WO2006059785A1 - Développement d'un agent bioactif en utilisant un facteur induisant la différenciation de cellules dendritiques - Google Patents

Développement d'un agent bioactif en utilisant un facteur induisant la différenciation de cellules dendritiques Download PDF

Info

Publication number
WO2006059785A1
WO2006059785A1 PCT/JP2005/022420 JP2005022420W WO2006059785A1 WO 2006059785 A1 WO2006059785 A1 WO 2006059785A1 JP 2005022420 W JP2005022420 W JP 2005022420W WO 2006059785 A1 WO2006059785 A1 WO 2006059785A1
Authority
WO
WIPO (PCT)
Prior art keywords
gal
activity
cells
galectin
dendritic
Prior art date
Application number
PCT/JP2005/022420
Other languages
English (en)
Japanese (ja)
Inventor
Mitsuomi Hirashima
Akira Yamauchi
Nozomu Nishi
Ryusuke Nakagawa
Original Assignee
Galpharma Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Galpharma Co., Ltd. filed Critical Galpharma Co., Ltd.
Publication of WO2006059785A1 publication Critical patent/WO2006059785A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0639—Dendritic cells, e.g. Langherhans cells in the epidermis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0639—Dendritic cells, e.g. Langherhans cells in the epidermis
    • C12N5/064—Immunosuppressive dendritic cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5154—Antigen presenting cells [APCs], e.g. dendritic cells or macrophages
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a dendritic cell differentiation control technique using a rod-shaped cell differentiation-inducing factor.
  • the present invention relates to a technique for controlling differentiation of dendritic cells using galectins such as Gal-9 or a modified form thereof, or galectin 8 or a modified form thereof.
  • the present invention also relates to a technique for utilizing the biological activity associated with the induction of dendritic cell differentiation via the galectins.
  • Galectins are animal lectins that exhibit affinity for ⁇ -galactosides, which have some conserved sequence portion. To date, 14 types of galectins have been cloned in mammals, and cell adhesion and proliferation (Asakura, H., et al., J. Immunol. 169: 5912 (2002)) Nishi, N., et al., Glycobiology 13: 755 (2003) [Non-Patent Document 2]; Zick, Tsuji, et al., Glycoconj. J. 19: 517 (2004) [Non-Patent Document 3]; Perillo, N., et al., J. Mol. Med.
  • Non-patent Document 4 T cell apoptosis
  • T cell apoptosis Perillo, N., et al., Ature 378: 736 (1995) [Non-Patent Document 5]; Kashio, Y., et al., J. Immunol. 170: 3631 (2003) [Non-Patent Document 6]
  • immune responses Liu, FT Clin. Immunol. 97) : 79 (2000) [Non-Patent Document 7]
  • other biological processes have been shown to play a role in changing it.
  • galectin-1 (galectin-1; (Gal-1) 2 ) is classified as a prototype galectin, whereas Gal-3 is a chimeric type galectin and galectin-8 ( galectin-8; Gal_8) and galectin- Both 9 (galectin-9; Gal-9) are characterized by the tandem repeat subfamily (two different carbohydrate recognition domains (CRD) linked by a linker peptide) ) Belongs to.
  • CCD carbohydrate recognition domains
  • Gal-9 is a physiologically active substance with activity as a lectin and is expressed in tissue mast cells, eosinophils, macrophages, T cells, B cells, fibroblasts, vascular endothelial cells, various tumor cells, etc. It has been recognized that it is involved in various physiological phenomena, such as a correlation between its expression level and the metastatic potential of tumors. Gal-9 is thought to be involved in various biological activities such as inducing apoptosis of activated T lymphocytes.
  • Gal-3 preferentially acts on macrophages as an activator of migration reaction
  • Gal-8 induces adhesion activity and superoxide production in neutrophils
  • Gal-9 has eosinophil migration activity, induces superoxide production in eosinophils, and prolongs cell survival.
  • Gal-9 is an activated T lymphocyte cell (Kashio, Y., et al., J. I ⁇ unol. 170: 3631 (2003) [non-patent document 6]) and tumor cell. It has been shown to induce apoptosis in various cells such as the line (Kageshita, T., et al., Int. J. Cancer 99: 809 (2002) [12]. '
  • Galectins are also involved in bone marrow differentiation (Abedin,. J., et al., J. Leukoc. Biol. 73: 650 (2003) [Non-patent Document 13]).
  • the present inventors have shown that Gal-9 expression gradually decreases in the process of eosinophil differentiation, but Gal-10 expression increases.
  • Non-patent document 1 Asakura, H., et al., J. Immunol. 169: 5912 (2002)
  • Non-patent document 2 Nishi, Tsuji, et al., Glycobiology 13: 755 (2003) [Non-patent document] 3) Zick, Y., et al., Glycoconj. J. 19: 517 (2004)
  • Non-patent document 4 Perillo, ⁇ ⁇ L., Et al., J. Mol. Med.
  • Non-Patent Document 8 Tureci 0. et al., J Biol Chem., 272 (10): 6416-22 (Mar. 7, 1997)
  • Non-Patent Document 9 Matsumoto R. et al., J Biol Chem., 273: 16976-84 (1998)
  • Non-patent document 10 Sano, H., et al., J. Immunol. 165: 2156 (2000)
  • Non-patent document 1 1 Matsumoto, R., et al., J. Immunol. 168: 1961 ( 2002)
  • Non-Patent Document 1 2 Kageshita, Tsuji, et al., Int. J. Cancer 99: 809 (2002)
  • Non-Patent Document 1 3 Abedin,. J., et al., J. Leukoc. Biol. 73: 650 (2003) Disclosure of the invention
  • dendritic cells Maturation (differentiation) of dendritic cells is important in the initiation of an immune response and in vaccine therapy based on dendritic cells (or dendritic cells; DC) against various cancers. Nevertheless, the functional role of galectins in rod-shaped cells is discussed in terms of Gal-1, Gal-3, and Gal-9 mRNA 1K immature and mature dendritic cells (or not). In the process of dendritic cell maturation, the amount of Gal-9 mRNA increases twice, while Gal-3 mRNA is about 1 There is almost nothing known to the extent that it is reduced to / 3.
  • health foods such as agaricus, propolis, AHCC, and maiko are generally used to activate the immune system, lentinan, krestin, schizophyllan, BCG, 0K432, BRP, etc.
  • Gal-9 has an activity of inducing differentiation (maturation) of dendritic cells. I found it. Gal-8 is also It was found to have an activity that induces differentiation (maturation) of dendritic cells, although it is less active than Gal-9. Furthermore, the present inventors completed the present invention by finding characteristic phenomena such as that the dendritic cells treated with Gal-9 can stimulate the enhancement of IL-10 production by T cells.
  • the present invention provides the following.
  • a tandem repeat type galectin, a mutant protein of the galectin, a nucleic acid encoding them, and a substance selected from the group consisting of degradation products thereof are included as a dendritic cell differentiation inducing factor.
  • Tandem lipid type galectins, mutant proteins of the galectins and nucleic acids encoding them, and those selected from the group consisting of degradation products thereof and dendritic cell precursor cells or undifferentiated cells A method for inducing differentiation of dendritic cells, which comprises contacting with dendritic cells.
  • a pharmaceutical comprising the bioactive agent according to [1] or [2] above.
  • Dendritic cell differentiation characterized by containing a tandem repeat type galectin, a mutant protein of the galectin, a nucleic acid encoding them, and a degradation product thereof. Inducer.
  • a tandem repeat type galectin, a mutant protein of the galectin, a nucleic acid encoding the same, and a degradation product thereof are selected from the group consisting of the following biological activities:
  • tandem repeat galectins, Gal-8 and Gal-9 are involved in the differentiation (maturation) of dendritic cells and promoted the Thl immune reaction. It can be expected that the differentiation (maturation) of dendritic cells can be controlled. Furthermore, since it is possible to control the differentiation (maturation) of dendritic cells, it can be expected that the immune response (inflammatory response) can be regulated.
  • Site-power-in that enhances production from CD4 + T cells by dendritic cells treated with tandem repeat-type galectins, Gal-8, Gal-9 or by co-culture (I-12, IL-10, TNF- ⁇ ) has anti-tumor activity and differentiated dendritic cells are useful in CTL therapy.
  • differentiated dendritic fine Exosomes released from the vesicle have antitumor activity. Therefore, it is possible to develop anti-inflammatory agents, anti-allergic agents, immunosuppressive agents, anti-tumor agents and the like through dendritic cell differentiation by tan, dem-repeat galectins, Gal-8, and Gal-9. Development of measuring reagents, medicines, and accessories using the induction (maturation) induction activity of dendritic cells by tandem repeat-type galectins, Gal-8 and Gal-9.
  • Figure 1 shows 6-day culture in the presence of GM-CSF and IL-4 to induce differentiation into immature dendritic cells, and then GM-CSF and IL to induce maturation.
  • GM-CSF and IL-4 to induce differentiation into immature dendritic cells, and then GM-CSF and IL to induce maturation.
  • mmmature DCs immature dendritic cells
  • mature dendritic cells mature dendritic cells
  • (A) shows immature dendritic cells cultured for 2 days with the indicated concentrations of Gal-1, Gal-3, Gal-8, Gal-9 or LPS, and then indicated for that cell. It is an analysis of whether or not the molecule being expressed is expressed on the cell surface. Data are shown as mean fluorescence intensity (MFI) for each molecule.
  • MFI mean fluorescence intensity
  • (B) shows the results of collecting the supernatant of dendritic cells cultured as cultured in ( ⁇ ) and assaying for IL-12 by ELISA. Data are expressed as the mean value SD of three sets of one experiment.
  • Figure 3 shows the results of investigating the effect of Ga-9 on proliferation and cytokine production of T cells drawn by dendritic cells in allogeneic MLR.
  • IFN-g represents IFN- ⁇
  • TNF-a represents TNF- ⁇ .
  • Alodienetic CD4 + T cells are shown for 4 days as indicated ratio with dendritic cells treated with Ga 9 (10 g / ml), LPS (500 ng / ml) or PBS for 2 days Incubated. [] Thymidine was added to the culture for 18 hours at the final time, and [] thymidine incorporation was measured to observe T cell proliferation.
  • Figure 4 shows the results of examining the effect of ratatoose on Gal-9-induced -12 production by dendritic cells.
  • Immature dendritic cells have 20 lactose or Incubate with Ga ⁇ g dO ⁇ ug / ml), PS (500 ng / ml) or PBS in the presence of 20 mM sucrose for 2 days, and then culture supernatant is assayed for IL-12. It was.
  • the data is the mean value SD of the three values obtained in one experiment and is representative of three independent experiments.
  • Figure 5 shows the results of investigating the effects of Gal-9 CRD mutants on IL-12 production by dendritic cells.
  • Immature dendritic cells can be obtained together with Gal-9 (10 / ig / ml), Gal-9 (R65D) mutant (10 or 30 ⁇ g / ml), LPS (500 ng / ml) or PBS.
  • the culture was incubated for days, and then the culture supernatant was assayed for IL-12.
  • the data is the mean value SD of the three values obtained in one experiment, and is representative of three independent experiments.
  • Gal-9 (R65D) -treated dendritic cells at concentrations of ⁇ ⁇ 0. 05 vs. 10 w g / iTil.
  • Figure 6 shows the results of examining the effect of Gal-9 on phosphorylation of P 38 MAPK and EM1 / 2 in dendritic cells.
  • Immature dendritic cells were cultured at the time indicated there together with Gal-9 (10 ⁇ g / ml), LPS (500 ng / ml) or PBS, and then the cell lysate was p38 Immunoblotting analysis using antibodies against phosphorylated forms of MAPK or ERK1 / 2 was performed. Blots with antibodies bound to all p38 MAPK or all ERK1 / 2 were probed again. Data are representative of three independent experiments.
  • Figure 7 shows the results of examining the effect of signal transduction inhibitors on Gal-9-induced dendritic cell maturation.
  • SB203580 p38 MAPK inhibitor
  • PD98059 ERK1 / 2 inhibitor
  • Figure 8 shows the effect of galectin-9 variant (h-G9NC (null), “ga ⁇ ”) on the cancer peritonitis model inoculated with mouse cancer cells Meth A cells in BALB / c mice (animal survival). Rate).
  • Fig. 9 shows the galectin 9 variant (designated h-G9NC (null), "Gal-9 (nul l)”) for the cancer peritonitis model inoculated with mouse cancer cells Meth A cells in BALB / c mice. The effect (animal survival curve) is shown.
  • Figure 10 shows the effect of the galectin 9 variant (indicated as h-G9NC (null) and “Gal-9 (nul l)) on a cancer peritonitis model inoculated with mouse cancer cells Meth A cells in BALB mice (animals). Survival rate).
  • A shows the result of administration of galectin-9 variant (prophylactic effect) simultaneously with cancer cell transplantation.
  • B shows the result of administration (treatment effect) of galectin-9 variant after cancer cell transplantation.
  • Fig. 11 shows galectin 9 variants (see Fig. 11) for each cancer peritonitis model inoculated with mouse cancer cells Meth A cells in BALB / c mice (A) and nude mice (BALB / c nu-nu mice) (B). h- G9NC (null), “hG9NC (nul l) j” shows the effect (animal survival rate).
  • A is cancer peritonitis BALB mice were treated with galectin modification at the same time as cancer cell transplantation Results (preventive effect) are shown, and B is for cancerous peritonitis nude mice.
  • Fig. 12 shows the galectin 9 variant (see Fig. 12) for each cancer peritonitis model in which mouse cancer cells Meth A cells were inoculated into BALB / c mice (A) and nude mice (BALB / c nu-nu mice) (B). h- G9NC (null), shows the effect (animal survival rate) of “hG9NC (null) J”.
  • A shows cancer peritonitis BALB / c mice after cancer cell transplantation, galectin 9 variant The results (therapeutic effect) were administered, and 8 is for malignant peritonitis nude mice.
  • Fig. 13 shows a galectin-9 variant in a cancer peritonitis model formed by inoculating mouse cancer cells Meth A cells into nude mice (BALB / c nu-nu mice) transfected with spleen cells (T cells). h-G9NC (null)) shows the results (animal survival rate) of the effects of pretreatment.
  • resist Meth A-resistant mouse spleen cell-transfected nude mouse cancer peritonitis model group
  • pretreat Nude Mau transplanted with spleen cells of BALB mice treated with a modified variant of tin 9 Peritonitis model group.
  • Figure 14 shows a galectin-9 variant (h-) against a cancerous peritonitis model formed by inoculating mouse cancer cells Meth A cells into nude mice (BALB nu-nu mice) transfected with spleen cells (T cells).
  • G9NC nul l
  • “G9j” shows the results of examining the effect of administration (animal survival rate).
  • Resist Nude mouse cancer peritonitis model group transfected with Meth A-resistant mouse spleen cells
  • pretreat Galecti in advance Nude mice transplanted with spleen cells of BALB / c mice treated with 9 variant.
  • Cancer-treated peritonitis model group, nontreat Nude mouse cancer cells transfected with spleen cells of untreated BALB / c mice as control group Peritonitis model group.
  • Fig. 15 shows Fig. 12 (B) and Fig. 13 and 14 in the galectin 9 variant administration group and the non-administration group, and the galectin 9 variant (h-G9NC (nul l), "Gal_9”) is administered again.
  • This is a graph of the results (animal survival rate) of investigating the effects of.
  • Figure 16 shows the effect of the galectin 9 variant (designated h-G9NC (nul l), “G9”) on a solid tumor model in which MethA cells passaged in vivo were transplanted subcutaneously into BALB / c mice (tumor volume curve) )
  • FIG 17 shows the galectin 9 variant (h-G9NC (null), denoted as “G9”) for a solid tumor model subcutaneously transplanted into nude mice (BALB / c nu- ⁇ mice) with MethA cells passaged in vivo. The effect (tumor volume curve) is shown.
  • G9 galectin 9 variant
  • tandem repeat type galectins in particular, Gal-8 and Gal-9 function as dendritic cell differentiation inducing factors. Therefore, proteins related to the galectins and mutants thereof Alternatively, induction of dendritic cell differentiation using a nucleic acid encoding the substance, such as a modified or derivative Technology to adjust the phenomenon has become possible to develop.
  • the technology may include tandem liby, tomato galectins, particularly those involved in Gal-8 and Gal-9 induced dendritic cell differentiation.
  • genes and transformation techniques that can be used in the present specification include those known in the art. For example, J. Sambrook et al., Olecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (2nd Edition, 1989 & 3rd Edition, 2001); DM Glover et al. Ed., "DNA Cloning, 2nd ed., Vol.
  • Preferred methods for measuring homology include those designed to obtain a large match between the two sequences being tested. Such a method is What is assembled as a gram.
  • the preferred computer program method for measuring the homology between two sequences is GCG Proghumnokaseshi (Devereux, J. et 'al., Nucleic Acids Research, 12 (1): 387 (1984)), BLASTP ⁇ BLASTN ⁇ FASTA (Atschul, SF et al., J. Mol. Biol., 215: 403 (1990)), etc., are not limited to these, and methods known in the art are used. be able to.
  • the term “polypeptide 1” includes
  • polypeptide refers to any peptide containing two or more amino acids that are linked together by peptide bonds or modified peptide bonds. Means peptide or any protein.
  • polypeptide is generally referred to in the art as, for example, peptides, oligopeptides or short-chain, also referred to as peptide oligomers, and proteins. It can usually mean both long chain known ones.
  • Polypeptides often contain amino acids other than the amino acids usually referred to as naturally occurring amino acids (naturally occurring amino acids: or amino acids encoded by genes).
  • Polypeptides, including terminal amino acid residues are not only made by natural processes where many amino acid residues are translated and processed (or modified) after being translated, but also to those skilled in the art. It will be understood that the above polypeptide can be altered (modified) by well-known chemical modification techniques. Many forms of modifications (modifications) made to the polypeptide are known, and they are described in detail in basic reference books and more detailed papers and numerous research literatures in the field. These are well known to those skilled in the art.
  • Some particularly routine alterations / modifications include, for example, alkylation, acylation, esterification, amidation, glycosylation, lipid binding, Examples include sulfation, phosphorylation, y-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation. 1993); BC Johnson (Ed.), Posttranslaional Covalent Modification of Proteins, Academic Press, New York, (1983) (Wold, F., "Posttranslational Protein Modifications: Perspective and Prospects", pp. 1-12); Seifter et al., "Analysis for Protein Modifications and nonprotein cofactors, Methods in Enzymology, 182: 626-646 (1990); Rattan et al.,
  • Gal-9 typically includes natural type Gal-9.
  • L type Gal-9 long type (L type) Gal-9, medium type (M type) Gal-9 and short type (S type) Gal-9 have been reported.
  • Gal-9 is the N-terminal domain and C-terminal domain linked by the putative link peptide region of SEQ ID NO: 4 disclosed in W0 02/37114 A1, and M-type Gal-9 is An N-terminal domain and a C-terminal domain are linked by a putative link peptide region of SEQ ID NO: 5, and S-type Gal-9 is It is thought that the N-terminal domain and the C-terminal domain are linked.
  • the W0 02/37114 A1 differs from L-type Gal-9 in that the amino acid residue of the sequence is deleted, and in S-type Gal-9, the corresponding of M-type Gal-9 It differs from M-type Gal-9 in that the amino acid residue of the sequence of SEQ ID NO: 8 of W0 02/37114 A1 is deleted from the link peptide region. It differs from L-type Gal-9 in that the amino acid residue of SEQ ID NO: 9 of W0 02/37114 A1 is deleted from the putative link peptide region.
  • Gal-9 is the above-mentioned type Gal-9, M type Gal-9, S type Gal-9, and others. Naturally occurring mutants of the Gal-9 family, as well as artificial mutations in them.
  • Gal_9 mutant may be a mutin in which the mutation is introduced into the N-terminal CRD and Z or C-terminal CRD, and the sugar chain binding activity is reduced or deleted. In some cases, it may be preferable.
  • Gal-8 you can refer to JP 2004-215612 publication and Japanese Patent Application No. 2004-175086.
  • Gal_8 mutant is mutated to N-terminal CRD and / or C-terminal CRD.
  • a representative Gal-9 protein of the present invention includes any one of the amino acid sequences of SEQ ID NOs: 1 to 3 (SEQ ID N0: 1 to 3) in the sequence table of W0 02/37114 A1 or substantially the same.
  • a polypeptide having an equivalent amino acid sequence eg, at least 5-311, 5-323 or 5-355 contiguous amino acid residues of the amino acid sequence of SEQ ID N0: 1, 2 or 3 Having a group and having substantially equivalent biological activity, such as equivalent antigenicity, etc., or having those characteristics and any of SEQ ID N0: 1, 2 or 3 in the sequence listing At least 50% homology with any one of each domain, or at least 60% homology, or at least 70% homology, or at least 80% homology, or at least 90% higher Homology, or at least And those having a homology of 95% or more, or at least 98% of homology.
  • the Gal-8 protein can be considered almost the same way.
  • the human Gal-9 polypeptide of the present invention includes a continuous amino acid residue containing all or part of the amino acid sequence of SEQ ID N0: 1 to 3 in the sequence listing of W0 02/37114 A1, Or the amino acid sequence of SEQ ID N0: i, 2 and 3 5 or more, preferably 10 or more, more preferably 20 or more, more preferably 30 or more, more preferably 40 or more, more preferably 50 or more, and more.
  • the human Gal-9-related polypeptide of the present invention may have a part or all of an amino acid sequence selected from the group consisting of SEQ ID ⁇ : 1, 2 and 3 force ⁇ (start codon). You may be missing the Met that corresponds to). Anything having such a sequence may be included. The same is true for Gal-8.
  • Nucleic acids encoding Gal-9 or its constituent domains or fragments thereof may be obtained by coding a peptide having substantially the same biological activity as that of the antigenic equivalent of Gal-9. Any one containing a base sequence with the same effect may be used.
  • Nucleic acids encoding Gal-9 are nucleic acids such as single-stranded DNA, double-stranded DNA, RNA, DNA: RNA hybrid, and synthetic DNA, as well as human genomic DNA, human genomic DNA library, human tissue Either cell-derived cDNA or synthetic DNA may be used.
  • the nucleotide sequence of the nucleic acid encoding Gal-9 can be modified (for example, added, removed, substituted, etc.), and such modified ones can also be included. It may also be a naturally occurring mutant.
  • nucleic acids may encode a typoid, M-type or S-type Gal-9 peptide or a part thereof, and preferred examples include DNA.
  • the above-mentioned “same base sequence” means, for example, a sequence of 5 sequences out of the base sequence encoding the amino acid sequence of SEQ ID NO: 1 in the sequence listing disclosed in 02/37114 A1 under stringent conditions.
  • An amino acid that hybridizes with at least one nucleotide sequence preferably at least 10 nucleotide sequences, more preferably at least 15 nucleotide sequences, and even more preferably at least 20 nucleotide sequences, and is substantially equivalent to Gal-9. Examples thereof include those encoding sequences or their complementary chains.
  • the nucleic acid encoding Gal-9 is typically W0 02/37114 SEQ ID N0 in the sequence listing disclosed in Al: a nucleotide sequence encoding a peptide, peptide represented by any one of 1 to 3 and a portion of its continuous amino acid sequence (each characteristic Including a coding sequence only), a codon sequence added with a start codon (codon encoding Met) and a stop codon, and at least 50% of the protein encoded by the base sequence
  • oligonucleotide is a relatively short single-stranded or double-stranded polynucleotide, preferably a polydioxynucleotide, Angew. Chem. Int. Ed. Engl. Vol. 28, p. 716-734 (1989), known methods such as phos-photoreester method, phospho-diester method, phosphite method, phosphoramidite method, phosphonate method It can be chemically synthesized by such methods.
  • oligonucleotide may contain one or more modified bases, for example, a non-naturally occurring base such as inosine, or a tritylated base, In some cases, it may contain a marked base.
  • polymerase chain reaction J or “PCR” is generally as described in HA Erlich ed., PCR Technology, Stockton Press, 1989, etc.
  • the PCR method involves repeating a cycle of primer extension synthesis using two oligonucleotide primers that can preferentially hybridize with a vertical nucleic acid.
  • primers used in the PCR method can use a primer complementary to the nucleotide sequence to be amplified inside the cage, for example, at the nucleotide sequence to be amplified and at both ends thereof.
  • a force that is complementary, or one that is adjacent to the nucleotide sequence to be amplified can be preferably used.
  • the primer is preferably an oligonucleotide composed of 5 or more bases, more preferably 10 or more bases, more preferably an oligonucleotide composed of 18 to 25 bases.
  • the PCR reaction can be carried out by a method known in the art or a method or modification method substantially similar thereto, but in addition to the above documents, for example, R. Saiki, et al., Science, 230: 1350, 1985; R. Saiki, et al., Science, 239: 487, 1988; DM Glover et al. Ed., "DNA Cloning", 2nd ed., Vol. 1, (The Practical Approach Series), IRL Press, Oxford University Press (1995); MA Innis et al. Ed., "PCR Protocols: a guide to methods and applications", Academic Press, New York (1990)); MJ cPherson, P.
  • PCR 3 can be performed using a commercially available kit suitable for it, and can also be performed according to a protocol clarified by a kit manufacturer or a kit distributor.
  • a PCR reaction consists of, for example, a cage (typically DNA) and a primer designed based on the target nucleic acid.
  • dNTPs mixture of doxy nucleoside triphosphate dATP, dGTP, dCTP, dTTP
  • Taq DNA polymerase and deionized distilled water.
  • PCR cycle conditions include, for example, denaturation 90-95 ° C 5-100 seconds, annealing 40-60 ° C 5-150 seconds, extension 65-75 C C 30-300 seconds, preferably denaturation A cycle of 94 ° C for 15 seconds, annealing at 58 ° C for 15 seconds, and extension at 72 ° C for 45 seconds can be mentioned, but the reaction temperature and time for annealing can be selected appropriately by experiment, and denaturation reaction and extension reaction The appropriate time can be selected according to the expected chain length of the PCR product. It is usually preferable to change the annealing reaction temperature according to the Tm value of the hybrid of primer and vertical DNA.
  • the length of the extension reaction is usually about I minutes per lOOObp chain length, but it is possible to select a shorter time in some cases.
  • a hybridization technique can be used.
  • the hybridization can be performed by the method described in the literature disclosing the “gene recombination technology” or a method or modification method substantially similar thereto, for example, the colony hybridization method, plaque hybrida Use the lysation method, the hybridization method, the translaced assembly method, and the plus and minus methods.
  • a carrier including a membrane such as a nylon filter
  • the product transcribed on the carrier for example, a membrane
  • a labeled probe DNA fragment modified as necessary in a hybridization buffer For example, a radioactive isotope, use a commercially available standard. Labeling the probe DNA with [a-P] dCTP (Amersham), etc. using a recognition kit such as the random primed DNA labeling kit (Boehringer Mannheim) to obtain a radioactive probe
  • the labeling can be performed by a method known in the art, for example, digoxigenin, a fluorescent dye, a piotine-avidin system, etc. Hybridization treatment is usually performed.
  • the hybridization process is performed for about 18 hours at about 55 ° C.
  • a buffer for hybridization a buffer commonly used in this field is used.
  • the modification treatment of the transferred carrier include a method using an alkaline denaturation solution, and it is preferable to treat with a neutralizing solution or a buffer solution after the treatment.
  • the immobilization treatment of the carrier is usually about 40 ° C to about 100 ° C, more preferably about 70 ° C to about 90 ° C, about 15 minutes to about 24 hours, More preferably, the baking is carried out by baking for about 1 hour to about 4 hours, but can be carried out by appropriately selecting preferable conditions, for example, a carrier such as a filter at about 80 ° C. for about 2 hours.
  • Immobilization is performed by washing the transferred carrier (for example, a membrane) with a washing solution commonly used in the field, such as 1M NaCl, ImM EDTA and 0.1% Sodium Dodecyl.
  • the carrier including the membrane can be selected from those commonly used in the field, and examples thereof include a nylon filter.
  • the denaturing solution, neutralizing solution, and buffer solution can be selected from those commonly used in the field, and the alkaline denaturing solution contains, for example, 0.5M NaOH and 1.5M NaCl.
  • the neutralizing solution include 1.5M NaCl-containing 0.5M Tris-HCl buffer solution, PH8.0, etc.
  • Examples of the buffer solution include 2 X SSPE.
  • the transferred carrier for example, a membrane
  • This prehybridization treatment can be performed, for example, by using a prehybridization solution [50% formamide, 5 X Denhardt's solution (0.2% ushi serum albumin, 0.2% po lyv i ny l pyrrol i done), 5 X SSPE, 0.1% SDS, 100 ⁇ g / mL heat-denatured salmon sperm DNA], etc., and about 35 ° C to about 50 ° C, preferably about 42 ° C, about Although the reaction can be carried out by reacting for 4 to about 24 hours, preferably about 6 to about 8 hours, those skilled in the art can appropriately experiment by repeating the experiment as appropriate.
  • a prehybridization solution [50% formamide, 5 X Denhardt's solution (0.2% ushi serum albumin, 0.2% po lyv i ny l pyrrol i done), 5 X SSPE, 0.1% SDS, 100 ⁇ g / mL heat-denatured salmon
  • the denaturation of the labeled probe DNA fragment used in the hybridization is performed, for example, by heating at about 70 ° C to about 100 ° C, preferably about 100 ° C, for about 1 minute to about 60 minutes, preferably about 5 minutes.
  • Hybridization can be carried out by a method known per se or a method analogous thereto, but the stringent conditions in this specification are, for example, about 15 to about 50 mM with respect to sodium concentration. Preferably about 19 to about 40 mM, more preferably about 19 to about 20 ⁇ , and about 35 to about 85 ° C., preferably about 50 to about 70 ° C., more preferably about 60 to about 65 ° C. The conditions of are shown.
  • the target sequence in the case of “high homology”, depending on the length of the target sequence, for example, 50% or more of homology, further 60% or more, preferably 70% or more, more preferably 80% or more, and In certain cases, it may be 95% or more, particularly preferably 97% or more.
  • the “same-effect base sequence” may, for example, be one that hybridizes to those having the sequence in question under stringent conditions, for example, 5 or more consecutive base groups in the base sequence.
  • a sequence preferably 10 or more nucleotide sequences, more preferably 15 or more nucleotide sequences, more preferably 20 or more nucleotide sequences, and an amino acid sequence substantially equivalent to the polypeptide. What to code I can get lost.
  • the filter and other carriers can be thoroughly washed, and the labeled probe other than the labeled probe DNA fragment that has undergone a specific hybridization reaction can be removed before detection.
  • Washing of the carrier such as a filter can be performed by selecting from those commonly used in the field, for example, containing 0.1% SDS 0.5 X SSC (0.1M NaCl, 15mM Quen Acid) It can be carried out by washing with a solution.
  • Hybridized nucleic acids can typically be detected by autoradiography, but various technical methods are known in the field, and should be appropriately selected from these methods and used for detection. You can also.
  • the nucleic acid bands corresponding to the detected sheet Gunaru a suitable buffer, for example, SM solution (lOOmM NaCl and LOMM MgSO 4 containing 50 mM Tri s-HCl buffer, ⁇ 7 ⁇ 5) were suspended in such, then the suspension
  • SM solution lOOmM NaCl and LOMM MgSO 4 containing 50 mM Tri s-HCl buffer, ⁇ 7 ⁇ 5
  • the desired nucleic acid can be isolated, purified and further amplified.
  • the process of screening a target nucleic acid from a nucleic acid sample including a gene library or a cDNA library by a hybridization process can be repeated.
  • Samples carrying a given nucleic acid can be purified and separated by methods commonly used in the art, eg, glycerol gradient over It can be purified by centrifugation (Molecular Clon ing, a laboratory manual, ed. T. amatis, Cola Spring Harbor Laboratory, 2nd ed. 78, 1989).
  • DNA can be purified separated by methods commonly used in the art, for example, resulting phage TM solvent solution (LOMM MgSO 4 containing 50mM Tri s-HC l buffer, ⁇ 7 ⁇ 8), etc., and after treatment with DNase I and RNase A, add 20 mM EDTA, 50 ⁇ g / ml proteinase K and 0.5% SDS, etc. After incubating for 1 hour, this was extracted with phenol-extracted jetyl ether, and then DNA was precipitated by ethanol precipitation. The obtained DNA was then washed with 70% ethanol, dried, and dissolved in TE. Solution (IOmM EDTA-containing lOmM Tris-HCl buffer, pH 8. OH.
  • LOMM MgSO 4 containing 50mM Tri s-HC l buffer, ⁇ 7 ⁇ 8
  • SDS 0.5% SDS
  • nucleic acids are nucleic acids such as single-stranded DNA, double-stranded DNA, RNA, DNA: RNA hybrid, synthetic DNA, genomic DNA, genomic DNA library, cell origin
  • the nucleic acid can also be obtained by chemical synthesis, in which case the fragments are chemically synthesized and they are fermented.
  • CDNA libraries derived from cloned humans such as various human tissue or cultured cells (especially chick kidney, brain, pineal gland, lower Pituitary gland, nerve cell, retina, retinal vascular cell, retinal nerve cell, thymus, blood vessel, endothelial cell, vascular smooth muscle cell, blood cell, macrophage, lymphocyte, testis, ovary, uterus, intestine, heart, liver, spleen ) Small intestine, large intestine, gingival-related cells, skin-related cells, glomerular cells, tubule cells, connective tissue cells and other tissues / cells, and various tumor tissues, cancer cells, etc.) cDNA libraries can be used.
  • tissue or cultured cells especially chick kidney, brain, pineal gland, lower Pituitary gland, nerve cell, retina, retinal vascular cell, retinal nerve cell, thymus, blood vessel, endothelial cell, vascular smooth muscle cell, blood cell, macrophage, lymphocyte, testis, ovary,
  • cDNA libraries used as a cage type commercially available cDNA libraries from various tissues can be used directly.
  • Stratagene, Invitrogen, Clontech For example, a gene library prepared from human tissue or cells, such as human PI artificial chromosome Genomic Lifecycle (Human Genome Mapping Resource Center).
  • a rabbit tissue cDNA library (available from, for example, Clontech) can be used.
  • Human genomic DNA libraries or human-derived cDNA libraries constructed from various human tissues or cultured cells can be screened using probes.
  • the obtained nucleic acid (including DNA) such as a PCR product is usually subjected to 1-2% agarose gel electrophoresis and cut out from the gel as a 'specific band, for example, gene clean kit (Bio 101) Extract using a commercially available extraction kit.
  • the extracted DNA is cleaved with an appropriate restriction enzyme and, if necessary, 'purified or further phosphorylated at the 5' end with T4 polynucleotide kinase, etc., and then a pUC vector such as pUC18. Ligation into an appropriate plasmid vector such as the above, and transform appropriate suitable cells.
  • the base sequence of the cloned PCR product is analyzed.
  • plasmid vectors can be used to transform host cells, for example using phage vectors, calcium method, noredium / calcium method, calcium / manganese method, TFB high efficiency method, FSB freezing combination It can be carried out by methods known in the art such as the tent cell method, rapid colony method, electoral position method, or substantially similar methods (D. Hanahan, J. Mol.
  • DNA can be cloned as needed, and for example, plasmid, ⁇ fage, cosmid, P1 phage, F factor, YAC, etc. can be used.
  • Preferred examples include I phage-derived vectors such as Charon 4A, Charon 21A, AgtlO, IgtlADASHII, FIXII, ⁇ EMBL3, ⁇ ZAP11 TM (Stratagene Etc.) can be used.
  • the obtained DNA is incorporated into a suitable vector such as plasmid pEX, pMA neo, pG5, as described in detail below, and a suitable host cell as described in detail below. For example, it can be expressed in E.
  • the DNA fragment can be used as it is or as a DNA fragment to which an appropriate control sequence is added, or it is incorporated into an appropriate vector and introduced into an animal to create a transgenic animal that expresses the predetermined gene. can do. Examples of animals include mammals, such as mice, rats, rabbits, guinea pigs, and lions.
  • the DNA fragment can be introduced into a fertilized egg of an animal such as a mouse to create a transgenic animal. Confirmation of a predetermined gene product can be performed using animal cells, such as 293T cells and COS-1 cells, which have been transfected with the foreign gene.
  • a method for introducing a foreign gene into an animal cell such as a mammal a method known in the art or a method substantially similar thereto can be used.
  • a calcium phosphate method for example, FL Graham et al. , Virology, 52: 456, 1973, etc.
  • DEAE-dextran method eg, D. Warden et al., J. Gen. Virol., 3: 371, 1968, etc.
  • electroporation method eg, E. Neumann et al., ⁇ J, 1: 841, 1982
  • microinjection ribosome method, virus infection method, phage particle method, etc.
  • plasmid into which a predetermined gene or the like (DNA used in the present invention) is incorporated, host cells commonly used in genetic engineering (for example, prokaryotic hosts such as Escherichia coli and Bacillus subtilis, yeast, 293T cells, CH0 cells, Any plasmid can be used as long as it can express the DNA in eukaryotic cell hosts such as COS cells and insect cell hosts such as Sf21. Of course, it is possible to select from the ones attached to commercially available kits and reagents. , Such sequences include, for example, modified codons suitable for proper expression in selected host cells (eg, codons).
  • the target gene such as a regulatory sequence or facilitating sequence for facilitating the expression of the target gene.
  • useful linkers, adapters, and other antibiotics, as well as control of nutritional requirements-metabolites, and sequences useful for sorting and detection (hyprid proteins and fusions) Convenient or useful decorations may be applied, including those that encode proteins).
  • suitable promoters such as plasmids hosted by Escherichia coli, are the tritophan fan promoter (trp), the lactose promoter (lac), the tryptophan 'latatoose promoter
  • GAL1, GAL 10 promoters, etc. can be used in blastomers using yeast as a host.
  • control systems such as CYC1, HIS3, ADH1, PGK, PH05, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TP1, A0X1 can be used.
  • An enhancer can be inserted into the vector to promote transcription of the DNA encoding the desired polypeptide, and such an enhancer acts as a promoter and promotes transcription, usually about Examples include elements having a cis action of 10 to 100 bp. Many Hans Hansa are known from mammalian genes such as globin, elastase, anolebumin, human fetoprotein, and insulin. Typically, an enhancer obtained from a eukaryotic cell infectious virus can be suitably used.
  • SV40 enhancer 100-270 bp
  • the early promoter of cytomegalovirus Examples include the enhancer, the enhancer in the late region of the replication origin of polio, and the enhancer of adenovirus.
  • add a signal sequence that matches the host can be those well known to those skilled in the art. Examples of plasmids using E.
  • coli as hosts include pBR322, pUC18, pUC19, pUC118, pUC119, pSP64, pSP65, pTZ-18R /-18U, pTZ-19R / -19U, pGEM-3, pGE-4, pGEM-3Z , pGEM-4Z, pGEM-5Zf (-), pBluescript KS TM (Stratagene).
  • Examples of plasmid vectors suitable for expression in E. coli include pAS, pKK223 (Pharmacia), pC1403, pC931, pKC30, and pRSET- ⁇ (Invitrogen).
  • Examples of plasmids that use animal cells as hosts include SV40 vectors, polio-maunolu vector, vaccinia, winores betater, retro uenores vector, etc., specifically pcD, pcD-SR a, CDM8, pCEV4, pME18S, PBC12BI, P SG5 (Stratagene , Inc.), and the like.
  • Examples of plasmids using yeast as a host include Yip type vectors, YEp type vectors, YRp type vectors, YCp type vectors, and the like, for example, pGPD-2.
  • examples of host cells include those derived from E.
  • coli K12 strain such as ⁇ ⁇ ⁇ 533, XLl-Blue, C600, DH1, DH5, DH11S, DH12S, DH5a, DH10B, HB101, C1061 , JM109, STBL2, B834 strains include BL21 (DE3) pLysS.
  • yeast baker's yeast, fission yeast, and the like may be included. Examples include Saccharomyces cerevisiae, Schizosaccharomyces prombe, Pichia pastoris, Kluyveromyces strains, Candida, Trichoderma reesia, and other yeast strains.
  • the host cell is an animal cell, for example, COS-7 cells, C0S-1 cells, CV-1 cells, human kidney cell-derived 293 cells, human epidermis cell-derived A431 cells, human cells derived from African green monkey fibroblasts 205 cells derived from colon, COP cells derived from mouse fibroblasts, MOP cells, W0P cells, CH0 cells derived from Chinese hamster cells, CHO DHFR-cells, human HeLa cells, mouse cells derived C127 cells, mouse cells derived NIH 3T3 cells, mouse L cells, 9BHK, HL60, U937, HaK, Jurkat cells, other transformed cell lines, double normal Examples include somatic cells, and Itoda vesicles derived from in vitro primary cultured tissues.
  • COS-7 cells COS-7 cells, C0S-1 cells, CV-1 cells, human kidney cell-derived 293 cells, human epidermis cell-derived A431 cells, human cells derived from African green monkey fibroblasts 205 cells derived from colon
  • Insect cells include Bombyx mori nuclear pol yhedrosis virus, derived from it or other suitable vectors as vectors, Spodoptera frugiperda (caterpi l lar), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melangaster (frui tfly), silkworm larvae or silkworm cultured cells such as BM-N cells (for example, Luckow et al., Bio / Technology, 6, 47-55 (1988) Setlow, JK et al. (Eds.), Genetic Engineering, Vol. 8, pp.
  • Plant cells can be used as host cells using Agrobacterium tumefaciens, etc., and they are well known in the art, along with suitable vectors.
  • a restriction enzyme, reverse transcriptase, or DNA fragment that is known or widely used in the art is modified or converted into a structure suitable for cloning. Enzymes such as DNA modifying / degrading enzymes, DNA polymerases, terminal nucleotidyl transferases, and DNA ligases can be used.
  • restriction enzymes include RJ Roberts, Nucleic Acids Res., 13: rl65, 1985; S. Linn et al. Ed. Nucleases, p. 109, Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1982; RJ Roberts, D. Macel is, Nucleic Acids Res., 19: Suppl. 2077, 1991.
  • a transformant transformed with an expression vector containing a nucleic acid encoding a polypeptide (or protein) can be highly expressed by repeated cloning using an appropriate selection marker as necessary. Can be obtained.
  • a transformant using an animal cell as a host cell when the dhfr gene is used as a selection marker, the MTX concentration is gradually increased and cultured, and a resistant strain is selected. Amplify the DNA encoding A cell line capable of obtaining the present can be obtained.
  • the transformant of the present invention can be cultured under conditions capable of expressing the nucleic acid encoding the polypeptide of the present invention, and the target product can be produced and accumulated.
  • the transformant can be cultured in a medium commonly used in the art.
  • a liquid medium can be suitably used for a transformant having a prokaryotic host such as Escherichia coli or Bacillus subtilis or a host such as yeast.
  • the medium contains a carbon source, a nitrogen source, an inorganic substance, and the like necessary for the growth of the transformant.
  • carbon sources include gnolecose, dextrin, soluble starch, and sucrose.
  • nitrogen sources include ammonium salts, nitrates, cornstrip-liqueur, peptone, casein, meat extract, malt extract, soybean meal.
  • inorganic or organic substances and inorganic substances such as potato extract include calcium chloride, sodium dihydrogen phosphate, magnesium chloride, and calcium carbonate. You can also add yeast, vitamins, casamino acids, growth-promoting factors, etc. In addition, a drug such as 3 / 3-indolylacrylic acid can be added to make the promoter work efficiently if necessary.
  • the pH of the medium is preferably about 5 to about 8.
  • E. coli is usually cultured at about 15 to about 45 ° C for about 3 to about 75 hours, and if necessary, aeration or agitation can be added.
  • examples of the medium include MEM medium containing about 5 to about 20% fetal calf serum, PRMI 1640 medium, DMEM medium, and the like.
  • the pH is preferably from about 6 to about 8. Cultivation is usually carried out at about 30 to about 40 ° C for about 15 to about 72 hours, with aeration and agitation as necessary.
  • a transformant expressing a predetermined gene product can be used as it is, but it can also be used as its cell homogenate, but a predetermined gene product can also be isolated and used.
  • the cells or cells are collected by a known method and suspended in an appropriate buffer, and the cells or cells are obtained by ultrasound, lysozyme, and lysing or freeze-thawing.
  • a method of obtaining a crude extract by centrifugal separation or filtration after breaking can be used as appropriate.
  • Buffer A protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton, X-100 (trade name) or Tween-20 (trade name) may be added to the liquid.
  • the cells or cells are separated from the supernatant by a method known per se after completion of the culture, and the supernatant is collected.
  • the culture supernatant thus obtained or the target product contained in the extract can be purified by appropriately combining known separation / purification methods, such as ammonium sulfate precipitation. Salt filtration, gel filtration using cephadex, etc., for example ion exchange chromatography using a carrier having a jetylaminoethyl group or a carboxymethyl group, for example, hydrophobic groups such as butyl, octyl, and fuunil groups.
  • Purified by hydrophobic chromatography using supported carriers, dye gel chromatography, electrophoresis, dialysis, ultrafiltration, affinity chromatography, high-speed liquid chromatography, etc. can be obtained.
  • it can be purified and separated by treatment with polyacrylamide gel electrophoresis, affinity chromatography with ligands immobilized, etc. Examples include gelatin-agarose affinity chromatography and heparin-agarose chromatography.
  • the obtained polypeptide can be modified by amino acid residues contained in a chemical manner, or a peptidase such as pepsin, chymotrypsin, papain, bromelain, endopep It can be modified with enzymes such as thidase and exopeptidase, or it can be partially decomposed into its derivatives.
  • the C terminus is usually a carboxyl group (—C00H) or carboxylate (—C00—), but the C terminus is an amide (_C0NH 2 ) or ester (—C00R). Also good.
  • R in the ester is, for example, C ⁇ 6 alkyl group such as methyl, ethyl, n-propyl, isopropyl or n-butyl, for example, C 8 cycloalkyl group such as cyclopentinole, cyclohexyl, etc.
  • a bivalyloxymethyl group widely used as an oral ester is used.
  • the polypeptide of the present invention includes those in which the carboxyl group is amidated or esterified.
  • the ester in this case, for example, the above-mentioned C-terminal ester or the like is used.
  • polypeptide (or protein) contains an amino group of the N-terminal methionine residue in the above-mentioned polypeptide, such as a protective group (for example, a C- 5 alkyl monocarboxyl such as formyl group, acetyl).
  • a protective group for example, a C- 5 alkyl monocarboxyl such as formyl group, acetyl.
  • ⁇ -group ⁇ _ 6- acyl group
  • Daltamyl group generated by cleavage of the heel end in vivo substitution on amino acid side chain of molecular heel groups (e.g., - 0 ⁇ , - C00H, amino group, imidazole group, indole group, grayed ⁇ - like Gino group)
  • a suitable protecting group such as 6 Ashiru group such as formyl group, such as Asechiru group
  • a complex protein such as a so-called glycoprotein to which a sugar chain is bound etc.
  • site-directed mutagenesis using synthetic oligonucleotides (site-directed mutagenesis) (Zoller et al., Ucl. Acids Res., 10: 6487, 1987; Carter et al., Nucl. Acids Res , 13: 4331, 1986), cassette mutagenesis: Wells et al., Gene, 34: 315, 1985, restriction selection mutagenesis: Wells et al., Philos Trans. R.
  • fusion polypeptides can be purified by affinity chromatography using the fusion part.
  • fusion polypeptides include those fused to a histidine tag, or -galactosidase (/ 3-gal), maltose binding protein (MBP), glutathione-S-transferase (GST), thioredoxin (TRX) Alternatively, those fused to the amino acid sequence of Cre Recombinase can be mentioned.
  • the polypeptide can be tagged with a heterogeneous epitope and can be purified by immunoaffinity chromatography using an antibody that specifically binds to the epitope. .
  • poly-histidine (poly-His) or poly-histidine-glycine (poly-His- Gly) tag and such epitope tag, for example, AU5, c-Myc, CruzTag, 09, CruzTag 22, CruzTag 41, Glu-Glu, HA, Ha. 11, KT3, FLAG (registered trademark, Sigma-Aldrich), Omni -Probe, S-probe, T7, Lex A, V5, VP 16, GAL4, VSV-G (Field et al., Molecular and Cellular Biology, 8: pp. 2159-2165 (1988); Evan et al., Molecular and Cellular Biology, 5: pp.
  • epitope tag for example, AU5, c-Myc, CruzTag, 09, CruzTag 22, CruzTag 41, Glu-Glu, HA, Ha. 11, KT3, FLAG (registered trademark, Sigma-Aldrich), Omni -Probe, S-probe, T7, Lex A, V5, VP 16, GAL4, V
  • the fusion polypeptide may be one with a marker that becomes a detectable protein.
  • the detectable marker may be a biotin Avi Tag based on the biotin / streptavidin system, a fluorescent substance, or the like.
  • the fluorescent substances include luminescent jellyfishes such as Aequorea victorea, green fluorescent protein (GFP), and a modified variant (GFP variant) such as EGFP ( Enhanced-humanized GFP), rsGFP (red-shift GFP), yellow fluorescent protein (YFP), green fluorescent protein (GFP), cyan fluorescent protein (cyan) Examples include fluorescent protein (CFP), blue fluorescent protein (BFP), and GFP derived from Renilla reniformis.
  • Detection can also be performed using an antibody that specifically recognizes the fusion tag (including a monoclonal antibody and its fragment).
  • the expression and purification of such fusion polypeptides is a suitable commercial kit. It can also be performed according to protocols that have been identified by kit manufacturers or kit distributors.
  • the resulting protein (which may contain peptides or polypeptides) can be immobilized by binding it to an appropriate carrier or solid phase using known techniques such as enzyme immunoassay. It can.
  • Solid-phased proteins and solid-phased peptides can be conveniently used for screening of binding materials.
  • the modification and modification of the structure of the polypeptide protein is described in, for example, the Japanese Biochemical Society, “New Chemistry Experiment Course 1, Protein VI I, Protein Engineering”, Tokyo Kagaku Dojin (1993). Alternatively, it can be carried out by the methods described in the literature cited therein, or in a substantially similar manner.
  • the biological activity may include immunological activity, eg, antigenicity.
  • the peptide or polypeptide (or protein) derived from the human has one or more amino acid residues that differ from the natural ones in terms of identity, and the position of one or more amino acid residues differs from the natural one. It may be different.
  • the peptide derived from the human of the present invention has one or more amino acid residues peculiar to human Gal-9 (including L, M, and S) proteins (for example, 1 to 80, preferably 1 to 60, more preferably 1-40, more preferably 1-20, especially 1-10, etc.) Deletion analogues missing, one or more of the unique amino acid residues (eg 1 to 80, preferably 1 to 60, more preferably 1 to 40, more preferably 1 to 20, especially 1 to 10) are substituted with other residues.
  • the peptide or polypeptide may include a primary structure conformation substantially equivalent to that of natural human Gal-9 protein or a part thereof having a primary structure conformation. It may be included that has substantially the same biological activity as the above. It can also be one of naturally occurring variants.
  • the protein (or peptide or polypeptide) derived from the human is, for example, 60% of the amino acid sequence selected from the group consisting of SEQ ID N0: 1-3 in the sequence listing of W0 02/37114 A1. Some of them have homology higher than 70%, more preferably those having homologous amino acid sequences of 80% or 90% or more.
  • the part of the protein derived from the human is a peptide of a part of the protein derived from the human (that is, a partial peptide of the protein), and the Gal-9 of the present invention. Any substance may be used as long as it has an activity substantially equivalent to that of the protein (the sugar chain binding activity may be reduced or deleted).
  • the partial peptide of the protein is at least 5 or more, preferably 20 or more, more preferably 50 or more, more preferably 70 or more of the constituent amino acid sequences of the human Gal-9. More preferred are peptides having a sequence of 100 or more amino acids, and in some cases 200 or more amino acids, and preferably they correspond to consecutive amino acid residues or, for example, Among the amino acid sequences shown in SEQ ID N0: 1 to 3 in the sequence listing of W0 02/37114 A1, those having the same homology as mentioned above can be mentioned with respect to the homology to the corresponding region. Human Gal-8 protein However, it can be understood similarly.
  • the protein may be a mutin having a mutation as described above in the CRD region or may be preferable.
  • “substantially equivalent” means protein activity, for example, differentiation activity of a given dendritic cell (maturation) induction activity, biological activity associated with the dendritic cell differentiation (maturation) induction activity (For example, cytotoxic activity or its promoting activity, apoptosis-inducing activity or its promoting activity, anti-inflammatory activity, antiallergic activity, immunosuppressive activity, antitumor activity), dendritic cell differentiation (maturation) inducing activity It means that the accompanying physiological activity is substantially the same.
  • the meaning of the term may include a case where the activity has substantially the same quality, and the activity of substantially the same quality includes the activity of inducing differentiation (maturation) of dendritic cells, Biological activity associated with the dendritic cell differentiation (maturation) inducing activity (eg, cytotoxic activity or its promoting activity, apoptosis inducing activity or its promoting activity, anti-inflammatory activity, antiallergic activity, immunosuppressive activity, antitumor activity ), And physiological activity associated with the dendritic cell differentiation (maturation) inducing activity.
  • the substantially homogeneous activity means that these activities are qualitatively homogeneous, for example, physiologically, pharmacologically, or biologically homogeneous.
  • dendritic cell differentiation (maturation) inducing activity dendritic cell differentiation (maturation) inducing activity
  • dendritic cell differentiation (maturation) inducing activity cytotoxic activity, antitumor activity, etc.
  • cytotoxic activity cytotoxic activity
  • antitumor activity etc.
  • amino acid substitutions, deletions, or insertions often do not cause significant changes in the physiological and chemical properties of the polypeptide, and in some cases give favorable changes. In such cases, the polypeptide to which the substitution, deletion, or insertion has been made is not subject to such substitution, deletion, or insertion.
  • Substantially identical substitutions of amino acids in the amino acid sequence can be selected from other amino acids of the class to which the amino acids belong.
  • non-polar (hydrophobic) amino acids include alanine, phenylalanine, oral isine, isoleucine, valine, proline, tryptophan, methionine, etc.
  • polar (neutral) include glycine, serine, threonine, Cysteine, tyrosine, asparagine, glutamine, and the like.
  • Examples of positively charged amino acids (basic amino acids) include arginine, lysine, and histidine, and negatively charged amino acids (acidic amino acids) include asparagine. Acid, glutamic acid and the like.
  • a protein or a peptide synthesis resin is used, and an appropriately protected amino acid is sequentially bonded to the desired amino acid sequence on the resin by various condensation methods known per se.
  • various activating reagents known per se are preferably used, and as such a reagent, for example, carbodiimides such as dicyclohexylcarbodiimide can be preferably used.
  • the product has a protecting group, the desired product can be obtained by removing the protecting group as appropriate.
  • the peptide (or polypeptide) When the peptide (or polypeptide) is obtained as a free form, it can be converted into a salt by a method known per se or a method analogous thereto, and also obtained as a salt. In this case, it can be converted into a free form or other salt by a method known per se or a method analogous thereto.
  • the peptide (or polypeptide) salt is preferably physiologically acceptable or pharmaceutically acceptable, but is not limited thereto. Examples of such salts include salts with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, such as acetic acid, formic acid, maleic acid, fumaric acid, succinic acid, citrate, tartaric acid, malic acid.
  • Benzoic acid methanesulfur
  • examples thereof include salts with organic acids such as phonic acid, p-toluenesulfonic acid, and benzenesulfonic acid.
  • examples of the salts include ammonium salts such as salts with organic bases such as ethylamine, dimethylamine, trimethylamine, and hydroxetylamine.
  • Galectins, especially Gal-8 and Gal-9 expressed genes can be used to express specific genes in the field according to the above-mentioned “genetical recombination technology”.
  • Galectins using these technologies are all included in the technology of the present invention and the systems used for the in situ hybridization, for example, non-RI in situ hybridization, for example.
  • This may include, for example, direct and indirect methods, which include, for example, those in which a detectable molecule (reporter) is directly bound to a nucleic acid probe.
  • the signal is amplified using, for example, an antibody against a reporter molecule, etc.
  • the oligonucleotide in the nucleic acid probe has a functional group (for example, a primary aliphatic amino group).
  • the nucleic acid probe labeling method can be selected and used as appropriate from methods known in the art.
  • the random prime method, nick translation method, DNA amplification by PCR, labeling tiling method, in Examples include in vitro transcription. For the observation of the treated sample, it can be used by appropriately selecting from methods known in the field.
  • malignant cells may include tumor cells that metastasize.
  • Tumors that metastasize are malignant tumors.
  • the malignant tumors are classified into epithelial and non-epithelial types. In some cases, they may be considered as cancer, sarcoma, leukemia, etc.
  • cancer When it is simply called “cancer”, it generally refers to a malignant tumor in the general public.
  • cancer When it is simply called “cancer”, it generally refers to a malignant tumor in the general public.
  • cancer may be interpreted in a broad sense and should not be interpreted simply as an epithelial malignancy.
  • cancer may include epithelial malignant tumors and non-epithelial malignant tumors (including those that are tumorigenic and non-plastic), and skin cancer (including melanoma).
  • Functions such as predetermined biological activity of galectins such as Gal-9 (eg, dendritic cell differentiation-inducing activity, cytotoxic activity associated with dendritic cell differentiation induction, anti-inflammatory activity, anti-allergic activity, immunosuppression Compounds that promote activity, antitumor activity, etc., compounds that inhibit (antagonist), or salts thereof can be screened.
  • This also means providing the screening reagent.
  • a variety of dendritic cell differentiation-inducing activities exhibited by the polypeptide such as Gal-8 or Gal-9 protein, a part of the peptide or their salts elucidated in the present invention are used.
  • compounds that promote a predetermined function such as the biological activity of the Gal-9 protein of the present invention, some of its peptides or their salts, etc.
  • a screening method for compounds (antagonists) or salts thereof are also provided.
  • the biological activity (for example, activity related to the interaction between each Gal-8 or Gal-9 protein and a biological component) is measured and compared.
  • An appropriate detection substrate may be present in the screening system for convenience of measurement.
  • the substrate any substrate can be used as long as it can be effectively used for measurement.
  • a known substrate can be selected and used, but a synthesized compound can be preferably used.
  • the substrate can be used as it is, but preferably a substrate labeled with a fluorescence such as fluorescein, an enzyme or a radioactive substance can be used.
  • the test sample include proteins, peptides, non-peptide compounds, synthetic compounds, fermentation products, plant extracts, tissue extracts such as animals, and cell extracts.
  • the compound may preferably include an anti-galectin antibody, an enzyme inhibitor, a cytokine, a compound having various inhibitory activities, particularly a synthetic compound. These compounds may be novel compounds or known compounds.
  • the screening can be performed according to a usual method for measuring binding activity or enzyme activity. For example, the screening can be performed with reference to methods known in the art.
  • various labels, buffer solutions and other suitable reagents can be used, and the procedure described there can be performed.
  • the peptide used can be treated with an activator, or its precursor or latent type can be converted into the active type in advance.
  • the measurement is usually performed in a buffer solution that does not adversely affect the reaction, such as Tris-HCl buffer solution, phosphate buffer solution, etc., for example, pH of about 4 to about 10 (preferably pH of about 6 to about 8) Can be done.
  • a buffer solution that does not adversely affect the reaction
  • pH of about 4 to about 10 preferably pH of about 6 to about 8
  • the normal conditions and procedures in each method are added to the ordinary technical considerations of those skilled in the art, and the protein of the present invention or a polynucleotide having substantially the same activity as that of the present invention. What is necessary is just to construct a measurement system related to peptide or peptide.
  • a measurement system related to peptide or peptide For the details of these general technical means, refer to review articles, written books, etc. L, see eg Methods in Enzymology, Academic Press f ⁇ (USA)).
  • the elucidated structure of Gal-9 gene and the knowledge about the DNA sequence are used to screen the target genomic DNA, mRNA, and Gal-9 expression activity, Gal-9 activity. Furthermore, it is possible to design probes and blimmers for detecting dendritic cell differentiation-inducing activity by Gal-9. Any probe or primer for specific detection may be used as long as it substantially allows specific detection of dendritic cell differentiation-inducing activity by Gal-9. A typical example is one that makes it possible to detect a characteristic sequence portion of the gene disclosed in WO 02/37114 (0 02/37114 A1). As long as it is useful for specific detection, it is acceptable to detect a part of the Gal-9 gene. For example, to obtain human Gal-9 by PCR,
  • Gal-9 sense sequence CAGGCACCCATGGCTCAAACTAC [SEQ ID NO: 1]
  • Antisense sequence TATCAGACTCGGTAACGGGGGT [SEQ ID NO: 2]
  • the primer set described in the Examples can be used.
  • Probes and primers used for detection are preferably nucleic acid fragments or oligonucleotides, which are required to specifically hybridize to a given gene. In cases where detection is effective, those that are effectively bound in the form of hybridization are preferred. For such purposes, for example, oligonucleotides containing 5 or 10 consecutive bases, preferably 15 Or, an oligonucleotide containing 25 or more consecutive bases, more preferably an oligo (or poly) nucleotide containing 30 or 50 or more consecutive bases.
  • An oligo (or poly) nucleotide having a base sequence capable of effectively hybridizing to a target sequence may have another nucleotide or nucleotide chain added to one or both ends of the selected base sequence,
  • a label (including a marker or a reporter) described in the present specification may be bound.
  • the label may be incorporated, for example, during PCR.
  • those widely used in the field can be used, and for example, radioactive substances, fluorescent substances, luminescent substances, enzymes, etc., and also a piotin-avidin system may be used.
  • the probe may be labeled to facilitate detection.
  • PCR and PCR using reverse transcriptase (RT) (RT-PCR) can be used.
  • PCR can also be performed for quantitative measurements. For example, if a predetermined cDNA is used as a probe, a specific gene in a cell can be detected and measured by Northern blotting, Southern blotting, in situ hybridization, etc., for example. The same applies to galectin-8.
  • primers and In this case one consisting of a pair of oligonucleotides that define both ends of the sequence to be amplified is used.
  • the oligonucleotide disclosed in this specification or one of the specific oligonucleotides defined in the present invention is universal. Those composed of a pair of oligonucleotides composed of one of the primers can also be used.
  • This primer is used to initiate the extension of the sequence to be amplified, and can be used not only in the PCR method but also in amplification methods such as the LCR method and the TAS method.
  • the use of the primer is not limited to a specific nucleic acid amplification method, and can be used for various purposes-application-purposes.
  • a nucleic acid sample is obtained by the method described in “Gene Recombination Technique” above, and if necessary, an amplification reaction is performed using a primer capable of specifically amplifying the target gene. Test whether it occurred. Therefore, in the method of the present invention, known nucleic acid extraction methods such as DNA and mRNA or other suitable nucleic acid extraction methods can be used.
  • Amplification of the extracted nucleic acid such as DNA or mRNA can be performed by any amplification method, such as PCR method or RT-PCR method.
  • the product from the amplification operation is detected by, for example, electrophoresis, for example, agarose gel electrophoresis, and the presence or absence of the amplified DNA by a conventional method, for example, staining with ethidium bumb amide stain and then UV irradiation. be able to.
  • it can be detected by a predetermined probe. For example, if Gal-9 gene expression is not present in the test sample, amplification does not occur or is at a low level.For example, there is no separation of amplification products such as blotting and reverse blotting.
  • a detection method can also be used.
  • the relevant proteins or polypeptides targeted in this specification, fragments thereof, and nucleic acids including DNA can be used alone or organically, and further It can be applied to genomics and proteomics technologies in combination with sense technology, antibodies including monoclonal antibodies, and recombinant cells (transformants).
  • Gene expression analysis using nucleic acid array, protein array, gene function solution Analysis, protein-protein interaction analysis, and related gene analysis is performed in the nucleic acid array technology, a cDNA library is used, or DNA obtained by PCR technology is placed on a substrate with a spotting device at a high density, and analysis of the sample is performed using high hybridization.
  • the arraying is performed by attaching DNA to each unique position of a substrate such as a glass slide, a silicon plate, or a plastic plate using a needle or a pin, or using an ink jet printing technique. Can be implemented. Data is acquired by observing signals obtained as a result of hybridization on the nucleic acid array.
  • the signal may be obtained from a label such as a fluorescent dye (for example, Cy3, Cy5, BODIPY, FITC, Alexa Fluor dyes (trade name), Texas red (trade name), etc.).
  • a laser scanner or the like can be used for detection, and the obtained data can be processed by a computer system equipped with a program according to an appropriate algorithm.
  • tagged recombinant protein products may be used, including two-dimensional electrophoresis (2-DE) and mass spectrometry (MS) including enzymatic digestion fragments (including Technologies such as electrospray ionization (ESI) and matrix-assisted laser desorption / ionization (MALDI) are included.
  • MALDI-T0F analyzer, ESI-3 quadrupole analyzer, ESI-ion trap analyzer, etc. staining technology, isotope labeling and analysis, and image processing technology can be used. wear.
  • the present invention may also include the enzyme gene system obtained or used above, and software, databases, etc. relating to antibodies against the enzyme gene system.
  • Detection / measurement in the present invention can be performed by immunostaining such as tissue or cell staining, immunoelectron microscopy, immunoassay such as competitive immunoassay or non-competitive immunoassay, radioimmunoassay (RIA), FIA , LIA, EIA, ELISA, etc. can be used, and BF separation can be performed or the measurement can be performed with or without.
  • RIA, EIA, FIA and LIA are preferable, and sandwich type assembly is also preferable.
  • sandwich type assay one is an antibody against the Gal-8 or Gal-9 polypeptide of the present invention or an antibody against a Gal-8 or Gal-9 related peptide fragment, and the other is Gal-8 or Gal-9.
  • the antibody against the C-terminal residue of -9 is labeled, and one of them is detectably labeled (of course, other combinations are possible and can be designed appropriately according to the purpose).
  • Other antibodies capable of recognizing the same antigen are immobilized on the solid phase. Incubate the sample, labeled antibody, and solid-phased antibody to react sequentially as necessary. After separating the unbound antibody, the labeled product is measured. The amount of label measured is proportional to the amount of antigen, ie Gal-8 or Gal-9 polypeptide antigen.
  • this assembly it is called a simultaneous sandwich type assembly, a forward sandwich type assembly or a reverse sandwich type assembly depending on the order of addition of the insolubilized antibody or the labeled antibody.
  • washing, agitation, shaking, filtration, or pre-extraction of antigen are appropriately employed in the measurement process under specific circumstances.
  • Other measurement conditions such as the concentration of a particular reagent, buffer, etc., temperature or incubation time can be varied according to factors such as the concentration of antigen in the sample and the nature of the sample.
  • a person skilled in the art can perform the measurement by appropriately selecting optimum conditions effective for each measurement using a normal experimental method.
  • an anti-Gal-8 or Gal-9 antibody is used as a solid-phased antibody, and labeled and unlabeled antigens (antigens include Gal-8 or Gal-9 or a fragment thereof
  • labeled and unlabeled antigens include Gal-8 or Gal-9 or a fragment thereof
  • non-competitive methods such as sandwich methods can use immobilized anti-Gal-9 antibody and labeled anti-Gal-8 or Gal-9 antibody, and anti-Gal-
  • the 8 or Gal-9 antibody can be directly labeled, or the antibody against the anti-Gal-8 or Gal-9 antibody can be labeled or immobilized without immobilization.
  • Sensitivity amplification methods include, for example, a combination of a non-enzyme labeled primary antibody that uses a high molecular weight polymer, an enzyme, and a primary antibody (envision reagent applied; Enhanced polymer one-step staining (EPOS)).
  • a combination of enzyme and anti-enzyme antibody complex such as PAP (peroxidase-antiperoxidase) method, biotin labeled secondary antibody such as SABC (avidin-biotinylated peroxidase complex) method
  • PAP peroxidase-antiperoxidase
  • SABC avidin-biotinylated peroxidase complex
  • a combination of a biotin-labeled enzyme and a streptavidin complex with a biotin-labeled enzyme such as ABC (streptavidin-biotin complex) method, LSAB (labeled streptavidin-biotin) method, CSA (catalyzed signal ampl ification) SABC and Piotin standards!
  • the solid phase carrier is made of polystyrene, polycarbonate, polypropylene or polybule that adsorbs proteins such as antibodies well.
  • Various materials and forms such as balls, microplates, sticks, microparticles or test tubes can be arbitrarily selected and used.
  • the measurement can be performed in a suitable buffer solution system so as to maintain an optimum pH, for example, a pH of about 4 to about 9.
  • suitable buffers include, for example, phosphate buffer, citrate buffer, phosphate buffer, tris buffer, triethanolamine buffer, borate buffer, glycine buffer, carbonate buffer, Tris-hydrochloric acid buffer, veronal buffer, etc.
  • the buffering agents can be used by mixing with each other at an arbitrary ratio.
  • the antigen-antibody reaction is preferably performed at a temperature between about 0 ° C and about 60 ° C.
  • the Gal-9 expression gene measurement system, the reagents, methods, and processes used for it are all Gal-9-induced dendritic cell differentiation-inducing activity detection agent, Gal-9-induced dendritic cell differentiation-inducing activity detection method and In situ hybridization may include, for example, non-RI in situ hybridization, including direct and indirect methods, for example.
  • the direct method uses, for example, a molecule in which a detectable molecule (reporter) is directly bound to a nucleic acid probe
  • the indirect method uses, for example, an antibody against the reporter molecule.
  • Signal Functional groups for example, primary aliphatic amino groups, SH groups, etc.
  • haptens, ⁇ Photo dyes, enzymes, etc. may be bound to.
  • Neutral forces for labeling nucleic acid probes include digoxigenin (DIG), piotin, fluorescein, etc. Labels described above for antibodies The labeling method of the nucleic acid probe can be appropriately selected from methods known in the art and used.
  • random prime method for example, random prime method, nick 'translation method, DNA amplification by PCR, labeling Z tee ring method, in vitro transcr
  • a method selected from methods known in the art such as an observation field microscope, a phase contrast microscope, a reflection contrast microscope, a fluorescence microscope, and the like.
  • a digital imaging microscope, an electron microscope, etc. can also be used, and it can also be based on a flow cytometry etc.
  • Gal-9 and a Gal-9 expression gene can be used as a marker of a dendritic cell differentiation inducing factor.
  • Gal-9-induced dendritic cell differentiation-inducing activity detection agent or Gal-9-induced dendritic cell differentiation induction detection and / or measurement agent Various forms of Gal-9-induced dendritic cell differentiation-inducing activity detection agent or Gal-9-induced dendritic cell differentiation induction detection and / or measurement agent, Gal-9-induced dendritic cell differentiation inducing activity detection method or Gal-9-induced dendritic cell differentiation induction detection and / or measurement method, Gal-9-induced dendritic cell differentiation inducing activity detection or dendritic cell differentiation inducing factor Detection and Z or measurement reagent sets or systems can be created and not only useful in purification, identification, isolation-utilization of Gal-9 induced dendritic cell differentiation induction, they are excellent.
  • Anti-tumor agent, anti-allergic agent, immunosuppressive agent, agent for autoimmune disease, anti-inflammatory agent and corticosteroid hormone active ingredient agent by controlling Gal-8 or Gal-9 induced dendritic cell differentiation Can provide.
  • Gal-9-induced induction of dendritic cell differentiation it can be applied to fields using the pharmacological action / biological activity of darcocorticoid.
  • Allergies and autoimmune diseases are caused by hyperimmune reactions of CD4 + T lymphocytes, and steroids and immunosuppressants are used to treat refractory allergies and autoimmune diseases. Since Gal-8 or Gal-9 induced dendritic cell differentiation is thought to be involved in these reactions, Gal-9 induced dendritic cell differentiation is induced by immunosuppression, anti-inflammatory action, It can be expected to show allergic activity, and can be used for the development of antitumor agents, antiallergic agents, immunosuppressive agents, autoimmune disease agents, anti-inflammatory agents, and corticosteroid hormone substitutes.
  • Dendritic cell therapies include: (1) Autologous dendritic cell tumor local injection therapy (DCI), (2) Self-cancer extracted antigen-presenting dendritic cell vaccine therapy (TP-DC), (3) Artificial antigen-presenting dendritic Cellular vaccine therapy (PP-DC).
  • DCI Autologous dendritic cell tumor local injection therapy
  • TP-DC Self-cancer extracted antigen-presenting dendritic cell vaccine therapy
  • PP-DC Artificial antigen-presenting dendritic Cellular vaccine therapy
  • DCI Autologous dendritic cell tumor local injection therapy
  • TP-DC Self-cancer extracted antigen-presenting dendritic cell vaccine therapy
  • PP-DC Artificial antigen-presenting dendritic Cellular vaccine therapy
  • (a) cancer cells or cancer tissues are processed to obtain extracts, etc., or artificial antigens that are produced by artificially producing some of the proteins produced by cancer are prepared, while (b) blood collection. Prepared dendritic cells obtained by culturing leukocytes, etc.
  • TP-DC Self-cancer extracted antigen-presented dendritic cell vaccine therapy
  • TP-DC Self-cancer extracted antigen-presented dendritic cell vaccine therapy
  • the dendritic cells When autologous cancer and dendritic cells are mixed, the dendritic cells eat and digest the autologous cancer, present the characteristics of the cancer on the surface, and when this dendritic cell is injected subcutaneously as an acupuncture, it educates lymphocytes. However, lymphocytes that have been taught the characteristics of cancer travel around the body and attack cancer. Research is being conducted on skin cancer, prevention of recurrence of kidney cancer, liver cancer, spleen cancer, and colon cancer. Artificial antigen-presenting dendritic cell vaccine therapy (PP-DC) is a therapy that uses artificial antigens to show cancer characteristics in rod cells when autologous cancer is not preserved.
  • PP-DC is a therapy that uses artificial antigens to show cancer characteristics in rod cells when autologous cancer is not preserved.
  • Vaccine therapy using artificial antigen is a therapy that uses the apparent characteristics of cancer.
  • artificial antigen and dendritic cells are mixed outside the body and injected subcutaneously, the dendritic cells are transformed into lymphocytes and the apparent characteristics of cancer.
  • the lymphocytes that have been taught are a method of finding and attacking cancer based on its apparent characteristics, and even if the self-cancer is not preserved, it is only necessary to use an artificial antigen that is already available. However, it cannot be used unless the apparent characteristics of autologous cancer and artificial antigen are known.
  • the active ingredient of the present invention for example, a substance involved in the induction of differentiation of Gal-9-induced dendritic cells, a liquid containing the same, etc.
  • the active ingredient of the present invention is usually used alone or pharmaceutically acceptable in various formulations. It can be mixed with an agent and administered as a pharmaceutical composition or pharmaceutical preparation. Preferably, it is administered in the form of a pharmaceutical preparation suitable for use such as oral administration, topical administration or parenteral administration, and any dosage form (inhalation method or rectal administration is included depending on the purpose) ).
  • the active ingredients of the present invention may be used as a mixture, for example, a mixture of galectin 9 and a galectin 9 variant, a mixture of galectin 8 and a galectin 9 variant, and the like.
  • the active ingredient of the present invention includes various medicaments such as antitumor agents (anticancer agents), cancer cytotoxic agents, tumor metastasis inhibitors, thrombus formation inhibitors, joint destruction therapeutic agents, analgesics, anti-inflammatory agents and It can also be used in combination with ⁇ or immunosuppressants, and they can be used without limitation as long as they have an advantageous function, for example, can be selected from those known in the field .
  • parenteral dosage forms may include topical, transdermal, intravenous, intramuscular, subcutaneous, intradermal or intraperitoneal administration, but can also be administered directly to the affected area. Is also suitable.
  • mammals containing humans eg, intracellular, tissue, intravenous, intramuscular, subcutaneous, intradermal, intraperitoneal, intrathoracic, intrathecal, infusion, It can be administered to the enema, transrectum, ear drops, eye drops, nose, teeth, skin, mucous membranes, etc.).
  • preparations include solution preparations, dispersion preparations, semi-solid preparations, granular preparations, molded preparations, leachable preparations, etc., for example, tablets, coated tablets, sugar-coated preparations, Pills, lozenges, hard capsules, soft capsules, microcapsules, embeddings, powders, powders, granules, fine granules, injections, solutions, elixirs, emulsions, irrigants, syrups Agent, solution, emulsion, suspension, liniment, lotion, aerosol, spray, inhalant, Sprays, ointments, plasters, patches, pasta, poultice creams, oils, suppositories (eg rectal suppositories), tinctures, skin drops, eye drops, nasal drops, ear drops, Examples include powders for coating agents, infusions, liquids for injection, freeze-dried preparations, gel preparations, and the like.
  • the pharmaceutical composition can be formulated according to a usual method.
  • physiologically acceptable carriers for example, as needed, physiologically acceptable carriers, pharmaceutically acceptable carriers, adjuvants, excipients, excipients, diluents, flavoring agents, fragrances, sweeteners, vehicles, preservatives , Stabilizer, binder, pH regulator, buffer, surfactant, base, solvent, filler, extender, solubilizer, solubilizer, tonicity agent, emulsifier, suspending agent , Dispersant, Thickener, Gelling agent, Hardener, Absorber, Adhesive, Elasticizer, Plasticizer, Disintegrant, Propellant, Preservative, Antioxidant, Sunscreen, Moisturizer, Relaxant, Charge
  • an inhibitor, a soothing agent or the like alone or in combination with the protein of the present invention and the like it can be produced into a unit dosage form required for the practice of generally accepted formulations.
  • Formulations suitable for parenteral use include sterile solutions or suspensions of the active ingredient and water or other pharmaceutically acceptable media such as injections.
  • water, saline, aqueous dexrose solution, other related sugar solutions, and glycols such as ethanol, propylene glycol, and polyethylene glycol are listed as preferred liquid carriers for injections.
  • a solution known in the art using a carrier such as distilled water, Ringer's solution, physiological saline, an appropriate dispersing agent or wetting agent, and a suspending agent can be used.
  • a carrier such as distilled water, Ringer's solution, physiological saline, an appropriate dispersing agent or wetting agent, and a suspending agent.
  • Prepare in an injectable form such as a suspension or emulsion.
  • aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (for example, D-sorbitol, D-mannitol, sodium chloride, etc.), and are pharmacologically acceptable.
  • Suitable solubilizers such as alcohols (eg ethanol), polyalcohols (eg propylene glycol, polyethylene glycol etc.), nonionic interfaces It may be used in combination with an activator (for example, polysorbate 80 TM, HC0-50, etc.).
  • the oily liquid include sesame oil and soybean oil, and may be used in combination with benzyl benzoate, benzyl alcohol or the like as a solubilizer.
  • a buffer for example, phosphate buffer, sodium acetate buffer, etc.
  • a reagent for adjusting osmotic pressure for example, a soothing agent (for example, benzalkonium chloride, hydrochloric acid hydrochloride, etc.), a stabilizer (for example, Human serum albumin, polyethylene glycol, etc.), preservatives (eg, benzyl alcohol, fuyunol, etc.), antioxidants such as ascorbic acid, absorption enhancers and the like.
  • the prepared injection is usually filled in a suitable ampoule.
  • solutions in sterile pharmaceutically acceptable liquids such as water, ethanol or oil, with or without the addition of surfactants and other pharmaceutically acceptable auxiliaries Alternatively, it is formulated in the form of a suspension.
  • Oily vehicles or solvents used in the formulation include natural, synthetic or semi-synthetic mono-, di- or triglycerides, natural, semi-synthetic or synthetic fats or fatty acids, such as peanuts Vegetable oils such as oil, corn oil, soybean oil and sesame oil.
  • this injection can be prepared so that it usually contains about 0.1 to 10% by weight of the compound of the present invention.
  • Preparations suitable for topical, e.g. oral, or rectal use include e.g. mouthwashes, dentifrices, oral sprays, inhalants, ointments, dental fillers, dental coatings, dental pastes, suppositories Etc. Mouthwashes and other dental preparations are prepared by conventional methods using pharmacologically acceptable carriers.
  • the oral spray and inhalant can be dissolved in a solution for aerosol or nebulizer together with the compound of the present invention itself or a pharmacologically acceptable inert carrier, or can be administered to teeth as a fine powder for inhalation.
  • the ointment is prepared by a method for tti by adding a commonly used base such as an ointment base (white petrolatum, paraffin, olive oil, macrogol 400, macrogol ointment, etc.).
  • Medications for topical application to teeth and skin can be formulated into solutions or suspensions in appropriately sterilized water or non-aqueous excipients.
  • Additives include, for example, buffering agents such as sodium bisulfite or disodium edetoxalate; antiseptics including antibacterial and antifungal agents such as acetic acid or phenylmercuric nitrate, benzalkonium chloride, or oral hexidine And thickeners such as hypromelrose.
  • Suppositories are carriers well known in the art, preferably non-irritating suitable excipients such as polyethylene glycols, lanolin, cocoa butter, fatty acid triglycerides, etc., preferably solid at normal temperature but intestinal At temperature, it is prepared by a conventional method using a liquid that melts in the rectum to release the drug, etc., but it is usually prepared to contain about 0.1 to 95% by weight of the compound of the present invention. Is done. Depending on the excipient and concentration used, the drug can be suspended or dissolved in the excipient. Adjuvants such as local anesthetics, preservatives and buffering agents can be dissolved in the vehicle.
  • suitable excipients such as polyethylene glycols, lanolin, cocoa butter, fatty acid triglycerides, etc.
  • suitable excipients such as polyethylene glycols, lanolin, cocoa butter, fatty acid triglycerides, etc.
  • suitable excipients such as poly
  • suitable preparations for oral use include solid compositions such as tablets, pills, capsules, powders, granules, and troches, and liquid compositions such as liquids, syrups, and suspensions. Is mentioned.
  • a liquid carrier such as fats and oils can be further contained in the material of the above type.
  • the active ingredient is a protein or polypeptide
  • PEG polyethylene glycol
  • the immunogenicity and antigenicity of the heterologous compound may be effectively reduced.
  • the compound may be provided in a microcapsule device.
  • Polymers such as PEG include ⁇ -amino groups of amino-terminal amino acids, f-amino groups of lysine side chains, carboxyl groups of aspartic acid or glutamic acid side chains, It can be conveniently attached to the activated derivative of the daricosyl chain attached to the ⁇ -carboxyl group of the carboxy-terminal amino acid, or to certain asparagine, serine or threonine residues.
  • PEG reagents useful for reacting with amino groups of proteins include active esters of carboxylic acids and carbonate derivatives, especially those with a leaving group of N-hydroxysuccinimide, p-nitrophenol, imidazole, Or 1-hydroxy-2-nitrobenzene-4-sulfonate.
  • PEG reagents containing an amino hydrazine or hydrazide group are useful for reaction with aldehydes formed by periodate oxidation in proteins.
  • the active ingredient of the present invention can be administered over a wide range of dosages, and the dosage and frequency of administration are determined by the sex, age, weight, general health condition, diet, administration time, administration method of the patient being treated. Depending on the rate of excretion, the combination of drugs, and the condition of the patient being treated at that time, these or other factors may be taken into account.
  • the additives and preparation methods are described in, for example, the Japanese Pharmacopoeia Editorial Committee, 14th revised Japanese Pharmacopoeia, June 27, 2001, Yodogawa Shoten Co., Ltd. ; Ichibanse, et al.
  • the active ingredient of the present invention is as described herein: (a) the biological activity borne by Gal-8 or Gal-9 through Gal-8 or Gal-9 induced dendritic cell differentiation -Promising as an anti-tumor agent, anti-allergic agent, immunosuppressive agent, autoimmune disease agent, anti-inflammatory agent, and a drug that uses the same activity as corticosteroid hormones is there.
  • the terms are either according to IUPAC-IUB Cosition on, Biochemical Nomenclature, or based on the meaning of terms commonly used in the field.
  • the function of Ga ⁇ 8 or Gal-9 is related to Gal-8 or Gal-9 binding. It is possible to search for and identify molecules, especially proteins involved in dendritic cell differentiation inducing action.
  • the search target is not particularly limited, and various biological materials can be used.
  • As a method for searching for interacting molecules various methods known in the art can be used alone or in any combination. For example, to identify a protein that interacts with Gal-8 or Gal-9 dendritic cells from candidate proteins, for example, the following methods can be selected and applied. By knowing the interacting proteins, it is possible to know novel functions of target proteins as well as regulatory mechanisms such as those via Gal-8 or Gal-9.
  • immunoprecipitation (2) Wes ⁇ Western method (West Western method or Far Western method: Far Western method, including ligand and blotting method), (3) Intermolecular cross-linking (4) Expression cloning method, (5) Two-hybrid system, (6) Phage display method, (7) Surface plasmon resonance method, (8) Fluorescence polarization method
  • the immunoprecipitation method adds an antibody specific to a target protein to various sample protein solutions and immunoprecipitates the protein interacting with the target protein as an immune complex.
  • a specific antibody against the target protein or a specific antibody against a known protein, a resin that traps an antibody such as protein A or protein G cephalose, or the like can be used. It is preferable that a protein solution labeled with throat can be prepared.
  • kits can also be used, such as Affi-Prep 10, Affi-Gel Hz (BIO-RAD), NHS Sepharose HP (Pharmacia).
  • a fusion protein prepared and purified can be used as the protein to be measured.
  • antibodies against Tag can be used effectively, and the recombinant protein can be a host such as E. coli, yeast, or mammalian cells.
  • cell-free translation systems for reticulocytes.
  • co-purification when purifying the fusion protein simply by adding an excess amount of the target fusion protein to the protein solution.
  • the West Western or Far Western method is a modification of the Western method that uses a probe protein such as a labeled target protein or a known protein instead of an antibody to bind to the protein transferred to the membrane. By doing this, detection and measurement are performed. Using the target protein as a probe, it is possible to know the distribution, localization and molecular weight of the protein to be bound.
  • This method can be applied to the cloning of expression libraries and used for cDNA cloning (Akira Nomura, et al., “Immunity '92” (cDNA cloning using protein probes), Nakayama Shoten, pl69. -175 (1992)).
  • the ligand-blotting method is a method for analyzing a protein that binds to a ligand, which is a type of far-western plot that uses a RI-labeled ligand to detect the biotin-ligand. Use strep ⁇ avidin. Conjugate antibody, detection using unlabeled ligand, specific antibody and labeled secondary antibody. Signs and It is also possible to use non-RI labels.
  • the intermolecular cross-linking method uses a chemical cross-linking agent to cross-link proteins between proteins and separates them by SDS-PAGE and detects them together with Western blotting and immunoprecipitation methods. This is an effective technique for analyzing structures, examining interacting proteins or nearby proteins (or domains), and analyzing subunit structures such as receptors.
  • chemical crosslinking agents etc., refer to the PIERCE website (http: AAvww. Piercenet. Coni /). This method can be referred to hermanson, GT, Bioconjugate Techniques, Academic Press, 1996, for example.
  • the expression cloning method involves the expression of any of the cDM pools in a cell, and the target protein or tagged protein as a probe.
  • the specific cDNA is cloned from the cDNA group used and analyzed through cloning of receptors, ligands, and the like.
  • Expression clones are known in the art, such as expression systems using prokaryotic cells such as colon bacteria, expression systems using cultured cells such as mammalian cells, and expression systems using Xenopus laevis cells. An expression system is available. This method can be referred to, for example, Hiromi Sasaki, “Special Edition of Invincible Biotechnical Series' Proceeding with Bio-Experiment”, Chapter 6, Yodosha, 1997.
  • cDNA libraries such as Agtll, A ZAPII can be screened by transforming into E. coli, etc. Made.
  • an expression vector with a specific cDNA is transferred into the cultured cells and bound to the target protein from the cells in which expression is observed. Screening can be done by selecting and crawling things. The sorting is not limited to this, but an ELISA method or FACS (Fluorescence Activated Cell Sorting) method can be suitably used.
  • iriRNA is synthesized in vitro from specific cDNA and microinjected into Xenopus laevis eggs, and the protein expressed by the interaction with the target protein is used.
  • the two-hybrid system utilizes the phenomenon of functional recovery of a transcriptional activator constructed so that a reporter gene is expressed when the domain structure of the protein of interest or its protein interacts with an independent protein domain. This is a crawling system that searches for proteins that interact with each other.
  • Commercially available pre-made libraries can be used in this method, and examples include, but are not limited to, MATCHMAKER GAL4 cDNA LIBRARY and MATCHMAKER LexA cDNA LIBRARY (Clontech).
  • HybriZAP Two-hybrid vector system (Stratagene) can be mentioned. This method can be found in IJ J. Masaru Yamamoto, Biomanual Series 1. Basic Technology of Genetic Engineering, Yodosha, 1993, Downward, J., FEBL Lett., 338, 113-117, 1994, etc. it can.
  • the phage display method is a procedure in which a library having a random amino acid sequence of 5 to 7 residues on the surface of a phage is used to collect phages that bind to the target protein and propagate the phages. This is a method for searching for highly specific amino acid sequences. It is also possible to search a protein database from the obtained results and select a corresponding protein from known proteins. For example, Smith, GP & Scott, JK, Methods in Enzymology, Vol. 217, pp228-257, 1993 can be referred to for this method.
  • the surface plasmon resonance method is typically a method developed for the purpose of monitoring the interaction between biomolecules on a sensor chip in real time using the BIAC0RE TM system.
  • This method is, for example, Setsuko Hashimoto, Bunseki 5, Analysis of biomolecular interactions using surface plasmon resonance phenomenon, PP362-368, 1997, Toru Natsume, Biomanual UP series, Protein molecular interaction test method Pp211-230, Yodosha, 1996.
  • Fluorescence polarization uses the phenomenon that when a molecule with a fluorescent label excited by plane-polarized light undergoes a movement such as rotation during the excited state, the emitted fluorescence becomes a plane different from that of the excitation light.
  • the degree of polarization can be measured to know the interaction.
  • Various fluorescent labels can be used. For example, FS, FITC, FXS, etc. can be used.
  • the measurement can be performed using, for example, FBEAC0N TM.
  • the affinity column can be used to search for and identify a binding active substance for a specific target substance. Synthetic peptides, fusion proteins, antibodies, etc. can be used as ligands for affinity columns.
  • G9NC (null) is disclosed in W02005 / 093064 and manufactured and acquired in Example 1 of W02005 / 093064.
  • Example 1
  • Gal-9 eosinophil migration 3 ⁇ 4 "sex (eosinophi l chemoattractant activity: ECA) 3 ⁇ 4: none (Matsushita, N., et al., J. Biol. Chem.
  • mutants were confirmed by DNA sequencing (recombinant protein was ratatose-agarose column (Biochemistry, Tokyo, Japan)) Purified by affinity chromatography on a thione-sepharose column (Amersham Biosciences, Uppsala, Sweden).
  • Protein concentration is determined using BCA Atsey reagent (Pierce, Rockford, IL). And BSA was determined as the standard. All galectin preparations were checked for endotoxin contamination by Limulus Atsey (Bio Whittaker, Walkersville, MD). If present, all contaminating LPS is made of polymer particles as described in Hirayama, C., et al., J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 781: 419 (2002). And removed.
  • the purified CD14 + monocytes were treated with 10% FBS, ImM glutamine, penicillin (100 U / ml), streptomycin (100 ⁇ g / ml), human rGM. -5% C0 at 37 ° C in RPMI 1640 with CSF (50 ng / ml, PeproTech, Rocky Hill, NJ) and human rlL-4 (100 ng / ml, R & D Systems, Minneapol is, MN) Incubated in humid air containing 2 . Every two days, half of the medium was replaced with fresh medium.
  • the cells After 6 days in culture, the cells show typical immature dendritic cell morphology and flow cytometry, which shows a cell surface phenotype of CD14—, CD80 low , CD83 ”, and CD86 seml.
  • E. coli LPS 500 ng / ml, Sigma-Aldrich, St. Louis, MO
  • Gal-1, Gal- 3, Gal-8 or Gal_9 is added to the medium and the cells are cultured for another 2 days did.
  • Apoptosis occurred in various types of cells when cultured with 1 ⁇ ( ⁇ 33 g / ml) of Gal-9 (Kashio, Y., et al., J. Immunol. 170: 3631).
  • the amount of galectins on the cell surface was determined as described in Abedin, M. J. et al, J. Leukoc. Biol. 73: 650 (2003). Specifically, after washing the cells with PBS containing 0.01% sodium azide and 2% FBS, a rabbit antibody against human Gal-1, human Gal-3, human Gal-8 or human Gal-9 (25 ⁇ m g / ml) and incubated for 1 hour on ice. After washing with PBS, the cells were incubated with water for 45 minutes in water with FITC-conjugated (conjugated) goat antibody (25 ⁇ g / ml, Santa Cruz Biotechnology, Santa Cruz, Calif.) To rabbit IgG.
  • FITC-binding mAb for CD80 (mouse IgM, clone BB1)
  • PE-binding mAb for CD86 (mouse IgG2b, clone IT2.2)
  • Alofikocani for CD83
  • Binding mAb (mouse IgGl, clone HB15e), PE binding mAb to CD14,
  • mAb refers to a monoclonal antibody (hereinafter the same).
  • FITC-conjugated mAbs to CD54 mouse IgGl, clone 84H10
  • PE-conjugated mAbs to CD40 mouse IgGl, clone AB89
  • 7-amino-actinomycin D were obtained from Beckmati-Coulter Immunotech (Marseille, France).
  • antibody (Ab) dendritic cells block on non-specific binding of the antibody to FcRs, so on ice with human IgG (lOO yU g / ml, Chemicon, Temecula, CA) And incubated for 10 minutes.
  • Cells were analyzed with a FACS Calibur instrument (BD Biosciences, San Jose, CA). 7-amino-actinomycin! Dead cells were excluded from the analysis based on staining.
  • the amount of IL-12 (p70) and IL-10 released into the culture of dendritic cells was measured using an ELISA kit (Pierce Endogen, Rockford, IL).
  • the detection limit for both IL-12 and IL-10 was 15.4 pg / ml.
  • T cells were isolated using MACS columns (Miltenyi Biotec) with microbeads conjugated with antibodies to CD4 from healthy donor PBMCs for use as responder cells. Mitomycin C ⁇ Q ⁇ g / m Kyowa ⁇ , Tokyo, dendritic cells with Japan) was treated with 37 Q C 30 min, then washed three times for use as Sutimyure Ichita single cell. Purified alogenetic T cells (> 90% CD4 + cells) were dispensed at a concentration of IX 10 5 cells / well into U-bottom 96-well microphone mouthplates. Next, mitomycin C-treated dendritic cells were added in various numbers to the wainole and the cell mixture was cultured at 37 ° C under 5% CO. 3 3 culture And then into each well 0. [H] thymidine (Amersham Pharmacia,
  • Dendritic cells and T cells were cultured at a ratio of 1:10 for 48 hours, and the culture supernatant was collected and stored frozen at -30 ° C until analysis.
  • the amount of Thl (IFN- ⁇ , IL-2, TNF- ⁇ ) and the amount of Th2 (IL-4, IL-5, IL-10) cytokines in the culture supernatant is determined by the cytometric 'bead'. Determined using an assay kit (BD Biosciences). That is, the supernatant was added with PE detection reagent, and mixed with human cytokine capture beads before incubating at room temperature for 3 hours. After washing, the beads were analyzed using FACS Calibur instrument and CBA software (BD Biosciences).
  • Immature dendritic cells are exposed to LPS (500 ng / ml) or Gal-9 (10 ⁇ g / ml), washed twice with ice-cold PBS, and lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, ImM PMSF, leupeptin (10 mg / ml), pepstatin A (l mg / ml), aprotinin (1 mg / ml), ImM sodium orthovanadate, 50 mM NaF, 2 mM sodium pyrophosphate, 1% Nonidet P40) was subjected to sonication.
  • LPS 500 ng / ml
  • Gal-9 10 ⁇ g / ml
  • lysis buffer 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, ImM PMSF, leupeptin (10 mg / ml), pepstatin A (l mg / ml), aprotin
  • the resulting cell lysate was centrifuged at 10,000 xg for 15 minutes, and the resulting supernatant was subjected to SDS-PAGE under reducing conditions.
  • the separated protein was immobilized on Immobilon polyvinylidene difluoride membrane (Millipore, Bedford, Was transferred to MA).
  • the resulting membrane (membrene) was blocked in a solution containing 50 mM Tris-HCl (pH 7.6), 150 mM NaCl and 0.05% Tween-20 to block nonspecific binding. Incubate with 5% skimmed milk. The membrane is then incubated at 4 ° C with mitogen-activated protein kinases (MAPKs) p38 or antibodies specific for ERK1 or ERK2 phosphorylated species. It was processed. The antibodies were then examined for total p38 or total ERK1 / 2 (all antibodies were obtained from Cel Signaling Technology, Beverly MA).
  • MAPKs mitogen-activated protein kinases
  • the membrane was agitated for 30 minutes at 50 ° C in stripping buffer (62.5 mM Tris-HCl (H 6.7), lOOmM 2-mercaptoethanol, 2% SDS). However, it was exposed to the antibody and incubated. The blot was developed using the Phototope-HRP Western Blot Detection System (Cell Signaling Technology).
  • Gal-3 was clearly low in monocytes, but compared to this, expression of Gal-3 was increased in immature dendritic cells. Moreover, mature dendritic cells were up-regulated. In monocytes and immature dendritic cells, the expression of Gal-9 was not clear, but dendritic cells After maturation, it was up-regulated. On the other hand, monocytes showed> only a little expression of Gal-8 or no expression of Gal-8. And for immature or mature dendritic cells, there was clearly a slight change.
  • Gal-9 greatly increased the production of IL-12 (p70) by dendritic cells in a concentration-dependent manner (Fig. 2B). It was lower. Moreover, Gal-8 induced Mel so Shi not increase IL- 12 production a little but, Gal- 1 and Ga Bok 3 had no operational effect any (Fig. 2 B) 0
  • the activity of inducing proliferation of allogeneic T cells is a functional characteristic of dendritic cells in vitro.
  • Gal-9 Dendritic cells treated with Gal-9 had no effect on IL-4 or IL-5 production, but induced a marked increase in IL-10 production.
  • Gal-8 like Gal-1 or Gal-3, is similar to that of Gal-9 in terms of the activity of dendritic cells in MLR, but it is less prominent than that. Indicated.
  • Table 1 shows the results of the effect of ratatoose on Gal-9-induced upregulation of costimulatory molecules and HLA-DR on the cell surface of rod-shaped cells (DC).
  • Gal-9 (R65D) at a concentration of 30 g / ml increases I 12 production by dendritic cells to the same extent when wild-type galectin is shown at lO g / ml. (Fig. 5). This clearly indicates that the activity of this galectin to induce maturation of Gal-9 dendritic cells does not require the / 3-galactosid binding activity. ⁇
  • Gal-9 matures in vitro (differentiates) as demonstrated by up-regulation of costimulatory and HLA molecules on the cell surface and IL-12 production. It was shown here that it has an activity to induce It was also possible to show that this activity of Gal-9 is independent of its lectin properties. Gal-8 has also been found to induce maturation of dendritic cells, although its effect is inferior to that of Gal-9.
  • monocyte lineage cells such as macrophages and dendritic cells
  • Gal-3 the level of Gal-3 expression is greatly increased after it has matured into macrophages. It has been shown (Liu, FT, et al., Am. J. Pathol. 147: 1016 (1995)).
  • Macrophage cell line THP-1 expresses Gal-9 on the cell surface and in the cytoplasm (Hirashima,., Et al., Glycoconj. J. 19: 593 (2004)).
  • Gal-3, Gal-8 and Gal-9 are only expressed at low levels, even on the surface of human monocytes, whereas Gal-1 is easily detected. It has been shown that it can. So far, hybridization by microarray has shown that both immature dendritic cells and mature dendritic cells contain Gal-1 mRNA, Gal-3 mRNA, and Gal-9 mRNA. . And the amount of Gal-9 mRNA is higher in mature dendritic cells than in immature dendritic cells, and the amount of Gal-3 mRNA is more mature in dendritic cells than in immature dendritic cells. Less in cells.
  • Gal-9 and Gal-8 depends on the concentration, as reflected in the upregulation of costimulatory and HLA molecule expression on the cell surface and the upregulation of IL-12 production. It was shown here that it induces the maturation of dendritic cells in the same manner. And it is shown here that the effect of Gal-9 is more remarkable than that of Gal-8. Furthermore, dendritic cells treated with Gal-9 have been shown to be able to promote both T cell proliferation and production of Thl cytokines by these cells in allogeneic MLR.
  • Gal-9-treated dendritic cells enhanced the production of IL-10 (Th2 site force-in) by T cells.
  • This is a dendritic crescent package treated with darcocorticoids or prostaglandin E 2 (Vieira, PL, et al., J. Immunol. 161: 5245 (1998); Kal inski, P., "et al , J. Immunol. 159: 28 (1997)), mature dendritic cells in response to Gal-9 can stimulate T cells involved in IL-10 synthesis. It is a suggestion.
  • Gal-9 is a specific antigen (Matsumoto, R., et al., J. Biol. Chem. 273: 16976 (1998)), ConA (Nagai, H., et al., Int. Arch. Alergy Immunol 104 (suppl. L): 12 (1994)), some relases to release from T cells in response to stimulation with PMA (Chabot, S., et al., Glycobiology 12: 111 (2002)). It is done. The release is associated with the activity of a matrix-metaprotein proteinase that has not yet been identified (Chabot, S., et al., Glycobiology 12: 111 (2002)) D
  • Gal-9 both in the cytoplasm and on the cell surface. Yes. A number of stimuli have been found to regulate the expression of Gal-9 (Hirashima, M. et al., Immunol. Lett. 36: 27332) (1993)) 0
  • Gal-9 is a natural inducer candidate for dendritic cell maturation in vitro.
  • Galectins play an important role in the natural immunity by altering the function of Fecta cells.
  • Gal-3 shows macrophage chemoattractant activity (Sano, H., et al., J. Immunol. 165: 2156 (2000))
  • Gal -9 originally was eosinic acid It was identified as an eosinophil chemoattractant (Matsumoto,., Et al., J. Biol. Chem. 273: 16976 (1998)).
  • Ga ⁇ 8 mediates neutrophil adhesion and induces superoxide production by these cells through interaction with integrins and up-regulation of pro-matrix metalloproteins " ⁇ -lase-9" (Nishi, N., et al., Glycobiology 13: 755 (2003))
  • the effect of Gal-9 on eosinophils depends on the properties of lectin (Matsushita, N., et al , J. Biol. Chem. 275: 8355 (2000))
  • Gal-9's activity to induce dendritic cell maturation is independent of its lectin properties.
  • the CRD mutant of Gal-8, namely Gal-8 (R69H, R233H) also induced maturation of dendritic cells.
  • the 3-galactosidic binding activity of galectins is not necessary for the activity of inducing dendritic cell maturation.
  • Gal_l Only the reduced form of Gal_l has lectin activity, while the oxidized form of Gal-1 shows different biological activities and promotes axonal regeneration in peripheral nerves (Horie , H., et al., J. Neurosci. 19: 9964 (1999); Inagaki, Y. 'et al., Eur. J. Biochem. 267: 2955 (2000)).
  • Maturation of dendritic cells induced by Gal-9 depends on the signal ing action of p38 MAPK, but maturation induced by LPS or CD40 ligand (Arrighi, JF, et al. al., J. Immunol. 166: 3837 (2001)), which is not dependent on that of ERK1 / 2.
  • Gal-4 stimulates CD4 + T cells in the small intestine in mice and produces IL-6 through binding at synaptic sites involved in immunity (Hokama, A., et al., Immunity 20: 681 (2004)).
  • Gal-4 like Gal-9, is a tandem repeat galectin containing two CRDs (Hadari, YR, et al., J. Biol. Chem. 270: 3447 (1995); Averbeck, M. , et al., Eur. J. Immunol. 34: 2708 (2004)).
  • Gal-9 binds to dendritic cells at the synapse involved in immunity, and Gal-9 induces maturation of dendritic cells (the binding of Gal-9 causes p38 to bind). This effect may be initiated through activation of the MAP signaling pathway.
  • Gal-4 induced IL-6 production by CD4 + T cells appears to be highly dependent on signal transduction by protein kinases.
  • the signaling molecule activated by Gal-9 is different from the signaling molecule activated by Gal-4.
  • the synapse formation and cell fistula signaling by the Ding cells has been studied relatively well.
  • Those by dendritic cells are not yet well understood (Averbeck, M., et al., Eur. J. Immunol. 34: 2708 (2004)) 0.
  • the maturation process of dendritic cells is not only induced by LPS and Gal-9 ', but also various cytokines.
  • prostaglandins such as IFN- ⁇ IL-1 and TNF- ⁇ , poly (1: 0, bacteria, etc.
  • Ga ⁇ 9 is up-regulated on the cell surface of dendritic cells and other cells in response to such factors, which may be induced by the maturation of dendritic cells.
  • this Gal-9 may contribute to the mutual arrest between innate and acquired immunity.
  • Dendritic cells are specialized antigen presenting cells (ABC) required for the initiation of the immune response (Steinman, RM, et al., Adv Exp. Med. Biol. 329: 1 (1993)).
  • CTL cytolytic T lymphocyte
  • Dendritic cell immunotherapy has been applied to various cancers such as malignant meonoma, non-Hodgkins lymphoma, multiple melanoma, prostate cancer, rectal cancer, colon cancer, and non-small cell lung cancer (Engleman, EG, Semin. Oncol. 30: 23 (2003)).
  • dendritic cells have the property of secreting exosomes, but the exosomes themselves are considered to be mediators useful for tumor treatment (Zitvogel, et al., Nature Med. 4: 594 (1998); Chaput, N., et al., Bull. Cancer 90: 695 (2003); Andre, F., et al., Adv. Exp. Med. Biol. 495: 349 (2001)).
  • Proteomic analysis shows that exosomal proteins include Gal-3, thioredoxin peroxidase II, Alix, etc. (Thery, C., et al., J. Immunol. 166). : 7309 (2001)).
  • Gal-9 has been shown not only to induce apoptosis in activated CM + T cells, but also to induce apoptosis in various types of malignant tumor cells, including malignant melanoma and lymphoma cells. (Kashio, Y., et al., J. Immunol. 170: 3631 (2003); Kageshita, T., et al., Int. J. Cancer 99: 809 (2002)).
  • Gal-9 proapoptotic activity
  • Gal-1 apoptosis-inducing activity
  • Gal-9 does not induce apoptosis in resting T cells or normal cells at concentrations that act on activated T cells or cancer cells (Kashio, Y., et al., J Immunol. 170: 3631 (2003)).
  • galectins especially Gal-9, are substances that have potential as active agents in applications in anti-tumor immunity therapy, such as when used with dendritic cells.
  • Example 2 are substances that have potential as active agents in applications in anti-tumor immunity therapy, such as when used with dendritic cells.
  • Meth A cells were cultured in RPMI (SIGMA) medium supplemented with 10% FBS (JRH). 2 ⁇ 10 5 cells were seeded in a 75 cm 2 flask (SUMIL0N), collected 2 days later, and subcultured. Grows about 10 times in 2 days.
  • the prepared Meth A cells (5 10 5 cells / 200 cells / mouse) were inoculated into the peritoneal cavity of BALB mice (SLC; 6-week-old female) using a 26 gauge (26G) injection ⁇ ".
  • a 26 gauge (26G) injection ⁇ " Immediately use the galectin 9 variant prepared to the working concentration (333 g / mL) at 300 i L / 10 / ig / animal, 300 ⁇ L / 30 / ig / animal or 300 ⁇ L / 100 ig / animal, or the same amount PBS (-) was administered intraperitoneally with a 26-gauge injection needle every day until 18 days after cell inoculation.
  • FIG. 9 is a survival curve showing that galectin-9 variant has an antitumor effect in a cancer peritonitis model with Meth A cells.
  • Meth A cells (5 ⁇ 10 5 ⁇ / 200 ⁇ were inoculated into the abdominal cavity of BALB / c mice (SLC; 6 weeks old female) using a 26 gauge (26G) needle. Immediately after inoculation ⁇ ⁇ g Similarly, the galectin-9 variant prepared in PBS (-) was administered intraperitoneally with a 26G injection needle to a volume of 300 L. After administration, 1 day after cell inoculation, 2 days later, 12 days every other day The survival rate was compared with the control group.
  • Meth A cells (5 10 5 cells / 200 cells) were inoculated into the abdominal cavity of BALB / c mice (SLC, 6 weeks old female) using a 26 gauge (26G) needle. Seven days after cell inoculation, the modified galectin 9 prepared in PBS (-) so as to be ⁇ ⁇ g / 300 ⁇ L was similarly administered intraperitoneally with a 26G injection needle. Thereafter, administration was carried out every other day until day IV. Survival was compared with the control group.
  • Figure 10 shows the results of ⁇ and B.
  • Meth A cells were collected, washed twice with PBS ( ⁇ ) (centrifuged at 1500 rpm and 5 min), and prepared with PBS ( ⁇ ) so that the cell concentration was 5 ⁇ 10 5 cells / 200 / L.
  • PBS PBS
  • eth A-resistant mouse spleen cells Meth A transplanted into the peritoneal cavity and simultaneously administered galectin 9 variant (lOO ⁇ u g), surviving to over 50 S BALB spleen cells
  • Galectin 9 variant pre-treatment BALB / c mouse spleen cells pre-treated with galectin 9 variant intraperitoneally for more than 14 days
  • Donor 2 BALB-resistant Meth A resistant, 2 no treated 2 Stabilized galactin 9 pretreated Use 2 each at a time, adoptive immunization with spleen cells a total of 4 times It was.
  • the spleen was removed aseptically in a clean bench.
  • the cell suspension obtained by grinding the spleen with a glass slide was removed from the petri dish with a micropipette, the tissue piece was removed through a nylon mesh, collected in a 15 mL tube and hemolyzed.
  • the spleen cells of each group were prepared with PBS ( ⁇ ) so that the count was 1 ⁇ 10 ′ / body.
  • Meth A cells (5 ⁇ 10 5 cells / 200 1 / mouse) prepared on DayO were intraperitoneally transplanted into mice with a 26G injection needle.
  • administration of Galectin 9 variant (10 ( ⁇ g / 450 / il) or the same amount of PBS (-) was started with a 26G needle.
  • Galectin 9 variant and PBS (-) were administered on Day The results were shown in Fig. 13 and 14.
  • Fig. 15 As a result, it was revealed that, if spleen cells were present, the life-prolonging effect was recognized by the modified galectin 9. That is, CD4 and CD8 that do not exist in nude mice It was suggested that NKT cells are involved in the life-prolonging effect of the modified galectin 9.
  • Statistical analysis was performed by the log rank test.
  • Meth A cells are 10 ° /.
  • the cells were cultured in RPMI (SIGMA) medium supplemented with FBS (JRH). Inoculate 2 X 10 ° cells into a 75 cm 2 flask (SUMIL0N), collect after 2 days, and subculture. It grows about 10 times in 2 days.
  • Meth A cells were harvested, PBS (-) was washed with (1500 rpm, 5min centrifugation), 1 ⁇ 10 6/200 ⁇ prepared intraperitoneally administered to do BALB 1 to so as PBS, 8 days Meth A was collected from the mouse abdominal cavity.
  • MethA cells passaged in vivo were collected, washed twice with PBS (-) (centrifuged at 1500 rpni for 5 min), and prepared with PBS (-) so that the cell concentration was 10 7 cells / 100 / l. Needle inoculation 27 gauge dorsal skin of the prepared Meth A cells (1 X 10 7 cells / 100 / i 1 / mouse) and BALB / c and BALB / c nu- nu mice (SLC, 6 weeks old female) did. On the fifth day after inoculation, the tumor size was determined by the following calculation method, and the mice were divided into groups so that the tumor sizes were averaged.
  • V 1/2 X long axis X short axis square Calculated by The results are shown in FIGS. .
  • the galectin 9 variant is useful for vaccine therapy using an antigen peptide and adoptive immunotherapy that induces CTL outside the body.
  • the modified galectin 9 used in the above examples is also known as stabilized galectin 9, and is G9NC (nul l) produced and obtained in Example 1 of W02005 / 093064 (SEQ ID NO: 1 of W02005 / 093064).
  • the polypeptide having the amino acid sequence represented by SEQ ID NO: 2 was used.
  • the stable galectin-9, that is, G9NC (nul). Can also be prepared as follows. The expression of stable galectin-9 (G9NC (null)) was induced by E. coli transformed with pET-G9NC (null) by electroporation (
  • Cryopreserved cells were 10 mM Tris-HC1 (pH 7.5), 0.5 M NaCl, 1 mM DTT, 1 mM PMSF, 10 m MgCl 2> 25 ⁇ g / ml DNase, 0.2 mg / ml egg white
  • Triton X-100 was added to a final concentration of 1% and sonicated for 18 minutes. After centrifuging at 18,800 xg for 75 minutes, the recombinant protein in the obtained supernatant was purified by affinity chromatography using ratato-agarose, and then the buffer was replaced by PBS by dialysis.
  • G9NC prepared in this way (null) Has no contaminating band on protein polyacrylamide electrophoresis, and the endotoxin content is less than 0.5 EU / ml. Stable to freezing and thawing, and retains biological activity stably for more than half a year even at 4 ° C storage.
  • galectin-9 a recombinant body obtained by expressing a native non-type galectin-9, M-type galectin-9 and S-type galectin-9 in a host cell using “genetical recombination technology” is used. May be.
  • galectins particularly Gal-9, induces differentiation of dendritic cells, and Gal-9-induced differentiated dendritic cells exhibit various characteristic properties. It can be used to develop pharmaceuticals, especially anti-tumor agents, anti-inflammatory agents, anti-allergic agents, immunosuppressive agents, or agents for autoimmune diseases. In addition, it is possible to develop various activators and reagents, Atsey methods, Atsey reagents, measuring reagents such as screening methods and reagents, pharmaceuticals, and accessories.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Rheumatology (AREA)
  • Pulmonology (AREA)
  • Pain & Pain Management (AREA)
  • Transplantation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

La maturation (différenciation) de cellules dendritiques a une signification importante dans l'amorce d'une réponse immunitaire et dans une thérapie de vaccin à base de cellules dendritiques pour différents types de cancers. Cependant, on ne sait toujours pas quelles fonctions et quels rôles jouent les galectines dans les cellules dendritiques. Ainsi, l'objet de l'invention consiste à clarifier les fonctions et les rôles des galectines et à développer une technique de régulation de la différenciation de cellules dendritiques. On a trouvé que la Gal-9 possède une activité d'induction de la différenciation (maturation) de cellules dendritiques. On a également trouvé que la Gal-8 possède de façon similaire une activité d'induction de la différenciation (maturation) de cellules dendritiques bien que ce soit à un niveau inférieur à celui de la Gal-9. Les cellules dendritiques qui ont été traitées avec la Gal-9 peuvent stimuler et renforcer la production d'une cytokine de type Th1 ainsi que la production d'IL-10 par des cellules T. Par conséquent, il est possible de développer un agent anti-inflammatoire, un agent antiallergique, un immunosuppresseur, agent anti-tumoral et ainsi de suite en utilisant l'activité d'induction de la différenciation de cellules dendritiques de la Gal-8 ou de la Gal-9. De plus, il est possible de développer un réactif de dosage, d'autres médicaments, un dosage, etc. en utilisant l'activité d'induction de la différenciation de cellules dendritiques telle que décrite ci-dessus.
PCT/JP2005/022420 2004-11-30 2005-11-30 Développement d'un agent bioactif en utilisant un facteur induisant la différenciation de cellules dendritiques WO2006059785A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2004345226 2004-11-30
JP2004-345226 2004-11-30

Publications (1)

Publication Number Publication Date
WO2006059785A1 true WO2006059785A1 (fr) 2006-06-08

Family

ID=36565206

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2005/022420 WO2006059785A1 (fr) 2004-11-30 2005-11-30 Développement d'un agent bioactif en utilisant un facteur induisant la différenciation de cellules dendritiques

Country Status (1)

Country Link
WO (1) WO2006059785A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2198879A1 (fr) 2008-12-11 2010-06-23 Institut Curie Agent modulateur de CD74 pour la régulation de la migration de cellules dendritiques et dispositif pour l'étude de la capacité de motilité d'une cellule

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004244411A (ja) * 2003-01-24 2004-09-02 Galpharma Co Ltd ガレクチン９含有医薬

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2004244411A (ja) * 2003-01-24 2004-09-02 Galpharma Co Ltd ガレクチン９含有医薬

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DAI S.Y. ET AL.: "Galectin-9 induces maturation of human monocyte-derived dendritic cells", J. IMMUNOL., vol. 175, no. 5, September 2005 (2005-09-01), pages 2974 - 2981, XP002996361 *
DATABASE EMBASE [online] SAHIN U. ET AL: "The Hodgekin's disease antigen galactin-9 is A novel marker for dendritic cells and macrophages and binds to ligands expressed onn dendritic and HandRS cells", XP002996363, accession no. STN Database accession no. (1997302376) *
DIETZ A.B. ET AL.: "Maturation of human monocyte-derived dendritic cells studied by microarray hybridization", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 275, no. 3, 2000, pages 731 - 738, XP002236579 *
IMMUNOBIOLOGY, vol. 197, no. 2-4, 1999, pages 389 - 390 *
KASHIO Y. ET AL.: "Galectin-9 induces apoptosis through the calcium-calpain-caspase-1 pathway", J. IMMUNOL., vol. 170, no. 7, 2003, pages 3631 - 3636, XP002996362 *
MATSUMOTO R. ET AL.: "Human ecalectin, a variant of human galectin-9, is a novel eosinophil chemoattractant produced by T lymphocytes", J. BIOL. CHEM., vol. 273, no. 27, 1998, pages 16976 - 16984, XP002944823 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2198879A1 (fr) 2008-12-11 2010-06-23 Institut Curie Agent modulateur de CD74 pour la régulation de la migration de cellules dendritiques et dispositif pour l'étude de la capacité de motilité d'une cellule

Similar Documents

Publication Publication Date Title
Hartgers et al. DC‐STAMP, a novel multimembrane‐spanning molecule preferentially expressed by dendritic cells
KR101592855B1 (ko) 암 백신 조성물
US8388975B2 (en) Cancer antigen peptides derived from WT1
KR102158225B1 (ko) 헬퍼 t세포의 활성화 방법
Pinto et al. CiC3-1a-mediated chemotaxis in the deuterostome invertebrate Ciona intestinalis (Urochordata)
US20100015101A1 (en) Novel tumor antigen peptides
KR20090102772A (ko) Ｈｌａ-ａ*1101 구속성 ｗｔ1 펩티드 및 이를 포함하는 의약 조성물
KR101744514B1 (ko) Ｎｅｉｌ3 펩티드 및 이를 포함하는 백신
WO2001041741A9 (fr) Compositions de vaccins et peptides d'antigene associes a une tumeur de hla-a2 de classe i
JP6959597B2 (ja) 腫瘍抗原ペプチド
CN109072219B (zh) 肿瘤抗原肽
US20100255579A1 (en) Tumor antigen protein and use thereof
JP2020089369A (ja) 腫瘍抗原ペプチド
US20030224036A1 (en) Hla class I a2 tumor associated antigen peptides and vaccine compositions
US9260499B2 (en) Tumor antigen peptide and use thereof
WO2006059785A1 (fr) Développement d'un agent bioactif en utilisant un facteur induisant la différenciation de cellules dendritiques
JPWO2007066423A1 (ja) Ａｍａｃｒ由来の腫瘍抗原ペプチド
TW200418876A (en) Methods of modulating inflammation by administration of interleukin-19 and inhibitors of il-19 binding
JP2013513549A (ja) Ｔｍｅｍ２２ペプチドおよびそれを含むワクチン
KR20010043090A (ko) 신규인 폴리펩티드, 그 폴리펩티드를 코드화하는 ｃＤＮＡ및 그 용도
WO2009112831A1 (fr) Procédés et molécules d’immunothérapie
JPWO2020071551A1 (ja) 良性腫瘍の予防または治療薬
WO2022210863A1 (fr) Peptide d'antigène exprimé dans des cellules souches cancéreuses de la vessie humaine
Bonecchi Identification of new molecules involved in dendritic cell localization

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

NENP Non-entry into the national phase

Ref country code: JP

122 Ep: pct application non-entry in european phase

Ref document number: 05814294

Country of ref document: EP

Kind code of ref document: A1

WWW Wipo information: withdrawn in national office

Ref document number: 5814294

Country of ref document: EP