WO2006056987A2 - Leptin antagonists - Google Patents

Leptin antagonists Download PDF

Info

Publication number
WO2006056987A2
WO2006056987A2 PCT/IL2005/001250 IL2005001250W WO2006056987A2 WO 2006056987 A2 WO2006056987 A2 WO 2006056987A2 IL 2005001250 W IL2005001250 W IL 2005001250W WO 2006056987 A2 WO2006056987 A2 WO 2006056987A2
Authority
WO
WIPO (PCT)
Prior art keywords
leptin
antagonist
human
seq
ovine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IL2005/001250
Other languages
English (en)
French (fr)
Other versions
WO2006056987A3 (en
Inventor
Arieh Gertler
Isabelle Callebaut
Jean Djiane
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universite Pierre et Marie Curie
Institut National de la Recherche Agronomique INRA
Yissum Research Development Co of Hebrew University of Jerusalem
Original Assignee
Universite Pierre et Marie Curie
Institut National de la Recherche Agronomique INRA
Yissum Research Development Co of Hebrew University of Jerusalem
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite Pierre et Marie Curie, Institut National de la Recherche Agronomique INRA, Yissum Research Development Co of Hebrew University of Jerusalem filed Critical Universite Pierre et Marie Curie
Priority to AT05809259T priority Critical patent/ATE498683T1/de
Priority to JP2007542513A priority patent/JP5113526B2/ja
Priority to DE602005026432T priority patent/DE602005026432D1/de
Priority to EP05809259A priority patent/EP1814986B1/en
Priority to CN2005800471206A priority patent/CN101189335B/zh
Publication of WO2006056987A2 publication Critical patent/WO2006056987A2/en
Publication of WO2006056987A3 publication Critical patent/WO2006056987A3/en
Priority to IL183335A priority patent/IL183335A0/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/5759Products of obesity genes, e.g. leptin, obese (OB), tub, fat
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the present invention relates to leptin antagonists and, in particular, to leptin mutants, and to pharmaceutical compositions comprising them.
  • leptin The product of the ob gene, leptin, was reported to suppress appetite by regulating activities of the satiety centers in the brain via its receptor, termed OB-R, and to affect body weight (Friedman and Halaas, 1998).
  • OB-R its receptor
  • leptin receptors are expressed in many other tissues (Cioffi et al., 1996; Emilsson et al., 1997; Hoggard et al., 1997; Glasow et al., 1998; Briscoe et al., 2001), and have suggested that leptin is involved in more diverse biological functions than expected previously.
  • Non-insulin-dependent diabetes or type II diabetes is caused by insulin resistance, particularly in skeletal muscle, adipose tissue and liver. Thus, despite hyperinsulinaemia, there is insufficient insulin to compensate for the insulin resistance and to maintain blood glucose in the desirable range.
  • US 6,399,745 discloses the use of leptin antagonists, which are fragments of human or murine leptin, for treating type II diabetes and insulin resistance in diabetic patients.
  • US Patent Application No. 2004/0048773 discloses the use of an antagonist of leptin for treatment of disorders resulting from deficiencies in insulin secretion and of hyperglycaemia, but no specific leptin antagonist is disclosed in this application.
  • US Patent Application No. 2004/0072219 discloses a modified molecule having the biological activity of human leptin and being substantially non- immunogenic or less immunogenic than any non-modified molecule having the same biological activity when used in vivo.
  • the variant leptin proteins disclosed have been designed by computer modeling, but have not been synthesized nor tested. These variants have altered T-cell epitopes, preferably by substitution of one sole amino acid, to reduce or remove immunogenic sites, while maintaining the leptin biological activity.
  • sequences disclosed are 13-mers in which the amino acid residue 39, 41 or 42 of native human leptin has been substituted with alanine.
  • Obesity is considered a risk for many cancers. Serum leptin levels are often elevated in obese people. Leptin acts as a mitogenic agent in many tissues; therefore, it may act to promote cancer cell growth. In fact, leptin was shown to act as a growth factor for prostate cancer cells in vitro, to induce increased migration of prostate cancer cells and expression of growth factors such as vascular endothelial growth factor (VEGF), transforming growth factor-beta 1 (TGF- ⁇ l), and basic fibroblast growth factor (bFGF), and to enhance prostate cancer growth.
  • VEGF vascular endothelial growth factor
  • TGF- ⁇ l transforming growth factor-beta 1
  • bFGF basic fibroblast growth factor
  • leptin Besides playing an important role in the regulation of food intake and energy consumption in the brain, leptin also acts as a potential growth stimulator in normal and neoplastic breast cancer cells. It was also shown recently to induce cell proliferation in ovarian cancer cells in vitro (Choi et al., 2004).
  • Leptin has been shown recently to promote T helper 1 (Thl)-cell differentiation and to modulate the onset and progression of autoimmune responses in several animal models of disease (La Cava and Matarese, 2004). If leptin's role is fundamental in ThI -mediated autoimmune diseases or inflammatory diseases, such as inflammatory bowel syndrome, then a therapeutic effect can be anticipated by blocking peripheral leptin action (Matarese et al., 2005). Leptin has also been shown to be involved in the pathogenesis of rheumatoid arthritis and in the development of experimental autoimmune encephalomyelitis (EAE), a mouse model for multiple sclerosis (Peelman et al., 2004).
  • EAE experimental autoimmune encephalomyelitis
  • the present invention provides a synthetic leptin antagonist in which at least two amino acid residues of the sequence LDFI/S of the hydrophobic binding site at positions 39-42 of a native leptin polypeptide sequence are substituted by different amino acid residues such that the site becomes less hydrophobic, and fragments of said leptin antagonist.
  • the present invention provides an isolated DNA molecule encoding said leptin antagonist.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising said synthetic leptin antagonist, or a fragment thereof, and a pharmaceutically acceptable carrier.
  • Figs. 1A-1C show purity determination of the isolated human and ovine leptin mutants.
  • A Gel-filtration analysis
  • B SDS-PAGE analysis (15% gel)
  • lanes 1-5 correspond to human wild-type (WT) leptin, L39A/D40A, F41A/I42A, L39A/D40A/F41A and L39A/D40A/F41A/I42A leptin mutants and lanes 6-10 to corresponding WT ovine leptin and its mutants
  • WT wild-type
  • B SDS-PAGE analysis (15% gel
  • lanes 1-5 correspond to human wild-type (WT) leptin, L39A/D40A, F41A/I42A, L39A/D40A/F41A and L39A/D40A/F41A/I42A leptin mutants and lanes 6-10 to corresponding WT ovine leptin and its mutants
  • C reverse phase chromat
  • Fig. 2 shows gel-filtration analysis of complex between chicken leptin binding domain (chLBD) and human or ovine leptin on a SuperdexTM 75 HR 10/30 column.
  • Complex formation was carried out during a 20-min incubation at room temperature in TN buffer using various molar ratios and then aliquots (200 ⁇ l) of the mixture were applied to the column, pre-equilibrated with the same buffer.
  • the initial leptin concentration (10 ⁇ M) was constant in all cases.
  • the column was developed at 0.8 ml/min and calibrated with bovine serum albumin (66 kDa), ovine placental lactogen (23 kDa) and lysozyme (14 kDa). Protein concentration in the eluate was monitored by absorbance at 220 nm.
  • Figs. 3A-3B show radioreceptor assay (RRA) using homogenate of BAF3 cells stably trans fected with the long form of human leptin receptor.
  • RRA radioreceptor assay
  • Figs. 4A-4B show inhibition of leptin acitivity by human leptin L39A/D40A/F41A/I42A mutant.
  • A Inhibition of leptin-induced phosphorylation of MAPK (erkl/2) in SH-SY5Y human neuroblastoma cells bioassay (the upper figure shows effect of increased leptin dose) and
  • B inhibition of leptin-inducible transactivation of luciferase reporting gene in CHO cells transiently transfected with leptin receptor and stimulated with 6.25 nM of human leptin.
  • Fig. 5 shows Hydrophobic Cluster Analysis (HCA). The analysis was done assuming the leptin site III interaction with immunoglobulin-like domain (IGD) of leptin receptor (LEPR) resembles that of IL-6 interacting with gpl30. The highlighted hydrophobic clusters mainly correspond to the regular secondary structures of the considered protein as shown in Fig. 6
  • Fig. 6 shows comparative 3D models of viral IL-6 (vIL-6) interacting with the IGD domain of gpl30 (upper) and corresponding human leptin (lower):
  • Site III Comparison of the experimental structure of viral IL-6, as observed in complex with gpl30 (top - only the Dl domain of one gpl30 molecule is shown in gray in the ribbon representation shown at left) and isolated human leptin, for which no residues were visible in the electronic density for the disordered AB loop (bottom - orange dotted line).
  • the two structures were superimposed on the basis of the structurally conserved helices (rmsd 2.2 superimposition on 89 C ⁇ atoms). Tyrl 19 of leptin was shown in violet in the figure at bottom.
  • the leptin tertiary structure solution revealed its pertinence to the long-chain cytokine superfamily (Zhang et al., 1997). Although the tertiary structure of the leptin receptor has been determined, yet its amino acid sequence analysis indicated the high similarity to receptors of the class I cytokine receptor family, like receptors for growth hormone (GH), granulocyte colony-stimulating factor (G-CSF), interleukin-6 (IL-6) and erythropoietin (EPO). The receptors from this family share multiple similar domains in their extra cellular part, like C2, CK and F3.
  • GH growth hormone
  • G-CSF granulocyte colony-stimulating factor
  • IL-6 interleukin-6
  • EPO erythropoietin
  • leptin receptor has two repeats of CK-F3 domains, which suggested being the ligand binding site (Wells and de Vos, 1996; Livnah et al., 1999; Aritomi et al., 1999). Fong and co-workers localized the leptin binding domain (LBD) to the membrane-proximal CK-F3 domain ( ⁇ 200 amino acids) in the leptin receptor extracellular domain (ECD) (Fong et al. 1999).
  • LBD leptin binding domain
  • ECD extracellular domain
  • leptin receptor As no structural information of the 3D structure of leptin receptor exists, two possible models may be considered. One, characteristic for GH/GHR, or for prolactin (PRL)/PRLR or EPO/EPOR, which is characterized by hormone induced receptor homodimerization that brings the juxtaposed Jak2 to mutual transphosphorylation (De Vos et al., 1992), and another suggested for IL-6 (Muller- Newen, 2003). In the later model, a hexameric complex is formed gradually, first by IL-6 molecule, which interacts with the IL-6R-alpha, then with gpl30 forming an inactive trimer, which subsequently dimerizes forming an active hexamer.
  • PRL prolactin
  • EPO/EPOR which is characterized by hormone induced receptor homodimerization that brings the juxtaposed Jak2 to mutual transphosphorylation (De Vos et al., 1992), and another suggested for IL-6 (Muller
  • leptin's amino acids 39- 42 (LDFI in all mammals except in pig and LDFS in pig), which are preserved in all leptin species as a main putative sequence that interacts with IGD.
  • LDFI leptin's amino acids 39- 42
  • the present invention thus provides a synthetic leptin antagonist in which at least two amino acid residues of the sequence LDFI/S of the hydrophobic binding site at positions 39-42 of a native mammal leptin polypeptide sequence are substituted with different amino acid residues such that the site becomes less hydrophobic, and fragments of said leptin antagonist.
  • the term "mammal” includes human mammal as well as non- human mammals.
  • the native leptin may be human leptin or a non-human mammal leptin such as, but not limited to, ovine, rat, mouse, horse and pig leptin, and the LDFI/S sequences represent the 39-42 LDFI sequence of human leptin or of a non-human mammal leptin except pig leptin, as well as the 39-42 LDFS sequence of pig leptin.
  • the leptin is human leptin.
  • the leptin is ovine leptin.
  • the terms "leptin antagonist” and “leptin mutant” are used interchangeably to denote a mammal leptin polypeptide in which at least two of the amino acids at positions 39-42 of a wild-type human or non-human mammal leptin sequence are substituted with other amino acids such that the site becomes less hydrophobic.
  • mammal leptin polypeptide encompasses naturally occurring mammal leptin polypeptides and biologically active variants thereof, as well as biologically active fragments of naturally occurring leptin and variants thereof.
  • “Variant” refers to a polypeptide differing from the mammal leptin polypeptide, but retaining essential properties thereof.
  • amino acid residues at positions 39-42 of a wild-type mammal leptin may be substituted with one or more amino acid residues selected from the group consisting of alanine, arginine, aspartic acid, glutamic acid, glycine, lysine and serine.
  • said amino acid residue is alanine.
  • any two of the amino acid residues at any of the positions 39-42 of a mammal leptin polypeptide sequence are substituted by alanine, for example at positions 39, 40, or 39, 41, or 39, 42, or 40,
  • the leptin antagonist with two alanine substitutions is derived from human leptin.
  • the human leptin antagonist is the human recombinant leptin polypeptide that carries two Ala mutations at positions 39 and 40, herein designated human leptin L39A/D40A mutant (SEQ ID NO: 1).
  • the human leptin antagonist is the human recombinant leptin polypeptide that carries two Ala mutations at positions 41 and
  • human leptin F41 A/I42A mutant SEQ ID NO: 2.
  • the leptin antagonist with two alanine substitutions is derived from ovine leptin.
  • the ovine leptin antagonist is the ovine recombinant leptin polypeptide that carries two Ala mutations at positions 39 and 40, herein designated ovine leptin L39A/D40A mutant (SEQ ID NO: 3).
  • the leptin antagonist is the ovine recombinant leptin polypeptide that carries two Ala mutations at positions 41 and 42, herein designated ovine leptin F41 A/I42A mutant (SEQ ID NO: 4).
  • any three of the amino acid residues at any of the positions 39-42 of a leptin polypeptide sequence are substituted by alanine, for example at positions 39, 40, 41 or 39, 40, 42, or 39, 41, 42, or 40, 41, 42.
  • the leptin antagonist with three alanine substitutions is derived from human leptin.
  • the human leptin antagonist is the human recombinant leptin polypeptide that carries three Ala mutations at positions 39, 40 and 41, herein designated human leptin L39A/D40A/F41A mutant (SEQ ID NO: 5).
  • the leptin antagonist with three alanine substitutions is derived from ovine leptin.
  • the ovine leptin antagonist is the ovine recombinant leptin polypeptide that carries three Ala mutations at positions 39, 40, and 41, herein designated ovine leptin L39A/D40A/F41A mutant (SEQ ID NO: 6).
  • the four amino acid residues at positions 39-42 of a leptin polypeptide sequence are substituted by alanine.
  • the leptin antagonist with the four alanine substitutions is derived from human leptin and is the human recombinant leptin polypeptide that carries four Ala mutations at positions 39, 40, 41 and 42, herein designated human leptin L39A/D40A/F41A/I42A mutant (SEQ ID NO: 7).
  • the leptin antagonist with the four alanine substitutions is derived from ovine leptin and is the ovine recombinant leptin polypeptide that carries four Ala mutations at positions 39, 40, 41 and 42, herein designated L39A/D40A/F41A/I42A (SEQ ID NO: 8).
  • the present invention relates to an isolated DNA molecule encoding a leptin antagonist of the invention.
  • the isolated DNA molecule encodes a leptin antagonist derived from human leptin.
  • the DNA molecule is of SEQ ID NO: 9 and encodes the double human leptin mutant L39A/D40A.
  • the DNA molecule is of SEQ ID NO: 10 and encodes the double human leptin mutant F41A/I42A.
  • the isolated DNA molecule encodes a leptin antagonist derived from ovine leptin.
  • the DNA molecule is of SEQ ID NO: 11 and encodes the double mutant L39A/D40A of ovine leptin.
  • the DNA molecule is of SEQ ID NO: 12 and encodes the double mutant F41A/I42A of ovine leptin.
  • the DNA molecule is of SEQ ID NO: 13 and encodes the triple mutant L39A/D40A/F41A of human leptin.
  • the DNA molecule is of SEQ ID NO: 14 and encodes the triple mutant L39A/D40A/F41A of ovine leptin.
  • the DNA molecule is of SEQ ID NO:
  • the DNA molecule is of SEQ ID NO: 16 and encodes the quadruple mutant L39A/D40A/F41A/I42A of ovine leptin.
  • site directed mutagenesis of the ob gene is carried out by procedures well known in the art, for example using commercially available kits. The mutants are screened, sequenced to confirm the correct mutation, the mutated plasmids are isolated, and competent cells are transformed with the plasmids and used for expression of the leptin mutants.
  • the present invention relates to a synthetic leptin antagonist fragment, said fragment comprising a mutated site at positions 39-42, as described for the full-length leptin polypeptide antagonist, and wherein said fragment is itself a leptin antagonist.
  • the synthetic leptin antagonist of invention is m pegylated form and has a variable number of polyethylene glycol (PEG) molecules attached thereto.
  • PEG polyethylene glycol
  • PEG of molecular weight of 4 ; 6 kDa or 40 kDa is suitable for this purpose.
  • the pegylation of the leptin antagonists of the invention increases their stability, their plasma half-life and pharmacokinetics.
  • the synthetic leptin antagonist of invention is tagged with the SPl plant protein (Dgany et al., 2004) and oligomerized, thus obtaining a product with higher molecular mass and higher avidity to the receptor.
  • the chimeric SPl -leptin antagonist protein spontaneous assemblies to one stable oligomeric form, up to a dodecamer.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising a synthetic leptin antagonist of the invention and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition of the invention is useful in treating any disorder in which a non-desirable or deleterious activity of endogenous leptin is implicated, as for example in type II diabetes, anorexia, cancer, and autoimmune diseases such as multiple sclerosis, inflammatory bowel syndrome, rheumatoid arthritis.
  • the invention provides a pharmaceutical composition for treatment of type II diabetes and for the treatment of insulin resistance, especially that associated with obesity in a human or non-human mammal.
  • the pharmaceutical composition can be used for inhibition of malignant cell growth and can thus be useful in the treatment of cancer such as, but not limited to, breast, colon, ovarian and prostate cancer.
  • compositions for use in accordance with the present invention may be formulated in conventional manner using one or more physiologically acceptable carriers or excipients.
  • the carrier(s) must be "acceptable” in the sense of being compatible with the other ingredients of the composition and not deleterious to the recipient thereof.
  • compositions of the invention include, but are not limited to, parenteral, e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, mucosal (e.g., oral, intranasal, buccal, vaginal, rectal, intraocular), intrathecal, topical and intradermal routes. Administration can be systemic or local.
  • parenteral e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, mucosal (e.g., oral, intranasal, buccal, vaginal, rectal, intraocular), intrathecal, topical and intradermal routes.
  • parenteral e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, mucosal (e.g., oral, intranasal, buccal, vaginal, rectal, intraocular), intrathecal, topical and intradermal routes.
  • mucosal e.g., oral, intranasal, buc
  • the present invention relates to a method for treatment of type II diabetes which comprises administering to a diabetic patient an effective amount of a leptin antagonist of the invention, or a fragment thereof.
  • the present invention relates to a method for treatment of cancer which comprises administering to a cancer patient an effective amount of a leptin antagonist of the invention, or a fragment thereof.
  • the leptin antagonists of the invention are useful as research tools for study of the biological activities of the leptin hormone.
  • RPMI- 1640 medium interleukin-3 (IL-3), nalidixic acid and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (thiazolyl blue, MTT) were purchased from Sigma Chemical Co. (St. Louis, MO), fetal calf serum (FCS) from Biolab Co. (Jerusalem, Israel) and pTrc 99A expression vector, Superdex75 HR 10/30 column, Q-Sepharose from Pharmacia LKB Biotechnology AB (Uppsala, Sweden).
  • FCS fetal calf serum
  • pTrc 99A expression vector Superdex75 HR 10/30 column, Q-Sepharose from Pharmacia LKB Biotechnology AB (Uppsala, Sweden).
  • CM5 sensor chip N-hydroxysuccinimide (NHS), N-ethyl-N' (3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC), ethanolamine-HCl and HBS-EP running buffer (10 niM Hepes, 150 mM NaCl, 3.4 mM EDTA and 0.005% (v/v) surfactant P20 at pH 7.4) were purchased from Biacore, AB (Uppsala, Sweden). All other chemicals were of analytical grade.
  • the CD measurements were performed at 25.0° C as controlled by thermoelectric Peltier elements to an accuracy of 0.1° C.
  • the CD spectra were measured at five repetitions resulting in an average spectrum. Standard deviation of the average CD signal at 222 nm was in the 5% range.
  • the CD data were expressed in degree cm 2 /dmol per mean residue, based on a respective molecular mass of ⁇ 16 kDa calculated for the protein from the 147 amino acids, as it is known that the N-terminal Met- Ala bond is hydrolyzed in the course of expression (unpublished data).
  • the secondary structure of leptin and leptin mutants was calculated by applying the procedure and computer program CONTIN (Provencher and Glockner, 1981).
  • the program determines ⁇ -helices, ⁇ -strands and ⁇ -turns as a percentage of amino acid residues involved in these ordered forms. Unordered conformation was determined as unity minus the sum of all elements of the secondary structure (Venyaminov and Yang, 1996). In this study, for calculation by the CONTIN program, a set of standard CD spectra of 17 proteins was employed (Sreerama and Woody, 1993). (iv) Determination of complex stoichiometry. Complexes between chLBD and human or ovine leptins or their mutants were prepared at various molar concentrations in TN buffer. The proteins final concentrations in the 1 : 1 ratio were 10 ⁇ M.
  • the surface was activated for 7 min with a mixture of 0.05 M N- hydroxysuccinimide and 0.2 M N-ethyl-N'(3-dimetylaminopropyl)-carbodiimide hydrochloride.
  • Leptin was injected at a concentration of 50 ⁇ g/ml in 10 mM acetate, pH 3.5, until the desired level (1000 resonance units) was achieved.
  • 1 M ethanolamine, pH 8.5 was injected for 7 min to block the remaining activated groups.
  • a control surface was prepared by activating the carboxyl groups and then blocking the activated groups by ethanolamine as described.
  • chLBD resuspended in HBS-EP buffer
  • 3 flow cells carrying human or ovine leptin or control
  • Regeneration of the surface after each interaction was performed by using 10- ⁇ l pulse of 10 mM glycine buffer, pH 2.
  • the experiments were controlled by the kinetics Wizard of the Biacore control software, which corrects automatically for refractive index changes and non- specific binding by subtraction of the responses obtained for the control surface from the data obtained for the interactions between LBD and leptin.
  • the obtained binding curves were fitted to the association and dissociation phases at all LBD concentrations simultaneously using Biacore evaluation software. In all cases, the best fit was obtained for a simple bimolecular interaction (Langmuir model).
  • reaction buffer (12.5 mM Na barbiturate, pH 8.6 buffer containing 0.1% bovine serum albumin, 7.5 mM EDTA, 150 mM NaCl and 0.1% (w/v) Triton- XlOO) and homogenized with Polytrone for 30 sec at 10,000 rpm on ice.
  • Each tube contained 150 ⁇ l of reaction buffer, 100 ⁇ l l25 I-human leptin (700,000 - 800,000 cpm) and 100 ⁇ l of different leptin solutions (providing 0-5000 ng/tube) in reaction buffer and the reaction was started by addition of 150 ⁇ l homogenate.
  • the tubes were incubated for 18 h at room temperature. Then the leptin-receptor complex was precipitated by adding 250 ⁇ l of 1% (w/v) bovine immunoglobulin and 500 ⁇ l of 20% (w/v) polyethylene glycol. The tubes were thoroughly mixed, incubated for 30 min at 4 0 C, and centrifuged at 12,00Og for 15 min at 4 0 C. Then supernatant was carefully aspirated and the precipitates were counted in a ⁇ counter. Human leptin was iodinated according to a protocol previously described for the iodination of hGH (Gertler et al, 1984).
  • (vii) BAF/3 proliferation assays The proliferation rate of leptin-sensitive BAF/3 1442-CI 4 cells transfected with the long form of human leptin receptor was used to estimate self and antagonistic activity of leptin mutants, using the MTT (tetrazolium salt 3- [4, 5-dimethylthiazol-2-yl] -2, 5-diphenyltetrazolium bromide) method as previously described (Raver et al., 2000). To determine antagonistic activity of leptin mutants, 6.25x10 ' ' ' M of wild type homologous leptin was added to each well containing also different concentrations of mutated leptins.
  • MTT tetrazolium salt 3- [4, 5-dimethylthiazol-2-yl] -2, 5-diphenyltetrazolium bromide
  • the average absorbance in wells without leptin (negative control) was used as a blank value and subtracted from other absorbance values to yield the corrected absorbance values.
  • the average absorbance in wells with wild-type leptin after subtraction of the negative control was used as a positive control to calculate percent inhibition.
  • the inhibition curves were drawn using Prizma non-linear regression sigmoidal one site inhibition program (Prizma, 2003) and the IC 50 values were calculated.
  • SH-SY5Y human neuroblastoma cells bioassay SH-SY5Y human neuroblastoma cells bioassay.
  • SH-SY5Y human neuroblastoma cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% heat inactivated fetal calf serum, 100 units/ml penicillin and 100 ⁇ g/ml streptomycin in 5% CO 2 atmosphere at 37°C; differentiation of SH- SY5Y cells was achieved by treatment with retinoic acid (RA). Differentiated cells were used after 15 days of RA treatment to obtain a high percentage of cells that showed a clear morphological differentiation.
  • RA retinoic acid
  • SH-SY5Y cells were starved in serum-free Dulbecco's modified Eagle's medium for 16 h, and pre-treated for 15 minutes in the presence or absence of various concentrations of leptin antagonists (6.25 to 320 nM) and then stimulated for 10 minutes with human leptin (6.25 nM) After stimulation, cells were harvested by rinsing in ice-cold PBS and scraping into lysis buffer containing 2OmM Tris-HCl (pH 7.5), 137mM NaCl, ImM MgCl 2 , ImM CaCl 2, 1% Nonidet-P40, 10% glycerol, Protease inhibitors (0.35 mg/ml PMSF, 2 ⁇ g/ml leupeptin, 2 ⁇ g/ml aprotinin and 10 mM benzamidine) and phosphatase inhibitors (10 mM sodium fluoride, 1 mM sodium orthovanadate and 20 mM sodium ⁇ -g
  • Immunoblots were blocked with non fat dry milk and incubated in the presence of anti-Phospho-MAP kinase or anti- Total MAP kinase (ERK 41/42) (from Cell Signaling) followed by an incubation in the presence of with appropriate secondary antibodies coupled to HRP, nitrocellulose membranes were washed and targeted protein were detected using enhanced chemiluminescence reagents (ECL; Amersham Biosciences).
  • ECL enhanced chemiluminescence reagents
  • CHO cells were grown in HAM-F 12 medium containing 10% FCS and maintained at 37°C in a humidified atmosphere gassed with 95% air, 5% CO 2 .
  • GC3 minimal medium used before hormonal induction experiments was composed of DMEM-F 12, supplemented with glutamine, 100 ⁇ g/ml penicillin/streptomycin, nonessential amino acids, transferrin and insulin.
  • CHO cells were co-transfected with the pCHl lO along with ST AT3 -responsive pAH32 luciferase and mouse LEPRb encoding plasmids.
  • transfections were carried out using ExGen 500 (Euromedex, Souffelweyersheim, France) according to the manufacturer's protocol.
  • ExGen 500 Euromedex, Souffelweyersheim, France
  • transfected cells were subsequently incubated for 24 h in the presence of different concentrations of human and ovine leptins in presence or absence of respective leptin mutants in GC3 medium.
  • the plates were washed with phosphate-buffered saline, and the enzymatic activity was determined as described previously (Bignon et al. 1993, Sotiropoulus et al. 1996).
  • the results were expressed as fold induction, after the luciferase activity was normalized by correcting for ⁇ -galactosidase activity, as explained earlier.
  • the pMon3401 expression plasmids encoding the wild-type (WT) ovine or human leptin were used as starting material.
  • the leptin inserts was modified with the Stratagene QuickChange mutagenesis kit (La Jolla, CA) according to manufacturer's instructions, using two complementary primers (Table 1), The primers were designed to contain base changes (marked in bold) to obtain the respective mutations but still conserve the appropriate amino acid sequence, and to modify a specific BshTl restriction site (underlined) for colony screening.
  • the mutated construct was then digested with Dpnl restriction enzyme, which is specific to methylated and hemi-methylated DNA (target sequence: 5'- G m6 ATC-3'), in order to digest the template and to select for mutations containing synthesized DNA.
  • Dpnl restriction enzyme which is specific to methylated and hemi-methylated DNA (target sequence: 5'- G m6 ATC-3')
  • the plasmids were then transfected into XLl competent cells. Five colonies of each mutant were screened for mutation, using the specific restriction site designed, and revealed at least 80% efficiency. Two colonies of each mutant were sequenced and confirmed to contain the mutation but no unwanted misincorporation of nucleotides.
  • XL-I competent cells were transformed with the mutated plasmids and grown in 5-10 ml LB medium and the plasmids were isolated. Monl05 competent cells were then transformed with the plasmids and used for expression.
  • the primers of SEQ ID NOs. 17-32 used in this experiment for preparation of the DNA molecules encoding the leptin mutants are shown in Table 1.
  • the modified restriction site (underlined) is BshTI(-) for human leptin and BshTI for ovine leptin.
  • Primer 8 Primer sequence SEQ ID NO.
  • L39/AD40A-3 A 5 '-GAGCCCAGG AATGAAAGCCGCACCAGTGACTTTCTGTTTGG-3 18
  • F41A/I42A-5 S 5'-CCAAACAGAAAGTCACTGGITTGGACGCCGCTCCTGGGCTCCACC-S' 19
  • F41A/I42A-3 A 5 '-GGTGGAGCCCAGGAGCGGCGTCCAAACC AGTGACTTTCTGTTTGG-3 ' 20
  • L39A/D40A/F41A/I42A-3 A 5'- GGTGGAGCCCAGGAGCGGCGGCCGCACCAGTGACTTTCTGTTTGG-S' 24
  • L39A/D40A-5 S 5'-CAGAGGGTCACCGGTGCTGCTTTCATCCCTGGGCTCCACCC -3 25
  • L39A/D40A-3 A 5'-GGGTGGAGCCCAGGGATGAAAGCAGCACCGGTGACCCTCTG -3' 26
  • F41A/I42A-3 A 5'-GAGCCCAGGAGCAGCGTCCAAACCGGTGACCCTCTGTTTGGAGG -3' 28
  • L39A/D40A/F41 A/I42A-5 S 5' -CAG AGGGTC ACCGGTGCTGCTGCTGCTCCCGGGCTCCACCC-3 ' 31 L39A/D40A/F41A/I42A-3 A 5 '-GGGTGG AGCCCGGGAGCAGCAGCAGC ACCGGTGACCCTCTG-3 ' 32
  • the recombinant wild-type (WT) or mutated human leptins with an extra methionine-alanine at the N-terminus were expressed upon nalidixic acid induction (50 ⁇ g/ml) in 2.5 1 culture of MON 105 cells, transformed with the appropriate expression plasmid.
  • Transformed bacteria were first grown in 5 x 500 ml in 2.5-liter flasks in Terrific Broth (TB) medium at 37°C to an A 60O of 0.9 with constant shaking of 200 rpm. Four hours after addition of nalidixic acid the cells were harvested by 10-min centrifugation at 10,000g and frozen at -20° C.
  • IBs Inclusion bodies
  • the pH of the solution was adjusted to 11.5 by NaOH. After 2 h of stirring at 4°C, 3 volumes of 0.67 M arginine were added to a final concentration of 0.5 M and stirred overnight. Next morning, the solution was transferred to dialysis tubes and dialyzed against 5 x 10 1 of 10 mM Tris-HCl, pH 9 (in the case of human leptin mutants) or 10 mM Tris-HCl pH 8 (in the case of ovine leptin mutants), for 60 h, with every 6-10 h external solution exchange.
  • Example 3 Purification and chemical characterization of leptin mutants
  • the refolded and dialyzed fractions of human leptin mutants of Example 2 were purified on a Q-Sepharose anion exchange column (30 ml bead volume), at maximal flow rate (400 - 500 ml/h), equilibrated with 10 mM Tris-HCl buffer, pH 9, using non continous NaCl gradient (50, 100, 150 and 400 mM of NaCl in 10 mM Tris-HCl,). Fifty-ml fractions were collected and protein concentration was determined by absorbance at 280 nm.
  • L39A/D40A/F41A SEQ ID NO. 5
  • L39A/D40A/F41A/I42A SEQ ID NO. 7 mutants were 0.885, 0.890 0.892, 0.895 and 0.897 and corresponding values for ovine species were 0.201, 0.202, 0.202, 0.203 and 0.203.
  • Iodinated human leptin served as the ligand in all competitive experiments and the respective wild-type (WT) human and ovine leptins and their alanine mutants as competitors.
  • Freshly prepared homogenate of BAF/3 cells stably transfected with the long form of human leptin receptor served as receptor source. Homogenate from 1.75 x 10 6 cells was used per tube giving 6 to 7% specific binding.
  • the inhibition curves (average of two experiments) are presented in Fig. 3 and the respective IC 50 values for WT human leptin and L39A/D40A (SEQ ID NO. 1), F41A/I42A (SEQ ID NO. 2), L39A/D40A/F41A (SEQ ID NO.
  • L39A/D40A/F41A SEQ ID NO. 5
  • L39A/D40A/F41A/I42A SEQ ID NO. 7
  • IL-3 55 pM
  • human and ovine leptin mutants no inhibition was observed even at 125 nM concentration of the mutants.
  • leptin mutants were also tested SH-S Y5 Y human neuroblastoma cells bioassay and by transactivation of luciferase reporting gene in CHO cells transiently transfected with leptin receptor.
  • pretreatment with human L39A/D40A/F41A/I42A SEQ ID NO. 7
  • leptin antagonist completely blocked the subsequent leptin-inducible activation of MAPK
  • human L39A/D40A/F41A/I42A SEQ ID NO. 7
  • leptin mutant have progressively attenuated the leptin-inducible activation of luciferase (Fig 4B). Fifty percent inhibition was achieved at approximately ten-fold antagonist to agonist excess.
  • any respective protein to elicit a biological effect in vivo depends on many factors including not only the affinity for its receptor, but also the rate at which it is cleared from circulation.
  • kidney-mediated clearance is mainly dependent on a molecular mass and proteins larger than 70-80 kDa are cleared at a remarkably slower rate
  • the effort should be directed at prolongation of hormonal in vivo half- live by increasing its size. This can be achieved by increasing the size of the hormone without affecting its activity by pegylation. Attachment of several polyethylene glycol (PEG) molecules increases the hydrodynamic volume of the protein, thereby slowing its clearance (Abuchowski et al.; 1977).
  • PEG polyethylene glycol
  • pegylated human growth hormone was the recent finding that despite the up to 500-fold lower affinity and in vitro activity, the in vivo potency of the pegylated hGH was remarkably increased mainly due to up to 25-fold increase in its half-life in the circulation. Thus, it was concluded that increasing circulating half-life can compensate the deficits in receptor binding affinity (Clark et al., 1996).
  • Pegylation is performed by cross-linking of the purified leptin mutants with polyethylene glycol (MW 40 kDa) to alpha- or epsilon-amino groups by well known procedures (Clark et al., 1996) or according to the manufacturer's (Nektar
  • a chimeric protein composed of human leptin mutant-29 amino acid linker and SPl plant protein was prepared (Dgany et al., 2004). The construct was subcloned to pET29a vector and expressed as insoluble protein as inclusion bodies
  • the main protein band had molecular mass of- 32 kDa close to theoretical value of 31402 Da.
  • the chimeric protein was solubilized, refolded and purified to homogeneity.
  • Class I cytokines interact with their receptor through conserved binding sites (sites I and II).
  • G-CSF and cytokines of the gpl30 family, including IL-6 have an additional binding site (site III), which was shown in recent crystal structures of IL- 6-gpl30 complexes to interact with the Ig-like domain (IGD) of the receptor (Chow et al., 2001 ; Boulanger et al., 2003) in a 2:2 arrangement.
  • Ig-like domain Ig-like domain
  • a similar type of complex formation is expected for the leptin/leptin receptor interaction due to the sequence similarities and overall architecture that the two interacting partners share with the hormone and receptors of the G-CSF and gpl30 family of cytokines.
  • site III includes the N-terminus of helix D (dark blue), loop C-D (light blue) and loop A-B (orange) and contacts the IGD of the receptor (gray on the left part of the figure). Site III appears to be the most variable region amongst the cytokines.
  • the A-B loop (orange in Fig 5) is of variable length and, in the isolated structure of human leptin (pdb Iax8; Zhang et al., 1997) or even in the IL-6-gpl30-IL-6R (pdb Ip9m; Boulanger et al., 2003), appears to be disordered, no residues being visible in the electron density map. Loop C-D is also variable (light blue in Fig 5).
  • the A-B loop includes a short ⁇ -strand, which forms a ⁇ -sheet- like structure through main-chain H-bonds with the first ⁇ -strand of the receptor Dl domain (Fig. 6, top panel).
  • an extended, ⁇ -strand-like structure can also be observed between the C-terminus of helix A and this ⁇ -strand, leading to a relatively flat contact surface with one of the two ⁇ -sheet of the receptor Dl domain (Fig 6).
  • HCA Hydrophobic Cluster Analysis
  • a loop of variable length separates helix A from helix B.
  • this loop includes clusters, which are typical of extended ( ⁇ -strand) structures.
  • the middle one corresponds to the ⁇ -strand, which interacts with the IGD of gl30.
  • the situation is different for leptin, and even simpler, as the loop is shorter and contains only one cluster, typical of a ⁇ -strand structure (VTGLDFI/S; cluster associated at 77 % with ⁇ -strands (our unpublished statistics)). It can be thus tentatively aligned to the IGD-interacting ⁇ -strand of IL-6, the sequence of which is LEPAAIF.
  • the core of the interface of viral IL-6 with gpl30 and involving loop CD is formed by the three aromatic amino acids Tyrl43, Trpl44 and Phel48 (Chow et al., 2001, Fig 5, top panel, highlighted in violet).
  • a tyrosine residue (Tyrl l9, pink in Fig. 6, bottom panel) might play a similar role in the interaction with the leptin receptor.
  • Y119A To test this assumption we have mutated this residue to Ala and prepared the recombinant mutant Y119A. Despite correct refolding as indicated by CD spectrum this mutant exhibited substantially lower agonistic activity and was totally devoid of any antagonistic effect (unpublished data).
  • the mutants of the present invention act as competitive antagonists to leptin.
  • Those mutants can be easily prepared in gram amounts and thus serve as a novel tool of studying leptin function in vitro and in vivo.
  • antagonizing leptin has been suggested as a possible therapy in auto- immune diseases and might also have beneficiary effects on atherosclerosis.
  • leptin antagonists offer a novel tool to elucidate the role of leptin in mammalian physiology and pathology.
  • Gertler, A. (2000) Preparation of recombinant bovine, porcine, and porcine W4R/R5K leptins and comparison of their activity and immunoreactivity with ovine, chicken, and human leptins. Protein Expr. Pur if. 19, 30-40. Raver, N., Vardy, E., Livnah, O., Devos, R., and Gertler, A. (2002) Comparison of R128Q mutations in human, ovine, and chicken leptins. Gen. Comp. Endocrinol. 126, 52-8.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Obesity (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Child & Adolescent Psychology (AREA)
  • Toxicology (AREA)
  • Biochemistry (AREA)
  • Neurology (AREA)
  • Emergency Medicine (AREA)
  • Neurosurgery (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
PCT/IL2005/001250 2004-11-26 2005-11-24 Leptin antagonists Ceased WO2006056987A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AT05809259T ATE498683T1 (de) 2004-11-26 2005-11-24 Leptin antagonisten
JP2007542513A JP5113526B2 (ja) 2004-11-26 2005-11-24 レプチン拮抗薬
DE602005026432T DE602005026432D1 (de) 2004-11-26 2005-11-24 Leptin antagonisten
EP05809259A EP1814986B1 (en) 2004-11-26 2005-11-24 Leptin antagonists
CN2005800471206A CN101189335B (zh) 2004-11-26 2005-11-24 瘦素拮抗剂
IL183335A IL183335A0 (en) 2004-11-26 2007-05-21 Leptin antagonists

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10/996,607 2004-11-26
US10/996,607 US7307142B2 (en) 2004-11-26 2004-11-26 Leptin antagonists

Publications (2)

Publication Number Publication Date
WO2006056987A2 true WO2006056987A2 (en) 2006-06-01
WO2006056987A3 WO2006056987A3 (en) 2006-08-24

Family

ID=36204374

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2005/001250 Ceased WO2006056987A2 (en) 2004-11-26 2005-11-24 Leptin antagonists

Country Status (8)

Country Link
US (1) US7307142B2 (https=)
EP (1) EP1814986B1 (https=)
JP (1) JP5113526B2 (https=)
CN (1) CN101189335B (https=)
AT (1) ATE498683T1 (https=)
DE (1) DE602005026432D1 (https=)
ES (1) ES2363011T3 (https=)
WO (1) WO2006056987A2 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011132189A3 (en) * 2010-04-22 2011-12-22 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd High affinity leptins and leptin antagonists
US8642543B2 (en) 2005-09-07 2014-02-04 Neurotez, Inc. Methods for treating progressive cognitive disorders related to neurofibrillary tangles
WO2014024189A1 (en) * 2012-08-06 2014-02-13 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd Pegylated high affinity leptins with increased biological activity
US8716220B2 (en) 2005-09-07 2014-05-06 Nikolaos Tezapsidis Leptin compositions and methods for treating progressive cognitive function disorders resulting from accumulation of neurofibrillary tangles and amyloid beta
ITCS20140016A1 (https=) * 2014-04-28 2015-10-28
WO2017013270A1 (en) 2015-07-23 2017-01-26 Universite De Strasbourg Use of leptin signaling inhibitor for protecting kidneys from patients having ciliopathy

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8227408B2 (en) * 2005-09-07 2012-07-24 Neurotez, Inc. Leptin as an anti-amyloidogenic biologic and methods for delaying the onset and reducing Alzheimer's disease-like pathology
WO2010117785A1 (en) * 2009-03-31 2010-10-14 Temple University - Of The Commonwealth System Of Higher Education Leptin antagonist and methods of use
EP3261582B1 (en) * 2015-02-26 2021-01-06 Remodeless CV Ltd. Methods and compositions relating to leptin antagonists
US10926006B2 (en) 2015-02-26 2021-02-23 Remodeless Cv Ltd Drug eluting stent
US11123461B2 (en) 2015-02-26 2021-09-21 Remodeless Cv Ltd Treatment of ischemia and reperfusion using leptin antagonist
CN104829708B (zh) * 2015-05-06 2017-11-28 广东省生物资源应用研究所 一条d螺旋区突变的瘦素活性肽及其编码基因和应用
CN104829707B (zh) * 2015-05-06 2017-12-19 广东省生物资源应用研究所 一条cd环和e螺旋区突变的瘦素活性肽及其编码基因和应用
LT3538554T (lt) * 2016-11-08 2025-10-10 Antigeną surišantys baltymai, antagonizuojantys leptino receptorius
PT3773713T (pt) 2018-04-06 2025-07-29 Regeneron Pharma Anticorpo agonista do recetor de leptina para usar no aumento da massa óssea num sujeito que sofre de disfunção metabólica ou de hipoleptinemia
KR20210104744A (ko) 2018-12-18 2021-08-25 리제너론 파마슈티칼스 인코포레이티드 렙틴 수용체, gdf8 및 액티빈 a에 대한 길항제를 사용하여 체중 및 제지방 근육량을 향상시키기 위한 조성물 및 방법
WO2024050285A2 (en) * 2022-08-31 2024-03-07 The Board Of Trustees Of The Leland Stanford Junior University Leptin analogs for treating obesity and weight management

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6309853B1 (en) * 1994-08-17 2001-10-30 The Rockfeller University Modulators of body weight, corresponding nucleic acids and proteins, and diagnostic and therapeutic uses thereof
AU1406497A (en) * 1995-12-06 1997-06-27 Schering Corporation Mutational variants of mammalian ob gene proteins
US20020160935A1 (en) * 2000-03-24 2002-10-31 Smithkline Beecham Plc Use of leptin antagonists for the treatment of diabetes
WO1998012224A1 (en) * 1996-09-20 1998-03-26 Hoechst Aktiengesellschaft Use of leptin antagonists for treating insulin resistance in type ii diabetes
CN1491232A (zh) * 2001-02-06 2004-04-21 Ĭ��ר�����޹�˾ 免疫原性减弱的经修饰肥胖蛋白

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8642543B2 (en) 2005-09-07 2014-02-04 Neurotez, Inc. Methods for treating progressive cognitive disorders related to neurofibrillary tangles
US8716220B2 (en) 2005-09-07 2014-05-06 Nikolaos Tezapsidis Leptin compositions and methods for treating progressive cognitive function disorders resulting from accumulation of neurofibrillary tangles and amyloid beta
WO2011132189A3 (en) * 2010-04-22 2011-12-22 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd High affinity leptins and leptin antagonists
US8969292B2 (en) 2010-04-22 2015-03-03 The Medical Research, Infrastructure, And Health Services Fund Of The Tel-Aviv Medical Center High affinity leptins and leptin antagonists
WO2014024189A1 (en) * 2012-08-06 2014-02-13 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd Pegylated high affinity leptins with increased biological activity
ITCS20140016A1 (https=) * 2014-04-28 2015-10-28
WO2017013270A1 (en) 2015-07-23 2017-01-26 Universite De Strasbourg Use of leptin signaling inhibitor for protecting kidneys from patients having ciliopathy

Also Published As

Publication number Publication date
JP5113526B2 (ja) 2013-01-09
US20060154859A1 (en) 2006-07-13
CN101189335A (zh) 2008-05-28
CN101189335B (zh) 2012-01-11
US7307142B2 (en) 2007-12-11
ES2363011T3 (es) 2011-07-18
JP2008521795A (ja) 2008-06-26
EP1814986A2 (en) 2007-08-08
DE602005026432D1 (de) 2011-03-31
WO2006056987A3 (en) 2006-08-24
ATE498683T1 (de) 2011-03-15
EP1814986B1 (en) 2011-02-16

Similar Documents

Publication Publication Date Title
EP1814986B1 (en) Leptin antagonists
EP2279007B1 (en) Pegylated recombinant human growth hormone compounds
EP1121155B1 (en) Site-directed dual pegylation of proteins
KR100776862B1 (ko) 엔 말단 모노피이지화된 인간 성장 호르몬 접합체, 그의제조 방법, 및 그의 사용 방법
JP2014521594A (ja) 長持続期間デュアルホルモンコンジュゲート
KR20090102785A (ko) 제거될 수 있는 결합을 지니는 인자 ⅸ 부분­중합체 컨주게이트
EP0756494A1 (en) Modified insulin-like growth factors
JP2008511610A (ja) グリセロール分岐のポリエチレングリコール−ヒト成長ホルモン結合体、それらの製造方法及び使用方法
JP2014516049A (ja) アミリンペプチドおよび誘導体ならびにそれらの使用
KR100507796B1 (ko) 생체내 반감기가 증가된 peg-생리활성 폴리펩티드 동종이량체 결합체 및 이의 제조방법
US11045523B2 (en) Formulation of growth hormone albumin-binder conjugate
CN105229035A (zh) 生长激素化合物
EP1325930A1 (en) Mammal prolactin variants
CN112912095B (zh) 包括多肽的药物组合物
WO2014139994A1 (en) Growth hormone compounds
RU2530714C9 (ru) Пэгилированные соединения рекомбинантного гормона роста человека
RU2802215C2 (ru) Фармацевтическая композиция и способ лечения связанных с гормоном роста заболеваний у человека
Leonora et al. Identification of the hydrophobic strand in the A–B loop of leptin as major binding site III: implications for large-scale preparation of potent recombinant human and ovine leptin antagonists

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 3742/DELNP/2007

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 183335

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2007542513

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2005809259

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 200580047120.6

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2005809259

Country of ref document: EP