WO2005103078A1 - Gm-csf aviaire - Google Patents

Gm-csf aviaire Download PDF

Info

Publication number
WO2005103078A1
WO2005103078A1 PCT/EP2005/051759 EP2005051759W WO2005103078A1 WO 2005103078 A1 WO2005103078 A1 WO 2005103078A1 EP 2005051759 W EP2005051759 W EP 2005051759W WO 2005103078 A1 WO2005103078 A1 WO 2005103078A1
Authority
WO
WIPO (PCT)
Prior art keywords
csf
protein
cells
nucleic acid
avian
Prior art date
Application number
PCT/EP2005/051759
Other languages
English (en)
Inventor
Pete Kaiser
Jim Kaufman
Lisa Rothwell
Original Assignee
Institute For Animal Health
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute For Animal Health filed Critical Institute For Animal Health
Publication of WO2005103078A1 publication Critical patent/WO2005103078A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/465—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from birds

Definitions

  • the current invention relates to the field of veterinary immunology, namely to avian cytokines, more specifically to avian granulocyte-macrophage colony-stimulating factor (GM- CSF).
  • GM- CSF avian granulocyte-macrophage colony-stimulating factor
  • the invention relates to a protein, or functional fragment thereof, having at least one of the biological activities of avian GM-CSF, as well as to a nucleic acid encoding such protein or fragment.
  • the invention relates to a recombinant DNA molecule, a live recombinant carrier, or a host cell.
  • the invention relates to the use as a medicament, and to compositions comprising such a protein or functional fragment thereof, or a nucleic acid encoding such protein or fragment.
  • Cytokines are proteins present in the serum of most vertebrate organisms that regulate proliferation, differentiation, and activation of blood cells. Cytokines play essential roles in e.g. haemopoiesis and immunological responses. Grouped under the general name of cytokines are families of proteins arranged by origin, function or structure: Interleukins, Lymphokines, Interferons, Chemokines, tumour necrosis factors, and growth factors. Most cytokines are both produced by, and have effects on, blood cells that span the range from undifferentiated pluripotent stem cells up to differentiated activated effector cells. These effects are mostly reached in combination with other (cytokine) factors, thereby forming a complex balance of both stimulatory and inhibitory signals. The respective signals are detected by the various target cells through specific receptors on the cell surface
  • Th1 cells produce a distinct panel of cytokines (in particular IFN- ⁇ and TNF- ⁇ ) that drive strong inflammatory reactions (classically defined as cell-mediated immunity) and promote antibody isotype switching to certain isotypes.
  • Th2 cells (classically defined as driving humeral immunity) produce a second distinct panel of cytokines (in particular IL-4, IL-5 and IL-13) that drive anti- helminthic worm reactions and allergic reactions, and promote antibody isofype switching to other, distinct isotypes, including IgE.
  • T1 cytokines drive inflammatory reactions
  • T2 cytokines drive anti- helminth reactions and allergy.
  • cytokines have been employed in many different (veterinary) medical uses, for instance for influencing an organisms' immunological response to infection or vaccination.
  • Such (immuno)therapeutic use is known for granulocyte-macrophage colony-stimulating factor (GM-CSF).
  • GM-CSF is also known as granulocyte-monocyte colony-stimulating factor, and its encoding gene is also named the colony stimulating factor 2 (CSF-2) gene.
  • CSF-2 colony stimulating factor 2
  • GM-CSF is a cytokine from the growth factor family. It is categorised as a colony stimulating-, and a haematopoietic growth factor.
  • GM-CSF is not the same as related cytokines: myelomonocytic growth factor (MGF), macrophage colony-stimulating factor (M- CSF), stem cell factor (SCF), or granulocyte colony-stimulating factor (G-CSF), which is also known as CSF-1.
  • MMF myelomonocytic growth factor
  • M- CSF macrophage colony-stimulating factor
  • SCF stem cell factor
  • G-CSF granulocyte colony-stimulating factor
  • GM-CSF is produced by activated T-lymphocytes, macrophages, endothelial cells, and fibroblasts, and has potent stimulatory and/or modulatory effects via multiple pathways on myeloid cells such as neutrophils, eosinophils, and various antigen presenting cells; see for a review Baldwin, G.C. (1992, Dev. Biol., vol. 151, p. 352-367).
  • GM-CSF normal biological activity in GM-CSF in the stimulation of proliferation and response to infection or vaccination is caused by its induction of proliferation of macrophages and granulocytes from precursor cells; the stimulation of differentiation of dendritic cells; the stimulation of antigen- presentation; the expression of molecules from the major histocompatibility complex (MHC); and activation of both CD4+ Th1 and Th2, as well as CD8+ cytotoxic T lymphocytes.
  • MHC major histocompatibility complex
  • GM-CSF human and mouse were described already in 1984 (Metcalf, D., 1985, Science, vol. 225, p. 16-22), and since then genes encoding the GM-CSF of several other mammalian species have been described, such as: cat, dog, cow, sheep and pig. In all species for which the GM-CSF gene has been described so far, the gene consists of 4 exons, and encodes a protein of approximately 144 amino acids.
  • GM-CSF has an N-terminal signal sequence for secretion from the cell. It shares with other members of the cytokine growth factor family a secondary structure comprising four alpha-helices.
  • GM-CSF mammalian GM-CSF
  • GM-CSF mammalian GM-CSF
  • recombinant expression technology thereby providing unlimited amounts of protein of desired purity.
  • rec. human GM-CSF is sold commercially amongst other names as Sargramostim®, and has been used for the treatment of neutropenia, allergy, cancer, and infections.
  • Alternative therapeutic applications have used the cDNA for human GM-CSF as a nucleic acid construct or in a live recombinant carrier.
  • administration of rec human GM-CSF to premature babies helped overcome infections (Carr, R. etal., 2003, Cochrane database Syst.
  • Vaccination before hatching has as major advantage that the chick at hatch already has some immunity against pathogenic agents that would otherwise put it at risk already at that stage.
  • the immune systems of embryos and newly hatched birds is not yet fully developed, it cannot give rise to an immune response that is as effective as when vaccinated at 1 - 3 weeks after hatching.
  • agents that promote immunomaturation i.e. that stimulate or enhance the development of the birds' immune response.
  • avian cytokines have been used for improving immune protection with varying levels of success.
  • Avian cytokines have been administered as therapeutic protein, as vaccine adjuvant, and as insert in viral vectors.
  • General reviews on avian cytokines and their uses were given by Hilton, L.S., et al. (2002, Vet. Immunol. Immunopathol., vol. 85, p. 119-128), Staeheli, P. etal. (2001, J.
  • avian GM-CSF protein For the purpose of inducing immunomaturation and immunomodulation in avian species it would be highly advantageous to have a biologically active avian GM-CSF protein or its encoding gene available. It is therefore an object of the invention to provide a protein, or a nucleic acid encoding such protein, that has at least one of the biological activities of an avian GM-CSF. It was surprisingly found now that the amino acid sequence of SEQ ID NO: 2, and the nucleotide sequence of SEQ ID NO: 1, constitute respectively a protein and a cDNA encoding such a protein, which protein is shown to have the biological activities of an avian GM-CSF.
  • the first avian GM-CSF protein and encoding nucleic acid are disclosed.
  • the GMCSF protein and the encoding nucleic acid can now be employed as described above for mammalian GM-CSF, e.g. by expression and purification from recombinant expression systems, by synthesis of nucleic acid constructs, and by incorporation into live recombinant carriers.
  • this first avian GM-CSF nucleic acid and protein now allows the generation of primers, probes and antibodies for the identification of homologous GM-CSF molecules in other avian species.
  • an avian GM-CSF for the purpose of immunomaturation and/or immunomodulation in avian organisms, by efficient stimulation of avian blood cell proliferation and differentiation, and by enhancing, increasing, or otherwise facilitating the quantity and/or quality of an immune response in an avian organism.
  • Advantageous effects of such uses of avian GM-CSF are e.g. stronger, earlier, and longer lasting vaccine efficacies, resulting in the possibility to reduce the number and the dose of vaccinations, as well as the possibility to immunize effectively at an earlier age, even before hatching.
  • the invention relates to an isolated protein or a functional fragment thereof, characterised in that the protein comprises an amino acid sequence having at least 70 % amino acid similarity to the amino acid sequence of SEQ ID NO: 2, whereby the protein or the fragment has at least one of the biological activities of avian GM-CSF.
  • the protein of the invention comprises an amino acid sequence having 75 %, preferably 80, 85, 90, 92, 94, 95, 96, 97, 98 or 99 % amino acid similarity to the amino acid sequence of SEQ ID NO: 2, whereby the protein has at least one of the biological activities of avian GM-CSF.
  • amino acid sequence of the protein of the invention is SEQ ID NO: 2.
  • SEQ ID NO: 2 represents the amino acid sequence of protein forming chicken GM-CSF, predicted by computer translation from the nucleotide sequence of SEQ ID NO: 1.
  • isolated is meant that the protein is isolated from the natural state, i.e. it has been changed or moved from its natural environment or both.
  • the molecule is separate and discrete from the whole organism with which the molecule is found in nature.
  • protein is meant to incorporate a molecular chain of amino acids.
  • a protein is not of a specific length, structure or shape and can, if required, be modified in vivo or in vitro, by, e.g. glycosylation, amidation, carboxylation, phosphorylation, or changes in spatial folding. Also, protein-salts, -amides, and -esters (especially C-terminal esters), and N-acyl derivatives are within the scope of the invention. Inter alia, peptides, oligopeptides and polypeptides are included within the definition of protein, as well as precursor-, pre-pro- and mature forms of the protein.
  • a protein can be of biologic and/or of synthetic origin.
  • a protein may be a chimeric or fusion protein, created from fusion by biologic or chemical processes, of two or more protein fragments.
  • similarity refers to a degree of similarity between proteins in view of differences in amino acids, wherein the differing amino acids are functionally similar e.g. in view of almost equal size, polarity or hydrophobicity.
  • the "% amino acid similarity" of a proteins' amino acid sequence with a protein according to the invention can be determined by amino acid alignment to the full-length amino acid sequence of SEQ ID NO: 2.
  • the percentage of similarity with a protein according to the invention can be determined with the computer program "BLAST 2 SEQUENCES” by selecting sub-program: "BlastP” (T. Tatusova & T. Madden, 1999, FEMS Microbiol. Letters, vol. 174, p.
  • variant, homologous, or polymorphic forms of the protein may take the form of (an) amino acid difference(s) in the overall sequence or by deletions, substitutions, insertions, inversions or additions of (an) amino acid(s) in said sequence.
  • amino acid substitutions which do not essentially alter biological activities have been described, e.g. by Neurath et al. (1979, in: "The Proteins", Academic Press New York).
  • Amino acid replacements between related amino acids or replacements which have occurred frequently in evolution are, i.a.
  • mouse - rat - gerbil 69-72 %
  • horse - cow - red deer - sheep 86 - 90 %
  • dog - cat 86 %
  • human - baboon - macaque 88-98 %. Therefore, a level of at least 70 % amino acid similarity can be expected between the amino acid sequence of GM-CSF proteins obtained from related avian species.
  • avian is meant to incorporate all species and organisms of the class Aves.
  • Preferred organisms are selected from the group consisting of chicken, turkey, duck, goose, quail, partridge, pheasant, guinea fowl, ostrich, pigeon, canary, budgerigar, and parrot. More preferred organisms are selected from the group consisting of chicken, turkey, duck and goose. Most preferred is chicken.
  • the "biological activities" of avian GM-CSF comprise the ability of avian GM-CSF on avian cells to function as a colony stimulating- or haematopoietic growth factor, similar to the activities of mammalian GM-CSF on mammalian cells, as outlined above.
  • Preferred biological activities are the proliferation and differentiation of granulocyte and macrophage precursors, and the ability to induce differentiation of dendritic cells from monocytes, for instance when applied together with IL-4.
  • Such activities are normally detected in colony formation assays, e.g. using bone marrow cells; or in assays measuring activation of cells, e.g. through uptake of a marker compound, e.g.
  • a "functional fragment" of a protein according to the invention is a protein fragment that has at least one of the biological activities of an avian GM-CSF outlined above, by retaining the part(s) of the protein which is/are essential for the proteins' biological activity.
  • Such a functional fragment can fulfil this function, for example, when used alone or fused to heterologous sequences.
  • a functional fragment may be a protein that is functional per se, or the fragment may be functional when linked to another protein, to obtain a chimeric protein.
  • a functional fragment of an avian GM-CSF can be based upon the results of studies of mammalian GM-CSF proteins, which have shown which regions are relevant for binding to the receptor and/or for biological activity. See for instance: Shanafelt A.B. et al. (1991, EMBO J., vol. 10, p. 4105-4112), Diederichs, K., etal. (1991, Science, vol. 254, p. 1779-1782), and Meropol, N.J. et al. (1992, J. Biol. Chem., vol. 267, p. 14266-14269).
  • Fragments can inter alia be produced by enzymatic cleavage of precursor molecules, using restriction endonucleases for the encoding nucleic acids, or proteases for the proteins. Other methods include chemical synthesis of the fragments or the expression of protein fragments from DNA fragments. Also fragments can be isolated from nature. For instance the signal sequence of GM-CSF is cut off upon passage of the native molecule through the cell on route to secretion. Therefore a mature secreted GM-CSF protein is a functional fragment within the scope of the invention.
  • a functional fragment according to the invention has a length of at least 8 amino acids; more preferably 10, 15, 20, 25, 30, 40, 50, 75, 100, 125, or 144 amino acids.
  • the preferred way to produce a protein according to the invention or a functional fragment thereof is by using techniques of genetic engineering and recombinant expression. These may comprise using nucleic acids, cDNA fragments, recombinant DNA molecules, live recombinant carriers, and/or host cells.
  • another aspect of the invention relates to an isolated nucleic acid capable of encoding a protein according to the invention or a functional fragment thereof, characterised in that the nucleic acid has at least 70 % nucleotide sequence identity to the nucleotide sequence of SEQ ID NO: 1 , whereby the encoded protein or the functional fragment has at least one of the biological activities of avian GM-CSF.
  • the nucleic acid of the invention is characterised in that the nucleic acid has at least 75 %, preferably 80, 85, 90, 92, 94, 95, 96, 97, 98 or 99 % nucleotide sequence identity to the nucleotide sequence of SEQ ID NO: 1 , whereby the encoded protein has at least one of the biological activities of avian GM-CSF.
  • nucleotide sequence of the nucleic acid of the invention is SEQ ID NO: 1.
  • SEQ ID NO: 1 represents the nucleotide sequence of cDNA of chicken GM-CSF obtained as outlined in Example 1.
  • nucleic acid is meant to incorporate a molecular chain of desoxy- or ribo-nucleic acids.
  • a nucleic acid is not of a specific length, therefore polynucleotides, genes, open reading frames (ORF's), probes, primers, linkers, spacers and adaptors, consisting of DNA and/or RNA, are included within the definition of nucleic acid.
  • a nucleic acid can be of biologic and/or synthetic origin.
  • the nucleic acid may be in single stranded or double stranded form. The single strand may be in sense or anti-sense orientation.
  • modified RNAs or DNAs are also included within the definition. Modifications in the bases of the nucleic acid may be made, and bases such as Inosine may be incorporated. Other modifications may involve, for example, modifications of the backbone.
  • encodes is meant to incorporate: providing the possibility of protein expression, i.a. through transcription and/or translation when brought into the right context.
  • a nucleic acid according to the invention when brought into the right context is capable of encoding a protein according to the invention, or a functional fragment thereof.
  • a nucleic acid according to the invention can be manipulated to encode a GM-CSF protein that lacks the N-terminal signal sequence, using techniques known in the art.
  • % nucleotide sequence identity of a nucleic acids' nucleotide sequence with that of a nucleic acid according to the invention can be determined by nucleotide sequence alignment to the whole of, or to the relevant part of the nucleotide sequence of SEQ ID NO: 1.
  • the percentage of identity between a nucleic acid and a nucleic acid according to the invention can be determined with the computer program "BLAST 2 SEQUENCES” by selecting sub-program: “BlastN” (T. Tatusova & T. Madden, 1999, FEMS Microbiol. Letters, vol. 174, p. 247-250), that can be found at the internet address: www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html. Parameters that are to be used are the default parameters: reward for a match: +1 ; penalty for a mismatch: -2; open gap penalty: 5; extension gap penalty: 2; and gap x_dropoff: 50. Unlike the output of the BlastP program described above, the BlastN program does not list similarities, only identities: the percentage of nucleotides that are identical is indicated as "Identities”.
  • Tm [81.5°C + 16.6(log M) + 0.41 (%GC) - 0.61 (%formamide) - 500/L] - 1 °C/1 % mismatch
  • M is the molarity of monovalent cations
  • %GC is the percentage of guanosine and cytosine nucleotides in the DNA
  • L is the length of the hybrid in base pairs
  • mismatch is the lack of an identical match. Washing conditions subsequent to the hybridization can also be made more or less stringent, thereby selecting for higher or lower percentages of identity respectively. In general, higher stringency is obtained by reducing the salt concentration, and increasing the incubation temperature. It is well within the capacity of the skilled person to select hybridisation conditions that match a certain percentage-level of identity as determined by computer analysis.
  • Stringent conditions are those conditions under which a nucleic acid still hybridises if it has a mismatch of 30 %; i.e. if it is 70 % identical to the (relevant part of the) nucleotide sequence depicted in SEQ ID NO: 1. Therefore, if a nucleic acid hybridises under stringent conditions to the nucleotide sequence depicted in SEQ ID NO: 1 , it is considered a nucleic acid according to the invention.
  • nucleotide sequence identity between chicken and mammalian cDNA coding for GMCSF is so low that a standard BlastN alignment of SEQ ID NO: 1 to e.g. the GenBank database does not report a significant match to any GM-CSF encoding sequence. From unrelated sequences no significant matches are detected of any sequence segment over 22 nucleotides. Sequences of such short length can only encode small peptides of some 7 amino acids. Such peptides are not able to induce one of the biological activities of a protein according to the invention. Therefore, peptides of 7 or less amino acids are not functional fragments of a protein according to the invention.
  • a nucleic acid according to the invention is at least 25 nucleotides long, more preferably 50, 75, 10, 150, 200, 250, 300, 350, 400, or 435 nucleotides long.
  • GM-CSF GM-CSF nucleotide sequences
  • genes and mRNA's from other avian species.
  • homologous genes can be called paralogs or orthologs.
  • Methods to isolate a nucleic acid capable of encoding a GM-CSF from avian species are well-known in the art.
  • the chicken GM-CSF cDNA as depicted in SEQ ID NO: 1 can be used to make or isolate probes or primers. These can be used to screen libraries of genomic or mRNA sequences by PCR or hybridization selection. From a positive clone or colony, the GM-CSF insert can be obtained, subcloned and used e.g. in an expression system.
  • GM-CSF variants or homologues in other avian organisms can now conveniently be identified by computerised comparisons of SEQ ID NO:1 or a part thereof in silico to other avian sequences that may be comprised in a computer database.
  • many computer programs are publicly available.
  • the suite of BLAST programs (Altschul, S.F., et al, 1997, Nucleic Acids Res., vol. 25, p. 3389-3402) can be employed to compare SEQ ID NO: 1 to EST- and genomic sequence databases of avian organisms.
  • the nucleic acid according to the invention is obtainable from an avian organism. More preferred, the nucleic acid is obtainable from an organism selected from the group consisting of chicken, turkey, duck, goose, quail, partridge, pheasant, guinea fowl, ostrich, pigeon, canary, budgerigar, and parrot. Even more preferred the nucleic acid is obtainable from an organism selected from the group consisting of chicken, turkey, duck and goose. In the most preferred embodiment, the nucleic acid according to the invention is obtainable from a chicken.
  • Nucleic acids according to the invention also include nucleic acids having variations in the nucleotide sequence when compared to SEQ ID NO: 1.
  • "Variant" nucleic acids may be natural or non-natural variants. Natural variants include homologues, polymorphic forms and allelic variations between such nucleic acids obtainable from different individuals, races and species of avians. Non-naturally occurring variants may be introduced by mutagenesis.
  • An allelic variant is one of several alternate forms of a gene occupying a locus on a chromosome of an organism. Sometimes, a gene is expressed in a certain tissue as a splicing variant, resulting in an altered 5' or 3' mRNA or the inclusion or exclusion of one or more exon sequences.
  • Nucleic acids encoding a protein according to the invention or a functional fragment thereof can be obtained, manipulated and expressed by standard techniques in molecular biology that are well-known to the skilled artisan, and are explained in great detail in standard textbooks like Sambrook & Russell: "Molecular cloning: a laboratory manual” (2001, Cold Spring Harbour Laboratory Press; ISBN: 0879695773).
  • One such type of manipulation is the synthesis of a cDNA fragment from RNA, preferably from mRNA that is obtainable from an avian organism by techniques known in the art.
  • the invention relates to a cDNA fragment according to the invention.
  • An isolated cDNA sequence may be incomplete due to incomplete transcription from the corresponding mRNA, or clones may be obtained containing fragments of the complete cDNA.
  • Various techniques are known in the art to complete such partial cDNA sequences, such as RACE (rapid amplification of cDNA ends).
  • PCR polymerase chain reaction
  • the invention relates to a recombinant DNA molecule comprising a nucleic acid, or a cDNA fragment according to the invention, the nucleic acid, or the cDNA fragment being functionally linked to a promoter.
  • DNA plasmids are employed. Such plasmids are useful e.g. for enhancing the amount of DNA- insert, as a probe, and as tool for further manipulations. Examples of such plasmids for cloning are plasmids of the pBR, pUC, and pGEM series; all these are available from commercial suppliers.
  • the nucleic acid or the cDNA fragment encoding a protein according to the invention or a functional fragment thereof can be cloned into plasmids and be modified to obtain the desired conformation using techniques well-known in the art.
  • Modifications to the coding sequences encoding a protein according to the invention or a functional fragment thereof may be performed e.g. by using restriction enzyme digestion, by site-directed mutations, or by polymerase chain reaction (PCR) techniques.
  • additional nucleic acids may be added. This may result in the final nucleic acid or cDNA fragment comprised in the recombinant DNA molecule being larger than the sequences required for encoding a GM- CSF protein or a functional fragment thereof.
  • a fusion protein is expressed, comprising a protein according to the invention or a functional fragment thereof.
  • Such fusion proteins are also within the scope of the invention
  • nucleic acid, a cDNA fragment, or a recombinant DNA molecule are operably linked to a transcriptional regulatory sequence such that this is capable of controlling the transcription of a nucleic acid, a cDNA fragment, or recombinant DNA molecule.
  • Transcriptional regulatory sequences are well-known in the art and comprise i.a. promoters and enhancers. It is obvious to those skilled in the art that the choice of a promoter extends to any eukaryotic, prokaryotic or viral promoter capable of directing gene transcription, provided that the promoter is functional in the expression system used.
  • the invention relates to a live recombinant carrier comprising a nucleic acid, a cDNA fragment, or a recombinant DNA molecule according to the invention.
  • a live recombinant carrier is a micro-organism such as e.g. bacteria, parasites and viruses, in which additional genetic information has been cloned, in this case a nucleic acid, a cDNA fragment, or a recombinant DNA molecule, capable of encoding a protein according to the invention or a functional fragment thereof.
  • Target organisms inoculated with such LRC's will produce an immunogenic response not only against the immunogens of the carrier, but also against the heterologous protein(s) or fragments) for which the genetic code is additionally cloned into the LRC, e.g. a nucleic acid encoding a GM-CSF protein or a functional fragment thereof.
  • LRC's As an example of bacterial LRC's, attenuated Salmonella strains known in the art can attractively be used. Alternatively, live recombinant carrier parasites have i.a. been described by Vermeulen, A. N. (1998, Int. Journ. Parasitol., vol. 28, p. 1121-1130). LRC's may be used as a way of transporting a nucleic acid to or into a target cell, so only as a delivery vehicle relying on the cell itself to provide expression. Also an LRC may itself provide expression of the heterologous nucleic acid, in the target organisms, or inside a cell of the target organism. LRC's have several advantages over administration e.g.
  • an LRC with an insert may form a combination vaccine, providing multiple protection in one vaccination.
  • viruses are also called carrier- or vector viruses.
  • Viruses used as vectors are for instance vaccinia-, herpes-, or retroviruses, as well as pox- and myxomaviruses. (For reviews, see theme issue of Meth. Mol. Biol, vol. 246, 2004.)
  • the technique of in vivo homologous recombination can be used to introduce a nucleic acid according to the invention into the genome of an LRC bacterium, parasite or virus of choice, capable of inducing expression of the inserted nucleic acid, cDNA fragment or recombinant DNA molecule according to the invention, in the target organism.
  • the LRC according to the invention is itself an avian pathogen.
  • the strain of the pathogen is one that has attenuated pathogenicity or virulence compared to wild type strains. This attenuated phenotype is present e.g. because the strain used is itself a vaccine strain, or because the insertion of the heterologous nucleic acid disrupts a virulence gene.
  • Preferred pathogens for use as LRC are: Salmonella, Herpes Virus of Turkeys (HVT), Marek's disease virus, infectious laryngotracheitis virus, fowl adenovirus, Fowlpox virus, myxomavirus, or Newcastle disease virus.
  • Each may.comprise a nucleic acid, a cDNA fragment, or a recombinant DNA molecule according to the invention.
  • Most preferred LRC is an HVT viral vector. Methods of introducing a heterologous nucleic acid into a viral vector have e.g. been described for HVT by Sondermeijer, P. et al. (1993, Vaccine, vol. 11 , p. 349-358).
  • the invention relates to a live recombinant carrier according to the invention, comprising HVT.
  • the LRC may also comprise heterologous nucleic acid sequences in addition to those according to the invention, for instance coding for additional cytokines or for an antigen.
  • Preferred additional cytokine-encoding nucleic acid is one encoding the chicken Interleukin 4, for instance as represented by SEQ ID NO: 15 and 16; preferred antigen-encoding nucleic acids are those encoding the nucleoprotein from Infectious bronchitis virus, and the fusion protein from Newcastle disease virus.
  • Bacterial, yeast, fungal, insect, and vertebrate cells are commonly used as host cells for an expression system. Such expression systems are well-known in the art and generally available, e.g. commercially through Invitrogen (the Netherlands).
  • the invention relates to a host cell comprising a nucleic acid, a cDNA fragment, a recombinant DNA molecule, or a live recombinant carrier, all according to the invention.
  • a host cell according to the invention may comprise a nucleic acid, a cDNA fragment, a recombinant DNA molecule, or a live recombinant carrier according to the invention, stably integrated into its genome, or as an extrachromosomal body replicating autonomously.
  • a host cell to be used for expression of a protein according to the invention or a functional fragment thereof may be a cell of bacterial origin, e.g. from Escherichia coli, Bacillus subtilis, Lactobacillus sp. or Caulobacter crescentus, in combination with the use of bacteria-derived plasmids or bacteriophages for expressing the sequence encoding a GM-CSF protein.
  • the host cell may also be of eukaryotic origin, e.g. yeast-cells (e.g. Saccharomyces, Pichia) in combination with yeast-specific vector molecules; insect cells in combination with recombinant baculo-viral vectors e.g.
  • Sf9 and pVL1393 (Luckow et a/.,1988, Bio-technology, vol. 6, p. 47-55); plant cells in combination with e.g. Ti-plasmid based vectors or plant viral vectors (Barton, K.A. et al., 1983, Cell, vol. 32, p. 1033-1043); or mammalian cells also with appropriate vectors or recombinant viruses, such as Hela cells, CHO, CRFK, or BHK cells, or avian cells such as chicken embryo fibroblasts (CEF), HD11 (a chicken macrophage cell line) or DT-40 (a chicken B-lymphocyte cell line).
  • CEF chicken embryo fibroblasts
  • HD11 a chicken macrophage cell line
  • DT-40 a chicken B-lymphocyte cell line
  • Preferred host cell for the invention is an insect cell such as Sf9 or Sf158, comprising a recombinant baculovirus, which insect cell comprises a nucleic acid or cDNA fragment according to the invention inserted behind a baculoviral promoter, such as the polyhedrin or p10 promoter.
  • a baculoviral promoter such as the polyhedrin or p10 promoter.
  • Expression may also be performed in so-called cell-free expression systems.
  • Such systems comprise all essential factors for expression of an appropriate nucleic acid, operably linked to a promoter that will function in that particular system. Examples are the E. coli lysate system (Roche, Basel, Switzerland), or the rabbit reticulocyte lysate system (Promega corp., Madison, USA).
  • a protein according to the invention, or a functional fragment thereof, or a nucleic acid, cDNA fragment, recombinant DNA molecule, live recombinant carrier, and/or a host cell according to the invention for the first time allow the identification of molecules capable of specific binding to these compounds by well-known screening techniques.
  • an avian GMCSF protein or a functional fragment thereof can be used to identify the avian receptor for GM-CSF on target cells.
  • specific antibodies can be generated against a protein according to the invention or a functional fragment thereof. Such antibodies can be used e.g. for therapy, for diagnostics, or for quality assurance purposes.
  • a further aspect of the invention relates to an antibody capable of specific binding to a protein according to the invention, or to a functional fragment thereof.
  • mammalian GM-CSF is known to be beneficial in treatment of neutropenia, allergy, cancer, and infections.
  • avian cytokines other than GM-CSF, for influencing the immunological response of an avian organism.
  • the medical uses of the protein of the invention or a functional fragment thereof have been outlined above: the immunomaturation and/or immunomodulation in avian organisms, by efficient stimulation of avian blood cell proliferation and differentiation, and/or by enhancing, increasing, or otherwise facilitating the quantity and/or quality of an immune response in an avian organism.
  • These can be put to practice in avian veterinary medicine e.g. by administering to an avian organism a protein according to the invention or a functional fragment thereof.
  • a further aspect of the invention relates to the protein according to the invention or a functional fragment thereof, for use as a medicament for an avian organism.
  • the invention also relates in a further aspect, to the use of a protein according to the invention or a functional fragment thereof, for the manufacture of a medicament for influencing the immunological response of an avian organism.
  • the invention relates to a method of influencing the immunological response of an avian organism by administering to an avian organism a protein according to the invention or a functional fragment thereof in a pharmaceutically effective amount and in a pharmaceutically acceptable formulation.
  • a “pharmaceutically effective amount” will be outlined below.
  • a “pharmaceutically acceptable formulation” can e.g. be water, saline, or a buffer suitable for the purpose.
  • the formulation may comprise an emulsion which itself comprises other compounds, such as a cytokine, an adjuvant, an antigen etc.
  • Preferred medical uses for a protein according to the invention or a functional fragment thereof are the induction of immunomaturation and immunomodulation in an avian organism.
  • Immunomaturation can be achieved by administering to an avian organism a protein according to the invention or a functional fragment thereof, which results in efficient proliferation and differentiation of blood cells. This results in an earlier, stronger, more efficient immune response to infection or vaccination, which also is of longer duration. This is caused, besides other effects, by the proliferation of granulocytes, macrophages and dendritic cells, which cause the immune system of the target organism to mature at an enhanced rate compared to untreated organisms. This results in the treated targets to be susceptible to vaccination at an earlier age, or to be better able to cope with infections or disease at an earlier age.
  • immunomaturation by a protein according to the invention or a functional fragment thereof is achieved by administration to chickens in ovo.
  • administration can e.g. be in the form of injection in ovo of a composition comprising the protein of SEQ ID NO: 2 and a pharmaceutically acceptable additive.
  • the invention relates to a composition
  • a composition comprising a protein according to the invention or a functional fragment thereof, in a pharmaceutically acceptable formulation.
  • Immunostimulation is achieved by the immunomaturation above, but preferably by the use of a protein according to the invention or a functional fragment thereof, as an adjuvant.
  • an adjuvant is a substance that boosts the immune response of the target.
  • the choice for a particular adjuvant determines the route of the immune response, and therefore its efficacy.
  • GM-CSF can be used as adjuvant or as additional adjuvant, to steer an immune response towards the Th1 or to the Th2 route.
  • an adjuvant, such as GM-CSF helps to strengthen the immune response upon vaccination, infection or disease.
  • Such use as an adjuvant can be implicit in the use for immunomaturation.
  • cytokines are known to resort their effects in combination with and depending from other factors, the application of a protein according to the invention or a functional fragment thereof, in a context that does not favour immunomaturation, may give rise only to the effect of immunostimulation.
  • Such a context can exists for instance when organisms are treated at an older age, or when a protein according to the invention or a functional fragment thereof, is mixed with other immuno-active compounds that do not favour immunomaturation.
  • a protein according to the invention or a functional fragment thereof can be administered to an avian organism as described above.
  • the use as an adjuvant of a protein according to the invention or a functional fragment thereof is achieved by admixture with an existing vaccine.
  • the protein or the functional fragment can be added to the antigen or to the adjuvant when present; can be added to the water phase or can be emulsified into an oil phase when present.
  • antigens and pharmaceutically acceptable additives can be admixed with the protein according to the invention or the functional fragment.
  • a protein according to the invention or a functional fragment thereof is admixed with a vaccine of a live, live attenuated, or killed avian pathogen.
  • avian pathogen can be of viral, bacterial or parasitic origin.
  • the vaccine antigen can be a whole (killed) organism or an isolated part or fraction.
  • the vaccine can itself be a combination vaccine.
  • the vaccine can comprise an adjuvant.
  • the adjuvant can comprise an additional cytokine.
  • nucleic acid, a cDNA fragment, or a recombinant DNA molecule according to the invention for the purpose of immunomaturation and/or immunostimulation is through DNA vaccination.
  • DNA plasmids carrying a nucleic acid, a cDNA fragment, a recombinant DNA molecule according to the invention can be administered to an avian organism as described above. Such methods are well-known in the art.
  • Nucleic acid vaccines (or gene- or genetic-vaccines as they are called) may require a targetting- or a delivery vehicle other than an LRC to target or protect it, or to assist in its uptake by (the cells of) the host.
  • Such vehicles may be biologic or synthetic, and are for instance virus-like particles, liposomes, or micro-, powder-, or nano particles delivered for instance via a GeneGun®. All these are well-known in the art.
  • a targetting- or delivery vehicle comprising a nucleic acid, a cDNA fragment, or a recombinant DNA molecule according to the invention, is within the scope of the invention.
  • the invention relates in a further aspect, to a nucleic acid, a cDNA fragment, a recombinant DNA molecule, a live recombinant carrier, or a host cell, all according to the invention, for use as a medicament for an avian organism.
  • the invention relates to the use of a nucleic acid, a cDNA fragment, a recombinant DNA molecule, a live recombinant carrier, or a host cell, all according to the invention, for the manufacture of a medicament for influencing the immunological response of an avian organism.
  • the invention relates to a method of influencing the immunological response of an avian organism by administering to an avian organism a nucleic acid, a cDNA fragment, a recombinant DNA molecule, a live recombinant carrier, or a host cell, all according to the invention, in a pharmaceutically effective amount and in a pharmaceutically acceptable formulation.
  • a nucleic acid, a cDNA fragment, a recombinant DNA molecule, a live recombinant carrier, or a host cell, all according to the invention, can advantageously be admixed with an existing vaccine, as described above for a protein according to the invention or a functional fragment thereof.
  • the invention relates in a further aspect to a composition
  • a composition comprising a nucleic acid, a cDNA fragment, a recombinant DNA molecule, a live recombinant carrier, or a host cell, all according to the invention, in a pharmaceutically acceptable formulation.
  • compositions comprising a protein according to the invention or a functional fragment thereof
  • a composition comprising a nucleic acid, a cDNA fragment, a recombinant DNA molecule, a live recombinant carrier, or a host cell, all according to the invention, can be admixed with antigen, adjuvant, cytokine, vaccine, etc.
  • the invention relates to an adjuvant composition
  • an adjuvant composition comprising a protein according to the invention or a functional fragment thereof, or a nucleic acid, a cDNA fragment, a recombinant DNA molecule, a live recombinant carrier, or a host cell, all according to the invention.
  • composition according to the invention can advantageously be combined with a pharmaceutical component such as an antibiotic, a hormone, or an anti-inflammatory drug.
  • a composition according to the invention can equally be used as prophylactic and as therapeutic treatment, to achieve immunomaturation and/or immunostimulation. This way it interferes with establishment and/or with the progression of an infection, with the progression of clinical symptoms of a disease, or with the efficacy of a vaccination.
  • a composition according to the invention can be administered to a target according to methods known in the art, depending on characteristics of the target species, characteristics of the composition itself, desired effects, and economy of application.
  • Application methods comprise application e.g. parenterally, comprising all routes of injection into or through the skin: e.g. intramuscular, intravenous, intraperitoneal, intradermal, submucosal, or subcutaneous.
  • ⁇ may be applied by topical application as a drop, spray, gel or ointment to the mucosal epithelium of the eye, nose, mouth, anus, or vagina, or onto the epidermis of the outer skin at any part of the body.
  • Other possible routes of application are by spray, aerosol, or powder application through inhalation via the respiratory tract. In this case the particle size that is used will determine how deep the particles will penetrate into the respiratory tract.
  • application can be via the alimentary route, by combining with the feed or drinking water e.g. as a powder, a liquid, or tablet, or by administration directly into the mouth as a liquid, a gel, a tablet, or a capsule, or to the anus as a suppository.
  • a composition according to the invention may take any form that is suitable for veterinary administration, and that matches the desired route of application and desired effect. Preparation of a composition according to the invention is carried out by means conventional for the skilled person. Preferably the composition according to the invention is formulated in a form suitable for injection such as a suspension, solution, dispersion, emulsion, and the like. Commonly such compositions are prepared sterile.
  • the dosing scheme of the application of a composition according to the invention to the target organism can be in single or multiple doses, which may be given at the same time or sequentially, in a manner compatible with the dosage and formulation, and in such an amount as will be immunologically effective. It is well within the capacity of the skilled person to determine whether a treatment is
  • a target organism for the invention is an organism of the class Aves.
  • Preferred target organisms are selected from the group consisting of chicken, turkey, duck, goose, quail, partridge, pheasant, guinea fowl, ostrich, pigeon, canary, budgerigar, and parrot. More preferred target organisms are selected from the group consisting of chicken, turkey, duck and goose. Most preferred target organism is chicken.
  • the target organism may be healthy or diseased.
  • the target may be of either sex, and of any age, even premature.
  • Preferred target for administration of a composition according to the invention is the fertilized avian egg. In ovo vaccinations are normally deposited into the amniotic cavity or into the embryo in the fertilized egg. For chickens a much used time of in ovo application is at about 18 days of age i.e. about 3 days before hatch.
  • a stabilizer can be added to a composition according to the invention e.g. to protect it from degradation, to enhance the shelf-life, or to improve freeze-drying efficiency.
  • Useful stabilizers are i.a. SPGA (Bovarnik etal., 1950, J. Bacteriology, vol. 59, p. 509), skimmed milk, gelatine, bovine serum albumin, carbohydrates e.g. sorbitol, mannitol, trehalose, starch, sucrose, dextran or glucose, proteins such as albumin or casein or degradation products thereof, and buffers, such as alkali metal phosphates.
  • compositions according to the invention are also within the scope of the invention.
  • composition according to the invention may be freeze-dried. In general this will enable prolonged storage at temperatures above zero ° C, e.g. at 4°C. Procedures for freeze-drying are known to persons skilled in the art; equipment for freeze-drying at different scales is available commercially. Therefore, in a preferred embodiment, a composition according to the invention is characterised in that the composition is in a freeze-dried form.
  • a freeze-dried composition it may be suspended in a physiologically acceptable diluent.
  • a physiologically acceptable diluent can e.g. be as simple as sterile water, or a physiological salt solution.
  • a diluent can e.g. be as simple as sterile water, or a physiological salt solution.
  • an emulsion e.g. as outlined in PCT/EP99/10178.
  • a preferred amount of a protein according to the invention or a functional fragment thereof, comprised in a composition according to the invention is between 1 ng and 1 mg.
  • the amount is between 10 ng and 100 ⁇ g/dose, more preferably between 100 ng and 10 ⁇ g/dose.
  • the amount is between 10 ng and 10 ⁇ g/dose.
  • a preferred amount of a live recombinant carrier according to the invention, comprised in a composition according to the invention, is dependent on the characteristics of the carrier microorganism used. Such an amount is expressed for instance as plaque forming units (pfu), colony forming units (cfu) or tissue culture infective dose 50% (TCID 50 ), depending on what is a convenient way of quantifying the LRC organism. For instance for a live viral vector a dose rate between 1 and 10 10 plaque forming units (pfu) may advantageously be used; preferably a dose rate between 10 and 10 5 pfu per animal.
  • a preferred amount of a host cell according to the invention, comprised in a composition according to the invention is between 1 and 10 9 host cells per dose. Preferably between 10 and 10 7 cells per dose are used.
  • Example 1 Isolation of Chicken GM-CSF cDNAfrom HD11 cells
  • the chicken macrophage-like cell-line HD11 (Beug, H. etal., Cell, vol. 18, p. 375-390) was cultured in RPM1 1640 (Sigma), containing 10 % v/v tryptose phosphate broth, 2.5 % v/v heat-inactivated foetal calf serum, 2.5 % v/v heat-inactivated chick serum (Invitrogen), 20 mM L-glutamine, 1U/ml penicillin and 1 ⁇ g/ml streptomycin, at 41 °C in a humidified incubator with 5% CO 2 environment. The cells were passaged every 3-4 days using trypsin.
  • HD11 cells were stimulated with lipopolysaccharide (LPS) as follows: at 75-80 % confluence,
  • HD11 cells in a T75 flask were incubated with LPS (serotype E. coli O55:B5, Sigma) for 3 hours. Thereafter cells were washed, trypsinised, centrifuged and used for RNA isolation, using an RNeasy® mini kit (Qiagen), following the manufacturer's instructions. Next, chicken GM-CSF cDNA was made by RT-PCR: 39 ⁇ l of DEPC treated water was added to Ready-To-Go® RT-beads (Amersham Biosciences) and incubated for 5 minutes on ice. Primers used were
  • GMC/1 5' - ATGCTGGCCCAGCTCACTATTC - 3' (SEQ ID NO: 3), and
  • GMC/4 5' - CAGTTGCAGTAGAGTTATTTCCTG - 3' (SEQ ID NO: 4), Each primer was added at 5 ⁇ l of 4 pM/ ⁇ l, to 1 ⁇ l of RNA (obtained as described above), and an RT-PCR program was run: 1 cycle of 42°C for 30 min, followed by 95°C for 5 min. Subsequently 30 cycles were run with 1 min 95°C; 2 min 55°C; and 2 min 72°Cper cycle.
  • the sequencing reactions were precipitated using 0.3 M final concentration Sodium acetate and glycogen, and sequenced on a CEQ 8000 capillary sequencer (Beckman Coulter).
  • the sequencing result revealed the sequence of chicken GM-CSF cDNA, as represented in SEQ ID NO:1.
  • the amino acid sequence of GM-CSF as represented in SEQ ID NO: 2 was obtained by translation of SEQ ID NO: 1 via 'Translate', a computer program from the GCG/Wisconsin suite of molecular biology analysis programs.
  • the PCR product from the second round of PCR as outlined in Example 1 was TA cloned into pGEM®-T easy vector (Promega), by following the manufacturer's protocol. Next 4 ⁇ l of ligation reaction were used to transform competent DH5- ⁇ E. coli bacterial cells by heat shock, the cells were plated out onto LB plates with 100 ⁇ g/ml Ampicillin (LB Amp-mo plates), and incubated overnight (o/n) at 37 °C. Resulting colonies were picked and plasmid DNA prepared using QIAprep® miniprep kit (Qiagen). Plasmid obtained was pGTChGMCSF.
  • Isolated plasmids were digested with EcoRI to excise the insert, which was separated on an agarose gel, cut out and isolated using a QIAquick® gel extraction kit.
  • the insert was ligated into shrimp-alkaline phosphatase-treated and EcoRI digested pClneo vector
  • T4 DNA ligase (Promega) using T4 DNA ligase (Invitrogen). Two ⁇ l of the ligation reaction were used to transform competent DH5-alpha E. coli cells, by heat-shock treatment. Cells were again plated onto LB-Amp 10 o plates, and incubated o/n. Resulting colonies were picked and plasmid DNA prepared using the miniprep kit. Miniprep plasmid samples were screened by restriction digest and analysis on agarose gel, to identify clones containing the GM-CSF cDNA insert. A positive plasmid was again sequenced to confirm the correctness of the insert.
  • GM-CSF mRNA expression in chicken cells and tissues was quantitated using a well described method of real-time quantitative RT-PCR analysis (see: Kaiser, P. et al., 2002, J. Immunol., vol. 168, p. 4216-4220; and Kaiser, P. et al., 2003, J. Virol., vol. 77, p. 762-768).
  • Probes used for GM-CSF and 28S RNA-specific amplification are presented in Table 1.
  • Real-time quantitative RT-PCR was performed using the Reverse Transcriptase qPCR Master Mix RT-PCR kit® (Eurogentec, Belgium).
  • Amplification and detection of specific products were performed using the ABI PRISM 7700® Sequence Detection System (PE Applied Biosystems) with the following cycle profile: one cycle of [50°C for 2 min, 96°C for 5 min, 60°C for 30 min, and 95°C for 5 min], and 40 cycles of [94°C for 20 sec, 59°C for 1 min]. Quantification was based on the increased fluorescence detected due to hydrolysis of the target-specific probes by the 5'-exonuclease activity of the rTth DNA polymerase during PCR amplification.
  • the passive reference dye 6-carboxy- ⁇ -rhodamine which is not involved in amplification, was used for normalization of the reporter signal.
  • Results are expressed in terms of the threshold cycle value (C t ), the cycle at which the change in the reporter dye passes a significance threshold ( ⁇ Rescu).
  • C t threshold cycle value
  • the values for cytokine- specific product for each sample were standardised using the C t value of 28S rRNA product for the same sample from the reaction run simultaneously.
  • the mean C t value for 28S rRNA-specific product was calculated by pooling values from all samples in that experiment. Tube to tube variations in 28S rRNA C t values about the experimental mean were calculated. The slope of the 28S rRNA logio dilution series regression line was used to calculate differences in input of total RNA.
  • Tissues tested were: 1, spleen; 2, thymus; 3, bursa of Fabricius; 4, caecal tonsil; 5, bone marrow; 6, liver; 7, kidney; 8, lung; 9, brain; 10, heart; 11, muscle.
  • Stimulated lymphocytes tested were: 12, splenocytes stimulated with ConA; 13, thymocytes stimulated with PHA; 14, bursal cells stimulated with PMAand ionomycin; 15, LPS-stimulated monocyte/macrophages; 16, LPS-stimulated HD11 cells. Lymphocyte cells were stimulated as described herein. These results show Ch GM-CSF mRNA is expressed in mitogen-activated chicken splenocytes, bursal cells, and HD11 cells. The expression of Ch GM-CSF mRNA in non- lymphoid tissues was detected in lung and heart.
  • COS cells (african green monkey kidney cells) were routinely grown to 75 - 90% confluency in T75 (at 7.5 x 10 5 cells/flask) or T175 (2.5 x 10 6 cells/flask) culture flasks, passaged twice a week by trypsinisation, and incubated at 37 °C at 5% CO 2 .
  • Medium used was DMEM, with 2 mM L- Glutamine, 1 U/ml penicillin, 1 ⁇ g/ml streptomycin, and 1% v/v non-essential amino" acids (from 100 x stock, Invitrogen). The medium is normally supplemented with 10 % v/v foetal calf serum.
  • the cell layers were incubated with a mixture in serum-free medium (5 ml/T25; 15 ml/T75), containing 37.5 ⁇ g plasmid DNA, 50 ⁇ l chloroquine (stock solution 5.16 mg/ml (10 M) - final concentration 0.1 mM), and 30 ⁇ l DEAE/dextran (stock solution100 mg/ml - final concentration 600 ⁇ g/ml). Plasmid DNA samples used were of pClneoChGMCSF and appropriate controls. The transfection mixture was incubated on the cells for 3 - 3.5 hours at 37°C/5% CO 2 .
  • Example 5 Isolation, subcloninq and expression of Ch IL-4:
  • Chicken splenocytes were isolated by teasing apart the spleen in DMEM (Sigma) to release a single cell suspension.
  • the single cell suspension was layered over Ficoll Paque (density 1077) (Amersham Biosciences) and centrifuged at 1000 xg, for 20 min at room temperature.
  • the lymphocytes were collected from the interface and were washed in DMEM supplemented with 2 mg/ml bovine serum albumin (BSA, Sigma), 20 mM L-glutamine, 1 U/ml pencillin and 1 ⁇ g/ml streptomycin in DMEM/BSA.
  • BSA bovine serum albumin
  • Splenocytes were resuspended at 5x10 6 cells/ml in DMEM/BSA and cultured (30 ml cell suspension per T75 flask), in the presence of 1 ⁇ g/ml ConA (Sigma) for 24 h at 41 °C, 5% CO 2 . Cells were harvested from the flask and pelleted by centrifugation (450 xg for 10 min). RNA was isolated from the cells using an RNeasy mini kit ( QIAGEN) following the manufacturer's instructions.
  • a second round of PCR amplification was carried out using 23 ⁇ l water, 8 ⁇ l of RT-PCR product, 20 pmol of each primer (at 4 pmol/ ⁇ l), 5 ⁇ l of 10x PCR buffer (Invitrogen), 1.5 ⁇ l MgCI 2 (50 mM), 2 ⁇ l dNTPs (10 mM each) and 0.5 ⁇ l Taq polymerase (Invitrogen). Again 40 cycles of [94 °C for 1 min, 50°C for 2 min, 72°C for 2 min] per cycle were run. A sample from the second round of amplification was visualized after electrophoresis on an agarose gel under standard conditions. Amongst several other bands, a band of 470 bp was visible.
  • the entire PCR product was then run on an agarose gel and the 470 bp band was excised and the cDNA extracted using a QIAquick® gel extraction kit (Qiagen).
  • the IL-4 PCR product was TA-cloned into pGEM- T Easy® vector (Promega) and transformed into competent JM 109 E. coli cells (Promega) following the manufacturer's protocol. Cells were plated onto LB Amp 10 o plates and incubated overnight at 37°C. Resulting colonies were picked, and plasmid DNA prepared Using a QIAprep® Spin miniprep kit (Qiagen). Plasmids were digested with Notl and tested on agarose gels, to screen for presence of inserts. Those colonies containing an insert were then sequenced with vector specific commercial primers:
  • SP6 5'-TACTCAAGCTATGCATCC -3'. SEQ ID NO: 14.
  • the plasmid inserts were sequenced by each sequencing reaction contained 1 ⁇ l of plasmid DNA, 4 pmol of primer and 2 ⁇ l of Quickstart® mix (Beckman Coulter) in water to a 20 ⁇ l reaction volume.
  • the cycle conditions were: 96°C for 2 min, followed by 30 cycles of [96°, 20 sec; 50°C, 20 sec; 60°C, 4 min].
  • the sequencing reaction was precipitated and sequenced as described herein.
  • the results obtained revealed the sequence of cDNA of chicken IL-4 cDNA, which is disclosed herein as SEQ ID NO: 15.
  • the encoded Ch IL-4 protein, disclosed as SEQ ID NO: 16 was predicted by computer translation.
  • Ch IL-4 cDNA was sub-cloned into pClneo plasmid (Promega) by releasing the insert from the pGEM-T Easy vector with a Notl digest under standard conditions and separating the insert on an agarose gel. It was then purified from the agarose using a QIAquick gel extraction kit (Qiagen). The insert was ligated into Notl digested, shrimp- alkaline phosphatase-treated pClneo vector using T4 DNA ligase (Invitrogen). Two ⁇ l of the ligation reaction were used to transform competent DH5-alpha E. coli cells by heat shock treatment.
  • Recombinant Ch IL-4 was produced by transfecting COS cells with this plasmid DNA, following the procedure as outlined in Example 4 exactly.
  • Example 6 Differentiation of chicken monocvtes to dendritic cells with Ch GM-CSF and Ch lL-4
  • PBMC periferal blood mononuclear cells
  • the blood was mixed at a 1:1 ratio with ice cold 1 % methylcellulose (Sigma) to sediment red blood cells, centrifuged 55 xg for 30 min at 4°C, and serum supernatant was collected.
  • Serum was diluted with ice- cold Hank's balanced salt solution (HBSS) w/o calcium or magnesium, in a 1:1 ratio. 20 ml samples of serum/HBSS were centrifuged in 50 ml conical tubes underlayed with 20 ml of Histopaque 1.077 (Sigma).
  • HBSS Hank's balanced salt solution
  • Isolated white blood cells were washed twice in ice-cold HBSS w/o Ca or Mg at 1000 rpm for 10 min in ice-cold R5 medium (RPMI medium with 5% FCS, 1 U/ml penicillin, 1 ⁇ g/ml streptomycin and 25 U/ml nystatin.
  • B- and T-lymphocytes were depleted from the mononuclear white blood cell population by incubating with a B-lymphocyte specific monoclonal antibody (moab): mouse-anti chicken Bu1 (Southern Biotech), and a T- lymphocyte specific moab: mouse anti-chicken CD3 (Southern Biotech). Both incubations were done sequentially, with the cells at 2x10 7 /ml in ice-cold PBS/BSAfor 30 min. In between cells were washed twice in PBS/BSA.
  • ab mouse-anti chicken Bu1 (Southern Biotech)
  • T- lymphocyte specific moab mouse anti-chicken CD3
  • the cells were resuspended in 90 ⁇ l of PBS/BSA with 10 ⁇ l of goat anti-mouse IgG coated on magnetic microbeads® (Miltenyi Biotec) per 10 7 cells. This mixture was incubated for 30 min on ice, washed twice in ice-cold PBS/BSA, and cells were resuspended to 10 6 cells/ml in cold R5 medium (supra). Three ml of cell suspension was aliquotted into each well of a 6-well plate. A sample containing different dilutions of supernatant containing chicken GM-CSF or IL-4 from transfected COS cells (Experiments 4 and 5 respectively) was added to the wells, or appropriate control samples. This was incubated for 3 days at 41 °C, after which the adherent and non-adherent cells were collected by scraping with cell disassociation medium (Sigma) and washing in PBS.
  • cell disassociation medium Sigma
  • Resulting differentiated dendritic cell were visualized and photographed unstained, using a digital camera (Nikon E4500) attached to an inverted light microscope, and photographed with a digital camera. Results are presented in Figure 5; dilutions refer to the final dilution of each cytokine (expressed from COS cells) as used on the PBMC culture. From these results it is clear PBMC's differentiate into dendritic cells upon incubation with GM-CSF and IL-4.
  • Example 7 Cloning of GM-CSF cDNA into a baculovirus vector
  • GM-CSF plasmid pGTChGMCSF (Example 2). This was modified by PCR cloning, so that the GM-CSF cDNA contained at its 5' end a Notl restriction site and a Kozak sequence preceding the startcodon, and at its 3' end instead of the stopcodon a 6x Histidine tag fused to the reading frame of GM-CSF, followed by a stopcodon and an Xbal restriction site.
  • GM-CSF Notl/Kozak 5'- TGCGGCCGCCACCATGCTGGCCCAGCTCACTAT -3' (SEQ ID NO: 17)
  • GM-CSF His/Xbal 5'- GTCTAGATTAGTGATGGTGATGGTGATGGATGGATGCAGTCTTTCTCCTCT -3' (SEQ ID NO: 18)
  • PCR products were gel-purified using the Qiaquick GelExtraction kit (Qiagen) and ligated into the pCR2.1-TOPO® vector (TA Cloning kit, Invitrogen). Plasmid DNA was purified using the Plasmid Midi kit (Qiagen). All clones were sequenced from both 5' and 3' directions using a DNA sequencing kit(BigDye® Terminator V3.0 Cycle Sequencing Ready Reaction, Applied Biosystems) and suitable sequencing primers, according to the manufacturers' instructions. Sequences were analyzed with Sequencher® 4.0 software (Gene Codes Corporation).
  • Sequence analysis confirmed a 471 nt fragment comprising a Not-GM-CSF-His-Xba insert of the correct sequence had been inserted into plasmid vector, named pNGHX. Subsequently, the Not-GM-CSF-His-Xba insert was subcloned from pNGHX into pFastbad® (Invitrogen). For this purpose, the 471 nt insert was excised using Notl and Xbal restriction enzymes, purified using Qiaquick GelExtraction kit and ligated into pFastBacl vector that had been digested with Notl and Xbal.
  • Example 8 Expression of Ch GM-CSF in the baculovirus expression vector system
  • plasmid pFBNGHX recombinant baculovirus was constructed using the Bac-to-bac system (Invitrogen) according to the manufacturers' instructions. Briefly: plasmid pFBNGHX was transfected into DHIOBac® E. coli cells by heatshock, and plated in several dilutions on LB agar plates containing 3 antibiotics, Bluo-gal and IPTG. These plates were incubated at 37 °C for 48 hrs. White colonies were picked and replated and re-incubated for 48 hours. 6 white colonies were picked, and bacmid DNA was isolated by miniprep isolation. These constructs were checked by PCR using recommended primers. All 6 turned out to be correct.
  • Purified bacmid DNA of two correct clones was transfected into Sf9 cells, using Cellfectin® (Invitrogen) according to the manufacterers' instructions.
  • Sf9 insect cell culture was performed in SF900 II® medium (Invitrogen) with pimafucine and gentamycin, at 27 °C for 5 days.
  • the supernatant of these cultures contained recombinant baculovirus vBacChGM-CSF-His, which was stored at 4°C until further use.
  • the cells from this transfection were used to detect expression of the GM-CSF-His insert, by immuno- fluorescence staining with a monoclonal mouse antibody directed against penta-His tag (Qiagen) as recommended. Positive fluorescence was detected in a majority of the cells of both bacmid transfections.
  • Example 9 Western blot of insect-cell expressed GM-CSF Sf9 cells in two T175 flasks were infected each with an individual clone of recombinant baculovirus vBacChGM-CSF-His comprising the His-tagged chicken GM-CSF cDNA (as obtained in Experiment 7), at an moi of 0.1 , and cultured for 3-5 days. Cells were pipetted off the flask, and pelleted by centrifugation. Pelleted cells were resuspended in 1/10 of the original cell culture volume.
  • Samples of 9 ⁇ l of the cell suspension of each of the two rec virus cultures were size fractionated by elecfrophoresis on 4-12% Nu-PAGE (Invitrogen).
  • As controls were used: a cell suspension of Sf9 cells that had been infected with an empty pFastBacl vector; and 10 ⁇ l of purified His-tagged chicken IL-6 (ChlL-6-His) were used. His- tagged Ch-IL6 was expressed in E. coli, and purified over Ni-agarose, as outlined by Schneider etal. (2001, Eur. J. Biochem., vol. 268, p. 4200-4206). The protein marker was the Kaleidoscope® Prestained Standard (Biorad) at 10 ⁇ l/lane.
  • the proteins were blotted from the gel onto a nitrocellulose filter (Schleicher & Schuell) using a semi-dry blotting apparatus (BioRad).
  • the blotted membrane was blocked in 3% skimmed milk in PBS (MPBS) and subsequently incubated with a monoclonal mouse anti-penta-His antibody (Qiagen) diluted 1:500 in MPBS. After extensive washing, the blot was incubated with alkaline phosphatase (AP)-conjugated goat anti-mouse IgG (H+L) antibodies (KPL) diluted 1:500 in MPBS. After washing, bound AP-labelled secondary antibodies were visualized via staining with BCIP/NBT.
  • Plasmid transfer vectors comprising GM-CSF were constructed from plasmid pNGHX, which comprised a 471 nt Not-GM-CSF-His-Xba insert in a pCR2.1-TOPO® vector.
  • plasmid pNGHX which comprised a 471 nt Not-GM-CSF-His-Xba insert in a pCR2.1-TOPO® vector.
  • two specific primers with integrated Bglll endonuclease restriction sites (underlined) were used:
  • HVT-fwd 5'- GATCAGATCTATGCTGGCCCAGCTCACTAT -3' SEQ ID NO: 19
  • HVT-rev 5'- GATCAGATCTTTAGATGCAGTCTTTCTCCTC -3' SEQ ID NO: 20
  • telomere transfer vectors as described (Sondermeijer, P. et al., 1993, Vaccine, vol. 11, p. 349-358).
  • the resulting plasmids each contain a different promoter to control expression of GM-CSF: the gB-promoter of pseudorabies virus and the LTR-promoter of Rous Sarcoma virus (RSV), respectively for pVEC165 and pVEC166.
  • the pVEC165 and pVEC166 transfer vectors were used to recombine the promoter- GM-CSF inserts into the genome of HVT.
  • Plasmids were linearised with an appropriate restriction enzyme and then co-transfected with HVT viral DNA to CEF cells, by calcium- phosphate precipitation transfection, as described. After DNA had entered the cells, recombination occurred between sequences in the US10 region of the HVT genome and homologous flanking regions in the transfer vector, thereby integrating the promoter-GM-CSF insert into the viral genome. Supernatant from CEF cell-cultures transfected rec HVT obtained from pVEC165 (gB promoter-GM-CSF ), was used to induce proliferation of chicken bone marrow cells, see Example 11 and Figure 8.
  • Recombinant viral plaques that have developed after transfection will be amplified once on CEF and checked for the presence and percentage of recombinant HVT in an immunofluorescence assay and by hybridizing filter-lifts of infected monolayers with labelled DNA probes hybridizing to the promoter region.
  • the recombinant virus will be purified by plaque isolation. Dishes with infected CEF will be overlaid with agarose in culture medium once plaques have developed. Several plaques will be picked randomly and passaged three times in CEF before harvesting and storage as cell associated preparations. Plaques transferred from infected CEF monolayers to nitrocellulose membranes will be hybridized with 3 P-labeled DNA probes
  • Example 11 Assay for bone marrow cell proliferation by GM-CSF
  • BM cell clumps were brought into a single cell suspension using an 100 ⁇ m mesh nylon gauze cell harvester (Falcon) and a 5 ml syringe with a 21 GA needle.
  • the BM cell suspension was centrifuged at room temperature for 10 min at 323 xg, washed with HBSS+ medium, centrifuged again and finally resuspended at a concentration of 5x10 6 cells/ml in RPMI-10 medium (RPMI-1640 medium supplemented with 5% FCS, 5% chicken serum (Gibco), 100 ⁇ g/ml streptomycin, 100 U/ml penicillin, 2 mM L-glutamine, 1 mM pyruvate in 20 mM HEPES buffer containing as mitogen LPS (Sigma) in a concentration range 30 ⁇ g/ml - 1 ng/ml.
  • BM cells were seeded in triplicate in a 96-well plate at a density of 0.5 x 10 6 cells/well (in 100 ⁇ l). To each well containing BM cells was added 25 ⁇ l of serial dilutions of culture supernatant either obtained from:
  • Example 12 Assay for induction of colony formation by GM-CSF
  • Chicken BM cells will be obtained as described in Example 11, and added in a density of 7.5x10 4 /ml to warm RPMI-10/0.5% agarose (41 °C).
  • Other suitable solidifiers may be used, for instance Na-methylcellulose.
  • the medium will also contain a mitogen, for instance: LPS, PMA, PHA, ConA or any other suitable mitogen, in a concentration range between 0.1 ⁇ g/ml and 50 ⁇ g/ml. All these are available commercially.
  • One millilitre aliquots will then quickly be pipetted into six-well plates already containing 150 ⁇ l of undiluted cell culture supernatant from GM-CSF transfected COS-7 cells (Example 2).
  • the medium will be left at room temperature for 10 - 20 min. to solidify, after which the plates will be incubated at 37°C/5% CO 2 for 10-14 days. Using a dissecting microscope, colonies of cells that have formed in the agarose will be studied. This will demonstrate the capacity of GM-CSF to induce proliferation.
  • the plates will be stained to increase the visibility by incubation with 0.5 ml of 0.005% Crystal Violet in culture medium for ⁇ 1 h.
  • Example 3 Nitric oxide (NO)- assay for demonstration of induction of IFN-y by GM-CSF
  • Chicken primary spleen cells splenocytes
  • Splenocytes will be seeded in triplicate in a 96-well plate at a density of 0.5 x 10 6 cells/well in 100 ⁇ l and incubated with 50 ⁇ l of serial dilutions of cell culture supernatants from COS-7 cells transfected with GM-CSF (Example 2). After incubation with the COS cell supernatant, splenocyte supernatants (75 ⁇ l) will be collected and analyzed for the presence of biologically active Ch IFN ⁇ y, via the NO assay.
  • NO Nitric oxide
  • HD11 cells For this purpose, 100 ⁇ l of 1.5 x 10 6 /ml HD11 cells will be incubated with 75 ⁇ l splenocyte supernatant for 24 h at 37°C/5% CO 2 in 96-well plates. Activation of HD11 cells by Ch IFN ⁇ y will than be measured spectrophoto-metrically as a function of nitric oxide accumulation in the culture supernatants using the Griess assay. See for references: Ding, A, etal., (1988, J. Immunol., vol. 141, p. 2407-2412), and Stuehr, D. J., & Nathan, C.F. (1989, J. Exp. Med., vol. 169, p. 1543-1555).
  • Example 14 Vaccination with recHVT carrying GM-CSF
  • the HVT inoculation in some groups of vaccinated chicks, or chicks from vaccinated eggs will be combined with an antigen inducing a detectable serologic response, such as Clostridium perfringens ⁇ -toxoid, or an inactivated poultry vaccine, such as a vaccine against NDV, IBDV, or avian Influenza.
  • a detectable serologic response such as Clostridium perfringens ⁇ -toxoid
  • an inactivated poultry vaccine such as a vaccine against NDV, IBDV, or avian Influenza.
  • the effect of GM-CSF on the cellular immune response will be assessed by challenge-protection trial, wherein some groups of HVT-GM-CSF inoculated chicks/eggs, will also receive a live vaccine against for instance ILT, or avipox.
  • This additional vaccination is applied either simultaneous or shortly after the HVT inoculation, to be determined by the characteristics of the vaccine. Subsequently, subgroups of vaccinated chicks will be challenged at various times post vaccination, e.g. after 1 -4 weeks.
  • the results of these trials will be monitored by determining the level and kinetics of the development of specific antibodies, and the clinical symptoms and virus re-isolations after challenge. The outcome will show an earlier, stronger, and longer lasting immune response induced by GM-CSF, when compared to chickens not receiving GM-CSF.
  • Example 15 Use of Ch GM-CSF in an HVT vector as an immune enhancer in ovo:
  • HVT vector constructs carrying the Ch GM-CSF gene were obtained as outlined in Example 10; in one viral vector construct the Ch GM-CSF gene was inserted behind the PRV gB promoter (HVT-ChGMCSF165), in the other it was behind the RSV LTR promoter (HVT-ChGMCSF166).
  • the gB promoter is somewhat weaker relative to the LTR promoter.
  • HVTChGMCSF165-R5 HVTChGMCSF165-R5
  • HVTChGMCSF166-T19 HVTChGMCSF166-T19
  • a control HVT inoculation in ovo also 3000 pfu, from a stock at 0.8 x 10 6 .
  • the HVT-PB1 virus used was the vaccine strain of HVT from which the two recombinant constructs had been derived. This PB1 strain does not carry any recombinant insert. After hatch, all chickens were individually marked. At the age of 7 days post hatch the chickens were challenged by aerosol inoculation.
  • Ch GM-CSF is effective in enhancing resistance of the newborn chick to a pathogenic infection.
  • Chicken GM-CSF administration in ovo reduces the signs of pathology and disease relative to groups receiving sham in ovo inoculation.
  • the construct wherein Ch GM-CSF was inserted behind the stronger LTR promoter was even more effective than the construct comprising the relatively weaker gB promoter.
  • the pathology observed was caused by E. coli APEC-1 infection, not by NDV infection alone.
  • Ch GM-CSF is effective in enhancing an avian's immune response. This can advantageously be applied at very young age, even prematurely. LEGEND TO THE FIGURES
  • Figure 2 Table of pair-wise alignment results of known GM-CSF amino acid sequences and Chicken GM-CSF. Amino acid sequences were the same as those used for Figure 1. Alignment program used was BlastP, using standard parameters. Percentages indicated are the % positives.
  • Figure 3 Phylogenetic tree representing the level of similarity between all known GM-CSF amino acid sequences and Chicken GM-CSF. Program used was Phylip, on the data from the ClustalX analysis performed for Figure 1. The distance of the scale bar represents 0.1 amino acid substitution per site.
  • FIG. 5 In vitro differentiation of chicken monocytes to dendritic cells by GM-CSF and IL-4.
  • Chicken PBMC were incubated with Ch IL-4 and Ch GM-CSF expressed in supernatant of transfected cell cultures. Scanned photographs from 6 well plates are presented.
  • FIG. 6 Expression patterns determined by quantitative RT-PCR of GM-CSF mRNA in various chicken tissues and stimulated lymphoid cells. Measurement results of real-time quantitative RT-PCR, are expressed as 40-Ct values. Significance intervals are indicated. Tissues: 1, spleen; 2, thymus; 3, bursa of Fabricius; 4, caecal tonsil; 5, bone marrow; 6, liver; 7, kidney; 8, lung; 9, brain; 10, heart; 11, muscle.
  • Stimulated lymphocytes 12, splenocytes stimulated with ConA; 13, thymocytes stimulated with PHA; 14, bursal cells stimulated with PMA and ionomycin; 15, LPS-stimulated monocyte/macrophages; 16, LPS-stimulated HD11 cells.
  • Figure 7 Western blot of chicken GM-CSF expressed in the baculovirus expression vector system.
  • Molecular weights are indicated from a weight marker lane which is not shown.
  • FIG. 8 Bone marrow proliferation assay Chicken bone marrow cells were induced to proliferate by Ch GM-CSF expressed into the supernatant of transfected COS cells and into supernatant from rec HVT infected CEF cells. Horizontal axis: supernatant sample dilutions; Vertical axis: cpm incorporated 3 H- Thymidine. For panels A and C the standard deviation is indicated.
  • Panels A: Supernatant from plasmid transfected COS cell culture on BM cells; BM cells stimulated with LPS at 10 ⁇ g/ml .
  • GM-CSF supernatant sample comprising GM-CSF, either from COS cells transfected with pClneo plasmid carrying GM-CSF insert (panels A, B), or from CEF transfected with HVT-carrying GM-CSF insert (panels C, D).
  • mock supernatant sample of COS cells transfected with a pClneo plasmid without insert (panels A, B), or from CEF transfected with rec HVT without insert (panel C, D).
  • medium plain BM cell culture medium.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne le domaine de l'immunologie vétérinaire, soit des cytokines aviaires, plus précisément le facteur stimulant de colonies de macrophages granulocytes aviaire (GM-CSF). Plus précisément, l'invention concerne une protéine ou un fragment fonctionnel de celle-ci possédant au moins une des activités biologiques du GM-CSF aviaire, ainsi qu'un acide nucléique codant de telle protéine ou tel fragment. L'invention concerne également une molécule d'ADN recombinante, un excipient recombinant vivant ou une cellule hôte. L'invention concerne enfin l'utilisation de celle-ci comme médicament et des compositions renfermant une telle protéine ou un tel fragment ou un acide nucléique codant une telle protéine ou un tel fragment.
PCT/EP2005/051759 2004-04-20 2005-04-20 Gm-csf aviaire WO2005103078A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP04101623.9 2004-04-20
EP04101623 2004-04-20

Publications (1)

Publication Number Publication Date
WO2005103078A1 true WO2005103078A1 (fr) 2005-11-03

Family

ID=34928984

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2005/051759 WO2005103078A1 (fr) 2004-04-20 2005-04-20 Gm-csf aviaire

Country Status (1)

Country Link
WO (1) WO2005103078A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022261554A1 (fr) * 2021-06-11 2022-12-15 Auburn University Vecteurs recombinants du virus de la maladie de newcastle (rndv) et leurs méthodes d'utilisation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002102404A1 (fr) * 2001-06-18 2002-12-27 Institut National De La Recherche Agronomique Utilisations de cytokines

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002102404A1 (fr) * 2001-06-18 2002-12-27 Institut National De La Recherche Agronomique Utilisations de cytokines

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL 8 August 2003 (2003-08-08), WITTZELL H. ET AL.: "phan105_g08 PHA-activated spenocytes Gallus gallus cDNA, mRNA sequence", XP002295790, Database accession no. CF258055 *
HILTON LOUISE S ET AL: "The emerging role of avian cytokines as immunotherapeutics and vaccine adjuvants", VETERINARY IMMUNOLOGY AND IMMUNOPATHOLOGY, vol. 85, no. 3-4, March 2002 (2002-03-01), pages 119 - 128, XP002295789, ISSN: 0165-2427 *
STAEHELI P ET AL: "CYTOKINES OF BIRDS: CONSERVED FUNCTIONS-A LARGELY DIFFERENT LOOK", JOURNAL OF INTERFERON AND CYTOKINE RESEARCH, MARY ANN LIEBERT, NEW YORK, NY, US, vol. 21, no. 12, December 2001 (2001-12-01), pages 993 - 1010, XP001079945, ISSN: 1079-9907 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022261554A1 (fr) * 2021-06-11 2022-12-15 Auburn University Vecteurs recombinants du virus de la maladie de newcastle (rndv) et leurs méthodes d'utilisation

Similar Documents

Publication Publication Date Title
CA2986388C (fr) Proteine d'interleukine-7 modifiee et ses utilisations
US6287554B1 (en) Chicken interleukin-15 and uses thereof
CN101918440B (zh) 禽类细胞因子及编码其的遗传序列的应用
WO1997014433A9 (fr) Interleukine-15 du poulet et ses utilisations
MXPA02002684A (es) Citocinas de mamifero; reactivos y metodos relacionados.
JPWO2007091624A1 (ja) 新規ウイルスベクター
JP3521936B2 (ja) 巨核球増殖分化因子
JPH04502164A (ja) 犬科・猫科動物における感染の治療または予防のための化学組成物及び方法
CA2328059A1 (fr) Emploi de l'interleukine 18 comme produit d'addition pour vaccin
ES2366176T3 (es) Citocinas aviares novedosas y secuencias genéticas que codifican para las mismas.
KR100857861B1 (ko) Ｍｙｏ－２ 펩타이드 중합체와 마이오스타틴의 융합단백질표면발현용 벡터 및 상기 벡터로 형질전환된 미생물
JP2003526360A6 (ja) ＩＬ−１２活性を増加させるＩＬ−１２ｐ４０小単位体突然変異遺伝子及びこれをＤＮＡワクチン免疫増強剤として利用する用途
WO2005103078A1 (fr) Gm-csf aviaire
CN113135986B (zh) 用于防治毒害艾美耳球虫的重组多肽及疫苗
JP4376783B2 (ja) ｐ４０サブユニットおよび／またはｐ３５サブユニットを含む、ＩＬ−１２のような鳥類のサイトカイン
JPH08508641A (ja) ウイルスタンパク質による免疫応答刺激
Dunham et al. Isolation, expression and bioactivity of feline granulocyte–macrophage colony-stimulating factor
KR20210084125A (ko) 신규 사이토메갈로바이러스 dna 백신 컨스트럭트 및 그의 용도
JP2003325188A (ja) サイトカイン遺伝子組換えカイコおよびそのタンパク質の製造方法
RU2004103468A (ru) Нуклеиновые кислоты, кодирующие рекомбинантный 250 к-да-антиген спорозоитов/мерозоитов eimeria maxima, и их применения
CN113307856B (zh) 用于防治巨型艾美耳球虫的重组多肽及疫苗
EP1013763A1 (fr) INTERLEUKINE 18 CANINE, INTERLEUKINE-1 $g(b)-CONVERTASE CANINE, SEQUENCES D'ADN CODANT CETTE ENZYME, PROCEDE DE PRODUCTION DE L'INTERLEUKINE 18, ET REMEDES CONTRE LES MALADIES IMMUNOLOGIQUES CHEZ LE CHIEN
CN113248587B (zh) 用于防治堆型艾美耳球虫的重组多肽及疫苗
WO2014029987A1 (fr) Protéines aviaires, acide nucléique et utilisations associées
DE60038020T2 (de) Vier-helix bündelprotein zsig81

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase