WO2005084104A2 - Novel isoamido-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors - Google Patents
Novel isoamido-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors Download PDFInfo
- Publication number
- WO2005084104A2 WO2005084104A2 PCT/EP2005/051025 EP2005051025W WO2005084104A2 WO 2005084104 A2 WO2005084104 A2 WO 2005084104A2 EP 2005051025 W EP2005051025 W EP 2005051025W WO 2005084104 A2 WO2005084104 A2 WO 2005084104A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hydrogen
- alkyl
- alkoxy
- compounds
- methoxy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 Cc(c(*)c1)cc2c1C(/C(/C/C(/*)=C1)=C/C=C/*1N(**)C(*)=O)=*C1=C(*)C(*)=C(*)I(C)=C21 Chemical compound Cc(c(*)c1)cc2c1C(/C(/C/C(/*)=C1)=C/C=C/*1N(**)C(*)=O)=*C1=C(*)C(*)=C(*)I(C)=C21 0.000 description 8
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D221/00—Heterocyclic compounds containing six-membered rings having one nitrogen atom as the only ring hetero atom, not provided for by groups C07D211/00 - C07D219/00
- C07D221/02—Heterocyclic compounds containing six-membered rings having one nitrogen atom as the only ring hetero atom, not provided for by groups C07D211/00 - C07D219/00 condensed with carbocyclic rings or ring systems
- C07D221/04—Ortho- or peri-condensed ring systems
- C07D221/06—Ring systems of three rings
- C07D221/10—Aza-phenanthrenes
- C07D221/12—Phenanthridines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/02—Nasal agents, e.g. decongestants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
- A61P15/10—Drugs for genital or sexual disorders; Contraceptives for impotence
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/04—Antipruritics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/10—Anti-acne agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
- A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/04—Centrally acting analgesics, e.g. opioids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/24—Antidepressants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
- C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
- C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
Definitions
- the invention relates to novel isoamido-substituted hydroxy-6-phenylphenanthridine derivatives, which are used in the pharmaceutical industry for the production of pharmaceutical compositions.
- the invention thus relates to compounds of formula I,
- R1 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloaikylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-4C-alkoxy,
- R2 is hydroxyl, 1-4C-alkoxy, 3-7C-cycloalkoxy, 3-7C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-4C-alkoxy, or in which
- R1 and R2 together are a 1-2C-alkylenedioxy group
- R3 is hydrogen or 1-4C-alkyl
- R31 is hydrogen or 1-4C-alkyl
- R4 is -0-R41 , in which
- R41 is hydrogen, 1-4C-alkyl, 1-4C-alkoxy-1-4C-alkyl, hydroxy-2-4C-alkyl, 1-7C-alkylcarbonyl, or completely or predominantly fluorine-substituted 1-4C-alkyl, and
- R5 is hydrogen or 1-4C-alkyl, or, in a second embodiment (embodiment b) according to the present invention,
- R4 is hydrogen or 1-4C-alkyl
- R5 is -O-R51 , in which
- R51 is hydrogen, 1-4C-alkyl, 1-4C-alkoxy-1-4C-alkyl, hydroxy-2-4C-alkyl, 1-7C-alkylcarbonyl, or completely or predominantly fluorine-substituted 1-4C-alkyl,
- R6 is hydrogen, halogen, 1-4C-alkyl or 1-4C-alkoxy
- R61 is hydrogen, 1-4C-alkyl or 1-4C-alkoxy-2-4C-alkyl
- R7 is Hetl , Har1 , 3-7C-cycloalkyl, or 1-4C-alkyl substituted by R8, in which
- Het1 is optionally substituted by R71 and is a monocylic 3- to 7-membered fully saturated heterocyclic ring radical, which is bonded via a ring carbon atom to the carbonyl moiety of the -C(0)N(R61)- group, and which comprises one nitrogen atom and optionally one further heteroatom selected from the group consisting of nitrogen, oxygen and sulfur, and, optionally, to which ring one or two oxo groups are bonded, in which R71 is 1-4C-alkyl, or completely or partially fluorine-substituted 1-4C-alkyI,
- Har1 is optionally substituted by R72 and/or R73, and is a 5- or 6-membered monocyclic unsaturated heteroaryl radical comprising 1 to 4 heteroatoms selected independently from the group consisting of oxygen, nitrogen and sulfur, in which
- R72 is halogen, 1-4C-alkyl, 1-4C-alkoxy, 1-4C-alkoxy-2-4C-alkoxy, 1-4C-alkylthio, cyano, 1-4C- -alkoxycarbonyl, carboxyl, hydroxyl, -A-N(R721)R722, pyridyl, or eompletely or partially fluorine- substituted 1-4C-aikyl, in which
- A is a bond or 1-4C-alkylene
- R721 is hydrogen or 1-4C-alkyl
- R722 is hydrogen or 1-4C-alkyl, or R721 and R722 together and with inclusion of the nitrogen atom, to which they are attached, form a heterocyclic ring Het2, in which
- Het2 is optionally substituted by R723, and is a 3- to 7-membered saturated or unsaturated monocyclic heterocyclic ring radical comprising the nitrogen atom, to which R721 and R722 are bonded, and optionally one to three further heteroatoms independently selected from the group consisting of oxygen, nitrogen and sulfur, in which
- R723 is 1-4C-alkyl
- R73 is halogen, 1-4C-alkoxy, 1-4C-alkoxy-2-4C-alkoxy, 1-4C-alkylthio, hydroxyl, amino or mono- or di- 1-4C-alkylamino,
- R8 is 1-4C-alkoxy, carbamoyl, carboxyl, 1-4C-alkoxycarbonyl, mono- or di-1-4C-alkylaminocarbonyl or -N(R81)R82, in which
- R81 is hydrogen, 1-4C-alkyl, carbamoyl, amidino or 1-4C-alkylcarbonyl,
- R82 is hydrogen or 1-4C-alkyl, or R81 and R82 together and with inclusion of the nitrogen atom, to which they are attached, form a heterocyclic ring Het3, in which
- Het3 is optionally substituted by R811 , and is a 3- to 7-membered saturated monocyclic heterocyclic ring radical comprising the nitrogen atom, to which R81 and R82 are bonded, and optionally one further heteroatom selected from the group consisting of oxygen, nitrogen and sulfur, in which R811 is 1-4C-alkyl, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- 1-4C-Alkyl represents a straight -chain or branched alkyl radical having 1 to 4 carbon atoms. Examples which may be mentioned are the butyl, isobutyl, sec-butyl, tert -butyl, propyl, isopropyl and preferably the ethyl and methyl radicals.
- 1-7C-Alkyl represents a straight -chain or branched alkyl radical having 1 to 7 carbon atoms. Examples which may be mentioned are the heptyl, isoheptyl (5-methylhexyl), hexyl, isohexyl (4-methylpentyl), neo- hexyl (3,3-dimethylbutyl), pentyl, isopentyl (3-methylbutyl), neopentyl (2,2-dimethylpropyl), butyl, isobutyl, sec-butyl, tert -butyl, propyl, isopropyl, ethyl or methyl radicals.
- 3-7C-Cycloalkyl represents cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl, of which cyclopropyl and cyclopentyl are preferred.
- 1-4C-Alkylene is a straight chain alkylene radical having 1 to 4 carbon atoms.
- Examples which may be mentioned in this context are the methylene (-CH Z -), ethylene (-CH 2 -CH 2 -), trimethylene (-CH 2 -CH 2 -CH 2 -) and the tetramethylene (-CH 2 -CH 2 -CH 2 -CH 2 -) radical.
- 1-4C-Alkoxy represents radicals which, in addition to the oxygen atom, contain a straight -chain or branched alkyl radical having 1 to 4 carbon atoms. Examples which may be mentioned are the butoxy, isobu- toxy, sec-butoxy, tert -butoxy, propoxy, isopropoxy and preferably the ethoxy and methoxy radicals.
- 3-7C-Cycloalkoxy represents cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy and cyclo- heptyloxy, of which cyclopropyloxy, cyclobutyloxy and cyclopentyloxy are preferred.
- 3-7C-Cycloalkylmethoxy represents cyclopropylmethoxy, cyclobutylmethoxy, cyclopentylmethoxy, cyclohexyl methoxy and cycloheptylmethoxy, of which cyclopropylmethoxy, cyclobutylmethoxy and cyclopentylmethoxy are preferred.
- fluorine-substituted 1-4C-alkoxy for example, the 2,2,3,3,3-pentafluoro- propoxy, the perfluoroethoxy, the 1 ,2,2-trifluoroethoxy, in particular the 1 ,1 ,2,2-tetrafluoroethoxy, the 2,2,2-trifluoroethoxy, the trifluoromethoxy and preferably the difluoromethoxy radicals may be mentioned.
- "Predominantly" in this connection means that more than half of the hydrogen atoms of the 1-4C-alkoxy radicals are replaced by fluorine atoms.
- fluorine-substituted 1-4C-alkyl for example, the 2,2,3,3,3-pentafluoropropyl, the perfluoroethyl, the 1 ,2,2-trifluoroethyl, in particular the 1 ,1 ,2,2-tetrafluoroethyl, the 2,2,2- trifluoroethyl, the trifluoromethyl and particularly the difluoromethyl radicals may be mentioned.
- "Predominantly" in this connection means that more than half of the hydrogen atoms of the 1-4C-alkyl radicals are replaced by fluorine atoms.
- fluorine-substituted 1-4C-alkyl for example, the 2,2,3,3,3-pentafluoropropyl, the perfluoroethyl, the 1 ,2,2-trifluoroethyl, the 1 ,1 ,2,2-tetrafluoroethyl, the 2,2,2-trifluoroethyl, the trifluoromethyl, the difluoromethyl and, in particular, the 2,2-difluoroethyl radicals may be mentioned.
- 1-2C-Alkylenedioxy represents, for example, the methylenedioxy [-0-CH 2 -0-] and the ethylenedioxy [-O-CH 2 -CH 2 -0-] radicals.
- 1-4C-Alkoxy-1-4G-alkyl represents one of the abovementioned 1-4C-alkyl radicals, which is substituted by one of the abovementioned 1-4C-alkoxy radicals.
- Examples which may be mentioned are the methoxy- methyl, the methoxyethyl and the isopropoxyethyl radicals, particularly the 2-methoxyethyl and the 2- isopropoxyethyl radicals.
- 1-4C-Alkoxy-2-4C-alkyl represents 2-4C-alkyl radicals, which are substituted by one of the abovementioned 1-4C-alkoxy radicals.
- Examples which may be mentioned are the methoxyethyl, ethoxyethyl and the isopropoxyethyl radicals, particularly the 2-methoxyethyl, 2-ethoxyethyl and the 2-isopropoxyethyl radicals.
- 1-7C-Alkylcarbonyl represents a radical which, in addition to the carbonyl group, contains one of the abovementioned 1-7C-alkyl radicals. Examples which may be mentioned are the acetyl, propionyl, bu- tanoyl and hexanoyl radicals.
- Hydroxy-2-4C-alkyl represents 2-4C-alkyl radicals, which are substituted by a hydroxyl group. Examples which may be mentioned are the 2-hydroxyethyl and the 3-hydroxypropyl radicals.
- mono- or di-1-4C-alkylamino radicals contain one or two of the above- mentioned 1-4C-alkyl radicals.
- Di-1-4C-alkylamino is preferred and here, in particular, dimethyl-, diethyl- or diisopropylamino.
- Halogen within the meaning of the invention is bromine, chlorine or fluorine.
- 1-4C-Alkoxycarbonyl represents a radical which, in addition to the carbonyl group, contains one of the abovementioned 1-4C-alkoxy radicals. Examples which may be mentioned are the methoxycarbonyl, the ethoxycarbonyl and the isopropoxycarbonyl radicals.
- 1-4C-Alkylthio represents radicals which, in addition to the sulfur atom, contain one of the abovementioned 1-4C-alkyl radicals. Examples which may be mentioned are the butylthio, propylthio and preferably the ethylthio and methylthio radicals.
- Pyridyl or pyridinyl includes 2-pyridyl, 3-pyridyl and 4-pyridyl.
- Mono- or di-1-4C-alkylaminocarbonyl radicals represent a radical, which in addition to the carbonyl group, contains one of the abovementioned one or two of the abovementioned mono- or di-1-4C-alkylamino radicals. Examples include, but are not restricted thereto, dimethylaminocarbonyl or diethylaminocarbonyl.
- Het1 is optionally substituted by R71, and is a monocylic 3- to 7-membered fully saturated heterocyclic ring radical, which is bonded via a ring carbon atom to the carbonyl moiety of the carbonylamino group C(O)N(R61)-, and which comprises one nitrogen atom and optionally one further heteroatom selected from the group consisting of nitrogen, oxygen and sulfur, and, optionally, to which ring one or two oxo groups are bonded. More precisely, Het1 is optionally substituted by R71 on a ring nitrogen or ring carbon atom.
- Het1 may include, without being restricted thereto, aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, ho- mopiperidinyl, morpholinyl, thiomorpholinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothiazolidinyl, pyrazolidinyl, imidazolidinyl, piperazinyl or homopiperazinyl; or 1 ,4-diazepan-5-onyl, piperidin-2-onyl, piperidin-4-onyl, piperazin-2-onyl, pyrrolidin-2-onyl, imidazolidin-2-onyl, glutarimidyl or succinimidyl.
- Het1 may include, without being restricted thereto, piperidin-3-yl, morpholin-3-yl or piperidin-4-yl; or pyrrolidin-2-on-5-yl.
- R71 -substituted derivatives of the abovementioned exemplary Het1 notably, for example, Het1 radicals, which are substituted by R71 on a ring nitrogen atom.
- Het1 radical may be mentioned, for example, without being restricted thereto, piperidin-4-yl or pyrrolidin-2-on-5-yi.
- Har1 is optionally substituted by R72 and/or R73, and is a 5- or 6-membered monocyclic unsaturated (heteroaromatic) heteroaryl radical comprising 1 to 4 heteroatoms selected independently from the group consisting of oxygen, nitrogen and sulfur.
- Har1 is optionally substituted by R72 and/or R73, and is- 6-membered monocyclic unsaturated (heteroaromatic) heteroaryl radical comprising 1 to 3, particularly 1 or 2, nitrogen atoms.
- Har1 is optionally substituted by R72 and/or R73, a ⁇ d is a 5- membered monocyclic unsaturated (heteroaromatic) heteroaryl radical comprising 1 to 4 heteroatoms selected independently from the group consisting of oxygen, nitrogen and sulfur.
- the radical Har1 is bonded via a ring carbon atom to the carbonyl moiety of the C( )N(R61) group.
- Har1 may include, without being restricted thereto, furanyl, thiophenyl, pyrrolyl, oxazolyl, isoxazolyl, thia- zolyl, isothiazolyl, imidazolyl, pyrazolyl, triazolyl (precisely: 1 ,2,4-triazolyl or 1 ,2,3-triazolyl), thiadiazolyl (precisely: 1 ,3,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1 ,2,3-thiadiazolyl or 1 ,2,4-thiadiazolyl), oxadiazolyl (precisely: 1 ,3,4-oxadiazolyl, 1 ,2,5-oxadiazolyl, 1 ,2,3-oxadiazolyl or 1 ,2,4-oxadiazolyl) or tetrazolyl, or, pyridinyl, pyrimidinyl,
- Har1 radicals may include, without being restricted thereto, pyridinyl, pyrimidinyl, pyrazinyl or pyridazinyl, as well as the R72- and/or R73-substituted derivatives thereof.
- Har1 radicals may include, without being restricted thereto, pyrimidinyl, pyrazinyl, pyridazinyl or, in particular, pyridinyl, as well as the R72- and/or R73-substituted derivatives of these radicals, wherein R72 is 1-4C-alkoxy, R73 is 1-4C-alkoxy.
- exemplary suitable Har1 radical may be mentioned, for example, without being restricted thereto, pyridinyl, or, more specifically, pyridin-4-yI or pyridin-3-yl, or the dimethoxy-substituted derivatives thereof.
- Har1 radical may be mentioned, for example, without being restricted thereto, 2,6-dimethoxy-pyridin-3-yl.
- Het2 is optionally substituted by R723 and stands for a monocylic 3- to 7-membered fully saturated or unsaturated (heteroaromatic) heterocyclic ring radical comprising the nitrogen atom, to which R721 and R722 are bonded, and optionally one to three further heteroatoms independently selected from the group consisting of nitrogen, oxygen and sulfur.
- R723 stands for a monocylic 3- to 7-membered fully saturated or unsaturated (heteroaromatic) heterocyclic ring radical comprising the nitrogen atom, to which R721 and R722 are bonded, and optionally one to three further heteroatoms independently selected from the group consisting of nitrogen, oxygen and sulfur.
- Het2 is optionally substituted by R723 on a ring nitro- -gen atom and stands for a monocylic 3- to 7-membered fully saturated heterocyclic ring radical comprising the nitrogen atom, to which R721 and R722 are bonded, and optionally one further heteroatom selected from the group consisting of nitrogen, oxygen and sulfur.
- Het2 stands for a monocylic 5-membered unsaturated (heteroaromatic) ring radical comprising the nitrogen atom, to which R721 and R722 are bonded, and optionally one to three further nitrogen atoms.
- Het2 may include according to facet 1 , without being restricted thereto, aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, homopiperidinyl, morpholinyl, thiomorpholinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothi- azolidinyl, pyrazolidinyl, imidazolidinyl, piperazinyl or homopiperazinyl. Het2 may also include according to facet 2, without being restricted thereto, pyrrolyl, imidazolyl, pyrazolyl, triazolyl or tetrazolyl.
- Het2 As further examples for Het2 according to this invention may be mentioned, without being restricted thereto, R723-substituted derivatives of the abovementioned exemplary Het2 radicals according to facet 1 , such as e.g. 4-N-(R723)-piperazinyl or 4-N-(R723)-homopiperazinyl.
- Het2 radical may be mentioned, for example, without being restricted thereto, morpholin-4-yl.
- Het3 is optionally substituted by R811 , and is a 3- to 7-membered saturated monocyclic heterocyclic ring radical comprising the nitrogen atom, to which R81 and R82 are bonded, and optionally one further heteroatom selected from the group consisting of oxygen, nitrogen and sulfur.
- Het3 may include, without being restricted thereto, aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, homopiperidinyl, morpholinyl, thiomorpholinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothiazolid ⁇ nyl, pyrazolidinyl, imidazolidinyl, piperazinyl or homopiperazinyl.
- Het3 As further examples for Het3 according to this invention may be mentioned, without being restricted thereto, R811 -substituted derivatives of the abovementioned exemplary Het3 radicals, notably, for example, Het3 radicals, which are substituted by R811 on a ring nitrogen atom, such as e.g. 4-N-(R811)- piperazinyl or 4-N-(R811)-homopiperazinyl.
- R811 -substituted derivatives of the abovementioned exemplary Het3 radicals notably, for example, Het3 radicals, which are substituted by R811 on a ring nitrogen atom, such as e.g. 4-N-(R811)- piperazinyl or 4-N-(R811)-homopiperazinyl.
- Het3 radical may be mentioned, for example, without being restricted thereto, piperidin-1-yl.
- heterocyclic groups mentioned herein refer to all of the possible isomeric forms thereof. . . . . . . . .
- heterocyclic groups mentioned herein refer, unless otherwise noted, in particular to all of the possible positional isomers thereof.
- pyridyl or pyridinyl includes pyridin-2-yl, pyridin-3-yl and pyridin-4-yl.
- heterocyclic groups alone or as part of other groups, mentioned herein may be substituted by their given substituents, unless otherwise noted, at any possible position, such as e.g. at any substitutable ring carbon or ring nitrogen atom.
- rings containing quaternizable imino-type ring nitrogen atoms may be preferably not quaternized on these imino-type ring nitrogen atoms by the mentioned substituents.
- any heteroatom of a heterocyclic ring with unsatisfied valences mentioned herein is assumed to have the hydrogen atom(s) to satisfy the valences.
- each definition is independent.
- N-oxides compounds comprising nitrogen atoms can form N-oxides.
- the compounds according to the present invention comprising the imine nitrogen atom in position 5 of the phenylphenanthridine backbone and, optionally (depending on the meaning of R7), one or more further nitrogen atoms suitable to exist in the N-oxide state (--N ⁇ O " )-) may be capable to form (depending on the number of nitrogen atoms suitable to form stabile N-oxides) mono-N-oxides, bis-N-oxides or muiti-N- oxides, or mixtures thereof.
- N-oxide(s) as used in this invention therefore encompasses all possible, and in particular all stabile, N-oxide forms, such as mono-N-oxides, bis-N-oxides or multi -N-oxides, or mixtures thereof in any mixing ratio.
- Possible salts for compounds of the formula I -depending on substitution- are all acid addition salts or all salts with bases. Particular mention may be made of the pharmacologically tolerable salts of the inorganic and organic acids and bases customarily used in pharmacy. Those suitable are, on the one hand, water-insoluble and, particularly, water-soluble acid addition salts with acids such as, for example, hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, acetic acid, citric acid, -D-gluconic acid, benzoic acid, 2-(4-hydroxybenzoyl)benzoic acid, butyric acid, sulfosalicylic acid, maleic acid, lauric acid, malic acid, fumaric acid, succinic acid, oxalic acid, tartaric acid, embonic acid, stearic acid, toluenesulfonic acid, methanesulfonic acid or 3-hydroxy-2-naphthoic acid,
- salts with bases are also suitable.
- examples of salts with bases which may be mentioned are alkali metal (lithium, sodium, potassium) or calcium, aluminum, magnesium, titanium, ammonium, meglumine or guanidinium salts, where here too the bases are employed in salt preparation in an equimolar quantitative ratio or one differing therefrom.
- Pharmacologically intolerable salts which can initially be obtained, for example, as process products in the preparation of the compounds according to the invention on an industrial scale are converted into pharmacologically tolerable salts by processes known to the persoaskilled in the art.
- the compounds according to the invention and their salts when they are isolated, for example, in crystalline form, can contain various amounts of solvents.
- the invention therefore also comprises all solvates and in particular all hydrates of the compounds of the formula I, and also all solvates and in particular all hydrates of the salts of the compounds of the formula I.
- R6 and R7C(O)N(R61)- of compounds of formula I can be attached in the ortho, meta or para position with respect to the binding position in which the 6-phenyl ring is bonded to the phe- nanthridine ring system, whereby preference is given to the attachement of R7C(O)N(R61)- in the meta or in the para position.
- R6 is hydrogen
- the radical R7C(O)N(R61)- is at- tached in the meta or in the para position with respect to the binding position in which the 6-phenyl ring is bonded to the phenanthridine ring system.
- R1 is 1-2C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R2 is 1-2C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R3 is hydrogen
- R31 is hydrogen, either, in a first embodiment (embodiment a) according to the present invention
- R4 is -O-R41, in which R41 is hydrogen or 1-4C-alkylcarbonyl, and
- R5 is hydrogen, . . . , . . or, in a second embodiment (embodiment b) according to the present invention, R4 is hydrogen, and R5 is -O-R51, in which R51 is hydrogen or 1-4C-alkylcarbonyl,
- R6 is hydrogen
- R61 is hydrogen
- R7 is Het1 , Har1 , 3-7C-cycloalkyl, or 1-4C-alkyl substituted by R8, in which
- Het1 is optionally substituted by R71 and is a monocylic 5- to 7-membered fully saturated heterocyclic ring radical, which is bonded via a ring carbon atom to the carbonyl moiety of the -C(O)N(R61)- group, and which comprises one ritrogen atom and optionally one further heteroatom selected from the group consisting of nitrogen, oxygen and sulfur, and, optionally, to which ring one or two oxo groups are bonded, in which R71 is 1-4C-alkyl, or completely or partially fluorine-substituted 1-4C-alkyl,
- Har1 is optionally substituted by R72 and/or R73, and is either a 6-membered monocyclic unsaturated heteroaryl radical comprising one or two nitrogen atoms, or a 5-membered monocyclic unsaturated heteroaryl radical comprising 1 to 4 heteroatoms selected independently from the group consisting of oxygen, nitrogen and sulfur, in which R72 is halogen, 1-4C-alkyl, 1-4C-alkoxy, 1-4C-alkoxy-2-4C-alkoxy, 1-4C-alkylthio, cyano, 1-4C- alkoxycarbonyl, carboxyl, hydroxyl, -A-N(R721)R722, pyridyl, or completely or partially fluorine- substituted 1-4C-alkyl, in which A is a bond or 1-4C-alkylene, R721 is hydrogen or 1-4C-alkyl, R722 is hydrogen or 1-4C-alkyl, or R721 and R722 together and with inclusion of the nitrogen
- R8 is 1-4C-alkoxy, carbamoyl, mono- or di-1-4C-alkylaminocarbonyl or -N(R81)R82, in which R81 is hydrogen, 1-4C-alkyl, carbamoyl, amidino or 1-4C-alkylcarbonyl, R82 is hydrogen or 1-4C-alkyl, or R81 and R82 together and with inclusion of the nitrogen atom, to which they are attached, form a heterocyclic ring Het3, in which Het3 is optionally substituted by R81 1 , and is a 3- to 7-membered saturated monocyclic heterocyclic ring radical comprising the nitrogen atom, to which R81 and R82 are bonded, and optionally one further heteroatom selected from the group consisting of oxygen, nitrogen and sulfur, in which R811 is 1-4C-alkyl, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- R1 is 1-2C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R2 is 1-2C-alkoxy, 3-5C-cycloalkoxy, 3-5C-cycloalkylmethoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -O-R41 , in which R41 is 1-4C-alkylcarbonyl or, in particular, in an individual embodiment according to this invention, hydrogen, R5 is hydrogen,
- R6 is hydrogen
- R61 is hydrogen
- R7 is Het1 , Har1 , 3-7C-cycloalkyl, or 1-4C-alkyl substituted by R8, in which
- Het1 is optionally substituted by R71 and is a monocylic 5- to 7-membered fully saturated heterocyclic ring radical, which is bonded via a ring carbon atom to the carbonyl moiety of the -C(0)N(R61)- group, and which comprises one nitrogen atom, and, optionally, to which ring one oxo group is bonded, in which -R71 is 1-4C-alkyl, or completely or partially fluorine-substituted 1-2C-alkyl,
- Har1 is optionally substituted by R72 and/or R73, and is a 6-membered monocyclic unsaturated heteroaryl radical comprising one or two nitrogen atoms, in which R72 is halogen, 1-4C-alkoxy, 1-4C-alkoxy-ethoxy, 1-2C-alkylthio, hydroxyl, amino or mono- or di-1-2C- alkylamino, R73 is halogen, 1-4C-alkoxy, 1-2C-alkoxy-ethoxy, 1-2C-alkylthio, hydroxyl, amino or mono- or di-1-2C- alkylamino,
- R8 is 1-4C-alkoxy, carbamoyl, mono- or di-1-4C-alkylaminocarbonyl or -N(R81)R82, in which
- R81 is hydrogen, 1-4C-alkyl, carbamoyl or 1-4C-alkylcarbonyl,
- R82 is hydrogen or 1-4C-alkyl, or R81 and R82 together and with inclusion of the nitrogen atom, to which they are attached, form a heterocyclic ring Het3, in which
- Het3 is optionally substituted by R811 , and is a 3- to 7-membered saturated monocyclic heterocyclic ring radical comprising the nitrogen atom, to which R81 and R82 are bonded, and optionally one further heteroatom selected from the group consisting of oxygen, nitrogen and sulfur, in which
- R811 is 1-2C-alkyl, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- R1 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy,
- R2 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -0-R41, in which R41 is hydrogen, R5 is hydrogen,
- R6 is hydrogen
- R61 is hydrogen
- R7 is Het1 , Har1, 3-5C-cycloalkyl, or 1-4C-alkyl substituted by R8, in which Het1 is 1-N-(R71)-piperdin-4-yl or pyrrolidin-2-on-5-yl, in which R71 is 1-4C-alkyl,
- Har1 is optionally substituted by R72 and/or R73, and is pyridinyl, in which R72 is 1-4C-alkoxy, R73 is 1-4C-alkoxy,
- R8 is 1-4C-alkoxy, carbamoyl, mono- or di-1-4C-alkylaminocarbonyl or -N(R81)R82, in which
- R81 is 1-4C-alkyl, carbamoyl or 1-4C-alkylcarbonyl,
- R82 is hydrogen or 1-4C-alkyl, or R81 and R82 together and with inclusion of the nitrogen atom, to which they are attached, form a heterocyclic ring Het3, in which
- Het3 is piperidin-1-yl, pyrrolidin-1-yl, 4-N-(R811)-piperazin-1-yl, 4-N-(R811)-homopiperazin-1-yl, ho- mopiperidin-1-yl, morpholin-4-yl or thiomorpholin-4-yl, in which
- R811 is 1-2C-alkyl, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- R1 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy,
- R2 is 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy,
- R3 is hydrogen
- R31 is hydrogen
- R4 is -O-R41 , in which R41 is hydrogen, R5 is hydrogen, R6 is hydrogen, R61 is hydrogen,
- R7 is Het1 , Har1 , 3-5C-cycloalkyl, or 1-4C-alkyl substituted by R8, in which Het1 is 1-N-(R71 )-piperdin-4-yl or pyrrolidin-2-on-5-yl, in which R71 is 1-4C-alkyl,
- Har1 is 2,6-dimethoxypyridin-3-yl
- R8 is 1-4C-alkoxy, carbamoyl, mono- or di-1-4C-alkylaminocarbonyl or -N(R81)R82, in which R81 is 1-4C-alkyl, carbamoyl or 1-4C-alkylcarbonyl, R82 is hydrogen or 1-4C-alkyl,
- Het3 is piperidin-1-yl, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- R1 is methoxy or ethoxy
- R2 is methoxy, ethoxy, difluoromethoxy or 2,2-difluoroethoxy
- R3 is hydrogen
- R31 is hydrogen
- R4 is -O-R41, in which R41 is hydrogen
- R5 is hydrogen
- R6 is hydrogen
- R61 is hydrogen
- R7 is Het1 , Har1 , cyclopropyl, or 1-4C-alkyl substituted by R8, in which
- Het1 is 1-N-(R71)-piperdin-4-yl or pyrrolidin-2-on-5-yl, in which
- R71 is methyl
- Har1 is 2,6-dimethoxypyridin-3-yl
- R8 is methoxy, carbamoyl, dimethylaminocarbonyl or -N(R81)R82, in which R81 is methyl, carbamoyl or acetyl
- R82 is hydrogen or methyl
- R81 and R82 together and with inclusion of the nitrogen atom, to which they are attached, form a heterocyclic ring Het3, in which Het3 is piperidin-1-yl, and the salts, the N-oxides and the salts of the N-oxides of these compounds.
- a special interest in the compounds according to this invention relates to those compounds which are included by one or, when possible, by more of the following embodiments:
- a special embodiment of the compounds of the present invention include those compounds of formula I in which R1 and R2 are independently 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 and R2 are independently 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 and R2 are independently 1-2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy, and R3, R31 and R6 are all hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 or R2 is 2,2-difluoroethoxy, and R3, R31 and R6 are all hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which one of R1 and R2 is methoxy, and the other is methoxy, ethoxy, difluoromethoxy or 2,2- difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is ethoxy or, particularly, methoxy, and R2 is methoxy, or, particularly, ethoxy, difluoromethoxy or 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is methoxy, and R2 is methoxy, ethoxy, difluoromethoxy or 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is methoxy, and R2 is ethoxy, difluoromethoxy or 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which one of R1 and R2 is 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is ethoxy or, particularly, methoxy, and R2 is 2,2-difluoroethoxy, and R3 and R31 are both hydrogen. •
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is methoxy, and R2 is 2,2-difluoroethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is methoxy, and R2 is ethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R1 is methoxy, and R2 is difluoromethoxy, and R3 and R31 are both hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R6 is hydrogen.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R61 is hydrogen.
- R5 or, particularly, R4 is the radical (1-4C-alkylcarbonyl)-O- such as e.g. acetoxy, or hydroxyl, and all the other substituents are as defined in any compound which is said to be mentioned above.
- Another special embodiment of the compounds of the present invention include those compounds of formula I in which R5 or, particularly, R4 is hydroxyl.
- a preferred embodiment according to the present invention is embodiment a.
- a further preferred embodiment of the compounds of the present invention include compounds according to embodiment a, in which R5 and R41 are both hydrogen, and in which R1 and R2 are independently 1- 2C-alkoxy, 2,2-difluoroethoxy, or completely or predominantly fluorine-substituted 1-2C-alkoxy, and R3, R31 and R6 are all hydrogen.
- a yet further preferred embodiment of the compounds of the present invention include compounds according to embodiment a, in which R5 is hydrogen, and in which R1 is methoxy, and R2 is ethoxy, difluoromethoxy or 2,2-difluoroethoxy, and R3, R31 and R6 are all hydrogen.
- a still yet further preferred embodiment of the compounds of the present invention include compounds according to embodiment a, in which R5 and R41 are both hydrogen, and in which R1- is methoxy, and R2 is ethoxy, difluoromethoxy or 2,2-difluoroethoxy, and R3, R31 and R6 are all hydrogen.
- Suitable compounds according to the present invention include those compounds of formula I, in which R5 or, particularly, R4 is hydroxyl.
- Exemplary compounds according to the present invention may include those selected from
- Cyclopropanecarboxylic acid [3-((3SR,4aRS,10bRS)-9-ethoxy-3-hydroxy-8-methoxy-1 ,2,3,4,4a,1 Ob- hexahydro-phenanthridin-6-yl)-phenyl]-amide the enantiomers, as well as the salts, the N-oxides and the salts of the N-oxides of these compounds and enantiomers.
- the compounds according to the present invention which are listed in the Table A in the appended "Biological Investigations” and, particularly, the enantiomers thereof, particularly those having the formula la*****, as well as the salts of these compounds and enantiomers, are to be mentioned as a particular interesting aspect of the present invention.
- the compounds of formula I are chiral compounds having chiral centers at least in positions 4a and 10b and depending on the meanings of R3, R31, R4 and R5 additional chiral centers in positions 1 , 2, 3 and 4. Numbering
- the invention includes all conceivable stereoisomers in pure form as well as in any mixing ratio. Preference is given to compounds of formula I in which the hydrogen atoms in positions 4a and 10b are in the cis position relative to one another.
- the pure cis enantiomers and their mixtures in any mixing ratio and including the racemates are more preferred in this context.
- Preferred compounds of the formula I according to embodiment b are those which have, with respect to the positions 3, 4a and 10b, the same configuration as shown in the formulae lb ** and lb* ** and lb****:
- More preferred compounds of the formula I according to embodiment b are those which have, with respect to the positions 3, 4a and 10b, the same configuration as shown in the formula lb* **** :
- the enantiomers can be separated in a manner known per se (for example by preparation and separation of appropriate diastereoisomeric compounds).
- an enantiomer separation can be carried out at the stage of the starting compounds having a free amino group such as starting compounds of formulae Via, in which R1 , R2, R3, R31 , R41 and R5 have the meanings mentioned above, or IXb as defined below.
- Separation of the enantiomers can be carried out, for example, by means of salt formation of the racemic compounds of the formulae Via or IXb with optically active acids, preferably carboxylic acids, subsequent resolution of the salts and release of the desired compound from the salt.
- optically active carboxylic acids which may be mentioned in this connection are the enantiomeric forms of mandelic acid, ⁇ tartaric acid, O.O'-dibenzoyltartaric acid, camphoric acid, quinic acid, glutamic acid, pyroglutamic acid, malic acid, camphorsulfonic acid, 3-bromocamphorsulfonic acid, ⁇ -methoxyphenylacetic acid, ⁇ -methoxy- ⁇ -trifluoromethylphenylacetic acid and 2-phenylpropionic acid.
- enantiomerically pure starting compounds can be prepared via asymmetric syntheses.
- Enantiomerically pure starting compounds as well as enantiomerically pure compounds of the formula I can be also obtained by chroma- tographic separation on chiral separating columns; by derivatization with chiral auxiliary reagents, subsequent diastereomer separation and removal of the chiral auxiliary group; or by (fractional) crystallization from a suitable solvent.
- the compounds according to the invention can be prepared, for example, as shown in the reaction schemes below and according to the following specified reaction steps, or, particularly, in a manner as described by way of example in the following examples, or analogously or similarly thereto according to preparation procedures or synthesis strategies known to the person skilled in the art.
- compounds of formula II are reacted with carboxylic acid derivatives of the formula R7- C(O)-X, in which X is a suitable leaving group, for example a chlorine atom.
- amide bond linking reagents known to the person skilled in the art which may be mentioned are, for example, the carbodiimides (e.g. dicyclohexylcarbodiimide or, preferably, 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide hydrochloride), azodicarboxylic acid derivatives (e.g. diethyl azodicar- boxylate), uronium salts [e.g.
- preferred amide bond linking reagents are uronium salts and, particularly, carbodiimides, preferably, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride.
- the amide compounds of formula I obtained, in which R61 is hydrogen can be N-alkylated using a suitable base to deprotonate the amide (e.g. sodium hydride) and a suitable alkylating agent R61-Y, in which Y is a suitable leaving group and R61 is other than hydrogen, to give compounds of formula I, in which R61 is other than hydrogen and has the meanings as given above.
- a suitable base e.g. sodium hydride
- R61-Y e.g. sodium hydride
- R61-Y e.g. sodium hydride
- compounds of the formula I can be also converted into further compounds of the formula I by methods known to one of ordinary skill in the art. More specifically, for example, from compounds of the formula I in which a) R41 or R51 is hydrogen, the corresponding ester compounds can be obtained by esterification reactions; b) R41 or R51 is hydrogen, the corresponding ether compounds can be obtained by etherification reactions; c) R41 or R51 is an acyl group, such as e.g. acetyl, the corresponding hydroxyl compounds can be obtained by deesterification (e.g.
- compounds of the formula I can be converted into their salts, or, optionally, salts of the compounds of the formula I can be converted into the free compounds.
- the compounds of the formula I can be converted, optionally, into their N-oxides, for example with the aid of hydrogen peroxide in methanol or with the aid of m-chloroperoxybenzoic acid in dichloro- methane.
- the person skilled in the art is familiar on the basis of his/her expert knowledge with the reaction conditions which are specifically necessary for carrying out the N-oxidation.
- the reduction is carried out using a hydrogen-producing mixture, for example, metals such as zinc, zinc-copper couple or iron with organic acids such as acetic acid or mineral acids such as hydrochloric acid. More preferably, the reduction is carried out using a zinc-copper couple in the presence of an organic or an inorganic acid. Such a zinc-copper couple is accessible in a way known to the person of ordinary skill in the art.
- R1, R2, R3, R31 , R41 and R5 have the meanings indicated above in embodiment a whereby R41 is other than hydrogen and which are sensitive against catalytic hydrogenation, can be prepared from the corresponding compounds of the formula Vila by selective reduction of the nitro group in a manner known to the person skilled in the art, for example by hydrogen transfer reaction in the presence of a metal catalyst, for example palladium or, preferably, Raney nickel, in a lower alcohol as solvent using, for example, ammonium formiate or, preferably, hydrazine hydrate as hydrogen donor.
- a metal catalyst for example palladium or, preferably, Raney nickel
- compounds of the formula IVa can also be prepared from the corresponding compounds of the formula Via and corresponding compounds of the formula V, in which X is hydroxyl, by reaction with amide bond linking reagents known to the person skilled in the art.
- amide bond linking reagents known to the person skilled in the art which may be mentioned are, for example, the carbodi- imides (e.g. dicyclohexylcarbodiimide or, preferably, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride), azodicarboxylic acid derivatives (e.g. diethyl azodicarboxylate), uronium salts [e.g.
- preferred amide bond linking reagents are uronium salts and, particularly, carbodiimides, preferably, 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide hydrochloride.
- Said cyclocondensation reaction is carried out in a manner known per se to the person skilled in the art or as described by way of example in the following examples, according to Bischler-Napieralski (e.g. as described in J. Chem. Soc, 1956, 4280-4282) in the presence of a suitable condensing agent, such as, for example, polyphosphoric acid, phosphorus pentachloride, phosphorus pentoxide or phosphorus oxy- chloride, in a suitable inert solvent, e.g.
- a chlorinated hydrocarbon such as chloroform
- a cyclic hydrocarbon such as toluene or xylene
- another inert solvent such as isopropyl acetate or acetonitrile
- said cyclocondensation reaction can be carried out in the presence of one or more suitable Lewis Acids such as, for example, suitable metal halogenides (e.g. chlorides) or sulphonates (e.g. tri- flates), including rare earth metal salts, such as e.g. anhydrous aluminum trichloride, aluminum tribro- mide, zinc chloride, boron trifluoride ethereate, titanium tetrachloride or, in particular, tin tetrachloride, and the like.
- suitable metal halogenides e.g. chlorides
- sulphonates e.g. tri- flates
- rare earth metal salts such as e.g. anhydrous aluminum trichloride, aluminum tribro
- Suitable reducing agents for the abovementioned reduction reaction may include, for example, metal hydride compounds such as, for example, diisopropy- laluminium hydride, borane, sodium borohydride, sodium triacetoxyborohydride, sodium cyanoboro- hydride, zinc borohydride, potassium tri-sec-butylborohydride, sodium tri-sec-butylborohydride, lithium tri- sec-butylborohydride, ⁇ -isopinocampheyl-9-borabicyclo[3.3.1]nonane and the like.
- metal hydride compounds such as, for example, diisopropy- laluminium hydride, borane, sodium borohydride, sodium triacetoxyborohydride, sodium cyanoboro- hydride, zinc borohydride, potassium tri-sec-butylborohydride, sodium tri-sec-butylborohydride, lithium tri- sec-butylborohydride, ⁇ -isopinocampheyl-9-
- the preferred examples of said reducing agents are sodium cyanoborohydride, ⁇ -isopinocampheyl-9- borabicyclo[3.3.1]nonane and potassium tri-sec-butylborohydride.
- the most preferred examples of the abovementioned reducing agents are ⁇ -isopinocampheyl-9-borabicyclo[3.3.1]nonane and potassium tri- sec-butylborohydride, which both allow to prepare compounds of the formula Via stereoselectively.
- “Stereoselectively" in this connection means that those compounds of the formula Via, in which the hydrogen atoms in positions 1 and 3 are located at the opposite side of the plane defined by the cyclohex- ane ring, are obtained preferentially.
- the compounds of the formula IXa in which R1, R2, R3, R31 and R5 have the meanings mentioned in embodiment a, are either known or can be obtained by the reaction of compounds of the formula Xla, in which R1 and R2 have the meanings mentioned above, with compounds of the formula Xa, in which R3, R31 and R5 have the meanings mentioned above in embodiment a.
- the cycloaddition reaction is carried out in a manner known to the person skilled in the art according to Diels-Alder, e.g. as described in J. Amer. Chem. Soc. 1957, 79, 6559 or in J. Org. Chem. 1952, 17, 581 or as described in the following examples.
- the compounds of the formulae Xa and Xla are either known or can be prepared in a known manner.
- the compounds of the formula Xla can be prepared, for example, in a manner known to the person skilled in the art from corresponding compounds of the formula Xlla as described, for example, in J. Chem. Soc. 1951 , 2524 or in J. Org. Chem. 1944, 9, 170 or as described in the following examples.
- the reduction can be carried out, for example, by contacting compounds of the formula Vlllb with a hydrogen-producing mixture such as, preferably, metallic zinc in a mildly acidic medium such as acetic acid in a lower alcohol such as methanol or ethanol at room temperature or at elevated temperature or, preferably, at the boiling temperature of the solvent mixture.
- a hydrogen-producing mixture such as, preferably, metallic zinc in a mildly acidic medium such as acetic acid in a lower alcohol such as methanol or ethanol at room temperature or at elevated temperature or, preferably, at the boiling temperature of the solvent mixture.
- the reduction can be carried out by selective reduction of the nitro group in a manner known to the person skilled in the art, for example by hydrogen transfer reaction in the presence of a metal catalyst, for example palladium or preferably Raney nickel, in a suitable solvent, preferably a lower alcohol, using, for example ammonium formiate or preferably hydrazine hydrate as hydrogen donor.
- compounds of the formula Vlllb in which R1 , R2, R3, R31 , R4 and R6 have the meanings given above in embodiment b, can also be prepared, for example, from corresponding compounds of the formula IXb and corresponding compounds of the formula V, in which X is hydroxyl, by reaction with am- ide bond linking reagents known to the person skilled in the art.
- am- ide bond linking reagents known to the person skilled in the art.
- Exemplary amide bond linking reagents known to the person skilled in the art which may be mentioned are, for example, the carbodiimides (e.g.
- azodicarboxylic acid derivatives e.g. diethyl azodicarboxylate
- uronium salts e.g. O(benzotriazol-l-yl)- N,N,N',N'-tetra
- preferred amide bond linking reagents are uronium salts and, particularly, carbodiimides, preferably, 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide hydrochloride.
- compounds of the formula Vlllb are converted into corresponding compounds of the formula Vllb by epoxidation reaction, which can be carried out as described in the following examples or in a manner known to one of ordinary skill in the art employing, for example, suitable epoxidation methods or suitable epoxidation reagents such as, for example, peracids (e.g. m-chloroperbenzoic acid) or organic or inorganic peroxides (e. g. dimethyldioxirane, hydrogene peroxide or persulfates).
- peracids e.g. m-chloroperbenzoic acid
- organic or inorganic peroxides e. g. dimethyldioxirane, hydrogene peroxide or persulfates.
- compounds of the formula Vb can be converted largely regio- and diastereoselectively into compounds of the formula IVb, wherein the hydroxyl radical in position 1 and the amido radical in position 3 are located at the same side of the plane defined by the cyclohexane ring.
- said inversion of configuration of position 1 of compounds of the formula Vlb can be also obtained, for example, as described by way of example in the following examples according to subsequently specified two step procedure shown in reaction scheme 5 below.
- exemplary compounds of the formula Vlb* in which R1 , R2 and R6 have the meanings indicated above in embodiment b, and R3, R31 and R4 are hydrogen and position 1 has the R configuration, are converted by oxidation reaction into corresponding compounds of the formula Xlb.
- Said oxidation is likewise carried out under conditions customary per se using, for example, chloranil, atmospheric oxygen, manganese dioxide or, preferably, chromium oxides as an oxidant.
- compounds of the formula Xlb obtained are converted by art-known reduction reaction of the keto group, preferably with metal hydride compounds or, more specifically, metal borohydrides, such as, for example, sodium borohydride, into corresponding compounds of formula Vlb ** , in which position 1 has now S configuration and thus the configuration of the carbon atom in position 1 is now inverted regarding to said compounds of the formula Vlb * .
- the cycloaddition is in this case carried out in a manner known to the person skilled in the art according to Diels-Alder, e.g. as described in J. Amer. Chem. Soc. 1957, 79, 6559 or in J. Org. Chem. 1952, 17, 581 or as described in the following examples.
- the compounds of the formula Xllb are either known or can be prepared in a known manner.
- compounds of the formula IVb in which R1 , R2, R3, R31 , R4, R51 and R6 have the meanings given above in embodiment b whereby R51 is other than hydrogen (particularly compounds of formula IVb, in which R1 , R2, R51 and R6 have the meanings given above in embodiment b whereby R51 is other than hydrogen, and R3, R31 and R4 are all hydrogen) can also be obtained as shown in reaction scheme 7 and as described by way of example in the following examples.
- the amino group of compounds of the formula IXb is protected with an art -known protective group PG1, such as e.g. the tert-butoxycarbonyl group.
- the proteced compounds are subjected to hydroboration reaction to obtain over two steps compounds of formula XI lib.
- Said hydroboration reaction is carried out as described in the following examples using an appropriate (hydro)borating agent, such as e.g. 9-BBN, isopinocampheylborane or the like, or, particularly, borane-tetrahydrofuran (H 3 B-THF), advantageously at ambient temperature.
- an appropriate (hydro)borating agent such as e.g. 9-BBN, isopinocampheylborane or the like, or, particularly, borane-tetrahydrofuran (H 3 B-THF), advantageously at ambient temperature.
- the product obtained via said hydroboration reaction or, suitably, the R51 -substituted derivative thereof is purified from resulting stereo- and/or regioisomeric side products by methods known to the person skilled in the art, such as e.g. by chromatographic separation techniques.
- the substances according to the invention are isolated and purified in a manner known per se, for example by distilling off the solvent under reduced pressure and recrystallizing the residue obtained from a suitable solvent or subjecting it to one of the customary purification methods, such as, for example, column chromatography on a suitable support material.
- Salts are obtained by dissolving the free compound in a suitable solvent (e.g. a ketone, such as acetone, methyl ethyl ketone or methyl isobutyl ketone, an ether, such as diethyl ether, tetrahydrofuran or diox- ane, a chlorinated hydrocarbon, such as methylene chloride or chloroform, or a low-molecular-weight aliphatic alcohol, such as ethanol or isopropanol) which contains the desired acid or base, or to which the desired acid or base is then added.
- the salts are obtained by filtering, reprecipitating, precipitating with a nonsolvent for the addition salt or by evaporating the solvent. Salts obtained can be converted into the free compounds, which can in turn be converted into salts, by alkalization or by acidification. In this manner, pharmacologically unacceptable salts can be converted into pharmacologically acceptable salts.
- N-oxides and salts of the N-oxides are a preferred subject of the present invention.
- m.p. stands for melting point, h for hour(s), min for minutes, R for rentention factor in thin layer chromatography, s.p. for sintering point, EF for empirical formula, MW for molecular weight, MS for mass spectrum, M for molecular ion, fnd. for found, calc. for calculated, other abbreviations have their meanings customary per se to the skilled person.
- the symbols RS and SR are used to denote the specific configuration of each of the chiral centers of a racemate.
- the term "(2RS,4aRS,10bRS)" stands for a racemate (racemic mixture) comprising the one enantiomer having the configuration (2R,4aR,10bR) and the other enantiomer having the configuration (2S,4aS,10bS).
- the product from above is dissolved in 4 ml of phosphorus oxychloride and heated at l OOO for 6 h. After cooling to room temperature 5ml of dichloromethane are added and the mixture poured into 3 M aqueous sodium hydroxide solution. Water is added to dissolve the precipitating solid and the pH is adjusted to pH>10. The organic layer is dried over sodium sulfate. The crude product is purified by flash chromatography on silica to yield 813 mg of the title compound.
- Solution B is added to solution A and left for 48 hours.
- the solid is filtered off and washed with a little isopropyl acetate to give after drying 32.48 g colorless crystals with a ratio of the enantiomers of 97:3 in favour of the title compound.
- the compounds according to the invention have useful pharmacological properties which make them industrially utilizable.
- selective cyclic nucleotide phosphodiesterase (PDE) inhibitors specifically of type 4
- they are suitable on the one hand as bronchial therapeutics (for the treatment of airway obstructions on account of their dilating action but also on account of their respiratory rate- or respiratory drive- increasing action) and for the removal of erectile dysfunction on account of their vascular dilating action, but on the other hand especially for the treatment of disorders, in particular of an inflammatory nature, e.g.
- the compounds according to the invention are distinguished by a low toxicity, a good enteral absorption (high bioavailability), a large therapeutic breadth and the absence of significant side effects.
- the compounds according to the invention can be employed in human and veterinary medicine as therapeutics, where they can be used, for example, for the treatment and prophylaxis of the following illnesses: acute and chronic (in particular inflammatory and allergen-induced) airway disorders of varying origin (bronchitis, allergic bronchitis, bronchial asthma, emphysema, COPD); dermatoses (especially of proliferative, inflammatory and allergic type) such as psoriasis (vulgaris), toxic and allergic contact eczema, atopic eczema, seborrhoeic eczema, Lichen simplex, sunburn, pruritus in the anogenital area, alopecia areata, hypertrophic scars, discoid lupus erythematosus, follicular and widespread pyodermias, endogenous and exogenous acne, acne rosacea and other prolife
- the compounds of the invention are useful in the treatment of diabetes insipidus and conditions associated with cerebral metabolic inhibition, such as cerebral senility, senile dementia (Alzheimer's disease), mem- ory impairment associated with Parkinson's disease or multiinfarct dementia; and also illnesses of the central nervous system, such as depressions or arteriosclerotic dementia; as well as for enhancing cognition.
- the compounds of the invention are useful in the treatment of diabetes mellitus, leukaemia and osteoporosis.
- the invention further relates to a method for the treatment of mammals, including humans, which are suffering from one of the above mentioned illnesses.
- the method is characterized in that a therapeutically active and pharmacologically effective and tolerable amount of one or more of the compounds according to the invention is administered to the ill mammal.
- the invention further relates to the compounds according to the invention for use in the treatment and/or prophylaxis of illnesses, especially the illnesses mentioned.
- the invention also relates to the use of the compounds according to the invention for the production of • • pharmaceutical compositions which are employed for the treatment and/or prophylaxis of the illnesses mentioned.
- the invention also relates to the use of the compounds according to the invention for the production of pharmaceutical compositions for treating disorders which are mediated by phosphodiesterases, in particular PDE4-mediated disorders, such as, for example, those mentioned in the specification of this invention or those which are apparent or known to the skilled person.
- the invention also relates to the use of the compounds according to the invention for the manufacture of pharmaceutical compositions having PDE4 inhibitory activity.
- the invention furthermore relates to pharmaceutical compositions for the treatment and/or prophylaxis of the illnesses mentioned comprising one or more of the compounds according to the invention.
- compositions comprising one or more compounds according to this invention and a pharmaceutically acceptable carrier.
- Said compositions can be used in therapy, such as e.g. for treating, preventing or ameliorating one or more of the abovementioned diseases.
- the invention still yet furthermore relates to pharmaceutical compositions according to this invention having PDE, particularly PDE4, inhibitory activity.
- the invention relates to an article of manufacture, which comprises packaging material and a pharmaceutical agent contained within said packaging material, wherein the pharmaceutical agent is therapeutically effective for antagonizing the effects of the cyclic nucleotide phosphodiesterase of type 4 (PDE4), ameliorating the symptoms of an PDE4-mediated disorder, and wherein the packaging material comprises a label or package insert which indicates that the pharmaceutical agent is useful for preventing or treating PDE4-mediated disorders, and wherein said pharmaceutical agent comprises one or more compounds of formula 1 according to the invention.
- the packaging material, label and package insert otherwise parallel or resemble what is generally regarded as standard packaging material, labels and package inserts for pharmaceuticals having related utilities.
- compositions are prepared by processes which are known per se and familiar to the person skilled in the art.
- the compounds according to the invention are either employed as such, or preferably in combination with suitable pharmaceutical auxiliaries and/or excipients, e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being between 0.1 and 95% and where, by the appropriate choice-of the auxiliaries • and/or excipients, a pharmaceutical administration form (e.g. a delayed release form or an enteric form) exactly suited to the active compound and/or to the desired onset of action can be achieved.
- suitable pharmaceutical auxiliaries and/or excipients e.g. in the form of tablets, coated tablets, capsules, caplets, suppositories, patches (e.g. as TTS), emulsions, suspensions, gels or solutions, the active compound content advantageously being
- auxiliaries, excipients, carriers, vehicles, diluents or adjuvants which are suitable for the desired pharmaceutical formulations on account of his/her expert knowledge.
- solvents for example anti- oxidants, dispersants, emulsifiers, preservatives, solubilizers, colorants, complexing agents or permeation promoters, can be used.
- compositions according to the invention may be performed in any of the generally accepted modes of administration available in the art.
- suitable modes of administration include intravenous, oral, nasal, parenteral, topical, transdermal and rectal delivery. Oral delivery is preferred.
- the compounds according to the invention are preferably also administered by inhalation in the form of an aerosol; the aerosol particles of solid, liquid or mixed composition preferably having a diameter of 0.5 to 10 ⁇ m, advantageously of 2 to 6 ⁇ m.
- Aerosol generation can be carried out, for example, by pressure-driven jet atomizers or ultrasonic atomizers, but advantageously by propellant-driven metered aerosols or propellant-free administration of mi- cronized active compounds from inhalation capsules.
- the administration forms additionally contain the required excipients, such as, for example, propellants (e.g. Frigen in the case of me- tered aerosols), surface-active substances, emulsifiers, stabilizers, preservatives, flavorings, fillers (e.g. lactose in the case of powder inhalers) or, if appropriate, further active compounds.
- propellants e.g. Frigen in the case of me- tered aerosols
- surface-active substances e.g. Frigen in the case of me- tered aerosols
- emulsifiers emulsifiers
- stabilizers emulsifiers
- preservatives e.g. lactose in the case of powder inhal
- the compounds according to the invention are in-particular administered in the form of those pharmaceutical compositions which are suitable for topical application.
- suitable pharmaceutical formulations are, for example, powders, emulsions, suspensions, sprays, oils, ointments, fatty ointments, creams, pastes, gels or solutions.
- compositions according to the invention are prepared by processes known per se.
- the dosage of the active compounds is carried out in the order of magnitude customary for PDE inhibitors.
- Topical application forms (such as ointments) for the treatment of dermatoses thus contain the active compounds in a concentration of, for example, 0.1-99%.
- the dose for administration by inhalation is customariy between 0.01 and 3 mg per day.
- the customary dose in the case of systemic therapy (p.o. or i.v.) is between 0.003 and 3 mg/kg per day.
- the dose for administration by inhalation is between 0.1 and 3 mg per day, and the dose in the case of systemic therapy (p.o. or i.v.). is between 0.03 and 3 mg/kg per day.
- the second messenger cyclic AMP (cAMP) is well-known for inhibiting inflammatory and immunocompe- tent cells.
- the PDE4 isoenzyme is broadly expressed in cells involved in the initiation and propagation of inflammatory diseases (H Tenor and C Schudt, in ..Phosphodiesterase Inhibitors", 21-40, sentThe Handbook of Immunopharmacology", Academic Press, 1996), and its inhibition leads to an increase of the intracellu- lar cAMP concentration and thus to the inhibition of cellular activation (JE Souness et al., Immunopharmacology 47: 127-162, 2000).
- Examples are the superoxide production of neutrophilic (C Schudt et al., Arch Pharmacol 344: 682-690, 1991) or eosinophilic (A Hatzel- •mann et al., Brit J Pharmacol -114: 821 -831, -1995) granulocytes, which can-be measured as luminol- enhanced chemiluminescence, or the synthesis of tumor necrosis factor- in monocytes, macrophages or dendritic cells (Gantner et al., Brit J Pharmacol 121 : 221-231, 1997, and Pulmonary Pharmacol Therap 12: 377-386, 1999).
- neutrophilic C Schudt et al., Arch Pharmacol 344: 682-690, 1991
- eosinophilic A Hatzel- •mann et al., Brit J Pharmacol -114: 821 -831, -1995
- granulocytes which can-be measured as luminol- enhanced chemilum
- the PDE4B2 (GB no. M97515) was a gift of Prof. M. Conti (Stanford University, USA). It was amplified from the original plasmid (pCMV5) via PCR with primers. Rb9 (5'- GCCAGCGTGCAAATAATGAAGG -3') and Rb10 (5'- AGAGGGGGATTATGTATCCAC -3') and cloned into the pCR-Bac vector (Invitrogen, Gron- ingen, NL).
- the recombinant baculovirus was prepared by means of homologous recombination in SF9 insect cells.
- the expression plasmid was cotransfected with Bac-N-Blue (Invitrogen, Groningen, NL) or Baculo-Gold DNA (Pharmingen, Hamburg) using a standard protocol (Pharmingen, Hamburg).
- Wt virus-free recombinant virus supernatant was selected using plaque assay methods. After that, high-titre virus supernatant was prepared by amplifying 3 times.
- PDE was expressed in SF21 cells by infecting 2x10 6 cells/ml with an MOI (multiplicity of infection) between 1 and 10 in serum-free SF900 medium (Life Technologies, Pais- ley, UK). The cells were cultured at 28°C for 48 - 72 hours, after which they were pelleted for 5-10 min at 1000 g and 4 °C.
- the SF21 insect cells were resuspended, at a concentration of approx. 10 7 cells/ml, in ice-cold (4°C) ho- mogenization buffer (20 mM Tris, pH 8.2, containing the following additions: 140 mM NaCl, 3.8 mM KCl, 1 mM EGTA, 1 mM MgCI 2 , 10 mM ⁇ -mercaptoethanol, 2 mM benzamidine, 0.4 mM Pefablock, 10 ⁇ M leupeptin, 10 ⁇ M pepstatin A, 5 ⁇ M trypsin inhibitor) and disrupted by ultrasonication. The homogenate was then centrifuged for 10 min at 1000xg and the supernatant was stored at -80 ⁇ O until subsequent use (see below). The protein content was determined by the Bradford method (BioRad, Kunststoff) using BSA as the standard.
- PDE4B2 activity is inhibited by the said compounds in a modified SPA (scintillation proximity assay) test, supplied by Amersham Biosciences (see procedural instructions "phosphodiesterase [3H]cAMP SPA enzyme assay, code TRKQ 7090", carried out in 96-well microtitre plates (MTP's ⁇ -The test volume is 100 ⁇ l and contains 20 mM Tris buffer (pH 7.4), 0.1 mg of BSA (bovine serum albumin)/ml, 5 mM Mg 2+ , 0.5 ⁇ M cAMP (including about 50,000 cpm of [3H]cAMP), 1 ⁇ l of the respective substance dilution in DMSO and sufficient recombinant PDE (1000xg supernatant, see above) to ensure that 10-20% of the cAMP is converted under the said experimental conditions.
- SPA sintillation proximity assay
- the final concentration of DMSO in the assay (1 % v/v) does not substantially affect the activity of the PDE investigated.
- the reaction is started by adding the substrate (cAMP) and the assay is incubated for a further 15 min; after that, it is stopped by adding SPA beads (50 ⁇ l).
- the SPA beads had previously been resuspended in water, but were then diluted 1 :3 (v/v) in water; the diluted solution also contains 3 mM IBMX to ensure a complete PDE activity stop.
- the MTP's are analyzed in commercially available luminescence detection devices.
- the corresponding ICso values of the compounds for the inhibition of PDE activity are determined from the concentration-effect curves by means of non-linear regression.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Physical Education & Sports Medicine (AREA)
- Rheumatology (AREA)
- Dermatology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Pulmonology (AREA)
- Pain & Pain Management (AREA)
- Hospice & Palliative Care (AREA)
- Cardiology (AREA)
- Psychiatry (AREA)
- Oncology (AREA)
- Heart & Thoracic Surgery (AREA)
- Psychology (AREA)
- Ophthalmology & Optometry (AREA)
- Transplantation (AREA)
- Otolaryngology (AREA)
- Gynecology & Obstetrics (AREA)
- Endocrinology (AREA)
- Reproductive Health (AREA)
- Hematology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Other In-Based Heterocyclic Compounds (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/591,478 US20070191414A1 (en) | 2004-03-09 | 2005-03-08 | Novel isoamido-substituted hydroxy-6-phenylphenanthridines |
| AU2005220034A AU2005220034A1 (en) | 2004-03-09 | 2005-03-08 | Novel isoamido-substituted hydroxy-6-phenylphenanthridines and their use as PDE4 inhibitors |
| JP2007502338A JP2007527899A (ja) | 2004-03-09 | 2005-03-08 | 新規のイソアミド置換されたヒドロキシ−6−フェニルフェナントリジン |
| CA002558375A CA2558375A1 (en) | 2004-03-09 | 2005-03-08 | Novel isoamido-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
| BRPI0508361-3A BRPI0508361A (pt) | 2004-03-09 | 2005-03-08 | hidróxi-6-fenilfenantridinas substituìdas por isoamido |
| EP05729761A EP1745025A2 (en) | 2004-03-09 | 2005-03-08 | Novel isoamido-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
| IL177497A IL177497A0 (en) | 2004-03-09 | 2006-08-15 | Isoamido-substituted hydroxy-6-phenylphenanthridine derivatives and pharmaceutical compositions containing the same |
| NO20064417A NO20064417L (no) | 2004-03-09 | 2006-09-29 | Nye isoamidosubstituertehydroksy-6-fenylfenantridiner |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP04100959.8 | 2004-03-09 | ||
| EP04100959 | 2004-03-09 | ||
| EP05100545.2 | 2005-01-27 | ||
| EP05100545 | 2005-01-27 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2005084104A2 true WO2005084104A2 (en) | 2005-09-15 |
| WO2005084104A3 WO2005084104A3 (en) | 2005-10-13 |
Family
ID=34921314
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2005/051025 Ceased WO2005084104A2 (en) | 2004-03-09 | 2005-03-08 | Novel isoamido-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20070191414A1 (https=) |
| EP (1) | EP1745025A2 (https=) |
| JP (1) | JP2007527899A (https=) |
| KR (1) | KR20060124784A (https=) |
| AU (1) | AU2005220034A1 (https=) |
| BR (1) | BRPI0508361A (https=) |
| CA (1) | CA2558375A1 (https=) |
| IL (1) | IL177497A0 (https=) |
| NO (1) | NO20064417L (https=) |
| WO (1) | WO2005084104A2 (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7423046B2 (en) | 2002-08-29 | 2008-09-09 | Nycomed Gmbh | 3-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
| US7585872B2 (en) | 2004-02-18 | 2009-09-08 | Nycomed Gmbh | Guanidinyl-substituted hydroxy-6-phenylphenanthridines as effective phosphodiesterase (PDE) 4 inhibitors |
| US7718668B2 (en) | 2005-03-02 | 2010-05-18 | Nycomed Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US8003798B2 (en) | 2004-03-03 | 2011-08-23 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP4587294B2 (ja) * | 2002-08-29 | 2010-11-24 | ニコメッド ゲゼルシャフト ミット ベシュレンクテル ハフツング | Pde4インヒビターとしての2−ヒドロキシ−6−フェニルフェナントリジン |
| AR049419A1 (es) * | 2004-03-03 | 2006-08-02 | Altana Pharma Ag | Hidroxi-6-fenilfenantridinas sustituidas con heterociclilo |
| EP1725534A1 (en) * | 2004-03-10 | 2006-11-29 | Altana Pharma AG | Novel amido-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR9707233A (pt) * | 1996-01-31 | 1999-07-20 | Byk Gulden Lomberg Chem Fab | Fenantridinas |
| US6127378A (en) * | 1996-03-26 | 2000-10-03 | Byk Gulden Lomberg Chemische Fabrik Gmbh | Phenanthridines substituted in the 6 position |
| SI0889886T1 (en) * | 1996-03-26 | 2003-02-28 | Altana Pharma Ag | Novel phenanthridines substituted in the 6 position |
| PT998460E (pt) * | 1997-07-25 | 2004-07-30 | Altana Pharma Ag | Novos derivados de tetrazole |
| JP2001510827A (ja) * | 1997-07-25 | 2001-08-07 | ビイク グルデン ロンベルク ヒエーミツシエ フアブリーク ゲゼルシヤフト ミツト ベシユレンクテル ハフツング | 置換6−フェニルフェナントリジン |
| DK1075477T3 (da) * | 1998-05-05 | 2003-06-30 | Altana Pharma Ag | Nye benzonaphthyridin-N-oxider |
| TR200501553T2 (tr) * | 1999-01-15 | 2005-06-21 | Altana Pharma Ag | PDE-IV inhibe edici aktivitesi olan fenilfenantridinler |
| JP4587294B2 (ja) * | 2002-08-29 | 2010-11-24 | ニコメッド ゲゼルシャフト ミット ベシュレンクテル ハフツング | Pde4インヒビターとしての2−ヒドロキシ−6−フェニルフェナントリジン |
| ATE353217T1 (de) * | 2002-08-29 | 2007-02-15 | Altana Pharma Ag | 3-hydroxy-6-phenylphenanthridine als pde-4 inhibitoren |
-
2005
- 2005-03-08 AU AU2005220034A patent/AU2005220034A1/en not_active Abandoned
- 2005-03-08 EP EP05729761A patent/EP1745025A2/en not_active Withdrawn
- 2005-03-08 JP JP2007502338A patent/JP2007527899A/ja not_active Withdrawn
- 2005-03-08 BR BRPI0508361-3A patent/BRPI0508361A/pt not_active IP Right Cessation
- 2005-03-08 KR KR1020067020594A patent/KR20060124784A/ko not_active Withdrawn
- 2005-03-08 US US10/591,478 patent/US20070191414A1/en not_active Abandoned
- 2005-03-08 CA CA002558375A patent/CA2558375A1/en not_active Abandoned
- 2005-03-08 WO PCT/EP2005/051025 patent/WO2005084104A2/en not_active Ceased
-
2006
- 2006-08-15 IL IL177497A patent/IL177497A0/en unknown
- 2006-09-29 NO NO20064417A patent/NO20064417L/no not_active Application Discontinuation
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8202880B2 (en) | 2002-08-29 | 2012-06-19 | Nycomed Gmbh | 3-hydroxy-6-phenylphenanthridines as PDE4 inhibitors |
| US7423046B2 (en) | 2002-08-29 | 2008-09-09 | Nycomed Gmbh | 3-hydroxy-6-phenylphenanthridines as pde-4 inhibitors |
| US7585872B2 (en) | 2004-02-18 | 2009-09-08 | Nycomed Gmbh | Guanidinyl-substituted hydroxy-6-phenylphenanthridines as effective phosphodiesterase (PDE) 4 inhibitors |
| US8329906B2 (en) | 2004-02-18 | 2012-12-11 | Nycomed Gmbh | Guanidinyl-substituted hydroxy-6-phenylphenanthridines |
| US8883818B2 (en) | 2004-03-03 | 2014-11-11 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8318944B2 (en) | 2004-03-03 | 2012-11-27 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8324391B2 (en) | 2004-03-03 | 2012-12-04 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8003798B2 (en) | 2004-03-03 | 2011-08-23 | Nycomed Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8455653B2 (en) | 2004-03-03 | 2013-06-04 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US9149479B2 (en) | 2004-03-03 | 2015-10-06 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US9387205B2 (en) | 2004-03-03 | 2016-07-12 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US9962377B2 (en) | 2004-03-03 | 2018-05-08 | Takeda Gmbh | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors |
| US8354535B2 (en) | 2005-03-02 | 2013-01-15 | Nycomed Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US8754218B2 (en) | 2005-03-02 | 2014-06-17 | Takeda Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US8829189B2 (en) | 2005-03-02 | 2014-09-09 | Takeda Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
| US7718668B2 (en) | 2005-03-02 | 2010-05-18 | Nycomed Gmbh | Salts of 6-heterocycle substituted hexahydrophenanthridine derivatives |
Also Published As
| Publication number | Publication date |
|---|---|
| US20070191414A1 (en) | 2007-08-16 |
| IL177497A0 (en) | 2006-12-10 |
| BRPI0508361A (pt) | 2007-11-20 |
| KR20060124784A (ko) | 2006-12-05 |
| WO2005084104A3 (en) | 2005-10-13 |
| JP2007527899A (ja) | 2007-10-04 |
| CA2558375A1 (en) | 2005-09-15 |
| NO20064417L (no) | 2006-10-10 |
| EP1745025A2 (en) | 2007-01-24 |
| AU2005220034A1 (en) | 2005-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9962377B2 (en) | Hydroxy-6-heteroarylphenanthridines and their use as PDE4 inhibitors | |
| US8329906B2 (en) | Guanidinyl-substituted hydroxy-6-phenylphenanthridines | |
| US20070185149A1 (en) | Novel amido-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibtors | |
| US20080161339A1 (en) | Novel Thio-Containing Hydroxy-6-Phenylphenanthridines and their Use as Pde4 Inhibitors | |
| US20070191414A1 (en) | Novel isoamido-substituted hydroxy-6-phenylphenanthridines | |
| US20070259909A1 (en) | Novel Difluoroethoxy-Substituted Hydroxy-6-Phenylphenanthridines and Their Use as Pde4 Inhibitors | |
| US20070191413A1 (en) | Novel heterocycle-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors | |
| EP1846390A1 (en) | Novel 6-pyridylphenanthridines | |
| MXPA06009893A (en) | Novel isoamido-substituted hydroxy-6-phenylphenanthridines and their use as pde4 inhibitors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006/06635 Country of ref document: ZA Ref document number: 200606635 Country of ref document: ZA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 177497 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 549253 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007502338 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2006/009893 Country of ref document: MX Ref document number: 200580006520.2 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2558375 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005729761 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10591478 Country of ref document: US Ref document number: 2007191414 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020067020594 Country of ref document: KR Ref document number: 2005220034 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1171/MUMNP/2006 Country of ref document: IN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| ENP | Entry into the national phase |
Ref document number: 2005220034 Country of ref document: AU Date of ref document: 20050308 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005220034 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020067020594 Country of ref document: KR |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005729761 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 10591478 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: PI0508361 Country of ref document: BR |