoma, mast cell tumor, osteosarcoma, chondrosarcoma, oncozytoma (rhabdomyoma), adenocarcinomas, myoblastoma, small cell carcinoma, non-small cell carcinoma, bronchial adenocarcinoma, bronchoalveolar Adenocarcinoma and alveolar adenocarcinoma.
- Uppe of the tumors of the skeleton preferably comprises:
- Osteosarcoma chondrosarcoma, parosteal osteosarcoma, hemangiosarcoma, synovial cell sarcoma, hemangiosarcoma, fibrosarcoma, malignant mesenchymoma, giant cell tumor, osteoma and multilobular osteoma.
- ppe of the tumors of the endocrine system preferably comprises:
- tumors of the thyroid / parathyroid gland more preferably adenomas and adenocarcinomas; 2. adrenal tumors, more preferably adenoma, adenocarcinoma and pheochromocytoma (adrenal tumor);
- hypothalamic / pituitary tumors more preferably adenoma and adenocarcinoma;
- Tumors of the endocrine pancreas more preferably insulinoma (beta cell tumor, APUDom) and Zollinger-Ellison syndrome (gastrin-secreting tumor of the pancreatic delta cells); and
- MEN endocrine neoplasia
- uppe of the tumors of the female sex system preferably comprises:
- tumors of the ovaries preferably adenoma, adenocarcinoma, cystadenoma, and undifferentiated carcinomas;
- tumors of the uterus more preferably leiomyoma, leiomyosarcoma, adenoma, adenocarcinoma, fibroma, fibrosarcoma and lipoma;
- tumors of the cervix more preferably adenocarcinoma, adenoma, leiomyosarcoma and leiomyoma;
- tumors of the vagina and vulva more preferably leiomyoma, leiomyosarcoma, fibromyiomyoma, fibroma, fibrosarcoma, polyps and squamous cell carcinoma.
- Ppe of the tumors of the mammary gland preferably comprises:
- Upp of the tumors of the male sex system preferably comprises:
- tumors of the testes more preferably seminoma, interstitial cell tumor and uterine cell tumor;
- tumors of the prostate more preferably adenocarcinomas, undifferentiated carcinomas, squamous cell carcinomas, leiomyosarcomas and transitional cell carcinoma; and
- Tumors of the penis and external genitalia more preferably mast cell tumor and squamous cell carcinoma.
- Upp of the tumors of the urinary system preferably comprises:
- tumors of the kidney more preferably adenocarcinoma, transitional cell carcinoma (epithelial tumors), fibrosarcoma, chondrosarcoma (mesenchymal tumors), Wiim's tumor, nephroblastoma and embryonic nephroma (embryonic pluripotent blastomas);
- Tumors of the urether more preferably leiomyoma, leiomyosarcoma, fibropapilloma, transitional cell carcinoma;
- tumors of the bladder more preferably transitional cell carcinoma, squamous cell carcinoma, adenocarcinoma, botryoid (embryonic rhabdomyosarcoma), fibroma, fibrosarcoma, leiomyoma, leiomyosarcoma, papilloma and hemangiosarcoma; and
- tumors of the urethra more preferably transitional cell carcinoma, squamous cell carcinoma and leiomyosarcoma.
- ppe of the tumors of the hematopoietic system preferably comprises:
- the group of mixed and embryonic tumors preferably comprises:
- Hemangiosarcomas Hemangiosarcomas, thymoma and mesothelioma.
- these tumors are selected from the group comprising breast cancer, ovarian carcinoma, prostate carcinoma, osteosarcoma, glioblastoma, melanoma, small cell lung carcinoma, and colorectal carcinoma.
- Other tumors are those that are resistant as described herein, preferably those that are multi-resistant, especially those tumors of the group described above.
- Particularly preferred tumors are also those selected from the group consisting of breast tumors, bone tumors, gastric tumors, intestinal tumors, gallbladder tumors, pancreatic tumors, liver tumors, kidney tumors, brain tumors, ovarian tumors, skin and skin appendage tumors, head / neck tumors, uterine tumors, synovial tumors, Including laryngeal tumors, esophageal tumors, tongue tumors and prostate tumors. It is preferred that these tumors are in terms of their expression as they are disclosed herein as a whole.
- tumors that can be used using the viruses of the invention are leukemias and metastatic tumors, especially metastatic tumors of the aforementioned tumors.
- Other tumors which may be treated according to the invention are selected from the group comprising primary tumors, secondary tumors, tertiary tumors and metastatic tumors. In this case, it is preferred if the tumors have at least one of the following features, namely that they have cell cycle-independent YB-1 in the nucleus, regardless of the cause, and / or that they have deregulated YB-I.
- Another group of tumors that can be treated using the viruses of the invention are any of the aforementioned tumors described herein as being treatable with the viruses of the invention, if they have one or more of the resistivities disclosed herein.
- such tumors can also be treated with the viruses according to the invention or using the viruses disclosed herein which have neither YB-1 in the nucleus, preferably independent of the cell cycle in the nucleus, nor deregulated YB-I exhibit. This is especially true when the viruses themselves code for YB-I. Because of Specificity of the expression of YB-I and thus the specificity of the replication of the viruses will in these embodiments put the expression of the viruses under the control of a preferably highly regulated promoter. Such a promoter may basically be any promoter that can be specifically activated so that the viruses replicate only in the intended cells.
- promoters are, in particular, tumor-specific promoters and gene-specific promoters known to those skilled in the art. Furthermore, it is also possible to monoclade the coding sequence for YB-I into the viral genome so that it is expressed via the adenoviral major late promoter (MLP). It is active mainly after the start of adenoviral replication (Tollefson AE et al., Journal of Virology 66, 3633-3642, 1992, Bauzon M. et al., Molecular Therapy 7, 526-534, 2003).
- MLP adenoviral major late promoter
- YB-I belongs to a group of highly conserved factors that bind to the inverted CAAT sequence, the so-called Y-box. They may be regulatory at both the transcriptional and translational level (Wolffe, A.P. Trends in Cell Biology 8, 318-323, 1998).
- the nucleic acid coding for YB-I which is part of the virus in one embodiment of the viruses to be used according to the invention, may comprise a nucleic acid sequence mediating nuclear transport of YB-1.
- viruses in particular adenoviruses, and adenoviral systems as well as the adenoviruses known in the prior art, such as onyx-015, Ad ⁇ 24, can be used as viruses or viral systems and thus the corresponding nucleic acids.
- Suitable nuclear transport mediating nucleic acid sequences are known to those of skill in the art and are described, for example, in (Whittaker, GR et al., Virology, 246, 1-23, 1998, Friedberg, EC, TIBS 17, 347, 1992, Jans, DA et al., Bioessays 2000 Jun; 22 (6): 532-44; Yoneda, Y., J. Biochem. (Tokyo) 1997 May; 121 (5): 811-7; Boulikas, T., Crit Rev. Eukaryot Gene Expr. 1993; 3 (3): 193-227; Lyons RH, Mol. Cell Biol., 7, 2451-2456, 1987).
- YB-I is formed as a fusion protein with a signal peptide and, as a result of the signal peptide, YB-I is introduced into the cell nucleus and thus replicates the adenoviruses according to the invention.
- Another principle which can be used in the embodiment of the adenoviruses used according to the invention is that YB-I is provided with a transport sequence which leads to YB-1, preferably starting from a synthesis in the cytoplasm, entering the cell nucleus is slid or translocated and promotes viral replication there.
- a particularly effective nuclear transport-mediating nucleic acid sequence is the TAT sequence of HIV, which is described, for example, in Efthymiadis, A., Briggs, LJ, Jans, DA, JBC 273, 1623-1628, among other suitable such nucleic acid sequences , 1998. It is within the scope of the present invention that the adenoviruses used according to the invention comprise the nucleic acid sequences which code for the peptides encoding the nuclear transport.
- YB-I is in full length, in particular in a form corresponding to the wild type of YB-I. It is further within the scope of the present invention that YB-I is used or is present as a derivative, for example, in truncated or truncated form.
- a YB-I derivative as used or present in the present invention is one that is capable of binding to the E2 late promoter and thereby gene expression from the adenoviral E2 region or elements activated.
- Such derivatives include, in particular, the YB-1 derivatives disclosed herein. Further derivatives can be generated by deleting single or multiple amino acids at the N-terminus, at the C-terminus or within the amino acid sequence.
- YB-I fragments are also designated and used as YB-I proteins in the context of the present invention.
- Jannett K et al. JBC 2003, 278, 27988-27996 disclose various YB-I fragments characterized by deletions at the C and N terminus. The distribution of the different YB-1 fragments has shown that both the cold-shock domain (CSD) and the C-terminus are important for the cell cycle-regulated transport of YB-I into the cell nucleus.
- CSD cold-shock domain
- a truncated YB-I (also referred to herein as YB-I protein) in conjunction with the expression of ElB55k and E4orf6 according to the invention migrates better into the nucleus and thus induces a stronger CPE, without inevitably bind better to the E2-late promoter compared to the native YB-I, wherein it should not be ruled out that a truncated YB-I migrates better into the nucleus and does both, ie induced CPE and the E2-late Promoter binds.
- truncated YB-1 fragments may also migrate better into the nucleus and be more effective there bind the E2 late promoter without inducing a better CPE. It is also within the scope of the present invention that truncated YB-1 proteins or fragments comprise further sequences as described herein in the context of full-length YB-1, in particular cell localization signal sequences (NLS) and the like.
- NLS cell localization signal sequences
- the invention also relates, in a further aspect, to a method for screening patients treatable with the viruses of the invention and / or using the viruses and drugs described herein, the method comprising the steps of:
- the examination of the tumor tissue is carried out using an agent or agent selected from the group comprising antibodies against YB-I, specific binding peptides, aptamers against YB-I, mirror mice against YB- I and anticalins against YB-I.
- an agent or agent selected from the group comprising antibodies against YB-I, specific binding peptides, aptamers against YB-I, mirror mice against YB- I and anticalins against YB-I.
- the same agents can be prepared or used for the corresponding YB-I alternative markers.
- the production of antibodies, particularly monoclonal antibodies, is well known to those skilled in the art.
- Another means for the specific detection of YB-I or the markers are peptides that bind with high affinity to their target structures, in this case YB-I or the said markers.
- phage display to produce such peptides.
- This is typically based on a peptide library, wherein the individual peptides have a length of about 8 to 20 amino acids and the size of the library is about 10 2 to 10 18 , preferably 10 8 to 10 15 different peptides.
- a special form of binding to target molecules polypeptides represent the so-called anticalins, as described for example in German Patent Application DE 197 42 706.
- aptamers Another means of specific binding to YB-I or the corresponding, alternative to YB-I marker and thus to demonstrate a cell cycle-independent localization of YB-I in the nucleus are the so-called aptamers, ie D-nucleic acid, based on RNA or DNA base either as a single strand or as a double strand and bind specifically to a target molecule.
- the preparation of aptamers is described, for example, in European Patent EP 0 533 838.
- a special form of aptamers are the so-called aptazymes, which are described, for example, by Piganeau, N. et al. (2000), Angew. Chem. Int. Ed., 39, No.
- aptamers insofar as they still have a Ribozymanteil addition to the aptamer and after binding or release of binding to the aptamer part of the target molecule of the ribozyme catalytically becomes active and a nucleic acid substrate cleaves, which is associated with the generation of a signal.
- aptamers are so-called mirror animals, d.
- the process for the preparation of Spiegelmeren is described for example in WO 98/08856.
- the tumor tissue sample can be obtained by puncture or surgery.
- the determination as to whether YB-I is cell-cell-independently located in the nucleus is often done using microscopic techniques and / or immunohistochemistry, typically using antibodies or any of the other means above. Further methods for detecting that YB-I is located in the nucleus and especially there cell cycle-independent, are known in the art. For example, in the screening of YB-I stained tissue sections, the location of YB-I can be readily recognized. This results in the fact that it is a cell cycle-independent localization in the nucleus already due to the frequency of occurrence of YB-I in the nucleus.
- Another way to nucleate YB-1 in the nucleus is to stain YB-I and determine if YB-I is localized in the nucleus, and to determine the cell stage of the cells.
- this or the detection of YB-I can also be carried out using the abovementioned agents directed against YB-I.
- the detection of the agents is done by procedures known to those skilled in the art.
- the said agents are specifically directed against YB-I and insofar do not bind to other structures within the sample to be investigated, in particular the cells, can be detected by a suitable labeling of the agents their localization and, as a result of their specific binding to YB-I, the localization of YB-I can be detected and detected accordingly.
- Methods of labeling the agents are known to those skilled in the art.
- the viruses described herein are also useful in diseases, preferably tumors and more preferably tumors, in which at least some of the tumor cells have a multiple resistance, especially having a multidrug resistance, can be used, in which YB-I is deregulated.
- diseases preferably tumors and more preferably tumors, in which at least some of the tumor cells have a multiple resistance, especially having a multidrug resistance
- YB-I is deregulated.
- This also applies to any other aspect as described herein in the context of cells and tumors, as it relates to cells and diseases in which YB-1 is in the nucleus, preferably located in the nucleus independent of the cell cycle.
- viruses of the invention or the viruses and viral systems to be used herein are preferably adenoviruses or adenoviral systems, the knowledge, methods and uses, nucleic acids, proteins, replication systems and the like described herein are not limited to adenoviruses.
- the viruses used according to the invention or the nucleic acids coding for them is any corresponding viral nucleic acid which leads to a replication event on its own or in combination with other nucleic acid sequences. It is possible that helper viruses provide the sequences and / or gene products required for replication. As used herein, referring to coding nucleic acid sequences, which are those nucleic acid sequences that are known, it is within the scope of the invention that not only the identical sequence be used, but also sequences derived therefrom.
- derived sequences herein is meant in particular those sequences which still lead to a gene product, be it a nucleic acid or a polypeptide, which has a function which corresponds to one or the function of the non-deduced sequence. This can be done by simple, familiar to the expert routine tests are determined.
- deduced nucleic acid sequences are those nucleic acid sequences which code for the same gene product, in particular for the same amino acid sequence, but have a different sequence of bases due to the degeneracy of the genetic code.
- viruses according to the invention are present as replication systems with and without helper viruses.
- adenoviral replication system in one embodiment that the adenoviral nucleic acid and / or the nucleic acid of the helper virus is present as a replicable vector.
- nucleic acid (s) coding for the viruses as used according to the invention are / are present in a vector, preferably in an expression vector, and this expression vector is used according to the invention.
- the present invention also relates to a vector group comprising at least two vectors, wherein the vector group as a whole comprises a viral replication system as described herein, and the vector group is used according to the invention. It can be provided that each component of the viral replication system is arranged on its own vector, preferably an expression vector.
- the present invention also relates to the use of a cell which encodes one or more of the nucleic acids coding for the inventive use of the viruses described herein which are to be used according to the invention, and / or a corresponding adenoviral replication system and / or or a corresponding vector and / or a vector group according to the invention, for the same purposes as described herein for the viruses
- viruses and in particular their nucleic acids or the nucleic acids coding therefor can also be introduced into a cell, in particular a tumor cell, as individual components, in which case these interact as if the various individual components were present Single components of a single nucleic acid or a single or multiple viruses.
- the nucleic acids used according to the invention and coding for viruses, viral systems or parts thereof can be present as vectors.
- they are viral vectors.
- the virus particle is preferably the vector.
- the said nucleic acids are present in a plasmid vector.
- the vector has elements which are responsible for the proliferation of the inserted nucleic acid, i. H. Provide and control replication and optionally expression of the inserted nucleic acid.
- Suitable vectors particularly expression vectors, and corresponding elements are known to those skilled in the art and are described, for example, in Grunhaus, A., Horwitz, M.S., 1994, Adenoviruses cloning vectors. In Rice, C, eds., Seminars in Virology, London: Saunders Scientific Publications.
- a vector group accordingly comprises at least two vectors. Otherwise, regarding the vectors or vector group, the terms generally used herein refer to vectors.
- viruses used in the invention are characterized by the various nucleic acids or gene products disclosed herein and may otherwise include all those elements known to those skilled in the art, as is particularly the case with wild-type adenoviruses (Shenk, T .: Adenoviridae: The virus and their replication, Fields Virology, 3rd Ed., Eds. Fields, BN, Knipe, DM, Howley, PM et al., Lippincott-Raven Publishers, Philadelphia, 1996, Chapter 67).
- the present invention relates to a method for the treatment of tumor diseases comprising the administration of a virus according to the invention, or the disclosed virus nucleic acid, vector, replication system, medicament or pharmaceutical composition.
- the tumor disease is one as disclosed herein.
- the patient needs treatment, and is preferably one of one of the patient groups disclosed herein. It is within the scope of the present invention that, unless stated otherwise, the features and embodiments disclosed in each case for the viruses, nucleic acid, vectors, replication systems, medicaments and pharmaceutical compositions according to the invention or the viruses to be used according to the present invention, nucleic acids , Vectors, replication systems, medicaments and pharmaceutical compositions also apply to all other aspects of the present invention and vice versa.
- Figure 1 is a schematic representation of the regulation of the E2 region of adenovirus by the promoters E2-late and E2 early by E2F and YB-I.
- Fig. 2 shows the schematic structure of wild-type adenovirus
- Fig. 3 is a schematic representation of an adenovirus Xvir 05 / promoter of the invention expressing protein IX under the control of the E2 late promoter;
- Figure 4 is a schematic representation of an adenovirus Xvir 05 / E1A12S of the invention expressing protein DC as part of the E1B55K reading frame under the control of E1A12S;
- Figure 5 is a schematic representation of an adenovirus Xvir 05 / E1B19K of the invention expressing protein DC under the control of ElB 19K;
- FIG. 5a shows a schematic representation of an adenovirus Xvir 05 / E3-DC according to the invention expressing protein DC under the control of the E3 promoter
- Figure 6 is a schematic representation of the wild-type adenovirus and the adenovirus Xvir 05 according to the invention, which is an embodiment of the virus Xvir 05 / E1B19K
- Figure 7 is a schematic representation of the wild-type adenovirus and the adenovirus Xvir 05 / protein IX according to the invention, which is an embodiment of the virus Xvir 05 / E1A12S;
- Figure 8 is a schematic representation of the wild-type adenovirus and adenovirus Xvir 05/01 according to the invention, which is an embodiment of the virus Xvir 05 / protein IX;
- FIG. 9 shows a schematic representation of the wild-type adenovirus and the adenovirus Xvir 05/02 according to the invention, which is a further embodiment of the virus Xvir 05 / protein IX;
- 11 shows the schematic structure of the oncolytic adenovirus XVir03-3'UTR.
- FIG. 1 shows a schematic representation of the regulation of the E2 region of adenovirus by the Promo gates E2-late and E2 early by E2F and YB-I.
- FIG. 1 shows the promoters involved, E2-early and E2-late promoter, with respect to binding or activation by E2F and YB-I.
- the wild-type El A protein interrupts the binding of E2F to the retinoblastoma protein Rb.
- the thus-released E2F binds to the E2-early promoter, thereby inducing adenoviral replication.
- a so-called switch to the E2-late promoter is made possible only by the translocation of YB-I from the cytoplasm into the nucleus. Following nuclear translocation, YB-I activates E2 gene expression by binding to the E2-late promoter.
- E2F / RB and the ElA mediated release of E2F is fundamentally different from the mechanism underlying the present invention. Not the release of E2F from the Rb protein, as assumed in the art, is important, not to say the crucial process of adenoviral replication, but the nuclear localization of the human transliterative factor YB-I. This transcription factor occurs in normal cells throughout most of the cell cycle only in the cytoplasm.
- nucleus After infection with an adenovirus this is under certain Conditions in the nucleus are already in the nucleus or present in certain cellular systems such as, but not limited to, breast cancer, breast cancer, ovarian cancer, prostate cancer, osteosarcoma, glioblastoma, melanoma, small cell lung carcinoma and colorectal carcinoma.
- the adenovirus is still ElB19K-minus and protein IX-minus in the sense that protein IX is not included in the wild-type regulatory context and protein IX is not expressed.
- the expression is controlled by the E2 late promoter.
- the protein IX has been cloned into the E3 region, but in principle can also be cloned into the E4 region.
- the genes for E2A, E2B, E4 and MLP are still present and expressible.
- the transporter consisting of E4orf6 and E1B55K is formed by the cassette E4orf6-IRES-E1B55K under the control of the CMV promoter.
- the corresponding cassette has been cloned into the region of the El region, but could also be cloned into other regions such as the E3 or E4 region.
- the adenovirus in the adenovirus XvirO5 / ElA12S shown in Figure 4, the adenovirus is still ElB19K-minus and protein IX-minus in the sense that protein IX is not included in the wild-type regulatory context and protein IX is not expressed. Rather, expression is due to the E1A12S driven by the E2 late promoter, which causes the protein IX reading frame contained in the E1B55K coding region region to be activated.
- the protein E1A12S has been cloned into the E3 region, but in principle can also be cloned into the E4 region.
- the genes for E2A, E2B, E4 and MLP are still present and also expressible.
- the transporter consisting of E4orf6 and E1B55K is formed by the cassette E4orf6-IRES-E1B55K under the control of the CMV promoter.
- the corresponding cassette has been cloned into the region of the El region, but could also be cloned into other regions such as the E3 or E4 region.
- the adenovirus is still ElB19K-minus and protein IX-minus in the sense that protein IX is not included in the regulatory context present in the wild-type. Rather, expression is controlled by the protein ElB 19K, which expresses under the influence of the CMV promoter and allows expression of the reading frame of protein DC contained in the E1B55K reading frame.
- the genes for E2A, E2B, E3, E4 and MLP are still present and expressible.
- the transporter consisting of E4orf6 and E1B55K is formed by the cassette E4orf6 RSV promoter El B region under the control of the CMV promoter. The corresponding cassette has been cloned into the region of the El region, but could also be cloned into other regions such as the E3 or E4 region.
- the adenovirus in the adenovirus Xvir05 / E3-IX shown in Figure 5a, the adenovirus is still ElB19K-minus and protein IX-minus in the sense that protein ElB 19K is not included in the wild-type regulatory context and does not express protein DC becomes. Rather, expression is controlled by the natural E3 promoter.
- the genes for E2A, E2B, E4 and MLP are still present and expressible.
- the transporter consisting of E4orf6 and E1B55K is formed by the cassette E4orf6-IRES-E1B55K under the control of the CMV promoter.
- the corresponding cassette has been cloned into the region of the El region, but could also be cloned into other regions such as the E3 or E4 region.
- FIGS. 6 to 9 show further embodiments of the adenoviruses according to the invention.
- the virus shown in Figure 6 is a further development of the adenovirus Xvir 05 / E1B19K shown in Figure 5.
- this virus has a cassette under the control of the E2-late promoter, which comprises E1A12S and YB-1 or a nucleic acid coding therefor, the two reading frames being separated from one another by an IRES.
- the coding for YB-I Nucleic acid is not contained in the cassette. The nucleic acid expressed by the virus for YB-I leads to an even stronger replication in cells with deregulated YB-I.
- the adenovirus shown in FIG. 8 is a further development of the adenovirus shown in FIG. 6, in which case the cassette under the control of the E2-late promoter, which comprises El A12S and YB-I or a nucleic acid coding therefor, in FIG the E4 region is cloned and different transgenes are cloned into the E3 region under the control of the E3 promoter, such as apoptosis-inducing genes, prodrug genes, siRNA, tumor suppressor genes or cytokines. Alternatively, the various transgenes disclosed herein may be cloned into this region.
- the adenovirus according to the invention shown in FIG. 9 is a further development of the adenovirus shown in FIG. 8, whereby the RGD motif which is advantageous for the targeting of the viruses is additionally cloned in here.
- This is located in the adenoviral genome in the fiber protein in the range of about 32675- 32685. This variation in the exact position is due to the fact that the sequences of wild-type adenovirus in the various databases or bakneinträge are different or have a different Lzana.
- the adenovirus according to the invention shown in FIG. 7 is based on the virus shown in FIG. In contrast, however, this adenovirus has no cassette from E4orf6 and E1B55K, but both are controlled by different promoters, namely the CMV promoter and the RSV promoter. The Einklontechnik takes place in the El region.
- the adenovirus still has a nucleic acid coding for the protein DC, which is separated by an IRES from that of E1A12S. In principle, this cassette could also be designed without the nucleic acid coding for protein IX.
- this virus could also contain the transgenes as described in connection with the virus shown in FIG. 8 in the E3 or E4 region.
- the RGD motif is included in another embodiment of this adenovirus.
- the cells were either uninfected (K), infected with the wild-type adenovirus, or infected with Xvir03.
- the infection was carried out in 1.5 ml of serum-free DMEM medium for 1 h at 37 ° C. Subsequently, the infection medium was removed and replaced by 10 ml of complete medium (10% FCS / DMEM). After 24-48 h, the RNA was isolated. Subsequently, a Northern blot analysis was performed.
- RNA were electrophoretically separated in an agarose gel with 3% formaldehyde, then blotted onto a nylon membrane and hybridized against a specific 386 bp probe.
- a probe which is generated by means of a PCR, a P32-labeled probe was used which is directed against the protein IX.
- the following primers were used for the PCR: 5'-TATTTGACAACGCG; 5'-TTTTAAACCGCATTGGG.
- the position of the probe in the wild-type adenovirus genome is between positions 3648 and 4033.
- the virus used is Xvir 03, which shows no expression of the protein DC.
- the virus Xvir03-3'UTR shows a reduced expression in the tumor cells 257RDB compared to the wild-type adenovirus.
- 293 cells expressing ElA and EIB proteins, including the ElB 19K protein sufficient protein DC is expressed.
- the expression cassettes CMV-E4Orf6 and RSV-ElB region ensure, inter alia, the expression of the viral proteins E4ORF6 and ElB55k. This leads to the translocation of YB-I into the nucleus.
- the virus is also able to inhibit the expression of the ABC transporters MRP and MDRl.
- the proteins E1B19K and protein DC are expressed as part of the cassette RSV-ElB region.
- the vector Xvir05 -Protein DC represents a further vector development. There, the expression of the adenoviral protein DC, which is present in the expression cassette E21ate E1A12S IRES protein DC, ensured. The verifier does not contain the entire EIB region but only the ElB55k open reading frame.
- the entire EIB region i. the ElB19k, ElB55k and the protein DC are controlled by a viral, non-adenoviral promoter, for example the RSV promoter.
- the expression cassette E21ate-E1A12S-IRES-YB-1 is located in the E4 region.
- specific therapeutic transgenes can be cloned into the E3 region.
- the E3 deletion is designed to still express the adenoviral ADP protein adenoviral death protein, and expression of E1A12S and ElB19k causes expression of the DC protein
- the vector Xvir05 / 02 additionally has an RGD motif in the H-loop of the fiber knob to ensure a better infection rate.
- viruses were prepared as follows: Modification of the rescue plasmid pAdEASY CFirma Obiogene)
- a CMV promoter and a bovine growth hormone polyadenylation signal were cloned into the present vector pShuttle-AdEASY.
- the plasmid was digested with EcoBl, the ends were smoothed by filling with T4 polymerase and dNTPs, the backbone was dephosphorylated and the two resulting cut products religated. By doing so, the restriction recognition sequences for EcoRI were destroyed.
- the resulting plasmid was named pShuttle (-EcoRI) -AdEAS Y.
- cassette CMV-MCS-polyA from the pShuttle from Clontech was cut with Mfel and EcoRI, the ends were smoothed and cloned into the vector pShuttle (-EcoRI) -AdEASY, which was linearized with Xbael, blunted and dephosphorylated. This resulted in the plasmid CMV-MCS-PolyA-pShuttle-AdEASY.
- the ⁇ E3E4 region from the plasmid pAdEASY with Spei and Päd was cloned into the plasmid CMV-MCS-polyA-pShuttle-AdEASY and thus the plasmid ⁇ E3E4-p shuttle AdE AS Y was generated.
- the plasmid ⁇ E3E4-pShuttle (-AWeI) -AdEASY was produced by restriction with Ndel and religation of two Ndel interfaces.
- This procedure produced the plasmid ⁇ E3E4-pShuttle (-AWeI) -AdEASY.
- the E4 region was specifically deleted in the plasmid ⁇ E3E4-pShuttle (- AWeI) -AdEASY.
- Corresponding deletions are feasible in other systems for the production of recombinant adenoviruses by a person skilled in the art.
- the HI loop of the Fiber-knob domain was modified (the adenovirus Vector with Genetically Modified Fibers Demonstrates Expanded Tropism via Utilization of a Coxsackievirus and Adenovirus Receptor Independent Cell Entry Mechanism): The corresponding region was treated with primers RGD-Hpa fw (5'- GAGgttaacCTAAGCACTGCCAAG-3 '), RGD-EcoRV rev (5'-
- RGD oligo 1 (5 'CACACTAAACGGTACACAGGAAACAGGAGACACAACTTGTGACTGCCGCGGAGACT GTTTCTGCCC-3') and RGD-Oligo 2 (5'-GGGCAGAAACAG TCTCCGCGGCAGTCA CAAGTTGTGTCTCCTGTTTCCTGTGTACCGTTTAGTGTG- S ').
- the 2709 bp fragment excised with Spei (27083 bp) and xliol (29792 bp) from the wild-type virus DNA was cloned in (pcDNA3.1 (+ ) oCMV / E3a ⁇ 7zöI).
- cut at the 3 'end instead of Xhol with Hpal (30570 bp).
- the vector pcDNA3.1 (+) oCMV is then cut open with Spei and EcoRV and the adenoviral Spel-H Georg fragment cloned into it (pcDNA3.1 (+) oCMV / E3aHpal).
- pcDNA3.1 (+) oCMV / E3aHpal adenoviral Spel-H Georg fragment cloned into it.
- 2718 bp EcoRI fragment from the adenovirus wild-type DNA positions 27332 bp and 30050 bp
- is cloned into the EcoRI-opened ⁇ cDNA3.1 (+) oCMV ⁇ cDNA3.1 (+) oCMV / E3aEcoi? 7).
- the E3a region could be cloned into the vector ⁇ E3RGD- E4 ⁇ ORF6-pShuttle (-NJeI) -AdEASY.
- the shuttle vector ⁇ E3RGD-E4 ⁇ ORF6-pShuttle (-NJeI) -AdEASY was used for this purpose Nhel cut, the ends smoothed and further cut with Spei.
- the insert from pcDNA3.1 (+) oCMV / E3aA7zoI was cloned into this site: the plasmid was cut with Xhol, the ends were smoothed and further cut with Spei.
- the excised fragment was cloned into the previously cut-up plasmid ⁇ E3RGD-E4 ⁇ ORF6-pShuttle (-MM) -AdEAS Y.
- the E3a region can be amplified by PCR with the primers E3a forward (Spei) 5'-CTTAAGGACTAGTTTCGCGC -3 'and E3a reverse ⁇ Xhol, Nhel) 5'-CAAGCTAGCTCGAGGAATCATG -3' with the adenovirus type 5 wild-type DNA as template become.
- the E3a reverse V ⁇ msx generates a NAeI interface.
- the amplificate is restricted with Spei and Nhel and cloned into the similarly Spei and Nhel vector ⁇ E3RGD-E4 ⁇ ORF6-pShuttle (-MM) -AdEASY.
- the E3a region can be amplified by PCR with the primers E3a forward (Spei) 5'-CTTAAGGACTAGTTTCGCGC -3 'and E3a reverse ⁇ Hpal, Nhel) 5'CACGCTAGC AAGTT AACCATGTCTTGG-3' with the adenovirus type 5 wild-type D ⁇ A as template be amplified.
- the E3a reverse primer generates an Nhel interface.
- the amplificate is restricted with Spei and NAeI and cloned into the similarly Spei and Nhel vector ⁇ E3RGD-E4 ⁇ ORF6-pShuttle (-NJeI) -AdEASY.
- the E3a region can be amplified by PCR with the primers E3a forward (EcoRI) 5'-GAAACCGAATTCTCTTGGAAC -3 'and E3a reverse ⁇ Nhel, EcoRI) 5'-GAATTCTAGCTAGCTCAGCTATAG -3' with the adenovirus type 5 wild-type D ⁇ A as template ,
- the ⁇ 3a reverae primer becomes an N7zel interface generated.
- the amplificate is restricted with EcoRI and Nhel and cloned into the vector ⁇ E3RGD-E4 ⁇ ORF6- ⁇ Shuttle (-Nde ⁇ ) -AdEASY, likewise cut open with EcoRI and MeI.
- the region thus formed comprises the E3 region beyond the open reading frame for the E3 ADP (position 29772 bp) and thus the E3 promoter, the entire E3A region with polyadenylation signal, the transcription start, and the open reading frame for 12.5 K, E3 6,7 K 5 E3 gpl9 K and E3 ADP.
- the E2Late promoter was constructed as paired oligonucleotides (Upper Primer 5'-TCGAGCTCCGCATTTGGCGGGCGGGATTGGTCTTCGTAGAACCTAATCTCGTGGGCG TGGTAGTCCTC AGGT AC AAAT-3 'and Lower Primer 5'-
- the luciferase gene was excised with Ncol and Xhal, the ends were smoothed and T-ends were attached.
- the transgene ElA 12S was obtained by RT-PCR with primers EIa 12S forward 5'-ATGGCCGCCAGTCTTTG-S 'and EIa 12S reverse 5 '-TTATGGCCTGGGGCGTTTAC-S' was amplified by TA cloning.
- the cassette thus contains the E2Late promoter, the Ela-12S open reading frame and the SV-40 late polyadenylation signal of the pGL3 vector.
- This cassette was excised with Pvul and CIal, blunt-ended, and now optionally cloned into EcoRII, BsiII, Dral, Muni deleted (after removal of open reading frames for E3 6.7K and gpl9K, see above) E3a region or in deletion of E4ORF6, for example in the blunted and dephosphorylated 5 / rI cleavage site.
- the resulting construct is E3a / E2Late-Ela-12S / ⁇ E3RGD-E4 ⁇ ORF6-pShuttle (-NJeI) - AdEASY or E3a ⁇ E3RGD-E4 ⁇ ORF6 / E2Late-Ela-12S shuttle (-NJeI) -AdEASY.
- EIa 12S see above
- IRES element pCITE-4a (+) from the company ⁇ ovagen as template
- the plasmid Ela-12S was linearized in pcDNA3.1 (+) with EcoRV, T- ⁇ nden attached and cloned the amplificate for the IR ⁇ S element.
- the resulting construct ⁇ la-12S-IR ⁇ S-pcDNA3.1 (+) was linearized with NotI and the ends were smoothed, as was the YB-l-EcoRI cut product from the plasmid pHVad2c CMV / S40 + Yb-I s (Stephan Bergmann ) and introduced into the dephosphorylated vector E1A-12S-IRES-pcD ⁇ A3.1 (+).
- the PCR amplicon for the protein IX open reading frame can be inserted into the smoothed NotI site of the vector Ela-12S-IRES- ⁇ cDNA3.1 (+) after attachment of T-ends with the primers TXforward 5 '- ATGAGCACCAACTCGTTTG-3' and IX reverse 5'-GTTTTAAACCGCATTGGGAGG-S '.
- Cassette E1A-12S-IRES-YB-1 or ElA-12S-IRES protein IX was digested with Pmel and cloned into the plasmid pGL3-E2Late described above after removal of the luciferase gene with NcoI and XbaI and smoothing and dephosphorylation.
- This cassette E21ate-ElA-12S-IRES-YB-1 was cut out with Pvul and CM, the ends smoothed and can now optionally in the deleted with EcoRTL, BsiWl, Dral, Muni (after removing the open reading frame for E3 6.7 K and gpl9K, supra) E3a region, or deletion of E4ORF6, for example into the blunted and dephosphorylated 5 / rI site.
- the resulting construct is E3a / E2Late-Ela-12S-IRES-YB-1 / ⁇ E3RGD-E4 ⁇ ORF6-pShuttle (-MZeI) -AdEASY or E3a ⁇ E3RGD-E4 ⁇ ORF6 / E2Late-Ela-12S-IRES-YB-1 shuttle (-Ndel ) - AdEASY.
- E3a ⁇ E3RGD-E4 ⁇ ORF6 region with the second expression cassette E2Late-Ela-12S or E2Late-Ela-12S-IRES-YB-1 in E3a or E4 ⁇ ORF6 was digested with Spei and Päd from the corresponding pShuttle plasmid E3a ⁇ E3RGD-E4 ⁇ ORF6- ⁇ Shuttle (-MM ) -AdEASY and cloned into the appropriately opened vector pAdEASY, whereby the new rescue vector E3a / E2Late-Ela-12S / ⁇ E3RGD-E4 ⁇ ORF6- ⁇ AdEASY or E3a ⁇ E3RGD-E4 ⁇ ORF6 / E2Late-Ela-12S-pAdEASY or E3a / E2Late- Ela-12S-IRES-YB-1 / ⁇ E3RGD-E4 ⁇ ORF6-pAdEASY or
- E3a ⁇ E3RGD-E4 ⁇ ORF6-pAdEASY contains the E3a region, an RGD motif and a deleted E4ORF6, as second expression cassette either E2Late-Ela-12S or E2Late-Ela-12S-IRES-YB-1 are present in E3a or E4 ⁇ ORF6.
- This construct represents the rescue plasmid for the introduction of additional transgenes into the El region by a shuttle plasmid. Generating the Trans gen cassette for the El region
- the adenogenome was restricted with XbaI (position 1340 bp) and Muni (position 3925 bp) and the 2585 bp Framgent cloned into the pShuttle from AdEASY into the XbaI and Muni interfaces, thus containing the entire EIB region ( pShuttle / ElB).
- the EIB region can be amplified by PCR with the primers ElB forward 5'-GTGTCTAGAGAATGCAATAGTAG-3 'and ElB reverse 5'-
- GTCAAAGAATCCAATTGTGC-3 are amplified with the adenovirus type 5 wild-type DNA as a template, restricted with XbaI and Muni and cloned into the XbaI and MunI cleavage sites of the AdEASY pShuttle.
- pShuttle / ElB comprises the EIB promoter, the open reading frames for E1B19K, E1B55K and the protein IX and the natural poly-A moiety.
- the EIB promoter was removed with the aid of XbaI and Hpal, the ends of the vector were smoothed and replaced by the CMV promoter from pcDNA3.1 (+) from Invitrogen, which was cut with MIuI and XhI1 and whose ends were also smoothed .
- an RSV promoter or a tumor-specific or viral promoter can control the expression of the EIB region, for example the promoters listed in the patent.
- the plasmid pRc / RSV from Invitrogen was cut with Xhol, Spei and XbaI.
- the resulting 2810 bp and 278 bp fragments were religated, thereby removing the Fl Origin and the neomycin resistance gene (oNeo).
- the resulting vector pRc / RSV (oNeo) has only one 5 ⁇ mHI site 3 into which the open reading frame of E4ORF6 from the plasmid CGN of Dobbelstein has been plated.
- the ampfilicate of a PCR with the primers ⁇ , 4ORF6-forward 5'-ATGACTACGTCCGGCGTTCC-3 'and E4OKF6-reverse 5'-CTACATGGGGGTAGAGTC-S' into the EcoRV interface of the vector pRc / RSV (oNeo) after attachment of T-ends (TA cloning) are introduced.
- a CMV promoter released from pcDNA3.1 (+) with MM and Hind ⁇ I
- a tumor specific or viral promoter may direct the expression of E4orf6, for example those in the patent listed promoters.
- the cassette RSV-E4ORF6-polyA (the bovine growth hormone polyadenylation signal derived from the plasmid pRC / RSV) was cut with Muni, the ends were smoothed and further extracted with Xhol from the plasmid. The expression cassette was subsequently cloned into the Notl cut and blotted, then Xhol cut, vector p Shuttle / E IB. The result was the vector RSV-E4ORF6-polyA / ElB-pShuttle-AdEASY.
- the vector RSV-E4ORF6-polyA / ElB- ⁇ Shuttle-AdEASY for the El region was linearized with BstI 1071 and Mrol and electroporated into BJ5183 (EC) bacteria along with the i? E ⁇ cwe plasmid (see above). Homologous recombination produced the adenoviral plasmid RSV-E4ORF6-polyA / ElB-E3a / E2Late-Ela-12S / ⁇ E3RGD-E4 ⁇ ORF6-pAdEASY (or according to the other above-mentioned rescue vector variants), which after transfection into HEK293 cells Virus production resulted.
- adenoviruses in particular those which contain the above-mentioned expression cassettes individually and / or together
- other systems can be used , z.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Virology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Communicable Diseases (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Oncology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP06700409A EP1830864A2 (de) | 2004-12-31 | 2006-01-02 | E1 -minus adenoviren und deren verwendung |
| US11/813,089 US20090232800A1 (en) | 2004-12-31 | 2006-01-02 | E1-minus adenoviruses and use thereof |
| CA002610360A CA2610360A1 (en) | 2004-12-31 | 2006-01-02 | E1-minus adenoviruses and use thereof |
| JP2007548838A JP5435871B2 (ja) | 2004-12-31 | 2006-01-02 | E1−マイナスアデノウイルス及びその使用 |
| US13/186,290 US20120039877A1 (en) | 2004-12-31 | 2011-07-19 | E1-minus adenoviruses and use thereof |
| US15/462,133 US20170190752A1 (en) | 2004-12-31 | 2017-03-17 | E1-minus adenoviruses and use thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE102004063662.1 | 2004-12-31 | ||
| DE102004063662 | 2004-12-31 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/813,089 A-371-Of-International US20090232800A1 (en) | 2004-12-31 | 2006-01-02 | E1-minus adenoviruses and use thereof |
| US13/186,290 Continuation US20120039877A1 (en) | 2004-12-31 | 2011-07-19 | E1-minus adenoviruses and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2006070024A2 true WO2006070024A2 (de) | 2006-07-06 |
| WO2006070024A3 WO2006070024A3 (de) | 2006-12-28 |
Family
ID=36615284
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2006/000010 Ceased WO2006070024A2 (de) | 2004-12-31 | 2006-01-02 | E1 -minus adenoviren und deren verwendung |
Country Status (5)
| Country | Link |
|---|---|
| US (3) | US20090232800A1 (https=) |
| EP (1) | EP1830864A2 (https=) |
| JP (1) | JP5435871B2 (https=) |
| CA (1) | CA2610360A1 (https=) |
| WO (1) | WO2006070024A2 (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10155930B2 (en) | 2002-05-27 | 2018-12-18 | Per Sonne Holm | Use of adenovirus and nucleic acids coding therefor |
| US10300096B2 (en) | 2003-11-14 | 2019-05-28 | Per Sonne Holm | Use of adenoviruses and nucleic acids that code for said viruses |
| US11369650B2 (en) | 2004-12-31 | 2022-06-28 | Per Sonne Holm | Methods for reversing multiple resistance in animal cells |
| US12054530B2 (en) | 2016-09-27 | 2024-08-06 | Epicentrx, Inc. | Immunomodulatory fusion proteins |
Families Citing this family (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5156392B2 (ja) | 2005-02-03 | 2013-03-06 | トポターゲット ユーケー リミテッド | Hdac阻害剤を用いる併用療法 |
| ATE542527T1 (de) | 2005-05-13 | 2012-02-15 | Topotarget Uk Ltd | Pharmazeutische formulierungen von hdac-hemmern |
| WO2007054719A2 (en) | 2005-11-10 | 2007-05-18 | Topotarget Uk Limited | Histone deacetylase (hdac) inhibitors (pxdlol) for the treatment of cancer alone or in combination with chemotherapeutic agent |
| US8642809B2 (en) * | 2007-09-25 | 2014-02-04 | Topotarget Uk Ltd. | Methods of synthesis of certain hydroxamic acid compounds |
| ES2536208T3 (es) * | 2008-03-07 | 2015-05-21 | Onxeo Dk, Branch Of Onxeo S.A., France | Métodos de tratamiento que emplean infusión continua prolongada de Belinostat |
| GB0900555D0 (en) * | 2009-01-14 | 2009-02-11 | Topotarget As | New methods |
| HUE026386T2 (en) * | 2009-03-02 | 2016-06-28 | Univ California | Tumor-selective adenovirus e1a and e1b mutants |
| JP2011111435A (ja) * | 2009-11-30 | 2011-06-09 | Joy Up:Kk | 神経芽腫又は膠芽腫の治療薬 |
| SG11201507393TA (en) | 2013-03-14 | 2015-10-29 | Salk Inst For Biological Studi | Oncolytic adenovirus compositions |
| KR102608590B1 (ko) | 2014-09-24 | 2023-12-01 | 솔크 인스티튜트 포 바이올로지칼 스터디즈 | 종양 살상 바이러스 및 이의 사용방법 |
| WO2017147265A1 (en) | 2016-02-23 | 2017-08-31 | Salk Institute For Biological Studies | High throughput assay for measuring adenovirus replication kinetics |
| WO2017147269A1 (en) | 2016-02-23 | 2017-08-31 | Salk Institute For Biological Studies | Exogenous gene expression in therapeutic adenovirus for minimal impact on viral kinetics |
| EP3532082A4 (en) | 2016-12-12 | 2020-08-26 | Salk Institute for Biological Studies | SYNTHETIC ADENOVIRUS TUMOR TARGETING AND THEIR USES |
| CN112292449A (zh) | 2018-04-09 | 2021-01-29 | 萨克生物研究学院 | 具有增强的复制特性的溶瘤腺病毒组合物 |
Family Cites Families (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP3827163B2 (ja) * | 1995-03-24 | 2006-09-27 | ジェンザイム・コーポレーション | 遺伝子治療用のアデノウイルスベクター |
| US5707618A (en) * | 1995-03-24 | 1998-01-13 | Genzyme Corporation | Adenovirus vectors for gene therapy |
| US6955808B2 (en) * | 1999-09-24 | 2005-10-18 | Uab Research Foundation | Capsid-modified recombinant adenovirus and methods of use |
| EP1497440B1 (en) * | 2002-04-25 | 2008-08-20 | Crucell Holland B.V. | Stable adenoviral vectors and methods for propagation thereof |
| JP5213298B2 (ja) * | 2002-05-27 | 2013-06-19 | ホルム,ペル・ゾンネ | アデノウイルスおよびそれをコードしている核酸の新たな使用 |
| MXPA05004074A (es) * | 2002-10-15 | 2005-09-20 | Sonne Holm Per | Nuevos adenovirus, acidos nucleicos que los codifican y su uso. |
| US20050042217A1 (en) * | 2003-03-19 | 2005-02-24 | Yan Qi | Specific inhibition of allorejection |
| CA2546178A1 (en) * | 2003-11-14 | 2005-06-09 | Per Sonne Holm | New use of adenovirus and nucleic acids coding therefor |
| EP1689446B1 (de) * | 2003-11-14 | 2015-01-07 | Per Sonne Holm | Neue adenoviren, dafür codierende nukleinsäuren und deren verwendung |
| US7851218B2 (en) * | 2004-12-13 | 2010-12-14 | Schering Corporation | Cell lines for production of replication-defective adenovirus |
| SG158133A1 (en) * | 2004-12-31 | 2010-01-29 | Sonne Holm | Method for reversing multiple resistance in animal cells |
| WO2007103825A2 (en) * | 2006-03-02 | 2007-09-13 | The Board Of Regents Of The University Of Texas System | Combination therapy with oncolytic adenovirus |
-
2006
- 2006-01-02 US US11/813,089 patent/US20090232800A1/en not_active Abandoned
- 2006-01-02 CA CA002610360A patent/CA2610360A1/en not_active Abandoned
- 2006-01-02 EP EP06700409A patent/EP1830864A2/de not_active Ceased
- 2006-01-02 JP JP2007548838A patent/JP5435871B2/ja not_active Expired - Lifetime
- 2006-01-02 WO PCT/EP2006/000010 patent/WO2006070024A2/de not_active Ceased
-
2011
- 2011-07-19 US US13/186,290 patent/US20120039877A1/en not_active Abandoned
-
2017
- 2017-03-17 US US15/462,133 patent/US20170190752A1/en not_active Abandoned
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10155930B2 (en) | 2002-05-27 | 2018-12-18 | Per Sonne Holm | Use of adenovirus and nucleic acids coding therefor |
| US10538744B2 (en) | 2002-05-27 | 2020-01-21 | Per Sonne Holm | Use of adenovirus and nucleic acids coding therefor |
| US10731136B2 (en) | 2002-05-27 | 2020-08-04 | Per Sonne Holm | Use of adenovirus and nucleic acids coding therefor |
| US11268073B2 (en) | 2002-05-27 | 2022-03-08 | Per Sonne Holm | Use of adenovirus and nucleic acids coding therefor |
| US10300096B2 (en) | 2003-11-14 | 2019-05-28 | Per Sonne Holm | Use of adenoviruses and nucleic acids that code for said viruses |
| US11369650B2 (en) | 2004-12-31 | 2022-06-28 | Per Sonne Holm | Methods for reversing multiple resistance in animal cells |
| US12054530B2 (en) | 2016-09-27 | 2024-08-06 | Epicentrx, Inc. | Immunomodulatory fusion proteins |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1830864A2 (de) | 2007-09-12 |
| WO2006070024A3 (de) | 2006-12-28 |
| US20090232800A1 (en) | 2009-09-17 |
| US20120039877A1 (en) | 2012-02-16 |
| JP5435871B2 (ja) | 2014-03-05 |
| JP2008526189A (ja) | 2008-07-24 |
| CA2610360A1 (en) | 2006-07-06 |
| US20170190752A1 (en) | 2017-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1689445B1 (de) | Neue verwendung von adenoviren und dafür codierende nukleinsäuren | |
| EP1689446B1 (de) | Neue adenoviren, dafür codierende nukleinsäuren und deren verwendung | |
| US20220339219A1 (en) | Method for reversing multiple resistance in animal cells | |
| US20170190752A1 (en) | E1-minus adenoviruses and use thereof | |
| EP1506021B1 (de) | Verwendung von adenoviren und dafur kodierenden nukleinsäuren | |
| EP1554375B1 (de) | Adenovirus mit umgekehrter reihenfolge der expression von genen und verwendung davon | |
| DE10223534A1 (de) | Verwendung von Adenoviren und dafür codierenden Nukleinsäuren |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| DPE2 | Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2007548838 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006700409 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWP | Wipo information: published in national office |
Ref document number: 2006700409 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2610360 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11813089 Country of ref document: US |