WO2006063242A1 - Méthodes et préparations destinées à induire une régression tumorale - Google Patents

Méthodes et préparations destinées à induire une régression tumorale Download PDF

Info

Publication number
WO2006063242A1
WO2006063242A1 PCT/US2005/044640 US2005044640W WO2006063242A1 WO 2006063242 A1 WO2006063242 A1 WO 2006063242A1 US 2005044640 W US2005044640 W US 2005044640W WO 2006063242 A1 WO2006063242 A1 WO 2006063242A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
cell
nucleic acid
tumor
cells
Prior art date
Application number
PCT/US2005/044640
Other languages
English (en)
Inventor
Lauren Costantini
Cristina Fillat
Anna Cascante
Original Assignee
Titan Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Titan Pharmaceuticals, Inc. filed Critical Titan Pharmaceuticals, Inc.
Publication of WO2006063242A1 publication Critical patent/WO2006063242A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C12N9/1211—Thymidine kinase (2.7.1.21)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2121/00—Preparations for use in therapy
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16311—Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
    • C12N2740/16322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to the field of tumor therapy, particularly to treating tumors and tumor cells through suicide gene/prodrug therapy.
  • TK/GCV thymidine kinase/ganciclovir
  • tumor transduction generally is limited to a small area of the tumor mass around the injection point, and this is one of the key elements that limits the antitumor effects of many cancer gene therapy strategies.
  • therapies and agents for killing cancer cells in a tumor and for inducing tumor regression are one of the key elements that limits the antitumor effects of many cancer gene therapy strategies.
  • Translocatory proteins can efficiently translocate across the membrane of mammalian cells and are able to mediate in the intracellular delivery of heterologous proteins iusea io mem.
  • oi sucn proteins are tne numan immunodeliciency virus (HIV) Tat, the Drosophila antennapedia, and the Herpes simplex virus VP22. See, for example, Fawell et al (1994) Proc. Natl. Acad. ScL USA, 91 :664-668; Miot et al. (1991) Proc. Natl. Acad. ScL USA 88:1864-1868; Elliot et al. (1997), Cell, 88:223-233.
  • HIV tne numan immunodeliciency virus
  • the intercellular transfer function has been mapped to short peptides of highly basic residues that have been termed protein transduction domains (PTDs) (Leifert et al. (2003) MoI Ther 8:13- 20; Beerens et al. (2003) Curr Gene Ther 3:486-494).
  • PTDs protein transduction domains
  • Tat 11-TK thymidine kinase gene
  • This PTD was characterized for having several alanine residues that, when properly placed, conferred alpha- helix strength indicating that what was enhancing protein transduction potential was not the number of arginine residues, but the combination with alpha-helical promoting agents. Thus, factors other than the content of basic residues also appear to play a role.
  • the current invention includes an 8 amino acid Tat sequence YGRKKRRQ that has protein transduction capability.
  • the invention includes a protein comprising a suicide polypeptide sequence and a protein transduction domain sequence (PTD), wherein the PTD comprises a sequence YGRKKRRQ. It does not comprise a sequence RKKRRQRRR, or a sequence YGRKKRRQRRR, or an entire HIV Tat sequence.
  • PTD protein transduction domain sequence
  • the invention also includes a protein comprising a protein transduction domain sequence (PTD) and a suicide polypeptide sequence, wherein the PTD consists essentially of a sequence YGRKKRRQ
  • the invention also encompasses a protein comprising a protein transduction domain sequence (PTD) and a suicide polypeptide sequence, wherein the PTD consists of a sequence YGRKKRRQ.
  • the suicide polypeptide can be a protein or protein fragment derived from the group consisting of thymidine kinase (e.g., from herpes simplex virus-1 or varicella zoster virus), cytochrome P450 2Bl, cytosine deaminase, the A chain of diphteria toxin, ricin, abrin, caspases, Fas-Ligand, Bax, and TRAIL.
  • the suicide polypeptide is a protein or protein fragment derived from herpes simplex virus-1 thymidine kinase or from cytochrome P450 2Bl
  • the invention also encompasses a nucleic acid encoding the above-described proteins of the invention, and vectors and cells comprising such a nucleic acid.
  • the vector is a phage, virus, plasmid, phagemid, cosmid, YAC, or episome.
  • the recombinant cell is preferably a bacterium, yeast, insect cell, or a mammalian cell.
  • the invention encompasses compositions comprising a protein or a nucleic acid or a cell of the invention.
  • the invention also includes kits comprising a protein or a nucleic acid or a cell of the invention.
  • the invention is also directed to methods of treating an individual with a tumor, the treatment comprising administering the nucleic acids or proteins or vectors or cells of the invention to the individual resulting in the introduction of the protein or nucleic acid into tumor cells or into other cells nearby, ultimately resulting in a decrease in tumor burden, for example by tumor cell death or injury.
  • the invention includes a method of treating an individual with a tumor to decrease tumor burden by administering a protein or a nucleic acid or a cell of the invention. In one aspect, this method further comprises administering a prodrug.
  • Nucleic acids can be administered by techniques known to those of skill in the art. In a preferred aspect, they are preferably administered by electrotransfer. If cells are to be administered, such cells may be attached to a support matrix that is suitable for implantation into the individual. In such cases, the support matrix is preferably in the form of a microcarrier.
  • the microcarrier preferably has a diameter from about 80 ⁇ m to about 330 ⁇ m.
  • the support matrix may be made of glass, polystyrene, polypropylene, polyethylene, polycarbonate, polypentane, acrylonitrile polymer, nylon, magnetite, natural polysaccharide, a modified polysaccharide, collagen, gelatin or modified gelatin such as crosslinked gelatin.
  • the support matrix may be coated on its external surface with factors known in the art to promote cell adhesion, growth or survival.
  • [UU 15] i he invention also encompasses a method ot preparing the protein ot the invention by incubating a cell containing a nucleic acid encoding the protein under conditions that allow the cell to express the protein. Such a method may further comprise isolating the protein from the host cell.
  • the invention also includes a method of attaching a cell of the invention to a support matrix suitable for implantation into an individual, by placing the cell in contact with the support matrix for a time sufficient to allow the cell to attach to the support matrix.
  • Fig. 1 depicts the effect of Tat peptides on the cytotoxicity of the TK/GCV and CYP2B1/CPA suicide systems.
  • Fig. Ia is a schematic illustration of the expression vectors encoding TK, Tat8-TK, Tatl 1-TK.
  • Fig. Ib is a graph depicting cell viability of NIH3T3 cells transfected with the indicated constructs after 5 days of GCV treatment. Values are expressed ⁇ SEM.
  • Fig. Ic is a schematic illustration of the expression vectors encoding CYP2B1, Tat8-CYP2B1, Tatll-CYP,2B1.
  • Fig. Id is a graph depicting cell viability of NIH3T3 cells transfected with the indicated constructs after 3 days of CPA treatment. Values are expressed ⁇ SEM.
  • Fig. 2 depicts an in vitro bystander effect of TK/GCV and Tat8-TK/GCV on cell viability.
  • Different ratios of NIH3T3TK or NIH3T3Tat8-TK-expressing cells were plated with (a) NIH3T3 wild type cells or (b) NPl 8 wild type.
  • the graphs depict cell viability of the cells after GCV treatment. Values are expressed ⁇ SEM.
  • Fig. 3 depicts the effects of TK/GCV and Tat8-TK/GCV therapies on pancreatic tumor growth after microcarrier cell delivery.
  • Fig. 3 a depicts microcarriers in the tumor after hematoxilin-eosin staining (20Ox).
  • Fig. 3b is a graph depicting growth of the tumors in the presence of the indicated MC-cell composition. Significance referred to comparisons between control and treated groups at each time point studied. Codes are ***p ⁇ 0.001, **p ⁇ 0.01, *p ⁇ 0.05.
  • FIG. 4 depicts EGFP expression in mouse subcutaneous tumors. Representative EGFP fluorescent images of tumors injected with 50 ⁇ g of the plasmid Tat8-TK with (top) or without (bottom) in vivo electrotransfer. Fluorescent images (left), light images (right). Magnification (40 x).
  • Fig. 5 depicts effects of TK/GCV and Tat8-TK/GCV therapies on pancreatic tumor growth after DNA electrotransfer at high dose of GCV.
  • Fig. 5a is a graph depicting tumor volume during treatment ot tour groups: Control 1 are tumors injected with IK or Tat8-TK plasmid followed by electrotransfer; Control 2 are tumors injected with saline solution followed by electrotransfer; TK are tumors injected with the TK plasmid followed by electrotransfer; Tat ⁇ -TK are tumors injected with the Tat8-TK plasmid followed by electrotransfer. Control 2, TK and Tat8-TK groups received GCV 100 mg/Kg for 6 days.
  • Fig. 5b depicts TUNEL-positive cells in cryosections at days 2 and 4 after electrotransfer with a FITC-conjugated antibody (green) and counterstained with 4',6-diamino-2-phenylindole (DAPI) (blue). Magnification (20Ox).
  • Fig. 6 is a graph depicting effects of TK/GCV and Tat8-TK/GCV therapies on pancreatic tumor growth after DNA electrotransfer at moderate dose of GCV.
  • Three different groups were established: Control are tumors injected with TK or Tat8-TK plasmid followed by electrotransfer; TK are tumors injected with the TK plasmid followed by electrotransfer; and Tat8-TK are tumors injected with the Tat8-TK plasmid followed by electrotransfer.
  • TK and Tat8-TK groups received GCV 50 mg/Kg for 14 days. Significance referred to comparisons between control and treated groups at each time point studied. Codes are ***p ⁇ 0.001, **p ⁇ 0.01, *p ⁇ 0.05.
  • Fig. 7 shows the cytotoxic effects of the Tat8-TK released protein.
  • Wild type cells were incubated in the presence or absence of GCV with conditioned media from (a) NIH3T3 wild type, NIH3T3TK or NIH3T3Tat8-TK expressing cells or (c) from Tat8-TK or TK transfected COS-7 cells and cultured for three days in the presence (+) or absence (-) of GCV. Cell viability was measured after 2 days of treatment. Values are expressed ⁇ SEM.
  • Statistical analysis was performed using the Mann- Whitney U test with significance reported when P was less than 0.05. Comparisons were performed between (-) and (+) groups.
  • a protein transduction domain is used to enhance delivery of a suicide polypeptide to tumor cells and thus elicit enhanced killing of the tumor cells, for example in the presence of a prodrug.
  • Methods and compositions of the invention are used tor Rilling tumor cells and/or in inducing tumor regression.
  • cell killing was enhanced and tumor volume reduced when an 8 amino acid PTD fused to a suicide enzyme and the suicide enzyme's respective prodrug are delivered to the cells.
  • the amount of cell killing appears to be well beyond that of the cells initially transduced with the gene expression vector.
  • the methods and agents of the invention are effective in killing more cells than just those transfected with the suicide gene construct and lead to a greater reduction in tumor size as compared to the suicide gene constructs without the PTD.
  • the use of the minimal efficient PTD with translocatory properties is desirable in order to minimize any putative side effects of the PTD.
  • the Tat 8 amino acid peptide is effective as a PTD.
  • protein protein
  • polypeptide peptide
  • Techniques for isolating proteins are well known in the art. See, e.g., Protein Analysis and Purification: Benchtop Techniques by Ian M. Rosenberg (2nd ed., 2005).
  • tumor as used herein broadly includes any malignant or pre-malignant tissue exhibiting abnormal cell growth that is exemplified, for instance, by hyperplasia, metaplasia, or dysplasia (for a review of such abnormal growth conditions, see Robbins and Angell, 1976, Basic Pathology, 2d. Ed., W.B. Saunders Co., Philadelphia, pp. 68-79).
  • tumor also includes cells or tissues that are predisposed to, or at risk of, progressing into a malignant or premalignant state.
  • treating includes any procedure that results in the alleviation, amelioration, and/or stabilization of a symptom associated with the tumor, and/or a delay in progression of a tumor. More specifically, treatment refers to the administration of the nucleic acids or proteins or compositions or vectors or cells of the invention to a subject after a tumor burden has been determined in that subject using any method known in the art, with a resultant decrease or elimination of the tumor burden. Treatment can involve slowing the growth of the tumor, halting growth of the tumor, causing reduction or regression of the tumor, inhibiting tumor invasion, causing tumor cell death, or causing reduction or regression of metastases.
  • Treatment can also include decreasing the likelihood of tumor development in a subject who may be predisposed or at high risk of developing tumors.
  • a treatment method ot the invention thus reduces probability of developing a tumor in a given time frame and/or reduces the extent of tumor growth in a given time frame, when compared to not using the method.
  • the effects of the treatment methods of the invention can be monitored through the assessment of tumor burden by well- established methods. For example, some clinical criteria (RECIST criteria) for such evaluation have been promulgated by Response Evaluation Criteria in Solid Tumors Working Group, a group of international experts in cancer. One commonly used criterion, for example, is tumor volume, and reduction in tumor burden can be expressed as percentage changed in tumor volume from baseline. James et al., J. Nat. Cancer. Inst. 91(6):523-528 (1999).
  • treatment results in a significant reduction in tumor burden.
  • treatment reduces the tumor burden by at least 10%, more preferably by at least 25% and most preferably by at least 50%.
  • a protein transduction domain sequence may comprise any synthetic or naturally-occurring amino acid sequence that can mediate or assist in the intracellular delivery of a protein containing the PTD, including heterologous protein sequences that have been attached to the PTD.
  • transduction can be achieved in accordance with the invention by use of a protein sequence, particularly the HIV Tat protein or any fragment thereof with transducing activity.
  • the PTD can also be derived from the Antennapedia homeodomain or the HSV VP22 sequence, or suitable transducing fragments and/or variants thereof.
  • a suicide polypeptide sequence or suicide gene product is any protein sequence or protein fragment that causes cell cytotoxicity or cell death (for example by apoptosis), either by itself or in the presence of other compounds.
  • a suicide gene is a polynucleotide sequence encoding a suicide polypeptide.
  • Examples of a suicide polypeptide include but are not limited to protein sequences or protein fragments and/or variant sequences derived from thymidine kinase of herpes simplex virus- 1 or varicella zoster virus, cytochrome P450 2Bl, cytosine deaminase, the A chain of diphteria toxin, ricin, and abrin or any other desired cytotoxic protein sequence; or caspases, Fas-Ligand, Bax, and TRAIL.
  • a "prodrug” is a substance that is not cytotoxic in itself, but which can be converted to a cytotoxic product through the action of the suicide polypeptide.
  • [UUJiJ une aspect ot tne invention encompasses a tusion protein suitable tor treating an individual with a tumor comprising a suicide polypeptide sequence and a protein transduction domain sequence (PTD), wherein the PTD comprises a sequence YGRKKRRQ.
  • the PTD does not comprise a sequence RKKRRQRRR or a sequence YGRKKRRQRRR or an entire HIV Tat sequence.
  • the PTD consists essentially of a sequence YGRKKRRQ.
  • the PTD consists of a sequence YGRKKRRQ.
  • such proteins can be administered to an individual with a tumor, being introduced for instance into the vicinity of a tumor. Because these sequences impart transduction capability to the protein, these proteins can enter tumor cells. This ultimately results in a decrease in tumor burden by virtue of tumor cell death or injury effected through the suicide polypeptide portion of the protein.
  • the invention further encompasses a nucleic acid construct encoding the protein of the invention.
  • the nucleic acid may also be included in a vector designed to facilitate manipulation and/or expression of a nucleic acid.
  • a vector as contemplated by the present invention is at least capable of directing the expression of the nucleic acids encoding the fusion proteins.
  • "Shuttle vectors" comprise the attributes of more than one type of vector. Suitable vectors in the invention also include constructs such as a phage, virus, plasmid, phagemid, cosmid, YAC, or episome. The circular plasmid form, supercoiled, and the linear form also fall within the scope of this invention.
  • the vectors of the invention generally include a transcription unit comprising a polynucleotide sequence comprising the sequence of a fusion protein, which sequence is comprised of a suicide polypeptide fused in frame with the PTD, wherein the PTD comprises or consists essentially of or consists of the sequence YGRKKRRQ.
  • the transcription unit also includes the elements necessary for the expression of the fusion protein in vivo.
  • the transcription unit may comprise a constitutive or inducible promoter capable of ensuring, in the host cells, the expression of the gene inserted under its control. Examples of suitable promoters include the cytomegalovirus early promoter CMV-IE, of human or murine origin, or optionally of other origin such as rat or guinea pig.
  • the promoter can be of viral origin or of cellular origin.
  • a viral promoter other than CMV-IE there may be mentioned the SV40 virus early or late promoter or the Rous Sarcoma virus LTR promoter.
  • Cellular promoters include those for cytoskeleton genes, such as for example the desmin promoter, or alternatively the actin promoter, i ne vector may also include downstream transcription termination sequences, and remaining vector sequences, for instance, control regions.
  • Suitable origins of replication include, for example, the SV40 viral origin of replication.
  • Suitable termination sequences include, for example, SV40 polyadenylation signal.
  • the PTD-suicide gene product is delivered to the tumor cells through the use of a vector or expression construct encoding the PTD-suicide gene product, wherein the vector or expression construct allows for expression of the PTD-suicide gene in the tumor cells.
  • the PTD-suicide gene vector or expression construct is introduced to the target cells in the form of a nucleic acid vector in a manner that facilitates cell uptake of the vector.
  • an electrotransfer procedure is used to enhance cell uptake of the vector or expression construct. If needed, a prodrug is administered after the expression construct is delivered.
  • electrotransfer also called “electroporation” involves the subjecting cells to a high- voltage electric field, and is well established in the art. Transfection efficiencies can be tightly regulated by altering such parameters as frequency, pulse duration and pulse number.
  • DNA is administered (especially by injection) into tissue and voltage pulses are applied between electrodes disposed in the tissue, thus applying electric fields to cells of the tissue.
  • the electrically- mediated enhancement covers administration using either iontophoresis or electroporation in vivo. Suitable techniques of electroporation and iontophoresis are provided by Singh et al. (1989) Drug Des. Deliv. 4:1-12; Theiss U et al. (1991) Methods Find.
  • cells containing the PTD-suicide gene expression construct are delivered to the tumor and the prodrug is subsequently administered.
  • the PTD- suicide gene product is spread trom the introduced cells to the tumor cells.
  • cells containing the PTD-suicide gene expression construct are attached to a support matrix, such as a microcarrier, prior to delivery to the tumor cells.
  • the microcarrier (MC) is made of material which is preferably nontoxic, for example, glass, polystyrene, polypropylene, polyethylene, polycarbonate, polypentane, acrylonitrile polymer, nylon, magnetite, natural polysaccharide, a modified polysaccharide, collagen, gelatin and modified gelatin such as crosslinked gelatin.
  • a microcarrier of gelatin is a preferred support matrix, as described for example in U.S. Patent Nos. 4,935,365; 6,060,048; and 6,210,664.
  • Suitable gelatin microcarriers are commercially available as Cultispher® porous microcarriers. These gelatin microcarriers generally have diameters ranging from about 80 ⁇ m to about 330 ⁇ m.
  • Cultispher-S® porous microcarriers of crosslinked gelatin having a diameter between about 80 ⁇ m to about 170 ⁇ m (mean of about 120 ⁇ m).
  • the material and size of the microcarrier will depend on the particular type 'of cells that are attached, the size of the attached cells, the number of cells that can be attached to the microcarrier based on size and/or material of the microcarrier, and the like.
  • the configuration of the support is preferably spherical, as in a bead, but may be cylindrical, elliptical a flat sheet or strip, a needle or pin shape, and the like. Bead sizes may range from about 10 ⁇ m to about 1000 ⁇ m in diameter, for example from about 90 to about 150 ⁇ m, or for example around 100 ⁇ m.
  • Bead sizes may range from about 10 ⁇ m to about 1000 ⁇ m in diameter, for example from about 90 to about 150 ⁇ m, or for example around 100 ⁇ m.
  • various microcarrier beads see, for example. Fisher Biotech Source 87-88. Fisher Scientific, Co., 1987, pp. 72-75; Sigma Cell Culture Catalog, Sigma Chemical Co., St. Louis, 1991, pp. 162-163; Ventrex Product Catalog, Ventrex Laboratories, 1989.
  • the solid matrix may optionally be coated on its external surface with factors known in the art to promote cell adhesion, growth or survival.
  • factors include cell adhesion molecules, extracellular matrix, such as, for example, fibronectin, laminin, collagen, elastin, glycosaminoglycans, or proteoglycans or growth factors.
  • the growth- or survival-promoting factor or factors may be incorporated into the matrix material, from which they would be slowly released after implantation in vivo. The use of any survival or growth promoting material would depend of its e ⁇ ect on me ⁇ esire ⁇ outcome, i.e., me reduction ot tumor growth and/or tumor cell number.
  • nucleic acid, proteins, or cells of the invention that is suitable for administration to a particular individual is routine to one of skill in the art. The exact amount required will depend on a number of variables, as will be apparent to one of skill in the art. For instance, the severity and type of the tumor, and the efficacy of the suicide polypeptide must be considered when selecting the amount administer to the subject, as well as the patient's age, weight, condition, and the exact method of administration selected.
  • the dosage can be in the range of about 5 ⁇ g to about 50 mg/kg of patient body weight.
  • nucleic acid can be administered for instance in a range of about 100 ng to about 200 mg.
  • the invention relates to methods of making the nucleic acids, proteins and cells of the invention.
  • the practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, virology, animal cell culture and biochemistry which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, “Molecular Cloning: A Laboratory Manual”, Second Edition (Sambrook, Fritsch & Maniatis, 1989); “Animal Cell Culture” (R.I. Freshney, ed., 1987); “Gene Transfer Vectors for Mammalian Cells” (J.M. Miller & M.P. Calos, eds., 1987); “Current Protocols in Molecular Biology” (F.M.
  • this method can include the steps of (1) inserting a nucleic acid sequence encoding a PTD into an expression vector in-frame with nucleic acid sequence encoding a suicide polypeptide or visa versa, wherein the resulting open reading frame is operatively linked to a promoter; (2) introducing the vector into a host cell; and (3) maintaining the host cell under conditions allowing expression of the vector, resulting in expression of a fusion protein.
  • the nucleic acids or vectors may be introduced into the host cell by any one of established methods, such as transformation, transfection (e.g., with calcium phosphate or DEAE dextran), lipofection, infection and electroporation.
  • the invention includes a method of attaching a cell to an implantable support matrix by placing the cell in contact with the support matrix for a sufficient time to allow the cell to attach to the support matrix.
  • the cell may be suspended in growth medium and preincubated for hours with support matrix prior to implantation.
  • the cells may be allowed to grow over days on the support matrix.
  • kits for use in any of the methods described herein comprises any of the proteins, nucleic acids, vectors and cells described herein in combination with a pharmaceutically acceptable carrier, and instructions for their use in any of the methods described herein.
  • An aspect of the invention is the use of the proteins and/or nucleic acids of the invention as a medicament.
  • the products of this invention can be used as a medicament for treatment of the human or animal body.
  • the medicament contains a clinically effective amount for treatment of a disease such as cancer.
  • These compositions can be used for administration to a subject suspected of having or being at risk for the disease, optionally in combination with other forms of treatment appropriate for their condition.
  • Primer 1 CCCAAGCTTGTTAGCCTCCCCCATCTC
  • primer 2 CCGCTCGAGATGGGAGGTGGAGGTTATGGCAGGAAGAAGCGGAGACAG GCTTCGTACCCCTGCCATC
  • CCGCTCGAGATGGGAGGTGGAGGTTATGGCAGGAAGAAGCGGAGAC AGCGACGAAGAGCTTCGTACCCCTGCCATC were used to make the Tatl 1-TK fusion protein.
  • Primer 1 and primer 4 (CCGCTCGAGATGGCTTCGTACCCCTGCC) were used to ampiny me i K gene.
  • pro ⁇ ucts were cloned m pt ⁇ blvi- 1 vector (Promega, Madison, Wl, USA). Confirmation of the correct sequence was performed by direct sequencing of the recombinant plasmids with universal primers T7 and SP6.
  • the cloned sequences were then digested with Xhol and HindIII and inserted into the same restriction sites of the pEGFP-Nl plasmid (Clontech).
  • the resultant vectors were designated as pTat8-TK-EGFP, pTatl 1-TK- EGFP and pTK-EGFP.
  • Primer 5 (CCGCTCGAGTCACCGAGCTGAGAAGCAG) and primer 6 (CCGGCTAGCCTCGAGATGGGAGGTGGAGGTTATGGCAGGAAGAAGCGGAGACA GGAGCCCAGTATCTTGCTCC) were used to make the Tat8-CYP2B1 fusion protein.
  • Primer 5 and primer 7 were used to make the Tat8-CYP2B1 fusion protein.
  • CYP2B1 CYP2B1 gene.
  • PCR products were cloned in pGEM-T vector (Promega). The correct sequence was confirmed by direct sequencing of the recombinant plasmids using universal primers T7 and SP6. The cloned sequences were digested with Nhel and Xhol and inserted into the same restriction sites of the pSecTag2/Hygro plasmid (Invitrogen). The resultant vectors were designated as pSecTat8-CYP2Bl, pSecTatl 1-CYP2B1 and pSecCYP2Bl.
  • plasmids were expanded into E.coli strain JMl 09 and purified with the EndoFree plasmid Giga kit (Qiagen GmbH, Hilden, Germany) in accordance with the supplier's protocol. DNA was dissolved in Endofree TE buffer and kept frozen at a concentration of 5 ⁇ g/ ⁇ l.
  • NIH3T3 (Swiss mouse embryo fibroblasts) and COS-7 cells (Monkey African green kidney, SV40 transformed) were purchased from the American Type Cell collection (ATCC).
  • NP-18 cells were derived from a poorly differentiated liver metastasis from a human adenocarcinoma of the pancreas that had been perpetuated as a xenograft in nude mice.
  • NP-18 cells have an epithelial morphology with a doubling time of 36 ⁇ 2 hours. This cell line is tumorogenic and develops distant metastasis when injected intrapancreatically (Reyes et al. (1996) Cancer Res 56:5713-5719).
  • NIH3T3 cells were cultured in DMEM supplemented with 10% FBS, penicillin (100 mg/ml), streptomycin (100 mg/ml), and glutamine (2mM) (Gibco BRL, Life Technologies, Paisley, UK).
  • NP-18 cells were mantained in RPMI 1640 medium supplemented with 10% FBS, penicillin (100 mg/ml) and streptomycin (100 mg/ml).
  • Transient transfections were performed by seeding 50,000 NIH3T3 cells in 60 mm 2 cell culture dishes.
  • cell viability was determined for mixed cell populations composed of different percentages of NIH3T3/Tat8-TK or NIH3T3/TK stable cell lines and NIH3T3 wild type cells or NP-18 wild type cells, following GCV exposure. 1x10 4 or 2x10 4 cells were plated at different ratios in quadruplicate in 24-well plates. 24 hours later, cells were incubated with 10 ⁇ g/ml of GCV and cell viability was measured 5 days later using standard methods.
  • NIH3T3/Tat8-TK cells 1.5x10 5 NIH3T3/Tat8-TK cells, NIH3T3/TK cells and NIH3T3 wild type cells were lated in duplicate and treated with GCV when stated.
  • d0 5 COS-7 cells were cotransfected with 5 ⁇ g of the Tat8-TK or TK constructs and 1 ⁇ g of te pCMV -galactosidase to normalize for transfection efficiency and treated with GCV when ated. Seventy two hours later, supernatants were removed and centrifuged at 600 g for 20 min. ne ml of these media were mixed with an equal volume of fresh DMEM + 10% FBS medium and GCV was added when stated. 5x104 NIH3T3 wild type cells were cultured in the presence of these conditioned media for two days and then cell viability was measured.
  • NIH3T3/Tat8-TK cells and NIH3T3 wild type cells were plated in duplicate in 60 mm 3 plates in the presence or absence of GCV.
  • IxIO 5 NIH3T3 cells were transfected with 5 ⁇ g of the Tat8-TK or TK constructs and treated with GCV when stated. Seventy two hours later, supernatants were centrifuged at 600 g for 20 min and pre-incubated for 1 hour at 4 0 C with protein-G beads (Amersham Biosciences, Wikstr ⁇ ms, Sweden).
  • mice Male BALB/c nude mice were used in all the in vivo experiments. Mice were fed ad libitum and maintained under a 12 hour light/dark cycle. AU the animal procedures were previously approved by the Animal Ethics Committee of the Autonomous Government of Catalonia, and performed in accordance with recommendations for the proper care and use of laboratory animals. When stated, animals were anaesthetized intraperitoneally with a combination of 2,2,2-Tribromethanol 97% and 2,2,2-Tribromoethanol 97% (Avertin, Aldrich) at a working solution of 20 mg/mL.
  • MC dry gelatin microcarriers
  • Cell attachment 1x106 of either NIH3T3/TK or NIH3T3/Tat8-TK cells were incubated with 250 ⁇ g of the above pretreated microcarriers in 1 ml of DMEM in a siliconized polypropylene tube (Sigma) at 37°C. After 24 hours of attachment, the medium was removed and the MC-cells were washed twice with PBS and re-suspended in 200 ⁇ l of PBS for injection. In vivo: 5 ⁇ l of MC-cells were injected into subcutaneous tumors developed in nude mice. GCV treatment was initiated two days after injection and lasted for 14 days. Monitoring of tumor growth was performed every other day.
  • DNA electrotransfer was performed on anaesthetized animals. 50 ⁇ g of plasmid DNA were injected into the subcutaneous tumors using a 33-gauge needle. The injected volume was 10 ⁇ l. Following the intratumoral injection of the plasmid DNA, an electrical field was applied to the area surrounding the injection site. Tumors were held by tweezer style in vivo electrodes and electric pulses were delivered using a square-wave electric pulse generator (BTX 820 electroporator; Genetronics Inc., San Diego). In all the experiments, eight 20 ms pulses were delivered at a frequency of 1 Hz and an output voltage of 500V/cm (Slack et al. (2002) J Gene M? ⁇ i4:381-389). A conductive gel applied to the tumor ensured electrical contact with the skin.
  • mice were sacrificed and perfused with PBS and 4% paraformaldehyde in PBS 48 hours after the gene transfer procedure. Tumors were then excised and fixed with 4% paraformaldehyde in PBS overnight. After washing with PBS, the tumors were sliced (20 ⁇ m) with a vibratome (Leica VTlOOOS) and sections mounted onto slides. Enhanced green fluorescent protein (EGFP) expression was viewed directly under a fluorescent microscope (Leica DMR). Images were captured using a digital camera (Spot RT Colour, Diagnostic Instruments) with SPOT Advanced version 3.2.4. Apoptosis determination by TUNEL assay
  • Tunel analysis was performed using an in situ death detection kit (Roche Molecular Biochemicals) according to the manufacturer's instructions. Briefly, frozen tissue sections (5 ⁇ m) were fixed in 4% paraformaldehyde for 20 min at room temperature, incubated with blocking solution (3% H 2 O 2 in methanol), and then permeabilized for 2 minutes on ice with 0.1% Triton X-IOO in 0.1% sodium citrate. The TUNEL reaction mixture was prepared using a 9:1 buffer-to-enzyme ratio, and sections were incubated in a humidified chamber for 1 hour at 37 0 C.
  • Tumors were excised and fixed with 4% paraformaldehyde in PBS overnight. After washing with PBS, they were submitted to standard paraffin processing and sectioned at 5 ⁇ m with a microtome (Leica RM2135). Sections were stained with hematoxilyn and eosin.
  • NIH3T3 cells were transfected with the indicated constructs and the CYP2B1 constructs were cotransfected with the pCMV ⁇ -galactosidase plasmid in order to normalize for transfection efficiency.
  • the day after transfection, TK or CYP2B1 transfected cells were exposed to 10 ⁇ g/ml of ganciclovir (GCV) or ImM of cyclophosphamide (CPA) for five or three days respectively, and cell viability was determined.
  • GCV ganciclovir
  • CPA cyclophosphamide
  • NIH3T3 cells expressing the TK or the Tat8-TK proteins were established.
  • NIH3T3 cells were transfected with the TK or the Tat8-TK expression vectors and subjected to G418 selection. Clones expressing the EGFP and sensitive to ganciclovir treatment were selected for the studies.
  • NIH3T3 wild type cells were cultured for two days in the presence or absence of GCV with conditioned media either from NIH3T3 wild type, NIH3T3/TK, NIH3T3/Tat8-TK cultures or from COS-7 cells previously transfected with the DNA plasmids Tat8-TK or TK treated or untreated with GCV for 3 days.
  • NIH3T3 wild type cells cultured with conditioned media from NIH3T3/Tat8-TK cells treated with GCV showed a significantly reduced viability (62%). However, no effect was observed in the same type of cultures derived from the NIH3T3/TK cells. Moreover, NIH3T3 wild type cell cultured with conditioned media from COS-7 cells transfected with the Tat8-TK construct and treated with GCV also showed an increased statistically significant cell death (30%). Again, this effect was not observed in the cultures that received TK conditioned media ( Figure 7c). These results suggested that the Tat8-TK protein but not the TK protein was able to exert a cytotoxic effect in the non-genetically- transduced cells.
  • GCV-induced cytotoxicity in neighboring cells was examined in cell mixtures of wild type NIH3T3 cells with NIH3T3TK or NIH3T3Tat8-TK expressing cells.
  • Different ratios of NIH3T3TK or NIH3T3Tat8-TK-expressing cells were plated in quadruplicate in 24- well plates with NIH3T3 wild type cells or NP 18 wild type. Twenty-four hours later, the cells were incubated with 10 ⁇ g/ml of GCV. Cell viability was measured after 5 days of treatment. Among the various cocultures studied, the strongest cytotoxicity was observed in the mixtures with NIH3T3 wild type and NIH3T3Tat8-TK.
  • Proteins fused to PTDs probably enter cells through a combination of different mechanisms that may slightly differ from one PTD to the other. Lundberg et al. (2003) MoI Ther 8: 143-150.
  • the Tat PTD has been proposed to enter the cell through the heparan sulfate proteglycans receptors, through a caveolar-mediated endocytic pathway, or through lipid raft-dependent macropinocytosis. Tyagi et al. (2001) J Biol Chem 276:3254-3261 ; Ferrari et a!. (2003) MoI Ther 8:284-294; Wadia et al. (2004) Nat Med 10:310-315.
  • an explanation for the enhanced cytotoxicity achieved with the Tat8-TK constructs is that the killing of Tat8-TK expressing cells by ganciclovir results in the release of the fused proteins, which in turn are internalized by neighboring cells and trigger their killing. This can lead to an amplification mechanism of cell death, not mediated by intracellular trafficking but by enhancing uptake of the post- released TK.
  • the Tat motif may introduce a conformational change in the TK or CYP proteins which transforms them into more active enzymes.
  • the Tat8-suicide gene fusion in combination with the prodrug is effective in killing a population of cells.
  • micro carrier as a delivery vehicle for cells expressing Tat8-TK/GCV
  • Microcarrier cell culture technology has been successful in producing viral vaccines, recombinant proteins, and viral vectors for gene therapy. See, for example, Kistner et al (1998) Vaccine 16:960-968; Goldman et al. (1998) Biotechnol Bioeng 60:596-607; Wu et al. (2002) Biotechnol Prog 18:617-622.
  • NIH3T3 TK or NIH3T3Tat8-TK expressing cells attached to microcarriers were inoculated into NP-18 tumors developed in the subcutaneous tissue of nude mice (Fig. 3a).
  • MC+Tat8-TK the group injected with cells attached to microcarriers, MC+Tat8-TK, showed a 35.6 % reduction in the initial tumor volume, which was already evident on day 8 after treatment and persisted throughout the entire treatment.
  • 50% of the tumors from this group were completely eradicated (Fig. 3b).
  • Subcutaneous NP-18 tumors in mice were injected with the Tat8-TK/EGFP fusion construct with or without in vivo electroporation (EP). Two days later, tumors were sliced and EGFP expression was observed under a fluorescent microscope to determine the extent of intratumoral transgene expression. Tumors from the control group, which received DNA injection without EP, expressed no EGFP. In contrast, tumors that received plasmid DNA with EP showed bright and numerous EGFP expressing cells covering a wide area of the tumor (Fig. 4). Expression could also be observed after 7 and 14 days of electroporation, although at lower levels.
  • NP-18 pancreatic cancer cells were injected s.c. into nude mice and tumors were allowed to establish until they reached a mean volume of 80 mm 3 . Animals were then randomized and tumors were treated with intratumoral injections of Tat8-TK or TK, followed by electroporation.
  • a high dose of GCV 100mg/Kg was injected into the animals for a short period of time and tumor volume was monitored on days 2, 4 and 6. No toxicity of GCV was observed, as shown by the tumor growth in control animals (no statistically significant differences were observed between the two control groups).
  • the average tumor volumes at day 6 were significantly smaller when compared to those from the two control groups.
  • complete tumor regression on day 6 was achieved in 5 out of 10 animals treated with Tat8- TK but only in 2 out of 10 animals treated with TK.
  • TUNEL analysis of tumor xenografts was performed to determine whether any differences in apoptotic cell death could be observed between the TK and the Tat8-TK group.
  • Massive cell death was found within the subcutaneous tumor tissues that were processed 2 and 4 days after the treatment, with a marked increase in the percentage of cells that underwent apoptosis in the Tat8-TK group. (Fig. 5b)
  • TK and Tat8-TK groups received GCV 50 mg/Kg for 14 days.
  • Fig. 6 an enhanced antitumor effect was observed in the Tat8-TK group.
  • the reduction in tumor progression in the Tat8-TK treated group was statistically significant at all the time points studied, whereas in the TK/GCV group significance was only reached at the end of the treatment. It is worthwhile to note that whereas on days 9 and 11 the volume of tumors from the Tat8-TK group was lower than the initial volume, by the end of the treatment the tumors had reached the initial volume, thus showing a tendency to regrow. At 14 days after the Tat8-TK administration together with GCV treatment, no tumor cells with Tat8-TK may remain and the remaining cells may actively contribute to tumor growth.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention a pour objet des méthodes et des préparations visant à traiter des tumeurs et des cellules tumorales en employant une thérapie à base de gène suicide/prodrogue. En particulier, lesdites méthodes et préparations impliquent une amélioration de la libération du facteur suicide dans les cellules tumorales.
PCT/US2005/044640 2004-12-10 2005-12-09 Méthodes et préparations destinées à induire une régression tumorale WO2006063242A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US63489504P 2004-12-10 2004-12-10
US60/634,895 2004-12-10

Publications (1)

Publication Number Publication Date
WO2006063242A1 true WO2006063242A1 (fr) 2006-06-15

Family

ID=35976467

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/044640 WO2006063242A1 (fr) 2004-12-10 2005-12-09 Méthodes et préparations destinées à induire une régression tumorale

Country Status (1)

Country Link
WO (1) WO2006063242A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11690807B2 (en) 2018-05-24 2023-07-04 Celanese Eva Performance Polymers Llc Implantable device for sustained release of a macromolecular drug compound
US11690806B2 (en) 2018-05-24 2023-07-04 Celanese Eva Performance Polymers Llc Implantable device for sustained release of a macromolecular drug compound

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004070012A2 (fr) * 2003-02-03 2004-08-19 Palo Alto Institute Of Molecular Medicine Molecules d'elimination de cellules et methodes d'utilisation associees

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004070012A2 (fr) * 2003-02-03 2004-08-19 Palo Alto Institute Of Molecular Medicine Molecules d'elimination de cellules et methodes d'utilisation associees

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
GUELEN ET AL: "TAT-apoptin is efficiently delivered and induces apoptosis in cancer cells", ONCOGENE, vol. 23, 2004, pages 1153 - 1165, XP002371927 *
TASCIOTTI AND GIACCA: "Fusion of the human immunodeficeincy virus type 1 Tat protein tranduction domain to thymidine kinase increases bystander effect and induces tumor killing in vivo", HUMAN GENE THERAPY, vol. 16, December 2005 (2005-12-01), pages 1389 - 1403, XP002371928 *
UMEZAWA N ET AL: "Translocation of a beta-peptide across cell membranes", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, AMERICAN CHEMICAL SOCIETY, WASHINGTON, DC, US, vol. 124, no. 3, January 2002 (2002-01-01), pages 368 - 369, XP002266953, ISSN: 0002-7863 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11690807B2 (en) 2018-05-24 2023-07-04 Celanese Eva Performance Polymers Llc Implantable device for sustained release of a macromolecular drug compound
US11690806B2 (en) 2018-05-24 2023-07-04 Celanese Eva Performance Polymers Llc Implantable device for sustained release of a macromolecular drug compound
US11951215B2 (en) 2018-05-24 2024-04-09 Celanese Eva Performance Polymers Llc Implantable device for sustained release of a macromolecular drug compound

Similar Documents

Publication Publication Date Title
US20050074884A1 (en) Identification of peptides that facilitate uptake and cytoplasmic and /or nuclear transport of proteins, DNA and viruses
US20070253968A1 (en) Identification of peptides that facilitate uptake and cytoplasmic and/or nuclear transport of proteins, DNA and viruses
WO2005009287A2 (fr) Administration de medicament dans l'oreille interne et methodes d'utilisation correspondantes
KR101726282B1 (ko) 뉴클레오시드 프로드럭의 효소 활성자로서의 퓨린 뉴클레오시드 인산화효소
US20210205475A1 (en) Mitochondrial optogenetics-based gene therapy for treating cancer
BR112021008832A2 (pt) Proteínas de núcleo de mininucleossoma e uso em distribuição de ácido nucleico
AU784499B2 (en) Compositions and methods for regulated protein expression in gut
JPH05246895A (ja) ウイルスの標的となる新生細胞の破壊
CA2970748C (fr) Cellules transgeniques de l'epithelium pigmentaire retinien (rpe) surexprimant le gene otx2 pour le traitement de la degenerescence retinienne
WO2016004281A1 (fr) Polypeptides comprenant un canal ionique thermosensible lié au domaine 5 d'un kininogène, des acides nucléiques, et leurs utilisations pour la modulation cellulaire et des traitements
WO2006063242A1 (fr) Méthodes et préparations destinées à induire une régression tumorale
US11510999B2 (en) Treatment of neuropathy with DNA constructs expressing IGF-1 isoforms
US20160002667A1 (en) Pseudomonas exotoxins for cancer treatment
CA2355859A1 (fr) Therapie genique 1
JP2017500849A (ja) 細胞透過組成物およびそれを用いる方法
CN112812182B (zh) 一种靶向fgfr4的单链抗体、嵌合抗原受体、嵌合抗原受体t细胞及其制备方法和应用
Muthumani et al. Anti-tumor activity mediated by protein and peptide transduction of HIV viral protein R (Vpr)
Xiong et al. Enhanced effect of microdystrophin gene transfection by HSV-VP22 mediated intercellular protein transport
US20120213742A1 (en) Virus growing in hypoxic cell or virus vector expressing gene therein
JP2006519614A (ja) 悪性かつ形質転換した哺乳動物細胞を選択的に殺すペプチド
KR20210057720A (ko) Clrn1 관련된 청력 손실 및/또는 시력 손실의 치료 방법
EP3861106A1 (fr) Procédé pour restaurer ou améliorer des fonctions cognitives
Beerens et al. Fusion of herpes simplex virus thymidine kinase to VP22 does not result in intercellular trafficking of the protein
KR20090092536A (ko) 유전자 전달 효율이 개선된 재조합 아데노바이러스 및리포좀을 포함하는 조성물
US7612039B2 (en) Method of cell growth inhibition with agnoprotein

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 05853538

Country of ref document: EP

Kind code of ref document: A1