WO2005040391A1 - Compositions and methods for differentiating stem cells - Google Patents

Compositions and methods for differentiating stem cells Download PDF

Info

Publication number
WO2005040391A1
WO2005040391A1 PCT/AU2004/001469 AU2004001469W WO2005040391A1 WO 2005040391 A1 WO2005040391 A1 WO 2005040391A1 AU 2004001469 W AU2004001469 W AU 2004001469W WO 2005040391 A1 WO2005040391 A1 WO 2005040391A1
Authority
WO
WIPO (PCT)
Prior art keywords
interleukin
hil
cell
protein
cells
Prior art date
Application number
PCT/AU2004/001469
Other languages
French (fr)
Inventor
Kong-Hong Andy Choo
Lee Hwa Wong
Richard Eric Saffery
Original Assignee
Murdoch Childrens Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2003905894A external-priority patent/AU2003905894A0/en
Application filed by Murdoch Childrens Research Institute filed Critical Murdoch Childrens Research Institute
Publication of WO2005040391A1 publication Critical patent/WO2005040391A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention relates generally to the field of tissue engineering and genetic manipulation of cells and to methods for generating tissue suitable for use in repair, replacement, rejuvenation or augmentation therapy. Even more particularly, the present invention contemplates a method for genetically manipulating a stem cell by introducing a nucleic acid molecule comprising a centromere or neocentromere into the stem cell or a parent of the stem cell, wherein the nucleic acid molecule conveys genetic information which is capable of introducing to or modifying a trait within the stem cell or progeny of the stem cell such as but not limited to modulating the level of stem cell proliferation, differentiation and/or self-renewal.
  • the engineered stem cells are useful inter alia in tissue repair, replacement, rejuvenation and/or augmentation therapy.
  • the engineered stem cells may also be re-programmed, for example, to direct the cells down a different cell lineage.
  • stem cell One such cell type is a stem cell. These cells are undifferentiated cells that are capable of self-maintenance and proliferation and have the potential to generate a large repertoire of functional, differentiated progeny (reviewed in Alison et al, J. Pathol. 197(4): 419-423, 2002; Rodda et al, Int JDev Biol. 46(4): 449-458, 2002). Stem cells produce the cells that eventually form the tissues and organs of multicellular organisms. The property that distinguishes stem cells from other cell types is that they can self-renew at each mitotic division while also producing daughter cells that differentiate into specialized cells.
  • stem cells There are many different types of stem cells, each of which has a different potential for the number and type of cells into which it can finally differentiate. Fertilized oocytes (zygotes) and the progeny ofthe first division are known as totipotent cells as they can give rise to a complete embryo including the placenta. Following the generation ofthe totipotent cells, a blastocyst is formed which incorporates the inner cell mass (ICM). These cells have the potential to give rise to any cell type in the adult animal, with the exception of placental tissue. Finally, there exists a stem cell set, which are described as being multipotent stem cells. These cells are capable of multiplying in culture and can be maintained for extended periods of time.
  • ICM inner cell mass
  • Organisms such as humans retain a complete set of genetic information in all adult body cells yet only a small fraction of an adult's cells have the ability to develop into multiple cell types. Recent research has shown that differentiated adult cells can be treated such that they become totipotent. Such totipotent or stem cells offer the possibility for a number of therapeutic uses such as repairing heart muscle after a heart attack or brain function after a stroke.
  • a stem cell has the ability to make any cell or tissue in the body and provide a valuable tool for the generation of tissues and cells for use in tissue replacement, repair, rejuvenation or augmentation. Further, the ability to isolate stem cells from adults removes many of the problems associated with tissue transplantation, such as the limited number of donor organs available, as well as problems associated with tissue rejection, such as graft versus host disease and host versus graft disease.
  • stem cell differentiation has been somewhat haphazard with mixed results using cocktails of one or more growth factors and/or cvtokine.
  • a genetic approach to controlling stem cell activities offers great opportunities for controlling differentiation, proliferation and self-renewal as well as introducing or modifying particular traits which could be passed on to tissue.
  • genetic manipulation of any cells including stem cells has largely been at the level of chromosomal manipulation such as introducing one or more mutations or generating gene knock-in or knock-out events.
  • centromeres have been proposed for use in generating centromere-based artificial chromosome-containing vectors for gene therapy.
  • the centromere is an essential structure for sister chromatid cohesion and proper chromosomal segregation during mitotic and meiotic cell divisions.
  • the centromere of the budding yeast Saccharomyces cerevisiae has been extensively studied and shown to be contained within a relatively short DNA segment of 125 bp that is organized into an 8 bp (CDEI) and 26 bp (CDEIII) domain, separated by a 78 to 87 bp, highly AT-rich, middle (CDEII) domain.
  • centromere of the fission yeast Schizosaccharomyces pombe is considerably larger, ranging from 40-100 kb and consists of a central core DNA element of 4-7 kb flanked on both sides by inverted repeat units.
  • the functional DNA components of a higher eukaryotic centromere have been characterized in a mini-chromosome from Drosophila melanogaster and shown to consist of a 220 kb essential core DNA flanked by 200 kb of highly repeated sequences on one side.
  • the mammalian centromere like the centromeres of all higher eukaryotes studied to date, contains a great abundance of highly repetitive, heterochromatic DNA.
  • a typical human centromere contains 2-4 Mb ofthe 171 bp ⁇ -satellite repeat , plus a smaller and more variable quantity of a 5 bp satellite III DNATransfection of a cloned 17 kb uninterrupted ⁇ -satellite array into cultured simian cells (Haaf et al, Cell 70: 681-696, 1992) or a 120 kb ⁇ -satellite-containing YAC into hamster cells (Larin et al, Hum. Mol. Genet.
  • telomere-associated chromosome fragmentation (Farr et al, EMBO Journal 14: 5444-5454, 1995).
  • CENP-A a protein localized to the outer kinetochore domain, is a centromere-specific core histone that shows sequence homology to the histone H3 protein and serves to differentiate the centromere from the rest of the chromosome at the most fundamental level of chromatin structure - the nucleosome (Choo, Dev. Cell 1: 165-177, 2001).
  • CENP- B a protein which associates with the centromeric heterochromatin through its binding to the CENP-B box motif found in primate ⁇ -satellite and mouse minor satellite DNA, probably has a role in packaging centromeric heterocliromatic DNA - a role which, however, is not indispensable since the protein is undetectable on the Y chromosome (Pluta et al, Trends Biochem. 15: 181-185, 1990), is found on the inactive centromeres of dicentric chromosomes (Earnshaw et al, Chromosoma 98: 1-12, 1989), and its gene can be knocked out in mice without detectable consequences to mitotic and meiotic cell divisions (Hudson et al, J. Cell Biol.
  • CENP-C has been shown to be located at the inner kinetochore plate and has an essential although yet undetermined centromere function as seen, for example, from inhibition of mitotic progression following microinjection of anti-CENP-C antibodies into cells (Bernat et al, J. Cell. Biol. Ill: 1519- 1533, 1990; Tomkiel et al, J. Cell. Biol. 125: 531-545, 1994), from its association with the active but not the inactive centromeres of dicentric chromosomes (Earnshaw et al, 1989 supra; Page et al, Hum. Mol. Genet. 4: 289-294, 1995; Sullivan and Schwartz, Hum. Mol. Genet.
  • CENP-H and CENP-I are the latest essential constitutively binding centromere proteins that have been described (Sugata et al, J. Biol. Chem. 274: 27343-27346, 1999; Suga ⁇ a et al, Hum. Mol. Genet. 9: 2919-2926, 2000; Nishihashi et al, Dev. Cell 2: 463-476, 2002; Liu et al, Nat. Cell Biol. 5: 341-345).
  • U.S. Patent No. 6,265,211 and International Patent Publication No. WO 98/51790 describe an unusual human marker chromosome, "mardel(l ⁇ )", which is 100% stable in mitotic division both in the human subject from which it was isolated and in established fibroblast and transformed lymphoblast cultures.
  • a region of he mardel(l ⁇ ) chromosome has been cloned together with the corresponding region from a normal human subject.
  • the nucleic acid molecules cloned contained no ⁇ -satellite repeats yet confer mitotic stability.
  • the nucleic acid molecules encompass, therefore, a new form of centromere referred to as a "neocentromere".
  • the centromeric regions of higher organisms have traditionally been described as inhibitory to transcriptional activity (Choo, 2001 supra).
  • the large tracts of repetitive DNA found at centromeres have, until the advent of the present invention, prevented proper analysis of transcriptional activity.
  • SEQ ID NO: Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:).
  • the SEQ ID NOs: correspond numerically to the sequence identifiers ⁇ 400>1 (SEQ ID NO:l), ⁇ 400>2 (SEQ ID NO:2), etc.
  • SEQ ID NO:1 sequence identifiers ⁇ 400>1
  • SEQ ID NO:2 sequence identifiers
  • the present invention is predicated in part on the use of vectors in the form of artificial chromosomes to genetically manipulate stem cells.
  • the genetically modified stem cells may have new traits introduced or existing traits altered.
  • the artificial chromosomes may carry genetic material which modulates a stem cell's ability to proliferate, differentiate or self-renew.
  • the genetic material may also enable a partially differentiated stem cell or even an adult stem cell to be re-programmed into different cell lineages.
  • the vector is in the form of a mammalian artificial chromosome (MAC) and even more preferably, the vector is a human artificial chromosome (HAC).
  • MAC mammalian artificial chromosome
  • HAC human artificial chromosome
  • the present invention provides a stem cell comprising a self-replicating artificial chromosome comprising a neocentromere having centromeric chromatin domains wherein the artificial chromosome comprises expressible genetic material within the centromeric chromatin domains or in a region proximal thereto which modifies or introduces at least one trait in said stem cell.
  • the present invention provides for a method of modulating the genetic potential of a stem cell, said method comprising introducing into said stem cell or a parent of said stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises expressible genetic material within the centromeric chromatin domains or in a region proximal thereto which modifies or introduces at least one trait in said stem cell.
  • the invention provides for a method for directing differentiation, proliferation or self-renewal of a stem cell by introducing into the stem cell or a parent of said stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises genetic material within the centromeric chromatin domains or in a region proximal thereto which is capable of generating an expression production which modulates stem cell differentiation, proliferation and/or self-renewal.
  • the present invention is directed to methods of proliferation and/or differentiation and/or self-renewal of stem cells in vivo, said method comprising administering a stem cell or population of homozygous stem cells or a population of heterozygous stem cells comprising artificial chromosomes comprising a neocentromere having centromeric chromatin domains incorporated in the cells and which expresses genetic material within the centromeric chromatin domains or in a region proximal thereto which is capable of modulating the level of stem cell differentiation, proliferation and/or self-renewal.
  • the artificial chromosome-transformed stem cells of the present invention are maintained and expanded in vivo.
  • the stem cells are maintained and proliferated in vitro prior to being transferred to a subject.
  • the stem cells contemplated in accordance with the present invention include inter alia embryonic stem cells, somatic stem cells, germ stem cells, epidermal stem cells, adult neural stem cells, keratinocyte stem cells, melanocyte stem cells, adult renal stem cells, embryonic renal epithelial stem cells, embryonic endodermal stem cells, hepatocyte stem cells, mammary epithelial stem cells, bone marrow-derived stem cells, skeletal muscle stem cells, bone marrow mesenchymal stem cells, CD34 + hematopoietic stem cells, mesenchymal stem cells.
  • the artificial chromosomes modulate differentiated cell types such as keratinocytes, fibroblasts, pancreatic islets, pancreatic ⁇ - cells, kidney epithelial cells, hepatocytes, bile duct epithelial cells, lung fibroblasts, bronchial epithelial cells, alveolar type II pneumocytes, cardiomyocytes, simple squamous epithelial cells, descending aortic endothelial cells, aortic arch endothelial cells, aortic smooth muscle cells, corneal epithelial cells, osteoblasts, peripheral blood mononuclear progenitor cells, osteoclasts, stromal cells, splenic precursor cells, splenocytes, CD4 T- cells, CD8 T-cells, NK cell, monocytes, macrophages, dendritic cells, B-cells, goblet cells, pseudostriated ciliated columnar cells, pseudostratified
  • the genetic material expressed within or near the centromeric chromatin domain on the artificial chromosomes induces differentiation or proliferation of the stem cells and hence enables reprogramming of partially differentiated stem cells.
  • the genetic material carried by the artificial chromosomes utilized in accordance with the present invention include Bcl-2, Bcl-w and Bcl-xy, Bcl-2-associated athanogene 1, CCAAT/enhancer binding protein (C/EBP), empty spiracles homolog 1 (Drosophila), empty spiracles homolog 2 (Drosophila), forkhead box Gl, proprotein convertase subtilisin/kexin type 9, suppressor of cytokine signaling 2, T-cell leukemia, homeobox 1, T-cell leukemia, homeobox 3, insulin-like growth factor 1, neuregulin 1, neurotrophin 5, cut-like 1 (Drosophila), growth factor independent 1, mucolipin 3, mucosal vascular addressin cell adhesion molecule 1, tumor susceptibility gene 101, endothelin 3, endothelin receptor type B and/or a bone morphogenetic protein (BMP) such as BMP1, BMP2, BMP3 or BMP4.
  • BMP bone morphogen
  • the genetic material encodes a cytokine, growth factor or receptor selected include without being limited to Activin RIA (Activin Receptor), ADAM (A
  • ADAMTS Disintegrin-like and Metalloproteinase Domain with Thrombospondin Type I Motifs
  • ALCAM Activated Leukocyte Cell Adhesion Molecule
  • ALK Activin Receptor-like Kinase
  • ANG Angiogenin
  • Ang CC Chemokine Receptors
  • APAF-1 Apoptosis Protease Activating Factor- 1)
  • APE AP Endonuclease
  • APJ A Seven Transmembrane-domain Receptor
  • APP Amyloid Precursor Protein
  • APRIL a Proliferation-inducing Ligand
  • AR Adiregulin
  • ARC Agouti-related Transcript
  • ART Fibroblast Growth Factor
  • Axl a Receptor Tyrosine Kinase
  • ⁇ 2M ⁇ 2 Microglobulin
  • B7-H B7 Homolog
  • BACE ⁇ -site APP Clea
  • Figure 1 is a representation showing NC gene expression and domain organisation
  • (a) is a diagramafic representation of a BAG array spanning a total of 8 Mb, showing positions of clones (horizontal bars) used in ChIP- and S/MAR-array analyses. Positions and orientations of genes located at 10q25 used in expression study are shown by arrows or arrowheads (green for expressed genes, red for non-expressed genes)
  • (b) is a graphical representation of a scaffold/matrix attachment along the 10q25 BAG array as determined by S/MAR-array analysis on chromatin prepared from mardel(l ⁇ ) and normal chromosome 10-containing hybrid cell lines, denoted as M10 and N10 respectively.
  • Green shading indicates position of the CENP-H-associated region
  • (d) is a graphical representation of the distribution of HP1 protein along the 10q25 BAC contig (x-axis) as determined by ChlP-array analysis. The y-axis shows the fold difference between the normalised bound/input ratio of M10 and N10 cell lines. Each data-point is the mean of four independent experiments. Significance (p ⁇ 0.01) of the data-points was determined using a Student's t-test and is indicated by *.
  • Orange shading indicates the position of the HP 1 -associated domain
  • (e) is a diagramatic representation of the organisation of various modified chromatin domains is shown in relation to the expression status of underlying genes #1-15 ( Figure la). (+) denotes positive gene expression following NC formation, whereas (?) indicates unknown expression status of a gene present in the HP 1 -associated chromatin domain.
  • Figure 2 is a representation of CT analysis of expressed genes.
  • 1/ ⁇ CT (y-axis) provides a measure of expression level of individual genes
  • (a) is a graphical representation of a comparison of results for somatic cell hybrids containing human chromosome 10 (shown as grey bars) and those for hybrids containing mardel(l ⁇ ) (black bars) indicate no major difference between hybrid pairs for all genes tested.
  • ES-M10 mardel(10)-containing mouse ES hybrid cell line
  • ES-M10 mardel(10)-containing mouse ES hybrid cell line
  • CT values of expressed genes including hCG39837 spanning the CENP-A-associated domain
  • ES-WT photographic representation gel electrophoresis of RT-PCR products obtained by SYBR green and TAQman analyses of hCG39837, showing specificity of gene amplification.
  • ES-WT refers to wild type ES cells, from which monochromosomal mardel(10)-containing hybrid lines ES-M10-9, -19, and -20 were derived.
  • NT no template control
  • S results from SYBR green
  • T results from TAQman experiments.
  • Figure 3 is a visualisation of scaffold/matrix attachment on metaphase chromosomes. FISH on histone-depleted chromosomes was performed as published (Bickmore and Oghene, Cell 84(1): 95-104, 1996). A, Chromosome-10 centromeric ⁇ -satellite probe showing tightly packed signals (closed arrow).
  • Figure 4 is a representation showing truncation of mardel(l ⁇ ) in mouse embryonic stem cells, (a) Structure of TACT (telomere-associated chromosomal truncation) targeting constructs used for truncating mardel(l ⁇ ).
  • Targeting DNA B43all and B79el6
  • a mammalian selectable marker either puromycin or hygromycin resistance gene, puromycin [registered trademark] hygromycin [registered trademark]
  • Htel human telomeric DNA
  • NC-MiC8a and 20f were the result of truncations using construct targeting B43all site with puromycin resistance gene followed by a second truncation using construct containing hygromycin resistance gene targeting B79el6s.
  • Vertical shaded area represents the centromere protein CENP-A-binding domain (Lo et al. 2001 A supra).
  • Open arrowheads indicate positions of intended targeted truncation. (+) denotes a positive FISH result for a BAC or cosmid probe on an NC-MiC, while (-) indicates a negative FISH result. Color copies of this figure are available from the patentee.
  • Figure 5 is a photomicrographic representation showing FISH analysis of NC-MiC6 in human HCT116pgrxr cell line.
  • NC-MiC6 is indicated by arrow and human chromosome 10 by arrowhead,
  • (b) Split images of (a) showing DAPI staining.
  • Figure 6 is a photomicrographic representation showing FISH analysis of NC-MiC6 in human 293trex cell line.
  • NC-MiC6 is indicated by arrow and human chromosome 10 by arrowhead,
  • (b) Split images of (a) showing DAPI staining.
  • Figure 7 is a photomicrographic representation showing FISH analysis NC-MiC6 in HCTl 16pgrxr (a) and 293trex (b).
  • NC-MiC6 is indicated by arrow and chromosome 10 by arrowhead, (i) FISH using B513g5 NC probe (green) and ⁇ -satellite DNA pTRA7 (red), (ii, iii) split images for pTRA7 and DAPI, respectively, showing absence of centromere- specific ⁇ -satellite DNA on NC-MiC6.
  • Figure 8 is a photomicrographic representation showing FISH analysis of NC-MiCs 53g, 8a and 20f. NC-MiCs are indicated by arrow, (a) Combined FISH images using B153g5 NC cosmid probe (green) and mouse major satellite DNA probe (red), showing absence of major satellite on NC-MiC53g (i), NC-MiC8a (ii) and NC-MiC20f (iii). (b) Split images of (a) showing DAPI staining. Color copies of this figure are available from the patentee.
  • Figure 9 is a photomicrographic representation showing FISH analysis of NC-MiCs 53g, 8a and 20f. NC-MiCs are indicated by arrow, (a) Combined FISH images using B153g5 NC cosmid probe (green) and mouse minor satellite DNA probe (red), showing absence of minor satellite on NC-MiC53g (i), NC-MiC8a (ii) and NC-MiC20f (iii). (b) Split images of (a) showing DAPI staining.
  • Figure 10 is a photomicrographic representation showing FISH analysis of NC-MiCs 53g, 8a and 20f. NC-MiCs are indicated by arrow, (a) Combined FISH images using B153g5 NC cosmid probe (green) and mouse cot DNA probe (red), showing absence of mouse DNA on NC-MiC53g (i), NC-MiC8a (ii) and NC-MiC20f (iii). (b) Split images of (a) showing DAPI staining.
  • Figure 11 is a photomicrographic representation showing FISH analysis of NC-MiCs 53g, 8a and 20f. NC-MiCs are indicated by arrow, (a) FISH using zeocin resistance gene (green) showing presence of zeocin resistance gene on NC-MiC53g (i), NC-MiC8a (ii) and NC-MiC20f (iii). (b) Split images of (a) showing DAPI staining.
  • Figure 12 is a representation showing formation and characterization of NC-MiCl.
  • (a) Mardel(lO) was formed following a complex rearrangement in which the central part of chromosome 10 was deleted to form a ring structure with joining of the ends and neocentromere formation producing the mardel(l ⁇ ) marker chromosome.
  • NC-MiCl was formed as a result of unknown rearrangements following transfer of this marker from a CHO based somatic cell hybrid line (Saffery et al, Proc. Natl. Acad. Sci.
  • Figure 13 is a photographic representation showing microcell-mediated chromosome transfer of mardel(l ⁇ ) into mouse ESGFP cells.
  • Mardel(lO) is indicated by arrow, (i-iii) Combined image, and split images for green, and red, respectively, (a) FISH using NC-specific probe E8 (ii, green) and human Cotl DNA (iii, red), showing the sole presence of mardel(l ⁇ ) and the absence of other human chromosomes in ESGFPmar(10)# 1. (b) FISH using E8 (ii, green) and mouse centromeric major satellite DNA (iii, red), showing absence of mouse major satellite in mardel(l ⁇ ) in ESGFPmar(10)# 1.
  • Figure 14 is a photographic representation showing microcell-mediated chromosome transfer of NC-MiC-1 into mouse ESGFP cells.
  • FISH FISH using neocentromere-specific probe E8 (ii, green) and human cotl DNA (iii, red), showing the presence of NC-MiC 1 and absence of other human chromosomes in ESGFPNC-MiC 1 #2.
  • NC-MiCl is indicated by arrow, (i-iii) Combined image, and split images for red and green, respectively, (a) FISH using BAC probe B153g5 (ii, green) and mouse centromeric major satellite DNA (iii, red), showing absence of mouse major satellite in NC- MiCl in ESGFPNC-MiCl#2. (c) FISH using B153g5 (ii, green) and mouse centromeric minor satellite DNA (iii, red), showing absence of mouse minor satellite inNC-MiCl in ESGFPNC-MiCl#2. (d) FISH using B153g5 (ii, green) and mouse genomic DNA-paint (iii, red), showing absence of mouse genomic DNA in NC-MiCl in ESGFPNC-MiCl#2.
  • Figure 15 is a photographic representation showing characterization of mardel(l ⁇ ) in various tissues of chimeric mice. FISH analysis of tissues derived from chimeric mice PL, CH and KM. Mardel(lO) is indicated by arrow, (a) (i-iii) FISH using E8 probe (green) and human cotl DNA (red), showing presence of mardel(l ⁇ ) in cells cultured from PL's lung (i), PL's spleen (ii), and CH's tail (iii).
  • Figure 16 is a photographic representation showing characterization of NC-MiCl in various tissues of chimeric mice. FISH analysis of tissues derived from chimeric mice TT and TEQ. NC-MiCl is indicated by arrow. FISH using B153g5 probe (i, green) and DAPI (ii), showing presence of NC-MiCl in cells cultured from TT's skin (a), TEQ's lung (b), and TEQ 's skin (c).
  • Figure 17 is a photographic representation showing the characterization of NC-MiCl in germline embryos. FISH analysis of tissues derived from chimeric mouse JL. NC-MiCl is indicated by arrow, (a-c) FISH using human cotl DNA as probe (i) and DAPI staining (ii), showing the presence of NC-MiCl in cells cultured from JL embryos at 9.5 days (b,c) and 2.5 day s(a) post-coitum, and the presence of more than one copy of NC-MiCl in the cells 9.5-day old embryos.
  • the present invention provides a means for genetically modifying stem cells or parent cells of stem cells including partially differentiated committed or adult stem cells as well as progeny thereof.
  • the genetically modified stem cell are useful in generating tissue suitable for use in replacement, repair, rejuvenation and/or augmentation therapy and as a source of cellular therapeutics.
  • the present invention further contemplates for a method of treatment or prophylaxis of a subject by the administration of stem cells genetically modified via an artificial chromosome.
  • the artificial chromosome of the present invention comprises a neocentromere having one or more definable centromeric chromatin domains.
  • the neocentromere is as defined in U.S. Patent No. 6,265,211 and is devoid of ⁇ -satellite repeat DNA.
  • the present invention contemplates a method for generating partially differentiated cells or cells with a propensity to develop or differentiate into mature cells or terminally differentiated cells or re-programmed cells for use in the treatment or prophylaxis of trauma or disease, by introducing a vector comprising an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises expressible genetic material within the centromeric chromatin domains into a stem cell or parent thereof.
  • one aspect of the present invention provides a stem cell comprising a self- replicating artificial chromosome comprising a neocentromere having centromeric chromatin domains wherein the artificial chromosome comprises expressible genetic material within the centromeric chromatin domains or in a region proximal thereto which modifies or introduces at least one trait in said stem cell.
  • Another aspect of the present invention provides for a method of modulating the genetic potential of a stem cell, said method comprising introducing into said stem cell or a parent of said stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains or in a region proximal thereto which comprises expressible genetic material within the centromeric chromatin domains which modifies or introduces at least one trait in said stem cell.
  • Still a further aspect of the invention provides for a method for directing differentiation, proliferation or self-renewal of a stem cell by introducing into the stem cell or a parent of said stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises genetic material within the centromeric chromatin domains or in a region proximal thereto which is capable of generating an expression production which modulates stem cell differentiation, proliferation and/or self-renewal.
  • the present invention provides, therefore, a method of generating a differentiated cell, mature cell or a cell capable of differentiating into mature tissue exhibiting a particular trait by introducing into a stem cell or a parent of a stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises expressible genetic material within the centromeric chromatin domains or in a region proximal thereto wherein the expression product adds or modifies a trait exhibited by the stem cell prior to genetic manipulation.
  • a trait is a feature of the stem cell which is unique to the stem cell or which directs the stem cell down a particular cell lineage pathway, or which affects its potential to differentiate, proliferate or self-renew.
  • the trait may also be in the form of a cell surface or sub-surface receptor or ligand or may be a particular molecule such as an enzyme involved in a genetic, physiological or bacterial pathway or attribute.
  • Stem cell includes reference to a single stem cell or a multiplicity of stem cells.
  • Stem cells of the present include embryonic stem cells, adult stem cells and somatic stem cells.
  • the embryonic stem cells of the present invention may be freshly derived primary cells, a stem-cell line or an embryonic carcinoma cell line. All other stem cells from somatic tissue (every tissue excluding germ cell tissue) are defined in general as “somatic stem cells”, “mature stem cells”, “progenitor stem cells”, “precursor stem cells” and “precursor cells”.
  • the germline stem cells are the final class of stem cells.
  • Stem cells of the present invention may be derived from any human or mammalian or non- mammalian animal or avian species.
  • Cell differentiation is the process whereby relatively imspecialized cells, e.g. embryonic or somatic stem cells acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. There are many pathways that an unspecialized cell e.g. a stem cell, can undertake in order to form a mature cell.
  • Reference to "differentiation of a stem cell” includes stem cells which are partially differentiated, e.g. monocytes or tissue specific stem cells or stem cells that are terminally differentiated e.g. macrophages.
  • the stem cells of the present invention encompasses cells differentiated to all stages in between. Differentiation may occur in vivo, in vitro or ex vivo.
  • the stem cells of the present invention may be induced to form cells ofthe brain, epidermis, skin, pancreas, kidney, liver, breast, lung, muscle, heart, eye, bone, nervous system, spleen or the immune system.
  • Cells ofthe immune system include without limitation, CD4+ T-cells, CD8 + T-cells, natural killer cells, monocytes, macrophages, dendritic cells and B-cells.
  • Bcl-2-associated athanogene 1 (Kermer et al, Cell Death Differ. 9(4): 405-413, 2002); CCAAT/enhancer binding protein (C/EBP) (Cortes-Canteli et al, J Biol Chem 277(7): 5460-5467, 2002); empty spiracles homolog 1 (Drosophila) (Bishop et al., J Comp Neurol 457(4): 345-360, 2003), empty spiracles homolog 2 (Drosophila) (Bishop et al, 2003, supra); forkhead box Gl (Hanashima et al, J Neurosci 22(15): 6526-6536, 2002; Xuan et al, Neuron 14(6): 1141-1152, 1995); proprotein convertase subtilisin/kexin type 9 (Seidah et al, Proc.
  • C/EBP CCAAT/enhancer binding protein
  • neural tissue for transplant Human neurons
  • neural tissue for transplant Human astrocytes
  • neural tissue for transplant Human glial cells
  • Epidermis cut-like 1 (Drosophila) (Ellis et al, Genes Dev 15(17): 2307-2309, 2001); growth factor independent 1 (Wallis et al, Development 130(1): 221-232, 2003); mucolipin 3 (Di Palma et al, Proc. Natl. Acad. Sci. USA 99(23): 14994-14999, 2002); mucosal vascular addressin cell adhesion molecule 1 (Nishioka et al, J Invest Dermatol 119(3): 632-638, 2002); tumor susceptibility gene 101 (Oh et al, Proc. Natl. Acad. Sci.
  • references to "cells capable of differentiating into mature tissue” includes the ability to differentiate into mature tissue in vivo, in vitro, or ex vivo.
  • the term “in vivo” refers to cells introduced in a living body or organism.
  • the term “in vitro” means performed in an artificial environment like a test tube or culture media.
  • the term “ex vivo” pertains to a biological process or reaction taking place outside of a living. In the case of the present invention, the term “ex vivo” pertains to the process of differentiating the stem cells in vitro and then growing all or part of the organ or tissue or pure cell population, prior to re- introducing them to the subject.
  • tissue means a group or layer of cells that are alike and that work together to perform a specific function.
  • Tissues ofthe present invention refer to organs, blood cells, skin cells and cells maintained in culture.
  • the stem cells of the present invention are modulated by the incorporation into the stem cell of an artificial chromosome.
  • the artificial chromosomes of the present invention comprise an isolated nucleic acid molecule comprising a nucleotide sequence corresponding to neocentromeric sequences of mammalian, avian or other higher eukaryote DNA, the nucleic acid molecule further comprising a heterologous nucleic acid molecule inserted within a centromeric chromatin domain within the neocentromeric region or immediately adjoining or proximal region and when the heterologous nucleic acid molecule is expressed modulates the stem cell.
  • the artificial chromosome nucleic acid molecule is a DNA molecule.
  • the artificial chromosome DNA molecule is in isolated form.
  • the artificial chromosome DNA is resident within the cell of the mammalian, avian species or any other higher eukaryote.
  • the term "resident" includes the DNA existing as a self- replicating unit relative to the cell's chromosome as well as being integrated into the cell's chromosome.
  • the artificial chromosome is in the form of a vector.
  • the vector comprises, therefore, a neocentromere or its centromeric equivalent and having a centromeric chromatin domain.
  • centromere is not intended to exclude a centromere although the neocentromere or centromere of the present invention is substantially devoid of ⁇ -satellite or other repeat DNA that normally resides at a centromere.
  • reference to a "neocentromere” includes a centromere which substantially contains no ⁇ -satellite or other repetitive DNA-based centromeric sequences.
  • mammal includes a human or other primate such as gorilla, marmoset, chimpanzee, a livestock animal (e.g. sheep, cow, pig, horse, donkey, goat), a laboratory test animal (e.g. mouse, rat, rabbit, guinea pig, hamster), a companion animal (e.g. dog, cat) or captive wild animal.
  • An avian species includes a poultry bird (e.g. chicken, duck, turkey, goose), game bird (e.g. wild duck, pheasant, peacock, emu, ostrich) or caged or aviary bird (e.g. parrots, pigeons, finches).
  • the DNA is present in a mammalian cell and even more preferably, a human cell.
  • An artificial chromosome for human cells is referred to as a "HAC” or "human artificial chromosome”.
  • another aspect of the invention provides a method for altering the genetic potential of a stem cell or a daughter cell thereof, said method comprising incorporating into a stem cell or parent thereof at least one artificial chromosome comprising a neocentromere having centromeric chromatin domains of mammalian, avian or other higher eukaryote DNA origin, said nucleic acid molecule comprising a heterologous nucleic acid molecule inserted within a centromeric chromatin domain of the neocentromeric region or immediately adjoining or proximal region and which when the heterologous nucleic acid is expressed adds to or modifies a trait in the stem cell.
  • the artificial chromosome is of mammalian origin and in particular is of human origin.
  • the artificial chromosome is a HAC.
  • heterologous nucleic acid or “heterologous genetic sequence” or “heterologous gene” means a genetic sequence not generally resident within the neocentromeric DNA or immediately adjoining or proximal DNA.
  • gene is used in its broadest sense to include a genomic gene (including exon or intron DNA) as well as cDNA (generally only exon DNA).
  • the present invention extends to the incorporation of intronic DNA which, upon transcription and optional splicing, is involved in genetic networking.
  • the present invention extends to homologous genetic material such as used in RNAi-mediated suppression of gene expression in order to induce gene silencing.
  • the heterologous or homologous genetic material should not be construed as limiting the inserted nucleotide sequence to encoding a proteinaceous product as the nucleotide sequence may encode an RNA molecule or a sense molecule or may induce RNAi which is involved in co-suppression or post-transcriptional or translational gene silencing or an intron involved in genetic networking.
  • genetic networking is meant the modulation of expression of genes, promoters, regulatory regions and peptides, polypeptides or proteins within the genome or proteome of a cell.
  • Genetic material contemplated by the present invention include those genes which when expressed result in the maturation or differentiation of a stem cell. These genes include Bcl-2, Bcl-w and Bcl-xy, Bcl-2-associated athanogene 1, CCAAT/enhancer binding protein (C ⁇ BP), empty spiracles homolog 1 (Drosophila), empty spiracles homolog 2 (Drosophila), forkhead box Gl, proprotein convertase subtilisin/kexin type 9, suppressor of cytokine signaling 2, T-cell leukemia, homeobox 1, T-cell leukemia, homeobox 3, insulin-like growth factor 1, neuregulin 1, neurotrophin 5, cut-like 1 (Drosophila), growth factor independent 1, mucolipin 3, mucosal vascular addressin cell adhesion molecule 1, tumor susceptibility gene 101, endothelin 3, endothelin receptor type B and/or a bone morphogenetic protein (BMP) such as BMP1, BMP2, BMP3 or BMP
  • Cytokines, growth factors, and receptors of the present invention include but are not limited to Activin RIA (Activin Receptor), ADAM (A Desintegrin and Metalloprotease-like Domain), ADAMTS (A Disintegrin-like and Metalloproteinase Domain with Thrombospondin Type I Motifs), ALCAM (Activated Leukocyte Cell Adhesion Molecule), ALK (Activin Receptor-like Kinase) ANG (Angiogenin), Ang (CC Chemokine Receptors), APAF-1 (Apoptosis Protease Activating Factor- 1), APE (AP Endonuclease), APJ (A Seven Transmembrane-domain Receptor), APP (Amyloid Precursor Protein), APRIL (a Proliferation-inducing Ligand), AR (Amphiregulin), ARC (Agout
  • Reference to a "neocentromere” includes reference to a functional neocentromere or a functional derivative thereof or a latent, synthetic or hybrid form thereof or an equivalent centromeric region and which is capable of facilitating sister chromatid cohesion and chromosomal segregation during mitotic cell divisions and/or is capable of associating with CENP-A and/or CENP-C and/or other functionally important centromere proteins and/or is capable of interacting with anti-CENP-A antibodies or anti-CENP-C antibodies or antibodies to other functionally important centromere proteins. Generally, and preferably, the neocentromere is incapable of interacting with CENP-B or anti-CENP-B antibodies.
  • the neocentromere is substantially devoid of ⁇ -satellite repeat DNA.
  • the neocentromere may also be a latent centromere capable of activation by epigenetic mechanisms or other relevant mechanisms including chromatin reorganization.
  • the neocentromere may also be a hybrid or other human, mammalian, plant, yeast or eukaryote neocentromeres. Synthetic or artificial or engineered neocentromeres provided by, for example, polymeric techniques to arrive at the correct conformation are also contemplated by the present invention. All such forms and definitions of neocentromeres are encompassed by use of this term.
  • centromeric/neocentromeric region is defined at least in humans as within a 4-Mb genetic region, but not limited to this size, comprising S/MAR, CENP-H, CENP- A, HPl ⁇ , and other proteins involved in centromere function.
  • S/MAR S/MAR
  • CENP-H CENP-H
  • CENP- A CENP- A
  • HPl ⁇ HPl ⁇
  • other proteins involved in centromere function A summary of genes expressed in this region is provided in Table 2.
  • the present invention is directed to the use of an isolated nucleic acid molecule comprising a nucleotide sequence corresponding to a neocentromeric region of human DNA and having a centromeric chromatin domain, said nucleic acid molecule further comprising a second nucleic acid molecule inserted within the centromere chromatin domain or immediately adjoining or proximal region and which second nucleic acid molecule is expressible and wherein the expression product alters the genetic potential of a stem cell or its daughter cells wherein the neocentromeric region comprises a q and p arm domain, CENP-H, HP1 domain and a scaffold domain and comprises a gene selected from but not limited to Celera gene ID: hCG41809, hCG40976, hCG1811152, hCG1781464, hCG39839, hCGl 781461, hCG40945, hCG1818126, hCG40995, hCGl ⁇ l 1159
  • the present invention provides methods for differentiating a stem cell comprising introducing an artificial or engineered chromosomes carrying heterologous genes or other genetic material for use in differentiating the stem cell for use in replacement, rejuvenation therapy or as a source of cellular therapeutics.
  • another aspect ofthe present invention provides methods for differentiating a stem cell comprising introducing an artificial or engineered chromosome comprising a neocentromere having centromeric chromatin domains of mammalian, avian or plant or higher eukaryote DNA, said nucleic acid molecule comprising a heterologous nucleic acid molecule inserted within the centromeric chromatin domains or immediately adjoining or proximal region and which heterologous nucleic acid molecule is expressible or otherwise differentiates the stem cell.
  • the present invention contemplates methods for differentiating a stem cell comprising introducing into a stem cell a mammalian artificial or engineered chromosome comprising a neocentromere having centromeric chromatin domains of mammalian origin, said nucleic acid molecule comprising a heterologous nucleic acid molecule inserted within the centromeric chromatin domains or immediately adjoining or proximal region and which heterologous nucleic acid molecule is expressible or differentiates said stem cell.
  • the mammal is a human.
  • the present invention further contemplates an isolated stem cell or a stem cell in situ comprising an artificial or engineered chromosome or nucleic acid.
  • the present invention provides, therefore, a construct for use in the process of stem cell differentiation.
  • the construct generally comprises a centromeric or neocentromeric region having a heterologous gene sequence inserted within or proximal to a centromeric chromatin domain, generally operably linked to a promoter and optionally a terminator and/or other regulatory sequences.
  • promoter is to be taken in its broadest context and includes the transcriptional regulatory sequences of a classical genomic gene, optionally including upstream activating sequences, enhancers and silencers or other regulatory sequences.
  • a promoter is usually, but not necessarily positioned upstream or 5', of a structural gene region, the expression of which it regulates.
  • promoter is also used to describe a synthetic or fusion molecule, or derivative that confers, activates or enhances expression of a nucleic acid molecule in a cell.
  • Preferred promoters may contain additional copies of one or more specific regulatory elements, to further enhance expression of the sense molecule and/or to alter the spatial expression and/or temporal expression ofthe sense molecule.
  • Placing a nucleic acid molecule under the regulatory control of a promoter sequence means positioning the molecule such that expression is controlled by the promoter sequence.
  • promoters are generally positioned 5' (upstream) to the genes that they control.
  • the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, i.e. the genes from which it is derived. Again, as is known in the art, some variations in this distance can also occur.
  • promoters suitable for use in the constructs of the present invention include mammalian (e.g. human) viral, fungal, animal and plant derived promoters capable of functioning in plant, animal, insect, fungal or yeast cells.
  • the promoter may regulate the expression of the structural gene component constitutively, or differentially with respect to cell, the tissue or organ in which expression occurs.
  • the promoter may also be inducible, becoming active only following the addition of an exogenous chemical to the cells in which it is contained.
  • operably linked shall be taken to indicate that expression of the structural gene region or multiple structural gene region is under the control ofthe promoter sequence with which it is spatially connected in a cell.
  • a nucleic acid molecule is under the control of its endogenous promoter where the two molecules are operably linked in their naturally occurring configuration.
  • the artificial chromosomes used in the methods of the present invention are capable of being modified further, for example, by the inclusion of marker nucleotide sequences encoding a detectable marker enzyme or a functional analogue or derivative thereof, to facilitate detection of the synthetic gene in a cell, tissue or organ in which it is expressed.
  • the marker nucleotide sequences will be present in a translatable format and expressed, for example, as a fusion polypeptide with the translation product(s) of any one or more of the structural genes or alternatively as a non-fusion polypeptide.
  • structural gene includes a gene which encodes RNA (e.g. mRNA) or an intronic or exonic RNA.
  • Genetic constructs are particularly suitable for the transformation of a eukaryotic cell to introduce novel genetic traits thereto or to repair defective genes (i.e. gene therapy). Such additional novel traits may be introduced in a separate genetic construct or, alternatively, on the same genetic construct which comprises the synthetic genes described herein.
  • the present invention provides, therefore, a method of propholaxis or treatment of a trauma or human disease in a subject, the method comprising expanding a culture comprising a stem cell containing an artificial chromosome, wherein said artificial chromosome further comprises a hetereologous gene capable of differentiating said stem cell, and introducing the expanded stem cell population into a subject.
  • the present invention therefore contemplates methods for treating subjects requiring organ transplantation, including heart lung, kidney, limbs, eyes, and liver.
  • the stem cells of the present invention could be used in treating stroke, ischemia, myocardial infarction, coronary artery disease, spinal cord injury, age-related tissue damage, Alzheimer's disease, Parkinson's disease, liver fibrosis, liver cirrhosis, chronic obstructive pulmonary disorder, compartment syndrome, multiple sclerosis, chronic inflammation, chronic infection, macular degeneration, and cataracts, neurodegenerative diseases, muscle wasting disorders, ataxias, and disorders of the blood.
  • the stem cells of the present invention could be infused in subjects following cancer treatments using chemotherapy, or for tissue regeneration.
  • Subject refers to an animal, preferably a mammal and more preferably human who can benefit from the methods of the present invention. There is no limitation on the type of animal that could benefit from the present methods. A subject regardless of whether a human or non-human animal may be referred to as an individual, subject, animal, host or recipient. The methods ofthe present invention have applications in human medicine, veterinary medicine as well as in general, domestic or wild animal husbandry.
  • Treating" a patient may involve prevention ofthe disorder or disease condition or adverse physiological event in a susceptible individual as well as treatment of a clinically symptomatic individual by inhibiting a disease or disorder.
  • Four new monochromosomal somatic cell hybrid lines were generated using microcell-mediated chromosome transfer (MMCT) procedures (Saffery et al. 2001 supra).
  • MMCT microcell-mediated chromosome transfer
  • Two of these (CHOM10 and CHON10, respectively) were CHO-based and contained mardel(l ⁇ ) or the progenitor normal chromosome 10 derived from the mardel(l ⁇ ) patient's father as previously described (Barry et al, Genome Res. 10(6): 832- 838, 2000).
  • Primers for PCR amplification were designed using Primer express software (ABI). Where possible several primer pairs were designed for each gene. To avoid the amplification of contaminating genomic DNA or total RNA, all primer pairs were designed so that at least one of the pair spanned a genomic exon/intron boundary. Each primer was checked for imiqueness in the human genome prior to synthesis. Initial validation experiments were performed for each primer pair to ensure that no amplification was detected from human genomic DNA or total RNA prior to reverse transcription. Quantitative RT-PCR was carried out using SYBR green technology with the Applied Biosystems SYBR green master mix, and reactions were performed on an ABI 7700 Sequence Detection System.
  • Delta CT analysis was used to calculate the relative amount of expression of individual genes in relation to an 18S control amplicon (Ambion Inc.). Further validation experiments were carried out to ensure that the efficiency of amplification of test primer pairs was comparable to that of the 18S control. This involved serial dilution of template (two-fold dilutions to 1/256) followed by PCR amplification with test primers and 18S control. Delta CT for each dilution was then calculated and if efficiencies of amplifications were comparable this value did not change significantly with each dilution. Several primer pairs failed one or more of the validation experiments and were not included in the final analysis. For TAQman-based quantitative RT-PCR, Assay on demand pre-optimized primer and probe mix were employed with TAQman master mix and TAQman 18S control reagents (Applied Biosystems). Scaffold isolation and array (SIA) analysis
  • Washed cells were resuspended in 12 ml of ice-cold isolation buffer containing 0.1% w/v digitonin and 100 KlU/ml Aprotinin, and broken up in a Dounce type tissue homogeniser with 12 strokes of a B (loose) pestle.
  • Nuclei were collected by three washes in isolation buffer containing 0.1% w/v digitonin and 10 KlU/ml Aprotinin at 900g, 10 min at 4°C.
  • the washed pellet was resuspended in 5 ml isolation buffer containing 0.1% w/v digitonin, 100 KlU/ml Aprotinin and without EDTA/KOH.
  • Nuclei were then filtered through a 40-micron filter to remove nuclei clumps.
  • 1 x 10 6 nuclei in 100 ul of isolation buffer with 0.1 % w/v digitonin, 100 KlU/ml Aprotinin and without EDTA/KOH were stabilized at 37° C for 20 min.
  • the nuclei were then diluted with 1 ml of LIS buffer consisting of 5 mM Hepes/NaOH, 0.25 mM Spermidine, 2 mM EDTA/KOH, 2 mM KCL and 50 mM 3,5-diiodasalicylic acid, lithium salt (SERVA), and left to extract for 10 min at 4°C.
  • LIS buffer consisting of 5 mM Hepes/NaOH, 0.25 mM Spermidine, 2 mM EDTA/KOH, 2 mM KCL and 50 mM 3,5-diiodasalicylic acid, lithium salt (SERVA), and left to extract for 10 min at 4°C.
  • the extracted nuclei were centrifuged at 2,400 g for 20 min at 4°C, followed by washing the pellet four times with 8 ml of digestion buffer consisting 20 mM Tris-HCl, 0.05 mM Spermine, 0.125 mM Spermidine, 20 mM KC1, 0.1 mM PMSF, 0.1% w/v digitonin, 50 mM NaCI, 5 mM MgCl 2 and 100 KlU/ml Aprotinin. Restriction enzymes EcoRI, EcoRV and BamHl were then added at 1000 U/ml and incubated at 37°C for 5 hr. The nuclear scaffold attached DNA was pelleted from the digested loop DNA by centrifugation at 2,400 g for 10 min at 4°C.
  • BAC DNA 100 ng was immobilized onto Hybond N+ nylon membranes in a dot blot format (minifold SRC-96, Schleisher and Schueel, Dassel, Germany). Identical membranes were pre-annealed with 5 ug of salmon sperm DNA, and probed with 1 ug of scaffold- attached or loop DNA from If and 5f cells, 32 P -labeled by random priming and pre- annealed with 5 ug of human Cot-1 DNA. Hybridization and washing were performed at high stringency (0.1 x SSC/0.1% w/v SDS, 65°C).
  • Results were analyzed by a phosphorimager system (Storm 860 Gel and Blot Imaging System, Molecular Dynamics) using Image QuaNT version 4.2 software (Molecular Dynamics).
  • the signals obtained using the scaffold-attached DNA probe were compared to those on a duplicate blot hybridised with the loop DNA probe.
  • the percentages of scaffold/matrix attachment for individual BAC spots were calculated by dividing the scaffold/matrix-attached signal by the sum of the scaffold/matrix-attached and loop DNA signal. The mean values from 10 independent experiments and standard deviations were plotted graphically using the midpoint for each BAC on the contig map. Statistical significance was determined using a two-tailed heteroscedastic Student's t-test.
  • Scaffold-FISH Actively growing cells were harvested by mitotic shake off, washed in phosphate-buffered saline (PBS), and resuspended at 2 x 10 6 cells/ml in 0.0075M KC1 for 10 min at 37°C.
  • PBS phosphate-buffered saline
  • CIB solution (10 mM Tris, 10 mM EDTA, 0.1% Nonidet P-40, 0.1 mM CuSO4, 20 ug/ml PMSF [pH 8.0]) for 5 mins and then extracted in CIB containing 0.5 M NaCI for 5 mins. FISH was carried out using standard conditions.
  • Tissues collected from chimeric mice were subjected to both DNA (QIAamp Tissue Purification Kit, Qiagen) and RNA (Triazol Reagent, GIBCO/ BRL) isolation according to manufacturers' protocols.
  • certain tissues including lung, kidney, skin, tail were also cultured in DMEM containing 10% v/v FCS for further analysis.
  • the sperm samples they were harvested from the uteri of the female C57BL/6 mice mated with the chimeric mice generated as described above (Mann et al, J Reprod Fertil, 99:505-512, 1993).
  • bone marrow was collected from mice (pretreated with 150mg/kg of body mass fluorouracil for 4 days), followed by washing with 1 x PBS, and lysis on ice for 10 min (lysis solution 0.83% w/v NH 4 C1 and 0.084% w/v NaHCO 3 ). The cells were then stained with R-Phycoerythrin (R-PE)- conjugated rat anti-mouse Ly-6A/E (Sca-1) monoclonal antibody prior to sorting by FACS.
  • R-PE R-Phycoerythrin
  • Ly-6A/ ⁇ (Sca-l)-positive haemopoietic stem cells isolated by FACS were then subjected to another round of sorting to emich the ES129.1-GFP-derived cells.
  • Cells collected were also cultured in the presence of 50 ng/ml SCF, 10 ng/ml IL3, 6 ng/ml IL6 and 100 ng/ml FLT3 (Chemicon International).
  • neostartl ATGATTGAACAAGATGGATTGCAC - SEQ ID NO:29
  • neocodRl TGAGATGACAGGAGATCCTGC - SEQ ID NO:30
  • RT-PCR was carried out using Titan one-step PCR kit (Roche) according to the manufacturer protocols, or a two-step procedure using cDNA prepared using a TAQman Reverse Transcription Reagents (Applied Biosystems) followed by standard PCR.
  • ESGFPmar(10)#l and ESGFPNC-MiCl#2 were cultured for 60 divisions in the presence (100 ⁇ g/ml) or absence of zeocin before the cells were harvested at various intervals for determination of mardel(l ⁇ ) orNC-MiCl stability. Retention rates of 80%-90% and 55%-70% were observed for the respective marker chromosomes after 60 cell divisions with and without selection, implying a small loss rate over time in the mouse ES cell background.
  • EXAMPLE 2 Genes in neocentromeric region
  • Figure la shows the arrangement of predicted genes with respect to the previously mapped CENP-A-associated region on mardel(l ⁇ ) (Lo et al, 2001A supra).
  • the BAC array spanning a total of 8 Mb showed positions of clones (horizontal bars) used in CIA and S/MAR analyses. Positions and orientations of genes located at 10q25 used in the expression study are shown by arrows or arrowheads. The location ofthe CENP-A-associated domain is indicated by purple shading (Lo et al, 2001A supra).
  • a total of 51 genes within an 8-Mb region were examined, including a single putative gene (Celera gene ID: hCG39837) that spans the CENP-A- associated domain.
  • RNA derived from each of these somatic cell hybrid lines was used in quantitative RT-PCR with SYBR green to determine gene expression levels both before and after centromere formation.
  • a mouse ES somatic cell hybrid line containing mardel(l ⁇ ) was produced.
  • ESGFPNC-MiCl#2 5 15 Zeocin 20 20/20 (100%) 0.0% 10 30 Zeocin 20 17/20 (85%) 0.5% 15 45 Zeocin 20 15/20 (75%) 0.56% 20 60 Zeocin 20 14/20 (70%) 0.5%
  • ESGFPmar(10)#l and ESGFPN C-MiCl#2 were cultur ed for 60 divisions in the ores ence (100 ⁇ g/ml) or absence of zeocin before the cells were harvested at various intervals for determination of mardel(l ⁇ ) or NC-MiCl stability. Retention rates of 80%-90% and 55%-70% were observed for the respective marker chromosomes after 60 cell divisions with and without selection, implying a small loss rate over time in the mouse ES cell background.
  • EXAMPLE 3 Detection of scaffold-attached chromatin domain at 10q25 neocentromere
  • centromeres Although previous studies have identified expressed genes and other transcripts in the flanking regions of some centromeres (Schulze et al, Mol. Gen. Genet. 264(6): 728-789, 2001), no detailed correlation of the sites of transcriptional activity with the locations of specific chromatin domains has yet been described. The available sequence of the 10q25 neocentromere provides a unique opportunity to define the relative positions of centromeric chromatin domains and directly assay the effects these domains have on underlying gene expression.
  • the first chromatin modification to be investigated by the inventors was the pattern of chromosomal scaffold/matrix attachment at 10q25 both pre- and post-NC formation.
  • the chromosomal scaffold/matrix is the insoluble chromatin that remains following removal of core histones (Paulson and Laemmli, Cell 12: 8178-828, 1977). It contains a proteinaceous core that interacts directly with DNA through specific S/MAR (scaffold/matrix attachment region) sequences and contains centromere-essential proteins such as Topo Il ⁇ , CENP-C, and cohesin subunits (Kalitsis et al, Proc. Natl Acad. Sci, USA 95: 1136-1141, 1998; Pinsky et al, Dev.
  • the combined S/MAR-array and FISH analyses define a 3.5-Mb region at the 10q25 NC showing a significantly increased level of chromosomal scaffold/matrix attachment that includes the CENP-A-associated domain.
  • FISH analysis of metaphase chromosomes indicates that BAC probes from the entire 3.5 -Mb region appear to be localised to the primary constriction of mardel(l ⁇ ), the exact relationship between increased centromeric S/MARs and chromatin compaction remains to be determined.
  • the region of S/MAR-modified chromatin contains 30 putative genes, 9 of which (genes #7-15; Figure IA) are expressed in one or more of our somatic cell hybrid lines. Thus, the formation of this chromatin domain has no measurable effect on underlying gene expression.
  • panels A and D show FISH using BAC clones BA313D6 and BA427L15, which mapped outside the S/MAR-enriched domain identified by S/MAR array analysis which produced dispersed signals (open arrows) on both the normal chromosome 10 (top panel) and mardel(l ⁇ ) chromosomes (bottom panel), indicating predominantly non-scaffold attachment of the probed regions.
  • Panels B and C show FISH using BAC clones E8 and BA153G5 mapping within the S/MAR domain which produced dispersed signals (open arrow) on chromosome 10 (top panel) but tightly packed signal on the mardel(l ⁇ ) chromosome (closed arrow; bottom panel), indicating predominantly scaffold attachment of the probed regions on mardel(l ⁇ ).
  • This increase in S/MAR over a substantial region may explain the tighter compaction of chromatin that gives rise to the mardel(l ⁇ ) primary constriction.
  • the previously identified CENP-A domain is located centrally within the 3.5 Mb domain of enhanced chromosomal S/MAR-modified chromatin.
  • the y-axis shows the fold difference between the normalised bound/input ratio of mardel(l ⁇ )- and normal chromosome 10-containing cell lines.
  • Each data-point is the mean of four independent CIA experiments. Significance of the data-points was determined using a student's t-test and is indicated by an asterisk (p ⁇ 0.01). The position of the CENP-H- associated region is indicated by green shading. This CENP-H-associated domain is 1 Mb away from, and shows no overlap with, the CENP-A-associated domain.
  • CENP-H and CENP-A domains are of note in light of evidence showing that CENP-A (and hMis ⁇ and hMisl2) is required for the localization of CENP-H to centromeres and that CENP-C is known to be targeted to CENP-A-containing chromatin, while both CENP- A and CENP-H are required for CENP-C localisation (Fukagawa et al, EMBO J. 20(16): 144-153, 2001; Howman et al, Proc. Natl. Acad. Sci. USA 97(3): 1148-1153, 2000; Van Hooser et al, J. Cell. Sci. 114(19): 3529-3542, 2001).
  • heterochromatin may play a role in sister-chromatid cohesion (Vagnarelli et al, Chromsoma 110(6): 393-401, 2001; Bernard et al, Science 294(5551): 2539-2542, 2001; Bernard and Allshire, Trends Cell Biol. 12(9): 419, 2002).
  • HP1- enriched domain itself encompasses a pancreatic lipase gene (PNLIP - hCG 1640542) that was not expressed in any ofthe cell lines tested, presumably due to tissue specificity (Su et al, Proc. Natl. Acad. Sci. USA 99: 4465-4470, 2002). Therefore, any direct effect on gene expression following HPl association could not be determined.
  • PNLIP - hCG 1640542 pancreatic lipase gene
  • Truncation of mardel(l ⁇ ) in human fibrosarcoma HT1080 cell line was performed via transfection of constructs containing a targeting DNA, human telomere sequence, and a hygromycin-resistance selection marker (Saffery et al, 2001 supra).
  • Recent approaches have involved the use of a similar construct with a neomycin resistance gene (neo R ) with flanking loxP sites, located between the p-arm-targeting DNA and human telomere sequence.
  • This construct was transfected into a HT1080 cell line carrying a 16 Mb NC- MiC2 (Saffery et al, 2001 supra).
  • NC-MiC6 shows full mitotic stability and centromere protein-binding properties, thereby demonstrating normal neocentromere function. Importantly, it contains loxP sites that can be used for later insertion of genes via CRE-mediated recombination.
  • NC-MiC6 was successfully transferred into two other human cell lines: human colorectal HCTl l ⁇ pgrxr and human embryonic kidney 293trex cell lines ( Figures 5-7). NC-MiC transfer was achieved using MMCT with hygromycin and neomycin selection for clones in the two cell lines respectively. The successful transfer of NC-MiC6 into these cell lines indicated that both the hygromycin and neomycin genes were expressed on NC-MiC6.
  • the HCTl 16 cell line used for fusion transfer of NC-MiC6 expresses the insect ecdysone receptor (pgRXR) and carries a zeocin resistant gene. This cell line can be used to express inducible levels of any desired protein.
  • the ecdysone inducible system utilises a dimer of the ecdysone receptor (VgEcR) and the retinoid X receptor (RXR) that binds to a hybrid ecdysone response element (E/GRE) in the presence of ecdysone analog, muristerone.
  • the ecdysone receptor is also modified to contain the VP16 transactivation domain that is derived from Drosophila.
  • muristerone induces the binding of the dimer of RXR and VgEcR to the hybrid Ecdysone response element (E/GRE) which consists of both the natural ecdysone response element and glucocorticoid response element, hence leading to an induction in the expression ofthe gene of interest.
  • E/GRE Ecdysone response element
  • the 293T cell line expresses Tet repressor (tetR) protein and is resistant to blasdicidin (BsdR). This cell line can also be used to express inducible levels of any protein of interest.
  • Tet repressor forms homodimers that bind to Tet operator sequences in the inducible expression vector, repressing transcription of the gene.
  • tet binds to tetR homodimer, causing the release of the tetR from the operator due to a change in its conformation, thus induction of transcription from the desired gene.
  • cre recombinase could be cloned into this tetracyclin-inducible vector for regulated induction of cre recombinase expression in the cell lines.
  • the timely presence of cre recombinase will allow for "flopping in” of genes into NC-MiC6 at the LoxP site, by transfection of a plasmid containing gene of interests and drug resistance genes flanked by two loxP sequences in the same orientation.
  • NC-MiC53g NC- MiC8a and NC-MiC20f
  • Figures 8 and 9 showing that these NC-MiCs had not acquired these satellite DNAs following the truncations and that the 10q25 neocentromere was mitotically functional.
  • mouse DNA as shown in FISH analysis using mouse cot DNA ( Figure 10), was absent on these NC-MiCs, indicating no detectable integration of mouse DNA into the NC-MiCs.
  • NC- MiC-containing lines expressing many different genes (e.g. 1.931b expressing 5 different genes; Table 7).
  • the diversity in gene expression mirrors the different human chromosome 10 regions contained in the NC-MiCs within ES cells and supports the use of a mouse ES model for analysis of gene expression from NC-MiCs.
  • W9.5 is wild-type ES cell line.
  • ES20A is an ES cell line containing an intact mardel(l ⁇ ). Refer to figure 4 for explanation of 20fC94, 8aC94, 53g and 1.931b.
  • CHON10 is a Chinese Hamster Ovary cell line containing a normal human chromosome 10.
  • ES-HAC1 is an ES hybrid line contai NC-HAC1, a truncation derivative of mardel(l ⁇ ). Nd refers to no data available.
  • a somatic hybrid cell line (designated ZB30) containing mardel(l ⁇ ) and tagged with a zeocin resistance gene in a Chinese hamster ovary background has been produced (Saffery et al, 2001 supra).
  • Transfer of the mardel(l ⁇ ) chromosome via microcell-mediated chromosome transfer (MMCT) into human HT1080 cells followed by telomere-associated chromosome truncation resulted in a number of lines containing truncated minichromosome derivatives of mardel(l ⁇ ) (Saffery et al, 2001 supra).
  • NC- MiC l(zeo) (or NC-MiC 1 in short) was identified by FISH as carrying a small minichromosome containing the 10q25 -derived neocentromere region and the zeocin resistance gene from a separate region of the mardel(l ⁇ ) chromosome formed through unknown rearrangements during the MMCT procedure ( Figure 12a). Reverse painting demonstrated that this minichromosome was derived solely from DNA of the 10q25 and 10pl5 regions of chromosome 10 ( Figure 12c). STS PCR analysis was performed to determine the content of the 10pl5-derived DNA of this minichromosome.
  • ESGFP cells containing mardel(l ⁇ ) [ESGFPmar(10)# 1] or NC-MiCl (ESGFPNC-MIC1#2) into mouse blastocysts followed by reimplantation into foster female mice resulted in 19 and 65 high-grade chimeric mice, respectively. None of the mice generated showed any abnormal phenotype.
  • Analysis of tissue samples from adult animals by PCR using human chromosome 10q25-specific primers demonstrated the presence of both mardel(l ⁇ ) and NC-MiC 1 in a variety of mouse tissues, with results from two exemplifying animals for each of mardel(l ⁇ ) and NC-MiC 1 shown in Tables 9 and 10.
  • transchromosomal chimeras up to 22 tissues
  • FISH probes A combination of human and mouse cotl DNA, whole human chromosome-10 paint, and neocentromere-specific BACs were used as FISH probes.
  • the transchromosomes were shown to be episomal, structurally intact, and contained no detectable mouse sequences (some examples shown in Figures 15 and 16).
  • two transchromosomes were observed, suggesting a certain level of missegregation.
  • ESI 29.1 denotes PCR detection of neomycin- resistance gene that was present in ESI 29.1 -derived tissues.
  • +ve and “-ve” denote the presence and absence of mardel(l ⁇ ) or the neomycin-resistance gene in a particular tissue, respectively.
  • NC-MiC 1 Screening of various tissues for presence of NC-MiC 1 in chimeric mouse THO and JN by PCR using specific primers to NC-MiC 1.
  • ES 129.1 denotes PCR detection of neomycin- resistance gene that was present in ESI 29.1 -derived tissues.
  • +ve and “-ve” denote the presence and absence of NC-MiC 1 or the neomycin-resistance gene in a particular tissue, respectively.
  • Tissues NC-MiCl ES129.1 Tissues NC-MiCl ES129.1 left lung +ve +ve testis 4-ve +ve right lung +ve +ve oesophagus -ve -ve left kidney -ve -ve liver +ve +ve right kidney +ve +ve bone marrow +ve +ve small intestine -ve -ve spleen +ve +ve large intestine -ve -ve tail +ve +ve +ve heart +ve +ve eye -ve +ve brain +ve +ve +ve skeletal muscle +ve +ve stomach +ve +ve skin +ve +ve thymus +ve +ve left eye +ve +ve +ve adrenal -ve +ve right eye -ve -ve -ve
  • Tissues NC-MiCl ES129.1 Tissues NC-MiCl ES129.1 left lung +ve +ve uterus -ve -ve right lung +ve +ve ovary -ve +ve left kidney -ve +ve oesophagus -ve +ve right kidney +ve +ve liver +ve +ve +ve small intestine -ve +ve bone marrow +ve +ve large intestine +ve +ve spleen -ve +ve heart -ve -ve pancreas +ve +ve brain -ve +ve tail -ve -ve stomach +ve +ve eye +ve +ve +ve thymus -ve +ve skeletal muscle +ve +ve adrenal +ve +ve +ve +ve
  • mice A total of 14%) was first carried out and 67%> of the chimeric mice were found to be positive for mardel(l ⁇ ) and NC-MiC 1, respectively, indicating the successful transmission of neocentromere-based markers through mouse meiosis to the male gametes.
  • These positive mice were crossed with C57BL mice to generate FI mouse progeny in order to determine the germline transmissibility ofthe transchromosomes. The mice were mated continuously over a period of 12 months to optimise the number of progeny from each animal.
  • Examples 9 to 19 relate to modulating stem cells using the subject constructs. Examples of suitable stem cells contemplated herein are provided in Table 3. EXAMPLE 9 A method for differentiating a stem cell
  • Stem cells are obtained from any ethically convenient source and may be primary isolated stem cells or artificially created stem cells using methods well known to those of skill in the art (Evans and Kaufman, Nature 292(5819): 154-156, 1981; Thomson et al, Science 282(5391): 1145-1147, 1998; Jiang et al, Nature 418(6893): 41-49, 2002; Reynolds and Weiss Science 255(5052): 1707-1710, 1992).
  • EXAMPLE 10 A method for differentiating a stem cell into a neural cell
  • an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a neural cell is transferred into an isolated stem cell.
  • the stem cell is maintained in culture and allowed to proliferate and differentiate into a neural cell.
  • EXAMPLE 11 A method for differentiating a stem cell into an epidermal cell
  • an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into an epidermal cell is transferred into an isolated stem cell.
  • the stem cell is maintained in culture and allowed to proliferate and differentiate into an epidermal cell.
  • EXAMPLE 12 A method for differentiating a stem cell into a skin cell
  • an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a skin cell is transferred into an isolated stem cell.
  • the stem cell is maintained in culture and allowed to proliferate and differentiate into a skin cell.
  • EXAMPLE 13 A method for differentiating a stem cell into a insulin-producing cell
  • an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into an insulin producing cell is transferred into an isolated stem cell.
  • the stem cell is maintained in culture and allowed to proliferate and differentiate into an insulin-producing cell.
  • EXAMPLE 14 A method for differentiating a stem cell into a kidney cell
  • an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a kidney cell is transferred into an isolated stem cell.
  • the stem cell is maintained in culture and allowed to proliferate and differentiate into a kidney cell.
  • EXAMPLE 15 A method for differentiating a stem cell into a liver cell
  • an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a liver cell is transferred into an isolated stem cell.
  • the stem cell is maintained in culture and allowed to proliferate and differentiate into a liver cell.
  • EXAMPLE 16 A method for differentiating a stem cell into a breast cell
  • an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a breast cell is transferred into an isolated stem cell.
  • the stem cell is maintained in culture and allowed to proliferate and differentiate into a breast cell.
  • EXAMPLE 17 A method for differentiating a stem cell into a lung cell
  • an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a lung cell is transferred into an isolated stem cell.
  • the stem cell is maintained in culture and allowed to proliferate and differentiate into a lung cell.
  • EXAMPLE 18 A method for differentiating a stem cell into a muscle cell
  • an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a muscle cell is transferred into an isolated stem cell.
  • the stem cell is maintained in culture and allowed to proliferate and differentiate into a muscle cell.
  • EXAMPLE 19 A method for differentiating a stem cell into a heart cell
  • an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a heart cell is transferred into an isolated stem cell.
  • the stem cell is maintained in culture and allowed to proliferate and differentiate into a heart cell.
  • Gene numbers refer to those shown in Figure 1 A. Celera Gene ID and corresponding gene name (where applicable) are shown. Domain refers to the location ofthe gene in relation to domains of chromatin modification identified in the current study. The relative expression levels of genes are shown for somatic hybrid cell lines in different genetic backgrounds. Relative expression levels were calculated as follows.
  • the CT value for a particular gene amplification within a particular RNA sample refers to the PCR Cycle at which SYBR green incorporation reaches a Threshold level indicating logarithmic amplification. This is directly related to the quantity of a particular RNA within the starting sample, with highly expressed genes having a lower CT than poorly expressed genes.
  • Relative expression levels (2 " ⁇ CT ) are a direct comparison of expression level to the normal chromosome.
  • 'Pooled N10 v M10' refers to a pooled analysis of all ⁇ CT values for normal chromosome 10 or mardel(l ⁇ ) for each gene in each of the 3 hybrid pairs combined.
  • HECs as autonomous entities that can function and segregate like their normal chromosome counterparts provide a useful tool to study centromere and chromosome biology, and a potential novel strategy for the ex vivo gene therapy of a variety of clinical conditions.
  • Neocentromeres that are fully functional and formed spontaneously on non- centromeric region offer an alternative source of centromere function for the construction of HECs.
  • HEC (NC-MiC 1) generates from the neocentric mardel(l ⁇ ) chromosome in mice and the corresponding parental mardel(l ⁇ ) chromosome.
  • NC-MiCl is relatively unstable in the mouse embryo background. This rapid loss of NC-MiC 1 due to postzygotic mitotic missegregation provides the explanation for our failure to observe NC-MiC 1-positive FI mice despite a continuous effort to breed the relatively large number of sperm-positive chimeric animals
  • the data presented herein evidences that the human neocentromere and its associated marker chromosome and derivative minichromosome are mitotically (and meiotically) functional in mouse ES cells and in mice.
  • Transchromosomes are shown to be transmitted in many different tissue types. Transmission in haemopoietic stem cells evidences a utility in particular of the neocentromere-based minichromosomes for somatic cell therapy through the stem cell route. Genes can be positively and differentially expressed from the minichromosome in a large spectrum of mouse tissues. These results enable the use of these minichromosomes for therapeutic gene replacement strategies.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates generally to the field of tissue engineering and genetic manipulation of cells and to methods for generating tissue suitable for use in repair, replacement, rejuvenation or augmentation therapy. Even more particularly, the present invention contemplates a method for genetically manipulating a stem cell by introducing a nucleic acid molecule comprising a centromere or neocentromere into the stem cell or a parent of the stem cell, wherein the nucleic acid molecule conveys genetic information which is capable of introducing to or modifying a trait within the stem cell or progeny of the stem cell such as but not limited to modulating the level of stem cell proliferation, differentiation and/or self-renewal. The engineered stem cells are useful inter alia in tissue repair, replacement, rejuvenation and/or augmentation therapy. The engineered stem cells may also be re-programmed, for example, to direct the cells down a different cell lineage.

Description

COMPOSITIONS AND METHODS FOR DIFFERENTIATING STEM CELLS
BACKGROUND OF THE INVENTION
FIELD OF THE INVENTION
The present invention relates generally to the field of tissue engineering and genetic manipulation of cells and to methods for generating tissue suitable for use in repair, replacement, rejuvenation or augmentation therapy. Even more particularly, the present invention contemplates a method for genetically manipulating a stem cell by introducing a nucleic acid molecule comprising a centromere or neocentromere into the stem cell or a parent of the stem cell, wherein the nucleic acid molecule conveys genetic information which is capable of introducing to or modifying a trait within the stem cell or progeny of the stem cell such as but not limited to modulating the level of stem cell proliferation, differentiation and/or self-renewal. The engineered stem cells are useful inter alia in tissue repair, replacement, rejuvenation and/or augmentation therapy. The engineered stem cells may also be re-programmed, for example, to direct the cells down a different cell lineage.
DESCRIPTION OF THE PRIOR ART
Bibliographic details of the publications referred to by author in this specification are collected at the end ofthe description.
Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that is not prior art forms part of the common general knowledge in any country.
There is great interest worldwide in discovering and developing a permanent source of cells having potential to differentiate into a variety of tissues and to be used in a manner which avoids problems associated with transplant rejection. One such cell type is a stem cell. These cells are undifferentiated cells that are capable of self-maintenance and proliferation and have the potential to generate a large repertoire of functional, differentiated progeny (reviewed in Alison et al, J. Pathol. 197(4): 419-423, 2002; Rodda et al, Int JDev Biol. 46(4): 449-458, 2002). Stem cells produce the cells that eventually form the tissues and organs of multicellular organisms. The property that distinguishes stem cells from other cell types is that they can self-renew at each mitotic division while also producing daughter cells that differentiate into specialized cells.
There are many different types of stem cells, each of which has a different potential for the number and type of cells into which it can finally differentiate. Fertilized oocytes (zygotes) and the progeny ofthe first division are known as totipotent cells as they can give rise to a complete embryo including the placenta. Following the generation ofthe totipotent cells, a blastocyst is formed which incorporates the inner cell mass (ICM). These cells have the potential to give rise to any cell type in the adult animal, with the exception of placental tissue. Finally, there exists a stem cell set, which are described as being multipotent stem cells. These cells are capable of multiplying in culture and can be maintained for extended periods of time.
Adults have a much more limited ability to produce totipotent cells than do embryos. Organisms such as humans retain a complete set of genetic information in all adult body cells yet only a small fraction of an adult's cells have the ability to develop into multiple cell types. Recent research has shown that differentiated adult cells can be treated such that they become totipotent. Such totipotent or stem cells offer the possibility for a number of therapeutic uses such as repairing heart muscle after a heart attack or brain function after a stroke.
Therefore, a stem cell has the ability to make any cell or tissue in the body and provide a valuable tool for the generation of tissues and cells for use in tissue replacement, repair, rejuvenation or augmentation. Further, the ability to isolate stem cells from adults removes many of the problems associated with tissue transplantation, such as the limited number of donor organs available, as well as problems associated with tissue rejection, such as graft versus host disease and host versus graft disease.
To date, stem cell differentiation has been somewhat haphazard with mixed results using cocktails of one or more growth factors and/or cvtokine. A genetic approach to controlling stem cell activities offers great opportunities for controlling differentiation, proliferation and self-renewal as well as introducing or modifying particular traits which could be passed on to tissue. However, genetic manipulation of any cells including stem cells has largely been at the level of chromosomal manipulation such as introducing one or more mutations or generating gene knock-in or knock-out events.
Other approaches need to be considered to genetically manipulate stem cells. Human centromeres have been proposed for use in generating centromere-based artificial chromosome-containing vectors for gene therapy. The centromere is an essential structure for sister chromatid cohesion and proper chromosomal segregation during mitotic and meiotic cell divisions. The centromere of the budding yeast Saccharomyces cerevisiae has been extensively studied and shown to be contained within a relatively short DNA segment of 125 bp that is organized into an 8 bp (CDEI) and 26 bp (CDEIII) domain, separated by a 78 to 87 bp, highly AT-rich, middle (CDEII) domain. The centromere of the fission yeast Schizosaccharomyces pombe is considerably larger, ranging from 40-100 kb and consists of a central core DNA element of 4-7 kb flanked on both sides by inverted repeat units. The functional DNA components of a higher eukaryotic centromere have been characterized in a mini-chromosome from Drosophila melanogaster and shown to consist of a 220 kb essential core DNA flanked by 200 kb of highly repeated sequences on one side.
The mammalian centromere, like the centromeres of all higher eukaryotes studied to date, contains a great abundance of highly repetitive, heterochromatic DNA. For example, a typical human centromere contains 2-4 Mb ofthe 171 bp α-satellite repeat , plus a smaller and more variable quantity of a 5 bp satellite III DNATransfection of a cloned 17 kb uninterrupted α-satellite array into cultured simian cells (Haaf et al, Cell 70: 681-696, 1992) or a 120 kb α-satellite-containing YAC into hamster cells (Larin et al, Hum. Mol. Genet. 3: 689-695, 1994) appear to confer centromere function at the sites of integration. Other workers have analyzed rearranged Y chromosomes (Tyler-Smith et al, Nature Genet 5: 368-375, 1993), or dissected the centromere of the human Y chromosome with cloned telomeric DNA (Brown et al, Hum. Mol. Genet. 3: 1227-1237, 1994) and suggested that 150 to 200 kb of α-satellite DNA plus several hundred kb of adjacent sequences are associated with human centromere function. In addition, a human X chromosome-derived mini-chromosome that retained 2.5 Mb of α-satellite array has been produced by telomere-associated chromosome fragmentation (Farr et al, EMBO Journal 14: 5444-5454, 1995).
In mammals, a number of constitutive centromere-binding proteins have been characterized to varying extents and implicated to have possible direct roles in centromere function. CENP-A, a protein localized to the outer kinetochore domain, is a centromere- specific core histone that shows sequence homology to the histone H3 protein and serves to differentiate the centromere from the rest of the chromosome at the most fundamental level of chromatin structure - the nucleosome (Choo, Dev. Cell 1: 165-177, 2001). CENP- B, a protein which associates with the centromeric heterochromatin through its binding to the CENP-B box motif found in primate α-satellite and mouse minor satellite DNA, probably has a role in packaging centromeric heterocliromatic DNA - a role which, however, is not indispensable since the protein is undetectable on the Y chromosome (Pluta et al, Trends Biochem. 15: 181-185, 1990), is found on the inactive centromeres of dicentric chromosomes (Earnshaw et al, Chromosoma 98: 1-12, 1989), and its gene can be knocked out in mice without detectable consequences to mitotic and meiotic cell divisions (Hudson et al, J. Cell Biol. 141: 309-319, 1998). CENP-C has been shown to be located at the inner kinetochore plate and has an essential although yet undetermined centromere function as seen, for example, from inhibition of mitotic progression following microinjection of anti-CENP-C antibodies into cells (Bernat et al, J. Cell. Biol. Ill: 1519- 1533, 1990; Tomkiel et al, J. Cell. Biol. 125: 531-545, 1994), from its association with the active but not the inactive centromeres of dicentric chromosomes (Earnshaw et al, 1989 supra; Page et al, Hum. Mol. Genet. 4: 289-294, 1995; Sullivan and Schwartz, Hum. Mol. Genet. 4: 2189-2197, 1995), and from an embryonic lethal phenotype in Cenpc gene knockout mice (Kalitsis et al, Proc. Natl. Acad. Sci. USA 95: 1136-1141, 1998). CENP-H and CENP-I are the latest essential constitutively binding centromere proteins that have been described (Sugata et al, J. Biol. Chem. 274: 27343-27346, 1999; Sugaτa et al, Hum. Mol. Genet. 9: 2919-2926, 2000; Nishihashi et al, Dev. Cell 2: 463-476, 2002; Liu et al, Nat. Cell Biol. 5: 341-345). A role for the mammalian centromere as a "marshalling station" for a host of "passenger proteins" (such as INCENPs, MCAK, CENP-E, CENP-F, 3F3/2 antigens and cytoplasmic dynein), has also been recognized (review by Earnshaw and Mackay, FASEB J. 8: 947-956, 1994 and Pluta et al, Science 270: 1591-1594, 1995). These passenger proteins, whose appearance at the centromere is transient and tightly regulated by the cell cycle, provide vital functions that include motor movement of chromosomes, modulation of spindle dynamics, nuclear organizations, intercellular bridge structure and function, sister chromatid cohesion and release and cytokinesis.
U.S. Patent No. 6,265,211 and International Patent Publication No. WO 98/51790 describe an unusual human marker chromosome, "mardel(lθ)", which is 100% stable in mitotic division both in the human subject from which it was isolated and in established fibroblast and transformed lymphoblast cultures. A region of he mardel(lθ) chromosome has been cloned together with the corresponding region from a normal human subject. The nucleic acid molecules cloned contained no α-satellite repeats yet confer mitotic stability. The nucleic acid molecules encompass, therefore, a new form of centromere referred to as a "neocentromere". The centromeric regions of higher organisms have traditionally been described as inhibitory to transcriptional activity (Choo, 2001 supra). The large tracts of repetitive DNA found at centromeres have, until the advent of the present invention, prevented proper analysis of transcriptional activity.
In accordance with the present invention, it is proposed to use the aforementioned neocentromere to generate an artificial chromosome comprising expressible material within or proximal to the centromeric chromatin domains for use in altering the genetic potential of a stem cell or its progeny or tissue cells derived therefrom. SUMMARY OF THE INVENTION
Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.
Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1 (SEQ ID NO:l), <400>2 (SEQ ID NO:2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided after the claims.
The present invention is predicated in part on the use of vectors in the form of artificial chromosomes to genetically manipulate stem cells. The genetically modified stem cells may have new traits introduced or existing traits altered. For example, the artificial chromosomes may carry genetic material which modulates a stem cell's ability to proliferate, differentiate or self-renew. The genetic material may also enable a partially differentiated stem cell or even an adult stem cell to be re-programmed into different cell lineages. In a preferred embodiment, the vector is in the form of a mammalian artificial chromosome (MAC) and even more preferably, the vector is a human artificial chromosome (HAC).
Accordingly, the present invention provides a stem cell comprising a self-replicating artificial chromosome comprising a neocentromere having centromeric chromatin domains wherein the artificial chromosome comprises expressible genetic material within the centromeric chromatin domains or in a region proximal thereto which modifies or introduces at least one trait in said stem cell.
In another aspect, the present invention provides for a method of modulating the genetic potential of a stem cell, said method comprising introducing into said stem cell or a parent of said stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises expressible genetic material within the centromeric chromatin domains or in a region proximal thereto which modifies or introduces at least one trait in said stem cell.
In a further aspect, the invention provides for a method for directing differentiation, proliferation or self-renewal of a stem cell by introducing into the stem cell or a parent of said stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises genetic material within the centromeric chromatin domains or in a region proximal thereto which is capable of generating an expression production which modulates stem cell differentiation, proliferation and/or self-renewal.
In yet another aspect, the present invention is directed to methods of proliferation and/or differentiation and/or self-renewal of stem cells in vivo, said method comprising administering a stem cell or population of homozygous stem cells or a population of heterozygous stem cells comprising artificial chromosomes comprising a neocentromere having centromeric chromatin domains incorporated in the cells and which expresses genetic material within the centromeric chromatin domains or in a region proximal thereto which is capable of modulating the level of stem cell differentiation, proliferation and/or self-renewal.
In a related aspect, the artificial chromosome-transformed stem cells of the present invention are maintained and expanded in vivo. In still another aspect, the stem cells are maintained and proliferated in vitro prior to being transferred to a subject.
The stem cells contemplated in accordance with the present invention include inter alia embryonic stem cells, somatic stem cells, germ stem cells, epidermal stem cells, adult neural stem cells, keratinocyte stem cells, melanocyte stem cells, adult renal stem cells, embryonic renal epithelial stem cells, embryonic endodermal stem cells, hepatocyte stem cells, mammary epithelial stem cells, bone marrow-derived stem cells, skeletal muscle stem cells, bone marrow mesenchymal stem cells, CD34+ hematopoietic stem cells, mesenchymal stem cells. According to another aspect of the present invention, the artificial chromosomes modulate differentiated cell types such as keratinocytes, fibroblasts, pancreatic islets, pancreatic β- cells, kidney epithelial cells, hepatocytes, bile duct epithelial cells, lung fibroblasts, bronchial epithelial cells, alveolar type II pneumocytes, cardiomyocytes, simple squamous epithelial cells, descending aortic endothelial cells, aortic arch endothelial cells, aortic smooth muscle cells, corneal epithelial cells, osteoblasts, peripheral blood mononuclear progenitor cells, osteoclasts, stromal cells, splenic precursor cells, splenocytes, CD4 T- cells, CD8 T-cells, NK cell, monocytes, macrophages, dendritic cells, B-cells, goblet cells, pseudostriated ciliated columnar cells, pseudostratified ciliated epithelium, stratified epithelial cells, ciliated columnar cells, basal cells or cricopharyngeus muscle cells, neuronal cells (oligodendrocytes, neurons).
In still another embodiment, the genetic material expressed within or near the centromeric chromatin domain on the artificial chromosomes induces differentiation or proliferation of the stem cells and hence enables reprogramming of partially differentiated stem cells.
The genetic material carried by the artificial chromosomes utilized in accordance with the present invention include Bcl-2, Bcl-w and Bcl-xy, Bcl-2-associated athanogene 1, CCAAT/enhancer binding protein (C/EBP), empty spiracles homolog 1 (Drosophila), empty spiracles homolog 2 (Drosophila), forkhead box Gl, proprotein convertase subtilisin/kexin type 9, suppressor of cytokine signaling 2, T-cell leukemia, homeobox 1, T-cell leukemia, homeobox 3, insulin-like growth factor 1, neuregulin 1, neurotrophin 5, cut-like 1 (Drosophila), growth factor independent 1, mucolipin 3, mucosal vascular addressin cell adhesion molecule 1, tumor susceptibility gene 101, endothelin 3, endothelin receptor type B and/or a bone morphogenetic protein (BMP) such as BMP1, BMP2, BMP3 or BMP4.
In a related aspect, the genetic material encodes a cytokine, growth factor or receptor selected include without being limited to Activin RIA (Activin Receptor), ADAM (A
Desintegrin and Metalloprotease-like Domain), ADAMTS (A Disintegrin-like and Metalloproteinase Domain with Thrombospondin Type I Motifs), ALCAM (Activated Leukocyte Cell Adhesion Molecule), ALK (Activin Receptor-like Kinase) ANG (Angiogenin), Ang (CC Chemokine Receptors), APAF-1 (Apoptosis Protease Activating Factor- 1), APE (AP Endonuclease), APJ (A Seven Transmembrane-domain Receptor), APP (Amyloid Precursor Protein), APRIL (a Proliferation-inducing Ligand), AR (Amphiregulin), ARC (Agouti-related Transcript), ART (Fibroblast Growth Factor), Axl (a Receptor Tyrosine Kinase),β2M (β 2 Microglobulin), B7-H (B7 Homolog), BACE (β-site APP Cleaving Enzyme), Bad (Bcl-xL/Bcl-2 Associated Death Promoter), BAFF (B cell Activating Factor), Bag-1 (Bcl-2-associated Anthanogene-1), BAK (Bcl-2 Antagonist/Killer), Bax (Bel Associated X Protein), BCA-1 (B -Cell-attracting Chemokine 1), BCAM (Basal-cell Adhesion Molecule), Bel (B-Cell Lymphoma/Leukemia), BCMA (B Cell Maturation Factor), BDNF (Brain-derived Neurotrophic Factor), β-ECGF (β Endothelial Cell Growth Factor), BID (BH3 Interacting Domain Death Agonist), Bik (Bcl- 2 Interacting Killer), BIM (Bcl-2 Interacting Mediator of Cell Death), BLC (B- Lymphocyte Chemoattractant), BL-CAM (B-lymphocyte Cell Adhesion Molecule), BLK (Bik-like Killer Protein), BMP (Bone Morphogenetic Protein), BMPR (Bone Morphogenetic Protein Receptor), β-NGF (β Nerve Growth Factor), BOK (Bcl-2-related Ovarian Killer), BPDE (Benzo[a]Pyrene-Guanosine-BSA), BPDE-DNA (Benzo[a]Pyrene- Diol Epoxide-DNA), BTC (β cellulin), CIO (a Novel Mouse CC Chemokine), CAD-8 (Cadherin-8), cAMP (Cyclic AMP), Caspase (Caspase-1), CCI (CC Chemokine Inhibitor), CCL (CC Chemokine Ligands), CCR (CC Chemokine Receptors), CD (Cluster of Differentiation), CD30L (CD30 Ligand), CD40L (CD40 Ligand), CFTR (Cystic Fibrosis Transmembrane Conductance Regulator), cGMP (Cyclic GMP), CINC (Cytokine-induced Neutrophil Chemotactic Factor), CKβ8-l (Chemokine β 8-1), CLC (Cardiotrophin-like Cytokine), CMV UL (Cytomegalovirus ORFUL), CNTF (Ciliary Neurotrophic Factor), CNTN-1 (Contactin-1), COX (Cyclooxygenase), C-Ret (a Receptor Tyrosine Kinase), CRG-2 (a Mouse CXC Chemokine), CT-1 (Cardiotrophin 1), CTACK (Cutaneous T-cell Attracting Chemokine), CTGF (Connective Tissue Growth Factor), CTLA-4 (Cytotoxic T- lymphocyte-associated Molecule 4), CXCL (CXC Chemokine Ligands), CXCR (CXC Chemokine Receptors), DAN (Differential Screening-selected Gene Aberrant in Neuroblastoma), DCC (Deleted in Colorectal Cancer), DcR3 (Decoy Receptor 3), DC- SIGN (Dendritic Cell-specific ICAM-3 -grabbing Nonintegrin), Dhh (Desert Hedgehog), DNAM-1 (DNAX Accessory Molecule 1), Dpp (Decapentaplegic), DR (Death Receptor), Dtk (Developmental Tyrosine Kinase), ECAD (E-Cadherin), EDA (Ectodysplasin-A), EDAR (Ectodysplasin Receptor), EGF (Epidermal Growth Factor), EMMPRIN (Extracellular Matrix Metalloproteinase Inducer, CD 147), EN A (Epithelial-derived Neutrophil Attractant), eNOS (Endothelial Nitric Oxide Synthase), Eot (Eotaxin Epo Erythropoietin), ErbB3 (Erb B3 Receptor Protein Tyrosine Kinase), ERCC (Excision Repair Cross-complementing), ET-1 (Endothelin- 1), Fas (Fibroblast-associated), FEN-1 (Flap Endonuclease), FGF (Fibroblast Growth Factor), FL (Fas Ligand FasL), FLIP (FLICE Inhibitory Proteins), Flt-3 (fins-like Tyrosine Kinase 3), Fractalkine, Gas 6 (Growth-arrest-specific Protein 6), GCP-2 (Granulocyte Chemotactic Protein 2), G-CSF (Granulocyte Colony Stimulating Factor), GDF (Growth Differentiation Factor), GDNF (Glial cell line-derived Growth Factor), GFAP (Flial Fibrillary Acidic Protein), GFRα-1 (Glial Cell Line-derived Neurotropic Factor Receptor α 1), GITR (Glucocorticoid Induced TNF Receptor Family Related Gene), Glut 4 (Insulin Regulated Glucose Transporter Protein), GM-CSF (Granulocyte Macrophage Growth Factor), gpl30 (glycoprotein 130), GRO (Growth Related Protein α), HB-EGF (Heparin Binding Epidermal Growth Factor), HCC (Hemofiltrate CC Chemokine), HCMV UL (Human Cytomegalovirus ORFUL), HGF (Hepatocyte Growth Factor), HRG (Heregulin), Hrk (Harakiri HVEM Herpesvirus Entry Mediator), 1-309 (a human CC chemokine), IAP (Inliibitors of Apoptosis), ICAM (Intercellular Adhesion Molecule, ICOS (Inducible Co-stimulator), IFN (Interferon Ig Immunoglobulin), IGF (Insulin-like Growth Factor), IGFBP (Insulin-like Growth Factor Binding Protein), IL-la (hlnterleukin-la), hIL-lb (Interleukin-lb), hIL-2(Interleukin-2 ), hIL-3 (Interleukin-3), hIL-4 (Interleukin-4), hIL-5 (Interleukin-5), hIL-6 (Interleukin-6), hIL-7 (Interleukin-7), hIL-10 (Interleukin-10), hIL-11 (Interleukin-11), hIL-12 (Interleukin-12), hIL-13 (Interleukin-13), hIL-15 (Interleukin-15), hIL-18 (Interleukin-18), iNOS (Inducible Nitric Oxide Synthase), IP- 10 (Interferon gamma Inducible Protein 10), I- TAC (Interferon-inducible T-cell α Chemoattractant), JE (Mouse homologue of human MCP-1), KC (Mouse homologue of human GRO), KGF (Keratinocyte Growth Factor), LAMP (Limbic System-associated Membrane Protein), LAP (Latency-associated Peptide), LBP (Lipopolysaccharide-binding Protein), LDGF (Leukocyte-derived Growth Factor), LECT2 (Leukocyte Cell-Derived Chemotaxin 2), LFA-1 (Lymphocyte Function- associated Molecule- lLfo), Lfo (Lactoferrin), LIF (Leukemia Inhibitory Factor), LIGHT (Name derived from Homologous to Lymphotoxins, Inducible expression, competes with HSV Glycoprotein D for HVEM, a receptor expressed on T-lymphocytes), LIX (LPS- induced CXC Chemokine), LKN (Leukotactin), Lptn (Lymphotactin), LT-α (Lymphotoxin α (aka TNF-β)), LT-β (Lymphotoxin β (aka p33)), LTB4 (Leukotriene B4), LTBP-1 (Latent TGF-β bpl), MAG (Myelin-associated Glycoprotein), MAP2 (Microtubule- associated Protein 2), MARC (Mast Cell Activation-Related Chemokine), MCAM (Melanoma Cell Adhesion Molecule (aka MUC 18, CD 146)), MCK-2 (Mouse Cytomegalovirus Viral CC Chemokine Homolog 2), MCP (Monocyte Chemotactic Protein), M-CSF (Macrophage Colony Stimulating Factor), MDC (Macrophage-derived Chemokine (aka STP-1)), Mer (Tyrosine Protein Kinase), MGMT (O-6 Methylguanine- DNA Methyltransferase), MIF (Macrophage Migration Inhibitory Factor), MIG (Monokine Induced by IFN-g), MIP (Macrophage Inflammatory protein), MK (Midkine), MMAC1 (Mutated in Multiple Advanced Cancers Protein 1), MMP (Matrix Metalloproteinase), MPIF (Myeloid Progenitor Inhibitory Factor), Mpo (Myeloperoxidase), MSK (Mitogen- and Stress-activated Protein Kinase), MSP (Macrophage Stimulating Protein), Mug (Mismatch Uracil DNA Glycosylase), MuSK (Muscle-specific Kinase), NAIP (Neuronal Apoptosis Inhibitor Protein), NAP (Neutrophil Activation Protein), NCAD N-Cadherin (N-Cadherin Neural Cadherin), NCAM (Neural Cell Adhesion Molecule), nNOS (Neuronal Nitric Oxide Synthase), NO (Nitric Oxide), NOS (Nitric Oxide Synthase), Npn (Neuropilin), NRG-3 (Neuregulin-3), NT (Neurotrophin), NTN (Neurturin), OB (Leptin, product of the ob gene), OGG1 (8- oxoGuanine DNA Glycosylase), OPG (Osteoprotegerin), OPN (Osteopontin), OSM (Oncostatin M), PADPr (Poly (ADP-ribose) Polymer), PARC (Pulmonary and Activation-regulated Chemokine), PARP (Poly (ADP-ribose) Polymerase), PBR (Peripheral-type Benzodiazepine Receptorlnterleukin-la (hIL-la), Interleukin-lb (hIL-lb), Interleukin-2 (hIL-2), Interleukin-3 (hIL-3), Interleukin-4 (hIL-4), Interleukin-5 (hIL-5), Interleukin-6 ( L-6), Interleukin-7 (hIL-7), Interleukin-10 (hIL-10), Interleukin-11 (hlL- 11), Interleukin-12 (hIL-12), Interleukin-13 (hIL-13), Interleukin-15 (hIL-15), Interleukin- 18 (hIL-18), PBSF (Pre-B Cell Growth Stimulating Factor (aka SDF-l)Interleukin-la (hIL-la), Interleukin-lb (hIL-lb), Interleukin-2 (hIL-2), Interleukin-3 (hIL-3), Interleukin- 4 (hIL-4), Interleukin-5 (hIL-5), Interleukin-6 (hIL-6), Interleukin-7 (hIL-7), Interleukin- 10 (hIL-10), Interleukin-11 (hIL-11), Interleukin-12 (hIL-12), Interleukin-13 (hIL-13), Interleukin-15 (hIL-15), Interleukin-18 (hIL-18), PCAD (P-Cadherin Placental Cadherin), PCNA (Proliferating Cell Nuclear Antigen), PDGF (Platelet-derived Growth Factor), PDK-1 (Phosphoinositide Dependent Kinase- 1), PEC AM (Platelet Endothelial Cell Adhesion Molecule), PF4 (Platelet Factor 4), PGE (Prostaglandin E), PGF (Prostaglandin F), PGI2 (Prostacyclin PGJ2 Prostaglandin J2), PIN (Protein Inhibitor of Neuronal Nitric Oxide Synthase), PLA2 (Phospholipase A2), P1GF (Placenta Growth Factor), PLP (Proteolipid Protein), PP14 (Placental Protein 14), PS (Presenilin), PTEN (Protein Tyrosine Phosphatase and Tensin Homolog, see MMAC PTN Pleiotrophin), R51 (S. cerevisiae homolog of RAD51), RANK (Receptor Activator of NF-kappa-B), RANTES (Regulated upon activation, normal T cell Expressed and Secreted), Ret (Proto-oncogene Tyrosine-protein Kinase Receptor), RPA2 (Replication Protein A2), RSK (Ribosomal Protein S6 Kinase II), SCF/KL (Stem Cell Factor/KIT Ligand), SDF-1 (Stromal Cell- derived Factor 1 (aka PBSF)), sFRP-3 (Secreted Frizzled Related Protein), Shh (Sonic Hedgehog), SIGIRR (Single Ig Domain Containing IL-1 Receptor-related Molecule), SLAM (Signaling Lymphocytic Activation Molecule), SLPI (Secretory Leukocyte protease Inhibitor), SMAC (Second Mitochondria-derived Activator of Caspase), SMDF (Sensory and Motor Neuron-derived Factor), SOD (Superoxide Dismutase), SPARC (Secreted Protein Acidic and Rich in Cysteine), Stat (Signal Transducer and Activator of Transcription), TACE (TNF-α-Converting Enzyme), TACI (Transmembrane Activator and CAML Interactor), TARC (Thymus and Activation-regulated Chemokine), TCA-3 (a CC Chemokine), TECK (Thymus-expressed Chemokine), TERT (Telomerase Reverse Transcriptase), TfR (Transferrin Receptor), TGF (Transforming Growth Factor), Thymus Ck-1 (Thymus Chemokine 1), Tie (Tyrosine Kinase with Immunoglobulin and Epidermal Growth Factor Homology Domains), TIMP (Tissue Inhibitors of Metalloproteinases) TIQ (N-methyl-6,7-dihydroxytetrahydroisoquinoline), Tmpo (Thymopoietin), TNF-R (TNF- Receptor), TNF (Tumor Necrosis Factor), TP-1 (Trophoblast Protein-1), Tpo (Thrombopoietin), TRAIL (TNF-related Apoptosis-inducing Ligand), TRAIL R (TRAIL Receptor), TRANCE (TNF-related Activation-induced Cytokine), TRF (Telomeric Repeat Binding Factor), Trk (Neurotrophic Tyrosine Kinase Receptor), TROP-2 (Tumor Associated Calcium Signal Transducer), TSG (Twisted Gastrulation), TSLP (Thymic Stromal Lymphopoietin), TWEAK (TNF-like and Weak Inducer of Apoptosis), TXB2 (Thromboxane B2), Ung (Uracil-N-Glycosylase), uPAR (Urokinase-type Plasminogen Activator Receptor), uPAR-1 (Urokinase-type Plasminogen Activator Receptor 1), VCAM-1 (Vascular Cell Adhesion Molecule 1), VECAD (VE-Cadherin Vascular Epithelium Cadherin), VEGF (Vascular Endothelial Growth Factor), VEGI (Vascular Endothelial Growth Inhibitor), VIM (Vimentin), VLA-4 (Very Late Antigen-4), WIF-1 (Wnt Inhibitory Factor), XIAP (X-linked Inhibitor of Apoptosis) or XPD (Xeroderma Pigmentosum D).
TABLE 1 Summary of sequence identifiers
Figure imgf000014_0001
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 is a representation showing NC gene expression and domain organisation, (a) is a diagramafic representation of a BAG array spanning a total of 8 Mb, showing positions of clones (horizontal bars) used in ChIP- and S/MAR-array analyses. Positions and orientations of genes located at 10q25 used in expression study are shown by arrows or arrowheads (green for expressed genes, red for non-expressed genes), (b) is a graphical representation of a scaffold/matrix attachment along the 10q25 BAG array as determined by S/MAR-array analysis on chromatin prepared from mardel(lθ) and normal chromosome 10-containing hybrid cell lines, denoted as M10 and N10 respectively. Data- points, represented on the x-axis by the midpoints of the positions of the BACs relative to the start of the contig map, were expressed as the means and standard deviation of the means from ten independent experiments, and were calculated as the percentage difference between the scaffold/matrix-attached/unattached signal ratio of M10 and N10 (y-axis). Significance ofthe data-points was determined using a Student's t-test and is indicated by * (p<0.01). A summary of S/MAR-FISH data is shown at the top of the graph, denoting scaffold/matrix-attached (+) or non-attached (-) BAG DNA, and showing close concordance with the S/MAR-array results. Corresponding BACs on the graph used in FISH are shown as open circles. The S/MAR- and CENP-A-associated (Lo et al, EMBO J. 20(8): 2087-2096, 2001 A) domains are indicated by blue and purple shadings, respectively, (c) is a graphical representation of the distribution of CENP-H protein along the 10q25 BAC contig (x-axis) as determined by ChlP-array analysis. The y-axis shows the fold difference between the normalised bound/input ratio of M10 and N10 cell lines. Each data-point is the mean of four independent experiments. Significance of the data- points was determined using a Student's t-test and is indicated by * (p<0.01). Green shading indicates position of the CENP-H-associated region, (d) is a graphical representation of the distribution of HP1 protein along the 10q25 BAC contig (x-axis) as determined by ChlP-array analysis. The y-axis shows the fold difference between the normalised bound/input ratio of M10 and N10 cell lines. Each data-point is the mean of four independent experiments. Significance (p<0.01) of the data-points was determined using a Student's t-test and is indicated by *. Orange shading indicates the position of the HP 1 -associated domain, (e) is a diagramatic representation of the organisation of various modified chromatin domains is shown in relation to the expression status of underlying genes #1-15 (Figure la). (+) denotes positive gene expression following NC formation, whereas (?) indicates unknown expression status of a gene present in the HP 1 -associated chromatin domain.
Color copies of this figure are available from the patentee.
Figure 2 is a representation of CT analysis of expressed genes. Refer to Table 2 for explanation of CT and ΔCT. 1/ΔCT (y-axis) provides a measure of expression level of individual genes, (a) is a graphical representation of a comparison of results for somatic cell hybrids containing human chromosome 10 (shown as grey bars) and those for hybrids containing mardel(lθ) (black bars) indicate no major difference between hybrid pairs for all genes tested. See Table 3 for a summary of the relative expression levels between hybrids and Student's t-test values, (b) is a graphical representation of a SYBR green- based real-time RT-PCR analysis of a mardel(10)-containing mouse ES hybrid cell line (ES-M10) showing CT values of expressed genes including hCG39837 (spanning the CENP-A-associated domain), (c) is a photographic representation gel electrophoresis of RT-PCR products obtained by SYBR green and TAQman analyses of hCG39837, showing specificity of gene amplification. ES-WT refers to wild type ES cells, from which monochromosomal mardel(10)-containing hybrid lines ES-M10-9, -19, and -20 were derived. (NT), no template control; (S), results from SYBR green; and (T), results from TAQman experiments.
Color copies of this figure are available from the patentee.
Figure 3 is a visualisation of scaffold/matrix attachment on metaphase chromosomes. FISH on histone-depleted chromosomes was performed as published (Bickmore and Oghene, Cell 84(1): 95-104, 1996). A, Chromosome-10 centromeric α-satellite probe showing tightly packed signals (closed arrow). (b,e,f,i), BAC clones bA313D6 (b, f) and bA427L15 (e, i), which map outside the S/MAR-enriched domain identified by S/MAR- array analysis, produce dispersed signals (open arrows) on both the normal chromosome 10 (left panel) and mardel(lθ) (right panel), indicating predominantly non-scaffold/matrix attachment of the probed regions, (c, d, g, h), BAC clones E8 (c, g) and bA153G5 (d, h), which map within the S/MAR-enriched domain identified by S/MAR-array analysis, produce dispersed signals (open arrow) on chromosome 10 (c, d) but tightly packed signals on mardel(lθ) (closed arrow; g, h), confirming increased scaffold/matrix attachment for these regions on mardel(lθ). Combined image (i) and split images for DAPI (ii) and FITC (iii) are shown for each probe. Scale bar represents 1 μM.
Color copies of this figure are available from the patentee.
Figure 4 is a representation showing truncation of mardel(lθ) in mouse embryonic stem cells, (a) Structure of TACT (telomere-associated chromosomal truncation) targeting constructs used for truncating mardel(lθ). Targeting DNA (B43all and B79el6) from the p and q arm of mardel(lθ) [see (4b)] and a mammalian selectable marker (either puromycin or hygromycin resistance gene, puromycin [registered trademark] hygromycin [registered trademark]) were cloned into vectors containing small arrays of cloned human telomeric DNA (Htel). Constructs were linearized at a restriction site between the vector DNA and the telomere repeats to expose the telomere sequences at the terminal, (b) Schematic formation of mardel(lθ) and NC-MiCs derived from truncation of mardel(lθ). Open arrows indicate the breakpoints on the normal chromosome 10 in the generation of mardel(lθ). The long and short arms of mardel(lθ) are denoted as q and p, respectively. NC-MiC53g was formed as a result of truncation and deletion both the and q arms of mardel(lθ). NC-MiC8a and 20f were the result of truncations using construct targeting B43all site with puromycin resistance gene followed by a second truncation using construct containing hygromycin resistance gene targeting B79el6s. Vertical shaded area represents the centromere protein CENP-A-binding domain (Lo et al. 2001 A supra). Open arrowheads indicate positions of intended targeted truncation. (+) denotes a positive FISH result for a BAC or cosmid probe on an NC-MiC, while (-) indicates a negative FISH result. Color copies of this figure are available from the patentee.
Figure 5 is a photomicrographic representation showing FISH analysis of NC-MiC6 in human HCT116pgrxr cell line. NC-MiC6 is indicated by arrow and human chromosome 10 by arrowhead, (a) FISH using (i) neocentromeric probe B153g5 and (ii) p'-arm probe B326h7 (green), showing the transfer of NC-MiC6 into HCTl lόpgrxr. (b) Split images of (a) showing DAPI staining.
Color copies of this figure are available from the patentee.
Figure 6 is a photomicrographic representation showing FISH analysis of NC-MiC6 in human 293trex cell line. NC-MiC6 is indicated by arrow and human chromosome 10 by arrowhead, (a) FISH using (i) neocentromeric probe B153g5 and (ii) p'-arm probe B326h7 (green), showing the transfer of MC-MiC6 into 293trex. (b) Split images of (a) showing DAPI staining.
Color copies of this figure are available from the patentee.
Figure 7 is a photomicrographic representation showing FISH analysis NC-MiC6 in HCTl 16pgrxr (a) and 293trex (b). NC-MiC6 is indicated by arrow and chromosome 10 by arrowhead, (i) FISH using B513g5 NC probe (green) and α-satellite DNA pTRA7 (red), (ii, iii) split images for pTRA7 and DAPI, respectively, showing absence of centromere- specific α-satellite DNA on NC-MiC6.
Color copies of this figure are available from the patentee.
Figure 8 is a photomicrographic representation showing FISH analysis of NC-MiCs 53g, 8a and 20f. NC-MiCs are indicated by arrow, (a) Combined FISH images using B153g5 NC cosmid probe (green) and mouse major satellite DNA probe (red), showing absence of major satellite on NC-MiC53g (i), NC-MiC8a (ii) and NC-MiC20f (iii). (b) Split images of (a) showing DAPI staining. Color copies of this figure are available from the patentee.
Figure 9 is a photomicrographic representation showing FISH analysis of NC-MiCs 53g, 8a and 20f. NC-MiCs are indicated by arrow, (a) Combined FISH images using B153g5 NC cosmid probe (green) and mouse minor satellite DNA probe (red), showing absence of minor satellite on NC-MiC53g (i), NC-MiC8a (ii) and NC-MiC20f (iii). (b) Split images of (a) showing DAPI staining.
Color copies of this figure are available from the patentee.
Figure 10 is a photomicrographic representation showing FISH analysis of NC-MiCs 53g, 8a and 20f. NC-MiCs are indicated by arrow, (a) Combined FISH images using B153g5 NC cosmid probe (green) and mouse cot DNA probe (red), showing absence of mouse DNA on NC-MiC53g (i), NC-MiC8a (ii) and NC-MiC20f (iii). (b) Split images of (a) showing DAPI staining.
Color copies of this figure are available from the patentee.
Figure 11 is a photomicrographic representation showing FISH analysis of NC-MiCs 53g, 8a and 20f. NC-MiCs are indicated by arrow, (a) FISH using zeocin resistance gene (green) showing presence of zeocin resistance gene on NC-MiC53g (i), NC-MiC8a (ii) and NC-MiC20f (iii). (b) Split images of (a) showing DAPI staining.
Color copies of this figure are available from the patentee.
Figure 12 is a representation showing formation and characterization of NC-MiCl. (a) Mardel(lO) was formed following a complex rearrangement in which the central part of chromosome 10 was deleted to form a ring structure with joining of the ends and neocentromere formation producing the mardel(lθ) marker chromosome. NC-MiCl was formed as a result of unknown rearrangements following transfer of this marker from a CHO based somatic cell hybrid line (Saffery et al, Proc. Natl. Acad. Sci. USA 98(10): 5705-5710, 2001) into human HT1080 cells, (b) FISH analysis using BAC clones of known position indicates the estimated size of NC-MiCl to be approximately 3.5 Mb. + and - denote presence and absence of a BAC signal, respectively, (c) Examples of FISH experiments used to characterise NC-MiCl. (i) Dual-colour FISH analysis using BACs BA153G5 (green) and BA373K12 (red; q' arm) mapping to 10q25 and 10pl5 respectively, demonstrating separation of signals on chromosome 10 (open arrow) and colocalisation of signals on NC-MiCl (closed arrowhead), (ii) Dual-colour FISH analysis using BACs BA153G5 (green) and BA69klO (red; p' arm) both mapping to 10q25, demonstrating positive signals on NC-MiCl. (iii) Dual-colour FISH analysis using BACs BA153G5 (green) and B5N23 (red; q' arm) mapping to 10q25 and 10pl5 respectively, demonstrating presence of signals on chromosome 10 (open arrow) and absence of B5N23 signal on NC- MiCl (closed arrowhead), (iv) Reverse painting of NC-MiC DNA on human chromosomes demonstrating that NC-MiCl was exclusively derived from 1 Op 14- 15 and 10q25 DNA.
Color copies of this figure are available from the patentee upon request.
Figure 13 is a photographic representation showing microcell-mediated chromosome transfer of mardel(lθ) into mouse ESGFP cells.
I) FISH analysis of ESGFPmar(10)#l cell line using 10q25 neocentromere-specific and flanking BAC probes (Saffery et al, 2001 supra). Mardel(lO) is indicated by arrow, (a) (i-iii) Combined and split images for BAC probe (green) and DAPI staining. FISH using 10q25 neocentromere-specific probe B153g5 (ii, green), showing presence of mardel(lθ) in ESGFPmar(10)#l. (b-c) (i-iii) Combined and split images for dual-colour FISH signals (green and red). Positive FISH signals using BAC probes B5402 on proximal p' arm (bii, green), B119p3 on proximal q' arm (cii, green), and neocentromeric E8 probe (biii and ciii, red), showing intactness ofthe neocentromere region on mardel(lθ) in mouse ES cells. II) FISH analysis of ESGFPmar(10)#l using human Cotl and mouse DNA probes. Mardel(lO) is indicated by arrow, (i-iii) Combined image, and split images for green, and red, respectively, (a) FISH using NC-specific probe E8 (ii, green) and human Cotl DNA (iii, red), showing the sole presence of mardel(lθ) and the absence of other human chromosomes in ESGFPmar(10)# 1. (b) FISH using E8 (ii, green) and mouse centromeric major satellite DNA (iii, red), showing absence of mouse major satellite in mardel(lθ) in ESGFPmar(10)# 1. (c) FISH using E8 (ii, green) and mouse centromeric minor satellite DNA (iii, red), showing absence of mouse minor satellite in mardel(lθ) in ESGFPmar(10)# 1. (d) FISH using E8 (ii, green) and mouse genomic DNA-paint (iii, red), showing absence of mouse genomic DNA in mardel(lθ) in ESGFPmar(10)# 1.
Color copies of this figure are available from the patentee upon request.
Figure 14 is a photographic representation showing microcell-mediated chromosome transfer of NC-MiC-1 into mouse ESGFP cells.
I) FISH analysis of ESGFPNC-MiCl#2 cell line using 10q25 neocentromere-specific and flanking BAC probes (Saffery et al., 2001 supra). NC-MiCl is indicated by arrow, (a) (i-iv) Combined and split images for green, red, and DAPI, respectively. FISH showing the presence of 10q25 neocentromere-specific BAC probe B153g5 (ii, green) and absence of distant p-arm BAC BlOkl (iii, red), (b) (i-iv) Combined and split images for green, red and DAPI, respectively. FISH using neocentromere- specific probe E8 (ii, green) and human cotl DNA (iii, red), showing the presence of NC-MiC 1 and absence of other human chromosomes in ESGFPNC-MiC 1 #2.
II) FISH analysis of ESGFPNC-MiCl#2 using mouse DNA probes. NC-MiCl is indicated by arrow, (i-iii) Combined image, and split images for red and green, respectively, (a) FISH using BAC probe B153g5 (ii, green) and mouse centromeric major satellite DNA (iii, red), showing absence of mouse major satellite in NC- MiCl in ESGFPNC-MiCl#2. (c) FISH using B153g5 (ii, green) and mouse centromeric minor satellite DNA (iii, red), showing absence of mouse minor satellite inNC-MiCl in ESGFPNC-MiCl#2. (d) FISH using B153g5 (ii, green) and mouse genomic DNA-paint (iii, red), showing absence of mouse genomic DNA in NC-MiCl in ESGFPNC-MiCl#2.
Color versions of this Figure are available from the patentee upon request.
Figure 15 is a photographic representation showing characterization of mardel(lθ) in various tissues of chimeric mice. FISH analysis of tissues derived from chimeric mice PL, CH and KM. Mardel(lO) is indicated by arrow, (a) (i-iii) FISH using E8 probe (green) and human cotl DNA (red), showing presence of mardel(lθ) in cells cultured from PL's lung (i), PL's spleen (ii), and CH's tail (iii). (b) (i-iii) FISH using E8 probe (green) and mouse cotl DNA (red), showing absence of mouse DNA on mardel(lθ) in cells established from PL's lung (i), PL's spleen (ii), and CH's skin (iii). (c) (i-iii) FISH using E8 probe (red) and human chromosome-10 paint (green), showing positive painting solely on mardel(lθ) in cell cultures established from PL's skin (i), CH's tail (ii), and KM's tail (iii).
Color copies of this figure are available from the patentee upon request.
Figure 16 is a photographic representation showing characterization of NC-MiCl in various tissues of chimeric mice. FISH analysis of tissues derived from chimeric mice TT and TEQ. NC-MiCl is indicated by arrow. FISH using B153g5 probe (i, green) and DAPI (ii), showing presence of NC-MiCl in cells cultured from TT's skin (a), TEQ's lung (b), and TEQ 's skin (c).
Color copies of this figure are available from the patentee upon request. Figure 17 is a photographic representation showing the characterization of NC-MiCl in germline embryos. FISH analysis of tissues derived from chimeric mouse JL. NC-MiCl is indicated by arrow, (a-c) FISH using human cotl DNA as probe (i) and DAPI staining (ii), showing the presence of NC-MiCl in cells cultured from JL embryos at 9.5 days (b,c) and 2.5 day s(a) post-coitum, and the presence of more than one copy of NC-MiCl in the cells 9.5-day old embryos.
Color copies of this figure are available from the patentee upon request.
LIST OF TABLES
Figure imgf000024_0001
DET AILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention provides a means for genetically modifying stem cells or parent cells of stem cells including partially differentiated committed or adult stem cells as well as progeny thereof. The genetically modified stem cell are useful in generating tissue suitable for use in replacement, repair, rejuvenation and/or augmentation therapy and as a source of cellular therapeutics. The present invention further contemplates for a method of treatment or prophylaxis of a subject by the administration of stem cells genetically modified via an artificial chromosome. The artificial chromosome of the present invention comprises a neocentromere having one or more definable centromeric chromatin domains. The neocentromere is as defined in U.S. Patent No. 6,265,211 and is devoid of α-satellite repeat DNA. More particularly, the present invention contemplates a method for generating partially differentiated cells or cells with a propensity to develop or differentiate into mature cells or terminally differentiated cells or re-programmed cells for use in the treatment or prophylaxis of trauma or disease, by introducing a vector comprising an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises expressible genetic material within the centromeric chromatin domains into a stem cell or parent thereof.
Accordingly, one aspect of the present invention provides a stem cell comprising a self- replicating artificial chromosome comprising a neocentromere having centromeric chromatin domains wherein the artificial chromosome comprises expressible genetic material within the centromeric chromatin domains or in a region proximal thereto which modifies or introduces at least one trait in said stem cell.
Another aspect of the present invention provides for a method of modulating the genetic potential of a stem cell, said method comprising introducing into said stem cell or a parent of said stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains or in a region proximal thereto which comprises expressible genetic material within the centromeric chromatin domains which modifies or introduces at least one trait in said stem cell. Still a further aspect of the invention provides for a method for directing differentiation, proliferation or self-renewal of a stem cell by introducing into the stem cell or a parent of said stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises genetic material within the centromeric chromatin domains or in a region proximal thereto which is capable of generating an expression production which modulates stem cell differentiation, proliferation and/or self-renewal.
The present invention provides, therefore, a method of generating a differentiated cell, mature cell or a cell capable of differentiating into mature tissue exhibiting a particular trait by introducing into a stem cell or a parent of a stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises expressible genetic material within the centromeric chromatin domains or in a region proximal thereto wherein the expression product adds or modifies a trait exhibited by the stem cell prior to genetic manipulation.
A trait is a feature of the stem cell which is unique to the stem cell or which directs the stem cell down a particular cell lineage pathway, or which affects its potential to differentiate, proliferate or self-renew. The trait may also be in the form of a cell surface or sub-surface receptor or ligand or may be a particular molecule such as an enzyme involved in a genetic, physiological or bacterial pathway or attribute. By providing additional genetic information, traits can be added or removed or modified leading to new features associated with the stem cell such as an ability to direct the cell down a particular lineage pathway.
Reference to a "stem cell" includes reference to a single stem cell or a multiplicity of stem cells. Stem cells of the present include embryonic stem cells, adult stem cells and somatic stem cells. The embryonic stem cells of the present invention may be freshly derived primary cells, a stem-cell line or an embryonic carcinoma cell line. All other stem cells from somatic tissue (every tissue excluding germ cell tissue) are defined in general as "somatic stem cells", "mature stem cells", "progenitor stem cells", "precursor stem cells" and "precursor cells". These include, without being limited to, epidermal stem cells, adult neural stem cells, keratinocyte stem cells, melanocyte stem cells, adult renal stem cells, embryonic renal epithelial stem cells, embryonic endodermal stem cells, hepatocyte stem cells, mammary epithelial stem cells, bane marrow-derived stem cells, skeletal muscle stem cells, bone marrow mesenchymal stem cells, CD34+ hematopoietic stem cells or mesenchymal stem cells. The germline stem cells are the final class of stem cells. Stem cells of the present invention may be derived from any human or mammalian or non- mammalian animal or avian species.
"Cell differentiation" is the process whereby relatively imspecialized cells, e.g. embryonic or somatic stem cells acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. There are many pathways that an unspecialized cell e.g. a stem cell, can undertake in order to form a mature cell. Reference to "differentiation of a stem cell" includes stem cells which are partially differentiated, e.g. monocytes or tissue specific stem cells or stem cells that are terminally differentiated e.g. macrophages. In addition, the stem cells of the present invention encompasses cells differentiated to all stages in between. Differentiation may occur in vivo, in vitro or ex vivo.
Examples of the types of differentiated cells encompassed by the present invention are described in Table 3. The stem cells of the present invention may be induced to form cells ofthe brain, epidermis, skin, pancreas, kidney, liver, breast, lung, muscle, heart, eye, bone, nervous system, spleen or the immune system. Cells ofthe immune system include without limitation, CD4+ T-cells, CD8+ T-cells, natural killer cells, monocytes, macrophages, dendritic cells and B-cells. TABLE 3 Differentiated Cell Types
Cell Type Application
Tissue-specific cells and Genes associated therewith
Brain:
Bcl-2-associated athanogene 1 (Kermer et al, Cell Death Differ. 9(4): 405-413, 2002); CCAAT/enhancer binding protein (C/EBP) (Cortes-Canteli et al, J Biol Chem 277(7): 5460-5467, 2002); empty spiracles homolog 1 (Drosophila) (Bishop et al., J Comp Neurol 457(4): 345-360, 2003), empty spiracles homolog 2 (Drosophila) (Bishop et al, 2003, supra); forkhead box Gl (Hanashima et al, J Neurosci 22(15): 6526-6536, 2002; Xuan et al, Neuron 14(6): 1141-1152, 1995); proprotein convertase subtilisin/kexin type 9 (Seidah et al, Proc. Natl. Acad. Sci. USA 100(3): 928-933, 2003); suppressor of cytokine signaling 2 (Turnley et al, Nat Neurosci 5(11): 1155-1162, 2002); T-cell leukemia, homeobox 1 (Qian et al, Genes Dev 16(10): 1220-1233, 2002); Υ-C ll leukemia, homeobox 3 , (Qian et al, 2002 supra); insulin-like growth factor 1 (Vicario- Abejon et al, J Neurosci 23(3): 895-906, 2003); neuregulin 1 (Schmid et al, Proc. Natl. Acad. Sci. USA 100(7): 4251-4256, 2003); neurotrophin 5 (Liebl et al, Proc. Natl Acad. Sci. USA 97(5): 2297-2302, 2000). Adult neural stem cells Generation of neural tissue for transplant Human neurons Generation of neural tissue for transplant Human astrocytes Generation of neural tissue for transplant Human glial cells Generation of neural tissue for transplant
Epidermis: cut-like 1 (Drosophila) (Ellis et al, Genes Dev 15(17): 2307-2309, 2001); growth factor independent 1 (Wallis et al, Development 130(1): 221-232, 2003); mucolipin 3 (Di Palma et al, Proc. Natl. Acad. Sci. USA 99(23): 14994-14999, 2002); mucosal vascular addressin cell adhesion molecule 1 (Nishioka et al, J Invest Dermatol 119(3): 632-638, 2002); tumor susceptibility gene 101 (Oh et al, Proc. Natl. Acad. Sci. USA 99(8): 5430- 5435, 2002); endothelin 3 (Reid et al, Development 122(12): 3911-3919, 1996); endothelin receptor type B (Reid et al, 1996 supra). Human keratinocyte stem cells Generation of epidermal type tissues such as hair follicles, sebaceous glands and skin for transplant Human keratinocyte transient Generation of epidermal type tissues such as hair amplifying cells follicles, sebaceous glands and skin for transplant Human melanocyte stem cells Generation of epidermal type tissues for transplant Human melanocytes Generation of epidermal type tissues for transplant
Skin Human foreskin fibroblasts Generation of skin for transplant
Pancreas Human duct cells Generation of insulin-producing cells for transplant Human pancreatic islets Generation of insulin-producing cells for transplant Human pancreatic β-cells Generation of insulin-producing cells for transplant
Figure imgf000029_0001
Figure imgf000030_0001
Figure imgf000031_0001
Reference to "cells capable of differentiating into mature tissue" includes the ability to differentiate into mature tissue in vivo, in vitro, or ex vivo. The term "in vivo" refers to cells introduced in a living body or organism. The term "in vitro" means performed in an artificial environment like a test tube or culture media. The term "ex vivo" pertains to a biological process or reaction taking place outside of a living. In the case of the present invention, the term "ex vivo" pertains to the process of differentiating the stem cells in vitro and then growing all or part of the organ or tissue or pure cell population, prior to re- introducing them to the subject.
Reference to a "tissue" means a group or layer of cells that are alike and that work together to perform a specific function. Tissues ofthe present invention refer to organs, blood cells, skin cells and cells maintained in culture. The stem cells of the present invention are modulated by the incorporation into the stem cell of an artificial chromosome. The artificial chromosomes of the present invention comprise an isolated nucleic acid molecule comprising a nucleotide sequence corresponding to neocentromeric sequences of mammalian, avian or other higher eukaryote DNA, the nucleic acid molecule further comprising a heterologous nucleic acid molecule inserted within a centromeric chromatin domain within the neocentromeric region or immediately adjoining or proximal region and when the heterologous nucleic acid molecule is expressed modulates the stem cell.
Generally, the artificial chromosome nucleic acid molecule is a DNA molecule. In one form, the artificial chromosome DNA molecule is in isolated form. In another form, the artificial chromosome DNA is resident within the cell of the mammalian, avian species or any other higher eukaryote. The term "resident" includes the DNA existing as a self- replicating unit relative to the cell's chromosome as well as being integrated into the cell's chromosome. Generally, the artificial chromosome is in the form of a vector. The vector comprises, therefore, a neocentromere or its centromeric equivalent and having a centromeric chromatin domain. The term "neocentromere" is not intended to exclude a centromere although the neocentromere or centromere of the present invention is substantially devoid of α-satellite or other repeat DNA that normally resides at a centromere. For brevity, reference to a "neocentromere" includes a centromere which substantially contains no α-satellite or other repetitive DNA-based centromeric sequences.
The term "mammal" includes a human or other primate such as gorilla, marmoset, chimpanzee, a livestock animal (e.g. sheep, cow, pig, horse, donkey, goat), a laboratory test animal (e.g. mouse, rat, rabbit, guinea pig, hamster), a companion animal (e.g. dog, cat) or captive wild animal. An avian species includes a poultry bird (e.g. chicken, duck, turkey, goose), game bird (e.g. wild duck, pheasant, peacock, emu, ostrich) or caged or aviary bird (e.g. parrots, pigeons, finches).
Preferably, however, the DNA is present in a mammalian cell and even more preferably, a human cell. An artificial chromosome for human cells is referred to as a "HAC" or "human artificial chromosome".
Accordingly, another aspect of the invention provides a method for altering the genetic potential of a stem cell or a daughter cell thereof, said method comprising incorporating into a stem cell or parent thereof at least one artificial chromosome comprising a neocentromere having centromeric chromatin domains of mammalian, avian or other higher eukaryote DNA origin, said nucleic acid molecule comprising a heterologous nucleic acid molecule inserted within a centromeric chromatin domain of the neocentromeric region or immediately adjoining or proximal region and which when the heterologous nucleic acid is expressed adds to or modifies a trait in the stem cell.
Preferably, the artificial chromosome is of mammalian origin and in particular is of human origin. Most preferably, the artificial chromosome is a HAC.
Reference herein to a "heterologous nucleic acid" or "heterologous genetic sequence" or "heterologous gene" means a genetic sequence not generally resident within the neocentromeric DNA or immediately adjoining or proximal DNA. The term "gene" is used in its broadest sense to include a genomic gene (including exon or intron DNA) as well as cDNA (generally only exon DNA). However, the present invention extends to the incorporation of intronic DNA which, upon transcription and optional splicing, is involved in genetic networking. However, the present invention extends to homologous genetic material such as used in RNAi-mediated suppression of gene expression in order to induce gene silencing.
The heterologous or homologous genetic material should not be construed as limiting the inserted nucleotide sequence to encoding a proteinaceous product as the nucleotide sequence may encode an RNA molecule or a sense molecule or may induce RNAi which is involved in co-suppression or post-transcriptional or translational gene silencing or an intron involved in genetic networking.
By "genetic networking" is meant the modulation of expression of genes, promoters, regulatory regions and peptides, polypeptides or proteins within the genome or proteome of a cell.
Genetic material contemplated by the present invention include those genes which when expressed result in the maturation or differentiation of a stem cell. These genes include Bcl-2, Bcl-w and Bcl-xy, Bcl-2-associated athanogene 1, CCAAT/enhancer binding protein (CΕBP), empty spiracles homolog 1 (Drosophila), empty spiracles homolog 2 (Drosophila), forkhead box Gl, proprotein convertase subtilisin/kexin type 9, suppressor of cytokine signaling 2, T-cell leukemia, homeobox 1, T-cell leukemia, homeobox 3, insulin-like growth factor 1, neuregulin 1, neurotrophin 5, cut-like 1 (Drosophila), growth factor independent 1, mucolipin 3, mucosal vascular addressin cell adhesion molecule 1, tumor susceptibility gene 101, endothelin 3, endothelin receptor type B and/or a bone morphogenetic protein (BMP) such as BMP1, BMP2, BMP3 or BMP4.
Alternatively, the genetic material ofthe present invention, when expressed produce one or more cytokines, growth factors, or receptors. Cytokines, growth factors, and receptors of the present invention include but are not limited to Activin RIA (Activin Receptor), ADAM (A Desintegrin and Metalloprotease-like Domain), ADAMTS (A Disintegrin-like and Metalloproteinase Domain with Thrombospondin Type I Motifs), ALCAM (Activated Leukocyte Cell Adhesion Molecule), ALK (Activin Receptor-like Kinase) ANG (Angiogenin), Ang (CC Chemokine Receptors), APAF-1 (Apoptosis Protease Activating Factor- 1), APE (AP Endonuclease), APJ (A Seven Transmembrane-domain Receptor), APP (Amyloid Precursor Protein), APRIL (a Proliferation-inducing Ligand), AR (Amphiregulin), ARC (Agouti-related Transcript), ART (Fibroblast Growth Factor), Axl (a Receptor Tyrosine Kinase),β2M (β 2 Microglobulin), B7-H (B7 Homolog), BACE (β-site APP Cleaving Enzyme), Bad (Bcl-xL/Bcl-2 Associated Death Promoter), BAFF (B cell Activating Factor), Bag-1 (Bcl-2-associated Anthanogene-1), BAK (Bcl-2 Antagonist/Killer), Bax (Bel Associated X Protein), BCA-1 (B-Cell-attracting Chemokine 1), BCAM (Basal-cell Adhesion Molecule), Bel (B-Cell Lymphoma/Leukemia), BCMA (B Cell Maturation Factor), BDNF (Brain-derived Neurotrophic Factor), β-ECGF (β Endothelial Cell Growth Factor), BID (BH3 Interacting Domain Death Agonist), Bik (Bel- 2 Interacting Killer), BIM (Bcl-2 Interacting Mediator of Cell Death), BLC (B- Lymphocyte Chemoattractant), BL-CAM (B-lymphocyte Cell Adhesion Molecule), BLK (Bik-like Killer Protein), BMP (Bone Morphogenetic Protein), BMPR (Bone Morphogenetic Protein Receptor), β-NGF (β Nerve Growth Factor), BOK (Bcl-2-related Ovarian Killer), BPDE (Benzo[a]Pyrene-Guanosine-BSA), BPDE-DNA (Benzo[a]Pyrene- Diol Epoxide-DNA), BTC (β cellulin), CIO (a Novel Mouse CC Chemokine), CAD-8 (Cadherin-8), cAMP (Cyclic AMP), Caspase (Caspase-1), CCI (CC Chemokine Inhibitor), CCL (CC Chemokine Ligands), CCR (CC Chemokine Receptors), CD (Cluster of Differentiation), CD30L (CD30 Ligand), CD40L (CD40 Ligand), CFTR (Cystic Fibrosis Transmembrane Conductance Regulator), cGMP (Cyclic GMP), CINC (Cytokine-induced Neutrophil Chemotactic Factor), CKβ8-l (Chemokine β 8-1), CLC (Cardiotrophin-like Cytokine), CMV UL (Cytomegalovirus ORFUL), CNTF (Ciliary Neurotrophic Factor), CNTN-1 (Contactin-1), COX (Cyclooxygenase), C-Ret (a Receptor Tyrosine Kinase), CRG-2 (a Mouse CXC Chemokine), CT-1 (Cardiotrophin 1), CTACK (Cutaneous T-cell Attracting Chemokine), CTGF (Connective Tissue Growth Factor), CTLA-4 (Cytotoxic T- lymphocyte-associated Molecule 4), CXCL (CXC Chemokine Ligands), CXCR (CXC Chemokine Receptors), DAN (Differential Screening-selected Gene Aberrant in Neuroblastoma), DCC (Deleted in Colorectal Cancer), DcR3 (Decoy Receptor 3), DC- SIGN (Dendritic Cell-specific ICAM-3 -grabbing Nonintegrin), Dhh (Desert Hedgehog), DNAM-1 (DNAX Accessory Molecule 1), Dpp (Decapentaplegic), DR (Death Receptor), Dtk (Developmental Tyrosine Kinase), ECAD (E-Cadherin), EDA (Ectodysplasin-A), EDAR (Ectodysplasin Receptor), EGF (Epidermal Growth Factor), EMMPRIN (Extracellular Matrix Metalloproteinase Inducer, CD 147), ENA (Epithelial-derived Neutrophil Attractant), eNOS (Endothelial Nitric Oxide Synthase), Eot (Eotaxin Epo Erythropoietin), ErbB3 (Erb B3 Receptor Protein Tyrosine Kinase), ERCC (Excision Repair Cross-complementing), ET-1 (Endothelin- 1), Fas (Fibroblast-associated), FEN-1 (Flap Endonuclease), FGF (Fibroblast Growth Factor), FL (Fas Ligand FasL), FLIP (FLICE Inhibitory Proteins), Flt-3 (fins-like Tyrosine Kinase 3), Fractalkine, Gas 6 (Growth-arrest-specific Protein 6), GCP-2 (Granulocyte Chemotactic Protein 2), G-CSF (Granulocyte Colony Stimulating Factor), GDF (Growth Differentiation Factor), GDNF (Glial cell line-derived Growth Factor), GFAP (Flial Fibrillary Acidic Protein), GFRα-1 (Glial Cell Line-derived Neurotropic Factor Receptor α 1), GITR (Glucocorticoid Induced TNF Receptor Family Related Gene), Glut 4 (Insulin Regulated Glucose Transporter Protein), GM-CSF (Granulocyte Macrophage Growth Factor), gpl30 (glycoprotein 130), GRO (Growth Related Protein α), HB-EGF (Heparin Binding Epidermal Growth Factor), HCC (Hemofiltrate CC Chemokine), HCMV UL (Human Cytomegalovirus ORFUL), HGF (Hepatocyte Growth Factor), HRG (Heregulin), Hrk (Harakiri HVEM Herpesvirus Entry Mediator), 1-309 (a human CC chemokine), IAP (Inhibitors of Apoptosis), ICAM (Intercellular Adhesion Molecule, ICOS (Inducible Co-stimulator), IFN (Interferon Ig Immunoglobulin), IGF (Insulin-like Growth Factor), IGFBP (Insulin-like Growth Factor Binding Protein), IL-la (hlnterleukin-la), hIL-lb (Interleukin-lb), hIL-2(Interleukin-2 ), hIL-3 (Interleukin-3), hIL-4 (Interleukin-4), hIL-5 (Interleukin-5), hIL-6 (Interleukin-6), hIL-7 (Interleukin-7), hIL-10 (Interleukin-10), hIL-11 (Interleukin-11), hIL-12 (Interleukin-12), hIL-13 (Interleukin-13), hIL-15 (Interleukin-15), hIL-18 (Interleukin-18), iNOS (Inducible Nitric Oxide Synthase), IP- 10 (Interferon gamma Inducible Protein 10), I- TAG (Interferon-inducible T-cell α Chemoattractant), JE (Mouse homologue of human MCP-1), KC (Mouse homologue of human GRO), KGF (Keratinocyte Growth Factor), LAMP (Limbic System-associated Membrane Protein), LAP (Latency-associated Peptide), LBP (Lipopolysaccharide-binding Protein), LDGF (Leukocyte-derived Growth Factor), LECT2 (Leukocyte Cell-Derived Chemotaxin 2), LFA-1 (Lymphocyte Function- associated Molecule- ILfo), Lfo (Lactoferrin), LIF (Leukemia Inhibitory Factor), LIGHT (Name derived from Homologous to Lymphotoxins, Inducible expression, competes with HSV Glycoprotein D for HVEM, a receptor expressed on T-lymphocytes), LIX (LPS- induced CXC Chemokine), LKN (Leukotactin), Lptn (Lymphotactin), LT-α (Lymphotoxin α (aka TNF-β)), LT-β (Lymphotoxin β (aka p33)), LTB4 (Leukotriene B4), LTBP-1 (Latent TGF-β bpl), MAG (Myelin-associated Glycoprotein), MAP2 (Microtubule- associated Protein 2), MARC (Mast Cell Activation-Related Chemokine), MCAM (Melanoma Cell Adhesion Molecule (aka MUC 18, CD 146)), MCK-2 (Mouse Cytomegalovirus Viral CC Chemokine Homolog 2), MCP (Monocyte Chemotactic Protein), M-CSF (Macrophage Colony Stimulating Factor), MDC (Macrophage-derived Chemokine (aka STP-1)), Mer (Tyrosine Protein Kinase), MGMT (O-6 Methylguanine- DNA Methyltransferase), MIF (Macrophage Migration Inhibitory Factor), MIG (Monokine Induced by IFN-g), MIP (Macrophage Inflammatory protein), MK (Midkine), MMAC1 (Mutated in Multiple Advanced Cancers Protein 1), MMP (Matrix Metalloproteinase), MPIF (Myeloid Progenitor Inhibitory Factor), Mpo (Myeloperoxidase), MSK (Mitogen- and Stress-activated Protein Kinase), MSP (Macrophage Stimulating Protein), Mug (Mismatch Uracil DNA Glycosylase), MuSK (Muscle-specific Kinase), NAIP (Neuronal Apoptosis Inhibitor Protein), NAP (Neutrophil Activation Protein), NCAD N-Cadherin (N-Cadherin Neural Cadherin), NCAM (Neural Cell Adhesion Molecule), nNOS (Neuronal Nitric Oxide Synthase), NO (Nitric Oxide), NOS (Nitric Oxide Synthase), Npn (Neuropilin), NRG-3 (Neuregulin-3), NT (Neurotrophin), NTN (Neurturin), OB (Leptin, product of the ob gene), OGG1 (8- oxoGuanine DNA Glycosylase), OPG (Osteoprotegerin), OPN (Osteopontin), OSM (Oncostatin M), PADPr (Poly (ADP-ribose) Polymer), PARC (Pulmonary and Activation-regulated Chemokine), PARP (Poly (ADP-ribose) Polymerase), PBR (Peripheral-type Benzodiazepine Receptorlnterleukin-la (hIL-la), Interleukin-lb (hIL-lb), Interleukin-2 (hIL-2), Interleukin-3 (hIL-3), Interleukin-4 (hIL-4), Interleukin-5 (hIL-5), Interleukin-6 (hIL-6), Interleukin-7 (hIL-7), Interleukin-10 (hIL-10), Interleukin-11 (hlL- 11), Interleukin-12 (hIL-12), Interleukin-13 (hIL-13), Interleukin-15 (hIL-15), Interleukin- 18 (hIL-18), PBSF (Pre-B Cell Growth Stimulating Factor (aka SDF-l)Interleukin-la (hIL-la), Interleukin-lb (hIL-lb), Interleukin-2 (hIL-2), Interleukin-3 (hIL-3), Interleukin- 4 (hIL-4), Interleukin-5 (hIL-5), Interleukin-6 (hIL-6), Interleukin-7 (hIL-7), Interleukin- 10 (hIL-10), Interleukin-11 (hIL-11), Interleukin-12 (hIL-12), Interleukin-13 (hIL-13), Interleukin-15 (hIL-15), Interleukin-18 (hIL-18), PCAD (P-Cadherin Placental Cadherin), PCNA (Proliferating Cell Nuclear Antigen), PDGF (Platelet-derived Growth Factor), PDK-1 (Phosphoinositide Dependent Kinase-1), PECAM (Platelet Endothelial Cell Adhesion Molecule), PF4 (Platelet Factor 4), PGE (Prostaglandin E), PGF (Prostaglandin F), PGI2 (Prostacyclin PGJ2 Prostaglandin J2), PIN (Protein Inhibitor of Neuronal Nitric Oxide Synthase), PLA2 (Phospholipase A2), P1GF (Placenta Growth Factor), PLP (Proteolipid Protein), PP14 (Placental Protein 14), PS (Presenilin), PTEN (Protein Tyrosine Phosphatase and Tensin Homolog, see MMAC PTN Pleiotrophin), R51 (S. cerevisiae homolog of RAD51), RANK (Receptor Activator of NF-kappa-B), RANTES (Regulated upon activation, normal T cell Expressed and Secreted), Ret (Proto-oncogene Tyrosine-protein Kinase Receptor), RPA2 (Replication Protein A2), RSK (Ribosomal Protein S6 Kinase II), SCF/KL (Stem Cell Factor/KIT Ligand), SDF-1 (Stromal Cell- derived Factor 1 (aka PBSF)), sFRP-3 (Secreted Frizzled Related Protein), Shh (Sonic Hedgehog), SIGIRR (Single Ig Domain Containing IL-1 Receptor-related Molecule), SLAM (Signaling Lymphocytic Activation Molecule), SLPI (Secretory Leukocyte protease Inhibitor), SMAC (Second Mitochondria-derived Activator of Caspase), SMDF (Sensory and Motor Neuron-derived Factor), SOD (Superoxide Dismutase), SPARC (Secreted Protein Acidic and Rich in Cysteine), Stat (Signal Transducer and Activator of Transcription), TACE (TNF-α-Converting Enzyme), TACI (Transmembrane Activator and CAML Interactor), TARC (Thymus and Activation-regulated Chemokine), TCA-3 (a CC Chemokine), TECK (Thymus-expressed Chemokine), TERT (Telomerase Reverse Transcriptase), TfR (Transferrin Receptor), TGF (Transforming Growth Factor), Thymus Ck-1 (Thymus Chemokine 1), Tie (Tyrosine Kinase with Immunoglobulin and Epidermal Growth Factor Homology Domains), TIMP (Tissue Inhibitors of Metalloproteinases) TIQ (N-methyl-6,7-dihydroxytetrahydroisoquinoline), Tmpo (Thymopoietin), TNF-R (TNF- Receptor), TNF (Tumor Necrosis Factor), TP-1 (Trophoblast Protein- 1), Tpo (Thrombopoietin), TRAIL (TNF-related Apoptosis-inducing Ligand), TRAIL R (TRAIL Receptor), TRANCE (TNF-related Activation-induced Cytokine), TRF (Telomeric Repeat Binding Factor), Trk (Neurotrophic Tyrosine Kinase Receptor), TROP-2 (Tumor Associated Calcium Signal Transducer), TSG (Twisted Gastrulation), TSLP (Thymic Stromal Lymphopoietin), TWEAK (TNF-like and Weak Inducer of Apoptosis), TXB2 (Thromboxane B2), Ung (Uracil-N-Glycosylase), uPAR (Urokinase-type Plasminogen Activator Receptor), uPAR-1 (Urokinase-type Plasminogen Activator Receptor 1), VCAM-1 (Vascular Cell Adhesion Molecule 1), VECAD (VE-Cadherin Vascular Epithelium Cadherin), VEGF (Vascular Endothelial Growth Factor), VEGI (Vascular Endothelial Growth Inhibitor), VIM (Vimentin), VLA-4 (Very Late Antigen-4), WIF-1 (Wnt Inhibitory Factor), XIAP (X-linked Inhibitor of Apoptosis) or XPD (Xeroderma Pigmentosum D).
Reference to a "neocentromere" includes reference to a functional neocentromere or a functional derivative thereof or a latent, synthetic or hybrid form thereof or an equivalent centromeric region and which is capable of facilitating sister chromatid cohesion and chromosomal segregation during mitotic cell divisions and/or is capable of associating with CENP-A and/or CENP-C and/or other functionally important centromere proteins and/or is capable of interacting with anti-CENP-A antibodies or anti-CENP-C antibodies or antibodies to other functionally important centromere proteins. Generally, and preferably, the neocentromere is incapable of interacting with CENP-B or anti-CENP-B antibodies. Furthermore, the neocentromere is substantially devoid of α-satellite repeat DNA. The neocentromere may also be a latent centromere capable of activation by epigenetic mechanisms or other relevant mechanisms including chromatin reorganization. The neocentromere may also be a hybrid or other human, mammalian, plant, yeast or eukaryote neocentromeres. Synthetic or artificial or engineered neocentromeres provided by, for example, polymeric techniques to arrive at the correct conformation are also contemplated by the present invention. All such forms and definitions of neocentromeres are encompassed by use of this term.
In particular, the centromeric/neocentromeric region is defined at least in humans as within a 4-Mb genetic region, but not limited to this size, comprising S/MAR, CENP-H, CENP- A, HPlα, and other proteins involved in centromere function. A summary of genes expressed in this region is provided in Table 2.
Accordingly, in a preferred embodiment, the present invention is directed to the use of an isolated nucleic acid molecule comprising a nucleotide sequence corresponding to a neocentromeric region of human DNA and having a centromeric chromatin domain, said nucleic acid molecule further comprising a second nucleic acid molecule inserted within the centromere chromatin domain or immediately adjoining or proximal region and which second nucleic acid molecule is expressible and wherein the expression product alters the genetic potential of a stem cell or its daughter cells wherein the neocentromeric region comprises a q and p arm domain, CENP-H, HP1 domain and a scaffold domain and comprises a gene selected from but not limited to Celera gene ID: hCG41809, hCG40976, hCG1811152, hCG1781464, hCG39839, hCGl 781461, hCG40945, hCG1818126, hCG40995, hCGlδl 1159, hCG40944, hCG40949, hCG39837, hCG40963, hCG40964 (see Tables 2 and 4 ).
An equivalent region in other mammalian, avian species and higher eukaryotic organisms is also contemplated by the present invention.
Furthermore, the present invention provides methods for differentiating a stem cell comprising introducing an artificial or engineered chromosomes carrying heterologous genes or other genetic material for use in differentiating the stem cell for use in replacement, rejuvenation therapy or as a source of cellular therapeutics.
Accordingly, another aspect ofthe present invention provides methods for differentiating a stem cell comprising introducing an artificial or engineered chromosome comprising a neocentromere having centromeric chromatin domains of mammalian, avian or plant or higher eukaryote DNA, said nucleic acid molecule comprising a heterologous nucleic acid molecule inserted within the centromeric chromatin domains or immediately adjoining or proximal region and which heterologous nucleic acid molecule is expressible or otherwise differentiates the stem cell.
More particularly, the present invention contemplates methods for differentiating a stem cell comprising introducing into a stem cell a mammalian artificial or engineered chromosome comprising a neocentromere having centromeric chromatin domains of mammalian origin, said nucleic acid molecule comprising a heterologous nucleic acid molecule inserted within the centromeric chromatin domains or immediately adjoining or proximal region and which heterologous nucleic acid molecule is expressible or differentiates said stem cell.
Preferably, the mammal is a human.
The present invention further contemplates an isolated stem cell or a stem cell in situ comprising an artificial or engineered chromosome or nucleic acid. The present invention provides, therefore, a construct for use in the process of stem cell differentiation. The construct generally comprises a centromeric or neocentromeric region having a heterologous gene sequence inserted within or proximal to a centromeric chromatin domain, generally operably linked to a promoter and optionally a terminator and/or other regulatory sequences.
Reference herein to a "promoter" is to be taken in its broadest context and includes the transcriptional regulatory sequences of a classical genomic gene, optionally including upstream activating sequences, enhancers and silencers or other regulatory sequences. A promoter is usually, but not necessarily positioned upstream or 5', of a structural gene region, the expression of which it regulates.
In the present context, the term "promoter" is also used to describe a synthetic or fusion molecule, or derivative that confers, activates or enhances expression of a nucleic acid molecule in a cell.
Preferred promoters may contain additional copies of one or more specific regulatory elements, to further enhance expression of the sense molecule and/or to alter the spatial expression and/or temporal expression ofthe sense molecule.
Placing a nucleic acid molecule under the regulatory control of a promoter sequence means positioning the molecule such that expression is controlled by the promoter sequence. As stated above, promoters are generally positioned 5' (upstream) to the genes that they control. In the construction of heterologous promoter/structural gene combinations, it is generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, i.e. the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of promoter function. Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, i.e. the genes from which it is derived. Again, as is known in the art, some variations in this distance can also occur.
Examples of promoters suitable for use in the constructs of the present invention include mammalian (e.g. human) viral, fungal, animal and plant derived promoters capable of functioning in plant, animal, insect, fungal or yeast cells. The promoter may regulate the expression of the structural gene component constitutively, or differentially with respect to cell, the tissue or organ in which expression occurs. The promoter may also be inducible, becoming active only following the addition of an exogenous chemical to the cells in which it is contained.
In the present context, the term "operably linked" or similar shall be taken to indicate that expression of the structural gene region or multiple structural gene region is under the control ofthe promoter sequence with which it is spatially connected in a cell.
In some or many situations, a nucleic acid molecule is under the control of its endogenous promoter where the two molecules are operably linked in their naturally occurring configuration.
Means for introducing (i.e. fransfecting or transforming) cells with the constructs are well- known to those skilled in the art.
The artificial chromosomes used in the methods of the present invention are capable of being modified further, for example, by the inclusion of marker nucleotide sequences encoding a detectable marker enzyme or a functional analogue or derivative thereof, to facilitate detection of the synthetic gene in a cell, tissue or organ in which it is expressed. According to this embodiment, the marker nucleotide sequences will be present in a translatable format and expressed, for example, as a fusion polypeptide with the translation product(s) of any one or more of the structural genes or alternatively as a non-fusion polypeptide. The term "structural gene" includes a gene which encodes RNA (e.g. mRNA) or an intronic or exonic RNA. Genetic constructs are particularly suitable for the transformation of a eukaryotic cell to introduce novel genetic traits thereto or to repair defective genes (i.e. gene therapy). Such additional novel traits may be introduced in a separate genetic construct or, alternatively, on the same genetic construct which comprises the synthetic genes described herein.
Furthermore, the present invention provides, therefore, a method of propholaxis or treatment of a trauma or human disease in a subject, the method comprising expanding a culture comprising a stem cell containing an artificial chromosome, wherein said artificial chromosome further comprises a hetereologous gene capable of differentiating said stem cell, and introducing the expanded stem cell population into a subject.
The present invention therefore contemplates methods for treating subjects requiring organ transplantation, including heart lung, kidney, limbs, eyes, and liver. Further, the stem cells of the present invention could be used in treating stroke, ischemia, myocardial infarction, coronary artery disease, spinal cord injury, age-related tissue damage, Alzheimer's disease, Parkinson's disease, liver fibrosis, liver cirrhosis, chronic obstructive pulmonary disorder, compartment syndrome, multiple sclerosis, chronic inflammation, chronic infection, macular degeneration, and cataracts, neurodegenerative diseases, muscle wasting disorders, ataxias, and disorders of the blood. Further the stem cells of the present invention could be infused in subjects following cancer treatments using chemotherapy, or for tissue regeneration.
"Subject" as used herein refers to an animal, preferably a mammal and more preferably human who can benefit from the methods of the present invention. There is no limitation on the type of animal that could benefit from the present methods. A subject regardless of whether a human or non-human animal may be referred to as an individual, subject, animal, host or recipient. The methods ofthe present invention have applications in human medicine, veterinary medicine as well as in general, domestic or wild animal husbandry.
"Treating" a patient may involve prevention ofthe disorder or disease condition or adverse physiological event in a susceptible individual as well as treatment of a clinically symptomatic individual by inhibiting a disease or disorder.
The present invention is further described by the following non-limiting Examples.
EXAMPLE 1 Materials and methods
Cell culture Mouse F9 teratocarcinoma cells, human HCTl 16, human 293T and mouse ES cells derivatives were cultured in Dulbeccos Modified Eagles Medium (Trace Biosciences) supplemented with 10% v/v FCS, penicillin, streptomycin. Growth medium for mouse ES lines was supplemented with leukemia-inhibitory factor (LIF) and (β-mercaptoethanol). Chinese Hamster Ovary (CHO) cell lines and derivative somatic cell hybrids were cultured Ham's F12 Medium (Trace Biosciences) supplemented with dialysed 10% v/v FCS, penicillin, streptomycin.. Growth medium for hybrid lines containing the zeocin-tagged mardel(lθ) chromosome (Saffery et al, 2001 supra) was supplemented with 200 μg/ml zeocin (Invitrogen). All cells were maintained at sub confluency and were split 1 :4 at 24 hr prior to RNA isolation to ensure logarithmic growth at harvest.
Production of somatic cell hybrid lines
Somatic cell hybrid lines 5f and If containing mardel(lθ) or an unrelated normal chromosome 10, respectively, were previously described (du Sart et al, Nat. Genet. 16(2): 144-153, 1997). Four new monochromosomal somatic cell hybrid lines were generated using microcell-mediated chromosome transfer (MMCT) procedures (Saffery et al. 2001 supra). Two of these (CHOM10 and CHON10, respectively) were CHO-based and contained mardel(lθ) or the progenitor normal chromosome 10 derived from the mardel(lθ) patient's father as previously described (Barry et al, Genome Res. 10(6): 832- 838, 2000). These cell lines were produced using selection for the Glutamate Oxaloacetic Transaminase gene as described before (du Sart et al, 1997 supra). The remaining two hybrid lines (F9M10 and F9N10) were mouse F9 cell-based and contained mardel(lθ) or normal chromosome 10, respectively. These were produced by MMCT using the zeocin- tagged mardel(lθ) under zeocin selection. RNA extraction and cDNA synthesis
RNA was isolated from cultured cells using Trizol reagent (Life Technologies, Bethesda, NY) or the Qiagen RNeasy midi kit, according to the manufacturer's instructions. RNA levels were quantified by spectrophotometry and integrity of RNA was assayed by non- denaturing gel electrophoresis. Two micrograms of total RNA was used in the production of cDNA using the ABI Reverse transcriptase kit with random hexamer priming according to the manufacturers instructions. One twentieth of this reaction was used in each quantitative RT-PCR reaction.
Primer design and quantitative RT-PCR
Primers for PCR amplification were designed using Primer express software (ABI). Where possible several primer pairs were designed for each gene. To avoid the amplification of contaminating genomic DNA or total RNA, all primer pairs were designed so that at least one of the pair spanned a genomic exon/intron boundary. Each primer was checked for imiqueness in the human genome prior to synthesis. Initial validation experiments were performed for each primer pair to ensure that no amplification was detected from human genomic DNA or total RNA prior to reverse transcription. Quantitative RT-PCR was carried out using SYBR green technology with the Applied Biosystems SYBR green master mix, and reactions were performed on an ABI 7700 Sequence Detection System. Delta CT analysis was used to calculate the relative amount of expression of individual genes in relation to an 18S control amplicon (Ambion Inc.). Further validation experiments were carried out to ensure that the efficiency of amplification of test primer pairs was comparable to that of the 18S control. This involved serial dilution of template (two-fold dilutions to 1/256) followed by PCR amplification with test primers and 18S control. Delta CT for each dilution was then calculated and if efficiencies of amplifications were comparable this value did not change significantly with each dilution. Several primer pairs failed one or more of the validation experiments and were not included in the final analysis. For TAQman-based quantitative RT-PCR, Assay on demand pre-optimized primer and probe mix were employed with TAQman master mix and TAQman 18S control reagents (Applied Biosystems). Scaffold isolation and array (SIA) analysis
Isolation of cell nuclei:
2 x 10 cells were pelleted at 500 g and washed in PBS for 5 min. Cells were resuspended and washed three times for 5 min at 500 g in isolation buffer containing 3.75 mM Tris- HCI, 0.05 mM Spermine, 0.125 mM Spermidine, 1% v/v thiodyglycol, 20 mM KC1, 0.1 mM PMSF, 0.5 mM EDTA/KOH and 10 KlU/ml Aprotinin [pH 7.4]. Washed cells were resuspended in 12 ml of ice-cold isolation buffer containing 0.1% w/v digitonin and 100 KlU/ml Aprotinin, and broken up in a Dounce type tissue homogeniser with 12 strokes of a B (loose) pestle. Nuclei were collected by three washes in isolation buffer containing 0.1% w/v digitonin and 10 KlU/ml Aprotinin at 900g, 10 min at 4°C. The washed pellet was resuspended in 5 ml isolation buffer containing 0.1% w/v digitonin, 100 KlU/ml Aprotinin and without EDTA/KOH. Nuclei were then filtered through a 40-micron filter to remove nuclei clumps.
Low-salt (LIS) scaffold extraction:
1 x 106 nuclei in 100 ul of isolation buffer with 0.1 % w/v digitonin, 100 KlU/ml Aprotinin and without EDTA/KOH were stabilized at 37° C for 20 min. The nuclei were then diluted with 1 ml of LIS buffer consisting of 5 mM Hepes/NaOH, 0.25 mM Spermidine, 2 mM EDTA/KOH, 2 mM KCL and 50 mM 3,5-diiodasalicylic acid, lithium salt (SERVA), and left to extract for 10 min at 4°C. The extracted nuclei were centrifuged at 2,400 g for 20 min at 4°C, followed by washing the pellet four times with 8 ml of digestion buffer consisting 20 mM Tris-HCl, 0.05 mM Spermine, 0.125 mM Spermidine, 20 mM KC1, 0.1 mM PMSF, 0.1% w/v digitonin, 50 mM NaCI, 5 mM MgCl2 and 100 KlU/ml Aprotinin. Restriction enzymes EcoRI, EcoRV and BamHl were then added at 1000 U/ml and incubated at 37°C for 5 hr. The nuclear scaffold attached DNA was pelleted from the digested loop DNA by centrifugation at 2,400 g for 10 min at 4°C.
BAC array analysis:
100 ng of BAC DNA was immobilized onto Hybond N+ nylon membranes in a dot blot format (minifold SRC-96, Schleisher and Schueel, Dassel, Germany). Identical membranes were pre-annealed with 5 ug of salmon sperm DNA, and probed with 1 ug of scaffold- attached or loop DNA from If and 5f cells, 32P -labeled by random priming and pre- annealed with 5 ug of human Cot-1 DNA. Hybridization and washing were performed at high stringency (0.1 x SSC/0.1% w/v SDS, 65°C). Results were analyzed by a phosphorimager system (Storm 860 Gel and Blot Imaging System, Molecular Dynamics) using Image QuaNT version 4.2 software (Molecular Dynamics). The signals obtained using the scaffold-attached DNA probe were compared to those on a duplicate blot hybridised with the loop DNA probe. The percentages of scaffold/matrix attachment for individual BAC spots were calculated by dividing the scaffold/matrix-attached signal by the sum of the scaffold/matrix-attached and loop DNA signal. The mean values from 10 independent experiments and standard deviations were plotted graphically using the midpoint for each BAC on the contig map. Statistical significance was determined using a two-tailed heteroscedastic Student's t-test.
Scaffold-FISH Actively growing cells were harvested by mitotic shake off, washed in phosphate-buffered saline (PBS), and resuspended at 2 x 106 cells/ml in 0.0075M KC1 for 10 min at 37°C. Cells were then washed in ice-cold PA buffer (15 mM Tris-HCl, 0.2 mM Spermine, 0.5 mM Spermidine, 0.5 mM EGTA, 2 mM EDTA, 80 mM KC1, 20 mM NaCI, 0.1 mM CuSO4 [pH7.2]) at 8 x 106 cells/ml before being resuspended at 1 x 107 cells/ml in cold PA buffer containing 1 mg/ml digitonin. Nuclei were spun out at 200 g for 10 mins at 4°C, and supernatant containing isolated metaphase chromosomes collected. Chromosomes were spread onto slides and allowed to dry for 16 hr. Slides were then gently lowered horizontally into CIB solution (10 mM Tris, 10 mM EDTA, 0.1% Nonidet P-40, 0.1 mM CuSO4, 20 ug/ml PMSF [pH 8.0]) for 5 mins and then extracted in CIB containing 0.5 M NaCI for 5 mins. FISH was carried out using standard conditions.
Chromatin immunoprecipitation and array (CIA) analysis
CIA analysis for CENP-H and HP1 was carried out essentially as described for CENP-A
(Lo et al, 2001A supra; Lo et al, Genome Res. 11(3): 448-457, 2001B) using an affmity- purified rat anti-CENP-H antibody (Sugata et al, 2000 supra), anti-HPlα (Le Douarin et al, EMBO J. 15(23): 6701-6715, 1996), and anti-HPlβ (Serotec Ltd, Oxford, UK). Micrococcal nuclease digestion of chromatin was carried out using 4 units per mg of chromatin-associated DNA for 5-6 min to obtain polynucleosomes.
Blastocyst injection and generation of chimeric mice ES129.1 cell lines containing mardel(lθ) [ESGFPmar(10)#l] and NC-MiCl (ESGFPNC- MiCl#2) were injected into C57BL/6 blastocysts by standard procedures (Bradley et al, Ciba Found Symp, 165:256-269; 1992). The injected blastocysts were then transferred into recipient pseudopregnant mice. Chimeric mice were selected by coat color. Chimeric mice were also crossed with C57BL/6 mice to generate embryos and mice containing germ-line transmitted mardel(l 0) or NC-MiC 1.
Tissue collection and genotyping of chimeric mice and embryo
Tissues collected from chimeric mice were subjected to both DNA (QIAamp Tissue Purification Kit, Qiagen) and RNA (Triazol Reagent, GIBCO/ BRL) isolation according to manufacturers' protocols. In addition, certain tissues including lung, kidney, skin, tail were also cultured in DMEM containing 10% v/v FCS for further analysis. As for the sperm samples, they were harvested from the uteri of the female C57BL/6 mice mated with the chimeric mice generated as described above (Mann et al, J Reprod Fertil, 99:505-512, 1993). In order to purify the haemopoietic stem cells, bone marrow was collected from mice (pretreated with 150mg/kg of body mass fluorouracil for 4 days), followed by washing with 1 x PBS, and lysis on ice for 10 min (lysis solution 0.83% w/v NH4C1 and 0.084% w/v NaHCO3). The cells were then stained with R-Phycoerythrin (R-PE)- conjugated rat anti-mouse Ly-6A/E (Sca-1) monoclonal antibody prior to sorting by FACS. The Ly-6A/Ε (Sca-l)-positive haemopoietic stem cells isolated by FACS were then subjected to another round of sorting to emich the ES129.1-GFP-derived cells. Cells collected were also cultured in the presence of 50 ng/ml SCF, 10 ng/ml IL3, 6 ng/ml IL6 and 100 ng/ml FLT3 (Chemicon International).
Individual embryos were dissected from their implantation site at 2.5, 3.5 and 9.5 days gestation, washed in lx PBS followed by either DNA purification or fixation onto slides for FISH analysis. PCR analysis was carried out on samples using the standard techniques. Primer sets neostartl (ATGATTGAACAAGATGGATTGCAC - SEQ ID NO:29) and neocodRl (TGAGATGACAGGAGATCCTGC - SEQ ID NO:30) were used to detect the presence of ESI 29.1 -originated cells within tissues. For the identification of mardel(lθ) or NC-MiCl in tissues or embryos, two primer sets were used (69klOF3- TTTGCTCACTAGCTGTCTCCTCAT - SEQ ID NO:31 with 69klOR6- GATCATTACCCAGACTCTGACCATT - SEQ ID NO:32, 69klOF4- AGTTATGGAACTCACAAGACAGGAC - SEQ ID NO:33 with 69klOR7- ACATGATGTGGTAGTTGA GTTCACA - SEQ ID NO:34).
RNA purification and RT-PCR
Total RNA was isolated using Trizol (Gibco) according to the manufacturer's instructions. RT-PCR was carried out using Titan one-step PCR kit (Roche) according to the manufacturer protocols, or a two-step procedure using cDNA prepared using a TAQman Reverse Transcription Reagents (Applied Biosystems) followed by standard PCR.
STS PCR analysis
Initial characterisation of NC-MiCl was carried out using STS PCR analysis and standard
PCR procedures using markers and primer pairs listed in Table 5.
ESGFPmar(10)#l and ESGFPNC-MiCl#2 were cultured for 60 divisions in the presence (100 μg/ml) or absence of zeocin before the cells were harvested at various intervals for determination of mardel(lθ) orNC-MiCl stability. Retention rates of 80%-90% and 55%-70% were observed for the respective marker chromosomes after 60 cell divisions with and without selection, implying a small loss rate over time in the mouse ES cell background. EXAMPLE 2 Genes in neocentromeric region
Human neocentromere activation generally occurs in euchromatic regions of the genome containing characterized or predicted genes (Choo, 2001 supra; Amor and Choo, Am. J. Hum. Genet. 71(4): 695-714, 2002). Available human genome sequence databases have been used to identify putative genes in the vicinity of a 10q25 neocentromere on the mardel(lθ) marker chromosome (du Sart et al, 1997 supra). A direct comparison of gene predictions in the public database [Ensemble, UCSC genome browser] to those in the Celera database revealed several differences in both gene number and order. Independent mapping experiments supported the Celera gene order at 10q25. Celera annotations were used as the basis for gene identification. Figure la shows the arrangement of predicted genes with respect to the previously mapped CENP-A-associated region on mardel(lθ) (Lo et al, 2001A supra). In Figure la, the BAC array spanning a total of 8 Mb showed positions of clones (horizontal bars) used in CIA and S/MAR analyses. Positions and orientations of genes located at 10q25 used in the expression study are shown by arrows or arrowheads. The location ofthe CENP-A-associated domain is indicated by purple shading (Lo et al, 2001A supra). A total of 51 genes within an 8-Mb region were examined, including a single putative gene (Celera gene ID: hCG39837) that spans the CENP-A- associated domain.
In order to differentiate between gene expression from the 10q25 region of the mardel(lθ) chromosome and the corresponding region from a normal human chromosome 10, it was necessary to isolate the chromosomes into separate somatic cell hybrid backgrounds. To achieve this, three pairs of somatic cell hybrids containing either mardel(lθ) or a normal chromosome 10, in either CHO or mouse F9 genetic backgrounds, were produced. RNA derived from each of these somatic cell hybrid lines was used in quantitative RT-PCR with SYBR green to determine gene expression levels both before and after centromere formation. In addition, a mouse ES somatic cell hybrid line containing mardel(lθ) was produced. Of 51 genes examined, 15 showed expression in one or more somatic cell hybrid lines tested (Figure 2; Table 2; arrows in Figure IA). Of these, 9 were examined further using TAQman quantitative RT-PCR, with essentially similar results. No significant difference in expression level was detected between corresponding hybrids containing chromosome 10 or mardel(lθ), indicating that the process of neocentromere formation that resulted in the major remodelling of underlying chromatin had no measurable effect on the expression of these genes. Genes as close as 200 kb (hCG40949) to the CENP-A domain were expressed at apparently unaltered levels. Low levels of hCG39837 expression from mardel(lθ), the only gene spanning the CENP-A domain, were detected in the CHO-based somatic cell hybrid lines using an optimised TAQman assay only, and in a mouse ES background, by both the SYBR green-based RT-PCR and an optimised TAQman assay with a primer and probe set that maps to a part of the hCG39837 gene located centrally within the CENP-A domain. This demonstrates for the first time that the formation of centromere-specific nucleosomes containing the modified histone H3, CENP-A, is not inhibitory to the cell transcriptional machinery. Chromosome 10 genes used in this expression analysis are summarized in Table 4.
TABLE 2 10q25 gene expression analysis
Gene no. Celera Gene ID (Figure (Gene Name) Domain Relative expression levels 2' CT IA) lf (N10) v CHON10 v F9N10 v Pooled 5f (M10) CHOM10 F9M10 N10 v M10
1 hCG41809 q arm 1.02+0.09 1.1410.42 1.2410.38 1.12+0.32 (p=0.98)
2 hCG40976 q arm 1.3310.36 1.0110.22 NE 1.1610.33 (hypothetical protein (p=0.95) FLJ21952)
3 hCG1811152 q arm 1.09+0.22 0.88+0.27 0.9610.09 0.9910.24 (p=0.94)
4 hCG1781464 CENP-H 1.03+0.45 1.410.33 1.02+0.58 1.1510.54 (caspase 7 - CASP7) (p=0.87)
5 hCG40995 CENP-H 1.26±0.62 1.39+1.09 1.62+1.53 1.1810.75 (p=0.84)
6. hCG39839 CENP-H 1.61+0.93 0.910.61 NE 1.19+0.1 (adrenergic β-1 (p=0.95) receptor - ADRB1)
7 hCG1781461 S/MAR 0.68+0.24 1.3910.89 NE 1.0510.48 (hypothetical protein CENP-H (p=0.65) FLJ10188)
8 hCG40945 S/MAR NE NE 0.8310.77 0.83+0.77 (tudor domain protein CENP-H (p=0.19) - TRD1)
9 hCG1818126 S/MAR 0.70±0.31 1.710.88 0.8710.19 1.04+0.67 CENP-H (P=0.91)
10 hCG1811159 S/MAR 1.16+0.84 1.0410.54 1.6411.31 1.25+0.92 (actin binding LIM (p=0.86) protein - ABLIM)
11 hCG40944 S MAR 0.71±0.34 1.2310.74 1.2310.82 1.0110.65 (p=0.75)
12 hCG40949 S/MAR 1.16+0.65 1.1310.97 1.911.3 1.5110.98 (tRNA pseudouridine (p=0.68) synthase - TRUB1)
13 hCG39837 CENP-A (See results in Figure 14) (KIAA0534)
14 hCG40963 S/MAR 1.2+0.61 0.9410.4 1.2410.84 1.1710.89 (GDNF family (P=0.97) receptor - GFRA1)
15 hCG40964 S/MAR 1.03+0.89 1.2310.83 2.6612.38 1.4511.42 (p=0.99) TABLE 4 Chromosome 10 genes used in expression analysis
Figure imgf000054_0001
Figure imgf000055_0001
Figure imgf000056_0001
Figure imgf000057_0001
TABLE 5 Stability of ESGFPMar(10)#l and ESGFPNC-MiCl#2
Cell line Passage Division Drug No. of cells Percentage Loss per no. no. selection scored of retention division
ESGFPMar(10)#l 5 15 Zeocin 20 20/20 (100%) 0.0% 10 30 Zeocin 20 19/20 (95%) 0.17% 15 45 Zeocin 20 18/20 (90%) 0.22% 20 60 Zeocin 20 18/20 (90%) 0.17%
ESGFPMar(10)#l 5 15 - 20 20/20 (100%) 0.0% 10 30 - 20 18/20 (90%) 0.33% 15 45 - 20 17/20 (85%) 0.33% 20 60 - 20 16/20 (80%) 0.33%
ESGFPNC-MiCl#2 5 15 Zeocin 20 20/20 (100%) 0.0% 10 30 Zeocin 20 17/20 (85%) 0.5% 15 45 Zeocin 20 15/20 (75%) 0.56% 20 60 Zeocin 20 14/20 (70%) 0.5%
ESGFPNC-MiCl#2 5 15 - 20 20/20 (100%) 0.0% 10 30 - 20 15/20 (75%) 0.83% 15 45 - 20 13/20 (65%) 0.78% 20 60 " 20 11/20 (55%) 0.78%
ESGFPmar(10)#l and ESGFPN C-MiCl#2 were cultur ed for 60 divisions in the ores ence (100 μg/ml) or absence of zeocin before the cells were harvested at various intervals for determination of mardel(lθ) or NC-MiCl stability. Retention rates of 80%-90% and 55%-70% were observed for the respective marker chromosomes after 60 cell divisions with and without selection, implying a small loss rate over time in the mouse ES cell background. EXAMPLE 3 Detection of scaffold-attached chromatin domain at 10q25 neocentromere
Although previous studies have identified expressed genes and other transcripts in the flanking regions of some centromeres (Schulze et al, Mol. Gen. Genet. 264(6): 728-789, 2001), no detailed correlation of the sites of transcriptional activity with the locations of specific chromatin domains has yet been described. The available sequence of the 10q25 neocentromere provides a unique opportunity to define the relative positions of centromeric chromatin domains and directly assay the effects these domains have on underlying gene expression.
The first chromatin modification to be investigated by the inventors was the pattern of chromosomal scaffold/matrix attachment at 10q25 both pre- and post-NC formation. The chromosomal scaffold/matrix is the insoluble chromatin that remains following removal of core histones (Paulson and Laemmli, Cell 12: 8178-828, 1977). It contains a proteinaceous core that interacts directly with DNA through specific S/MAR (scaffold/matrix attachment region) sequences and contains centromere-essential proteins such as Topo Ilα, CENP-C, and cohesin subunits (Kalitsis et al, Proc. Natl Acad. Sci, USA 95: 1136-1141, 1998; Pinsky et al, Dev. Cell 3(1): 4-6, 2002; Saitoh et al., Bioassays 17(9): 2919-2926, 1995). DNA from differentially isolated scaffold/matrix-attached and non-attached 'loop' fractions was used as a hybridization probe on the 10q25 BAC-array. The extent of S/MARs for cell lines containing the mardel(lθ) or normal chromosome 10 was then calculated and directly compared.
Using this approach resulted in the identification of a domain on mardel(lθ) showing an increased level of S/MARs compared to the corresponding region of the normal chromosome 10 (Figure IB). Data-points, represented on the x-axis by the midpoints ofthe positions ofthe BACs relative to the start of the contig map, were expressed as the means and standard deviation ofthe means from 10 independent experiments and were calculated and are shown on the y-axis as the percentage difference between the scaffold attached/unattached signal ratio of 5f and If Significance of the data-points was determined using a student's t-test and is indicated by an asterisk (pθ.01). The S/MAR- enriched domain is indicated by blue shading.
For independent verification, direct visualisation of scaffold/matrix attachment was performed by FISH analysis of histone-depleted metaphase chromosomes (Bickmore and Oghene, 1996 supra) using BACs from the 10q25 array as probes. In this technique, nucleosomal histones on metaphase chromosomes were removed through salt extraction, resulting in the looping out of non-S/MAR chromatin to form chromosome 'halos', while regions containing a high density of S/MARs remain closely associated with the chromosomal axis and produce tight FISH signals. The results for several BAC clones are shown in Figure 3B-I, and those for all the BACs analysed are summarised in Figure IB. Control centromeric α-satellite probes for chromosomes 10 (Figure 3 A) and Y showed tight scaffold/matrix attachment as previously described (Bickmore and Oghene, 1996 supra), thereby validating the technique.
The combined S/MAR-array and FISH analyses define a 3.5-Mb region at the 10q25 NC showing a significantly increased level of chromosomal scaffold/matrix attachment that includes the CENP-A-associated domain. Although FISH analysis of metaphase chromosomes indicates that BAC probes from the entire 3.5 -Mb region appear to be localised to the primary constriction of mardel(lθ), the exact relationship between increased centromeric S/MARs and chromatin compaction remains to be determined. Of note, the region of S/MAR-modified chromatin contains 30 putative genes, 9 of which (genes #7-15; Figure IA) are expressed in one or more of our somatic cell hybrid lines. Thus, the formation of this chromatin domain has no measurable effect on underlying gene expression.
For independent verification of the SIA results, direct visualization of scaffold attachment across the region of interest was performed by FISH analysis of metaphase chromosomes (Bickmore and Oghene, 1996 supra) using as probes BAC clones from the 10q25 array. The results, shown in Figure 3 for several BAC clones and summarized in Figure IB (+/- symbols), were in tight concordance with those obtained using S/MAR array analysis. FISH on salt-extracted, histone-depleted chromosomes was carried out essentially as previously described (Bickmore and Oghene, 1996 supra). In Figure 3, panels A and D show FISH using BAC clones BA313D6 and BA427L15, which mapped outside the S/MAR-enriched domain identified by S/MAR array analysis which produced dispersed signals (open arrows) on both the normal chromosome 10 (top panel) and mardel(lθ) chromosomes (bottom panel), indicating predominantly non-scaffold attachment of the probed regions. Panels B and C show FISH using BAC clones E8 and BA153G5 mapping within the S/MAR domain which produced dispersed signals (open arrow) on chromosome 10 (top panel) but tightly packed signal on the mardel(lθ) chromosome (closed arrow; bottom panel), indicating predominantly scaffold attachment of the probed regions on mardel(lθ). This increase in S/MAR over a substantial region may explain the tighter compaction of chromatin that gives rise to the mardel(lθ) primary constriction. As shown in Figure lb, the previously identified CENP-A domain is located centrally within the 3.5 Mb domain of enhanced chromosomal S/MAR-modified chromatin. These results clearly demonstrate the existence of a substantive scaffold-attached chromatin domain at the 10q25 neocentromere, and demonstrate that such a domain and its constituent proteins have no measurable effect on underlying gene expression. The Accession number of BACs used in this study are shown in Table 6.
TABLE 6 Accession number of BACs
Figure imgf000062_0001
EXAMPLE 4 Detection of gene expression in CENP-H domain
To extend the above observations, mapping of another constitutively modified centromeric chromatin associated with CENP-H-binding was performed, and assayed for any gene expression changes. A polyclonal rat anti-human CENP-H antibody (Sugata et al, 1999 supra) was used in chromatin immunoprecipitation (ChIP) and genomic BAC array mapping, as previously used to define the CENP-A-binding domain (Lo et al, 2001A supra). Figure lc shows the distribution of CENP-H antigen along the 10q25 BAC contig (x-axis) as determined by CIA analysis. A 900-kb domain of CENP-H association was identified that overlapped with the distal q-arm edge of the S/MAR-enriched region. The y-axis shows the fold difference between the normalised bound/input ratio of mardel(lθ)- and normal chromosome 10-containing cell lines. Each data-point is the mean of four independent CIA experiments. Significance of the data-points was determined using a student's t-test and is indicated by an asterisk (p<0.01). The position of the CENP-H- associated region is indicated by green shading. This CENP-H-associated domain is 1 Mb away from, and shows no overlap with, the CENP-A-associated domain. The non-overlap of CENP-H and CENP-A domains is of note in light of evidence showing that CENP-A (and hMisδ and hMisl2) is required for the localization of CENP-H to centromeres and that CENP-C is known to be targeted to CENP-A-containing chromatin, while both CENP- A and CENP-H are required for CENP-C localisation (Fukagawa et al, EMBO J. 20(16): 144-153, 2001; Howman et al, Proc. Natl. Acad. Sci. USA 97(3): 1148-1153, 2000; Van Hooser et al, J. Cell. Sci. 114(19): 3529-3542, 2001). Together with the mapping data described herein, these findings suggest the adoption of complex higher-order interactions between these protein domains. (Figure IE). Importantly, 6 genes were identified within this region that were expressed at comparable levels both pre- and post-neocentromere formation, suggesting that the constitutive, cell cycle independent association of an essential centromere protein such as CENP-H is not inhibitory to underlying gene expression. EXAMPLE 5 Relationship between heterochromatin protein and centromere function
The specific role of heterochromatin and its associated proteins at the centromeric/pericentromeric regions remains unclear. Numerous studies have indicated a role in gene silencing although several genes have been described that escape this repression presumably through some insulating activities protecting the genes from heterochromatin protein encroachment (Schulze et al, 2001 supra). Other studies have also suggested that heterochromatin may play a role in sister-chromatid cohesion (Vagnarelli et al, Chromsoma 110(6): 393-401, 2001; Bernard et al, Science 294(5551): 2539-2542, 2001; Bernard and Allshire, Trends Cell Biol. 12(9): 419, 2002). However, the existence of an abundance of repetitive DNA at and around the centromeres used in these studies has hindered the functional dissection of any direct role heterochromatin may have in kinetochore activity. The binding of heterochromatin protein HPl at neocentromeres in the absence of centromeric/pericentromeric repetitive DNA (Saffery et al, Hum. Mol. Genet. 9(2): 175-185, 2000) strongly suggests a direct role of heterochromatin in mammalian centromere function.
In order to investigate the relationship between heterochromatinization and transcriptional activity, a polyclonal anti-HP 1 antibody was used (Le Douarin et al, 1996 supra) in ChlP- array assay to determine the profile of HPl binding at the NC. The results identified a domain of approximately 100 kb that was enriched for HPl (Figure ID). The HP1- enriched domain maps approximately 800 kb from the CENP-A-binding region on the p- arm side of mardel(lθ). Between the HPl and CENP-A domains is a single expressed gene (GFRAl; Table 2) that is not affected by neocentromere formation. The 100-kb HP1- enriched domain itself encompasses a pancreatic lipase gene (PNLIP - hCG 1640542) that was not expressed in any ofthe cell lines tested, presumably due to tissue specificity (Su et al, Proc. Natl. Acad. Sci. USA 99: 4465-4470, 2002). Therefore, any direct effect on gene expression following HPl association could not be determined. EXAMPLE 6 Human cell models for NC-MiC analysis and gene expression
Truncation of mardel(lθ) in human fibrosarcoma HT1080 cell line was performed via transfection of constructs containing a targeting DNA, human telomere sequence, and a hygromycin-resistance selection marker (Saffery et al, 2001 supra). Recent approaches have involved the use of a similar construct with a neomycin resistance gene (neoR) with flanking loxP sites, located between the p-arm-targeting DNA and human telomere sequence. This construct was transfected into a HT1080 cell line carrying a 16 Mb NC- MiC2 (Saffery et al, 2001 supra). Screening of 15,000 colonies had produced several second-generation NC-MiCs containing further truncation of the arm of NC-MiC2, and incorporating the loxP sequence (Wong et al, Gene Ther 9: 724-726, 2002). One of these, a linear 1.2 Mb NC-M1C6, resulted from a targeted truncation event as evidenced by pulsed field gel electrophoresis, PCR, and FISH analysis (Figure 4b). NC-MiC6 shows full mitotic stability and centromere protein-binding properties, thereby demonstrating normal neocentromere function. Importantly, it contains loxP sites that can be used for later insertion of genes via CRE-mediated recombination.
NC-MiC6 was successfully transferred into two other human cell lines: human colorectal HCTl lόpgrxr and human embryonic kidney 293trex cell lines (Figures 5-7). NC-MiC transfer was achieved using MMCT with hygromycin and neomycin selection for clones in the two cell lines respectively. The successful transfer of NC-MiC6 into these cell lines indicated that both the hygromycin and neomycin genes were expressed on NC-MiC6.
The HCTl 16 cell line used for fusion transfer of NC-MiC6 expresses the insect ecdysone receptor (pgRXR) and carries a zeocin resistant gene. This cell line can be used to express inducible levels of any desired protein. The ecdysone inducible system utilises a dimer of the ecdysone receptor (VgEcR) and the retinoid X receptor (RXR) that binds to a hybrid ecdysone response element (E/GRE) in the presence of ecdysone analog, muristerone. The ecdysone receptor is also modified to contain the VP16 transactivation domain that is derived from Drosophila. The addition of muristerone induces the binding of the dimer of RXR and VgEcR to the hybrid Ecdysone response element (E/GRE) which consists of both the natural ecdysone response element and glucocorticoid response element, hence leading to an induction in the expression ofthe gene of interest.
The 293T cell line expresses Tet repressor (tetR) protein and is resistant to blasdicidin (BsdR). This cell line can also be used to express inducible levels of any protein of interest. In the absence of tetracycline, Tet repressor forms homodimers that bind to Tet operator sequences in the inducible expression vector, repressing transcription of the gene. Upon addition of tetracycline, tet binds to tetR homodimer, causing the release of the tetR from the operator due to a change in its conformation, thus induction of transcription from the desired gene. The PI bacteriohage cre recombinase could be cloned into this tetracyclin-inducible vector for regulated induction of cre recombinase expression in the cell lines. The timely presence of cre recombinase will allow for "flopping in" of genes into NC-MiC6 at the LoxP site, by transfection of a plasmid containing gene of interests and drug resistance genes flanked by two loxP sequences in the same orientation.
These results illustrate, first, the ease with which NC-MiCs containing a selectable marker can be transferred from one cell line to another using antibiotic resistance genes, second, the degree of mitotic stability of NC-MiC6 in various cell lines, and third, the expression ofthe selection markers on the NC-MiC. These results combined point to the feasibility of using human cell lines as a model for gene expression from NC-MiCs and, therefore, the future correction of gene defects in human cell model systems.
EXAMPLE 7 NC-MiC production and gene expression in mouse embryonic stem cells
In addition to studies describe above, a mardel(lθ) chromosome tagged with zeocin- resistance gene was successfully transferred into mouse embryonic stem (ES) cells using MMCT. Truncation constructs as shown in Figure 4A was also used to produce NC-MiCs in these cells. The truncation constructs (Figure 4A) were designed to target specific B43all and B79el6 sites (Figure 4B). Although no targeted events were obtained, four clones of random truncation were generated (Figure 4B), three of which were described further (Figures 8-11). FISH analysis with various probes showed that both truncation and deletion had occurred on the q arms of NC-MiC53g, NC-MiC8a and NC-MiC20f, however, the core CENP-A binding domain (upon which a functional centromere is assembled) remained intact as indicated by the FISH analysis using B153g5 probe. Results of FISH characterization of these minichromosom.es are summarized in Figure 4B.
Neither major nor minor satellite DNA were found to be present on NC-MiC53g, NC- MiC8a and NC-MiC20f (Figures 8 and 9), showing that these NC-MiCs had not acquired these satellite DNAs following the truncations and that the 10q25 neocentromere was mitotically functional. Moreover, mouse DNA, as shown in FISH analysis using mouse cot DNA (Figure 10), was absent on these NC-MiCs, indicating no detectable integration of mouse DNA into the NC-MiCs. The positive signals of zeocin resistance gene, previously shown to be present on distal q region (Saffery et al, 2001 supra), on all three NC-MiCs as shown by FISH (Figure 11) indicated that the zeocin resistance gene has integrated into these NC-MiCs during the truncation process. The presence of this selectable marker will facilitate the future transfer of NC-MiCs into other mammalian cell lines. An analysis of gene expression from NC-MiCs in ES lines revealed a diverse pattern of expression with some NC-MiC cell lines expressing few of the 14 genes tested (e.g. lines 20fC94, 8aC94, 53g43A expressing hCG40964, hCG1818126; Table 6), while other NC- MiC-containing lines expressing many different genes (e.g. 1.931b expressing 5 different genes; Table 7). The diversity in gene expression mirrors the different human chromosome 10 regions contained in the NC-MiCs within ES cells and supports the use of a mouse ES model for analysis of gene expression from NC-MiCs.
TABLE 7 Gene expression in mouse embryonic stem (ES) cell lines containing mardel(lθ) and derivatives.
Figure imgf000069_0001
W9.5 is wild-type ES cell line. ES20A is an ES cell line containing an intact mardel(lθ). Refer to figure 4 for explanation of 20fC94, 8aC94, 53g and 1.931b. CHON10 is a Chinese Hamster Ovary cell line containing a normal human chromosome 10. ES-HAC1 is an ES hybrid line contai NC-HAC1, a truncation derivative of mardel(lθ). Nd refers to no data available.
EXAMPLE 8 Gene expression in NCCS andNC-MiCs
Characterization of NC-MiCl
A somatic hybrid cell line (designated ZB30) containing mardel(lθ) and tagged with a zeocin resistance gene in a Chinese hamster ovary background has been produced (Saffery et al, 2001 supra). Transfer of the mardel(lθ) chromosome via microcell-mediated chromosome transfer (MMCT) into human HT1080 cells followed by telomere-associated chromosome truncation resulted in a number of lines containing truncated minichromosome derivatives of mardel(lθ) (Saffery et al, 2001 supra). A cell line NC- MiC l(zeo) (or NC-MiC 1 in short) was identified by FISH as carrying a small minichromosome containing the 10q25 -derived neocentromere region and the zeocin resistance gene from a separate region of the mardel(lθ) chromosome formed through unknown rearrangements during the MMCT procedure (Figure 12a). Reverse painting demonstrated that this minichromosome was derived solely from DNA of the 10q25 and 10pl5 regions of chromosome 10 (Figure 12c). STS PCR analysis was performed to determine the content of the 10pl5-derived DNA of this minichromosome. A total of 47 primer pairs spanning 15 Mb of the lOp region (Table 8) were used in amplification experiments on ESGFPNC-MiCl genomic DNA that contained NC-MiC 1 alone in a mouse ES background (see below). Among these primer sets, five of them produced positive signals in the PCR amplification. BAC clones in this region were then used in FISH experiments to directly visualise the 10pl5 DNA content of NC-MiC 1 (Figures 12b- c). From these combined analyses, the structure of NC-MiC 1 was determined and the total size calculated as approximately 3.5 Mb. TABLE 8 STS primers
dbSTS Forward primer Reverse primer
73898 TGGGTAACAGAGTGAGACTGTCTC AGTACACTGATGATTTCATTTCCT
98485 ATGAAATTTGACATGTTGCTGC ACAGGGAAGACGCGAATATG
149153 GGTTGCAGTGAGCTGAGCA AAGTCCACCAGGCAAGGCC
7930 ACAGCTGTGACCGCTGAAC GCTGGTTTGGGCTAAAATGA
156339 AGAAGGATCCAGGTCTGCTG TCCTGACAGCATGTGCCTCAG
11343 AGAAGAAAGGAAAGGAAAGGGAA TAGCCAGTGGAGTGTATAGA
13645 AGCTAACTGGTTTTTGTAGT GAATGCAAAAATGGAGGATCAT
140411 ACTATGATGGCAAAGCGGTTTTA TCTGTAAAAGTGTGTGAGCCTCG
85021 AGAGGCTGGGAAGGCAGG TCCTTGGTTCCCACAGGC
2736 AACAGTGCCTAAATCTTTATTTTCA GAGCTGTAGTTGCGGCTTG
84921 AGAAGACTGCTGCTGGCTAGG AAGGTGTGAGCATTGCAGC
92222 TTAGCGTTGTTAACACTGCACC AGCTCCCACAGCTCCTCC
43254 GACATTTGGGCTGGATAAAACC GACAGTGGTCCTCAGTTGGG
77077 TTAGTGTCGTGTGTTTTTTAAGTGA TGAACTTGTGAGATGAACCTGG
139068 CATCTTCCTCACCAATGAGCTG TAATTCCTTGACTCTGAGGCTGG
138863 TACACCCCAACCAGAGGAACTTA GGAATCGTCATGACCAAAGGTAG
176788 GCAATTCCAGGACAGTGAGGATA AAAAGTTTTGCGATACCCAGTGAA
57982 GTGCACTAGCCAGGGTTC TGAACATCACAGGTAAGGGA
171566 GTAAAGTTGTCAGCAGCCCAAAC AGGATGCACTCAGTAAACCTTGC
154746 GTTCTAGAGTGGAGTGCTAGC CTACTTGGGATGCTAAGGTG
182241 AAGCATTTAAACCTCGATGCCTT TCAAGGAGTGTGAGAGATGATGAA
34400 CGAGATTGTGCCACTGCAGT AGCCCTTTTTCACGTGTCG
72976 TGGAGAATCACTTGAACCC GAAATTGGCTCAGATGTCAC
58584 GTGTAGTGGTGCCATCATAGC GCAGGAGGATCACTACAGGA
176052 AGGGCTTCCATTAAAGTCTACGC TCTGTGTATGAATTTTGGGGGAC
168078 CTTACAAGGTTGAATGGAGGGC CCTAGAAACAGGCAGAACCAGAA
44783 GAGGGAGCCCGATAAGAATC ACTGAAGACTCGGAGGGGTT
29164 CCAAACTGTATCAAGTCCCCA TGACACTCCAGGGCTTCAG
137909 TGTCACCTCTTCCTTCTTTTTGC ATGGCACAGGTGACGTCTTACTT
14797 AGGATGTGCCTTGGGTCAG GACATGTTTGTTTTCTGCTTGG
136172 TTTCATGTCAGCAGTAGGCACAT GCCAATAAAAATGTCCCAACAAA
96179 CAACACTGATGTTTTCCTCCTCC TGAACGATCACTGTGGGATAATG
73049 TGGAGGGCATTGCATGAG TAGGTGAAGAATCTTTAGGAGA
13065 AGCATAGAGGGTGTTGCACG GCTAGCTGAAGTTGCCAAGC
182302 TGAGCAGGAATTTGAGGACTTTC GCCTGCAGAACGTTTTTCAATAG
185213 TGGCATGCTAGTGTCTGATTGTT CATATGGCA I I I I GCAACACACT
140062 TTACTAAGGAGGCTGAAATGGCA CTAAGGCCTGGGAAGAGTTTTTA
176265 TCTTGTCCAAGGACCACTCTTGT GGAAAATGAAGCCACAGAGAGAA
22980 GAAGACCGTGTCACTGCATT AGCCAGGCATTTGTGAACTT
31654 CCCCATGTGACTTTTATCTGTAGC AGTCTTGAGACGTCTGTACTCCG
135649 ACATGGCAAAAATTCTTCCTTCA CTGACTTTATAAAGACCTAGGCTT
135093 ATGAAACAAAGGCGTGGAGATAA TCTAAAGGCTAGAAACCCCCATC
173693 CAGGAAGAGACTGTTGAGCCATT AGTTGTGCAAATTGTTCAGGCTT
173578 GAGACACTCTTCAACCCAATCTGA AAGTCTGCCTGCTGAGAAACAGT
41243 GAAAACCACTTCACCCCTCT GGAAGGAAAGAAAGGAAGGA
6308 AATGTCCATTCAAAGTCCTTGC CACTCTGGACAAATGTCCC
9781 ACGTACAACCTCATCAATGG CCTAAGAGAATTTCAGGCCC
175002 TCTGTTGAGTTTGCTGCATTGAT AAGCCTGTGGGTGTAAGGAAATC
79957 TTGCTAATTTTGTAACCCAAATTG AGAAAAATGATAGAACATTGTTCCC
72229 TGCTACTCCCCCTTGAACAC TTCCAACCTAGGAGGTAATGC 75042 TGTCTCAGTCCAGCAAACAC CATGACCTTCGTGGCATTA
7875 ACAGCATGAGGGACTACAG TTTGCATGTGTGAAATTATTATAC
97152 GGGAATGGCTAGCGCATGT TTGGACTCGCCTAGGCAAC
175897 AGGGGCATGGACAGTAGATGATA TAGCATGAATGGGGAGTCATTTT
182159 GTGGGTTTCCTATTACCCTTTGC AGTATGTATGTGTTGGGGGATGG
182187 GGGAATCCAGAAGACAGTGGATA TTCCAGTTTCTTGCGTTGTTCTT
40290 CTTGAAAGGCGGAGGC CCCAATAGTCCACAGGGAG
171485 ATTGGCAACGTTTTTCTTGCTTA GGTAAAATGGCATCTATGGCTGA
172427 AATAAAAGTCTCCGTTCCCCAAA TGCCTATCTTCCAGACATTGACA
2162 AAATGTACCTCTGTTTCTAT CCTATCCAGAAACTCAACCTG
137561 AGAGTTCCCTCAGGTATTTTGCC CTGTGGTTTGAAAAGGTTTGTGA
80772 TTGTGTTCCTGATAGCAAGTGC TGACCAAACAATCAGCTTATTCA
135184 AGCAAGGGAAGAACCTGAGAAAA TAGGTGTTCCACCAGCTTCATCT
73896 TGGGTAACACAGTAAGATCCC GACTACTCCTGACACGAGAGG
57346 GTCTAGAACATATGTGATTGATTGC AGTCCCGCTTTATTCCCG
12762 AGCAAGGTAGATACACTGGTTTC CTGACTGACCCGTTTCTGA
148031 AGAAGAAAAGTCTGACCCATGC TCTACGGCCAGCCCCATTCTACT
177687 ATGCGAGTTATTGGCTGTAGGAA AAACGAATACGGTCAACCTTT
82197 TTTGAGGAACAGCAAATTGC GACTTGTCCAAGATCCCAGG
40771 CTTTCAGTTCCGTAGCAGGC TCGTGAGAGAAAAAGCAGCA
10397 ACTGATGTAGAGATTCAAAAGCCC ATTTCTTTACTTTGTGAGCAAATGG
14404 AGGAAAGCAGCTTTGAGTCT TGTCCTCTCTCTAGCCCTCT
172852 CAGCGGCAAAATGAGAAAAATAG ATTTACAGATGAAAGGCAGGTGG
152154 TTTCCTTGTTTTTCACAAGAC TTCTCAGTTGATTTCTGACC
3041 AAACGTAATAACTTAGGTGCTC TGCTGAAGACAGGTAAAGAG
67593 TCTAAGGCCCGGAGGAAGC GGATTAAGTCCCGAGTTGCC
103795 GTATTTTGTTGCTTGCTGGGTTC ATGGACTCACCACAGAACCTTGT
9942 ACTAGACTTCTACCAGTTTAGGA GAGGAAGAAAAACTGGAC
62076 TAGGGAGATATTGCTCCTGACAGCA GAATAATATCACAGGGTGTACACCCA
172855 CAAAACTTTTATTGGCCAAGTGC CCAAGTAATATCAAGCCCCAATAAA
102584 AAGGCAAGTGCTCACAAGGATAG AATGCCTGATTTTCCCATTCTTT
102365 TGAAATCCCACTACTCTGGCAAT GTCATTTATCCTGCCCCCTAAAC
76950 TTAGCCAGGCATAGTAGCCC AGTTTTTGGTGTCACAGTGTAGC
Mardel(lO) and NC-MiCl remain structurally intact and stable following transfer into mouse ES cells Both ZB30 and HT1080-NC-MiCl lines were used as donors for MMCT transfer into mouse embryonic stem cell line ES 129.1 expressing GFP (ESGFP cells) generated in this study (see Example 1). Thirteen positive fusion cell lines containing mardel(lθ) and five containing NC-MiC 1 were isolated. One cell line containing mardel(lθ) [ESGFPmar(10)#l] and another containing NC-MiCl (ESGFPNC-MiCl#2) were analysed further. Mitotic stability of ESGFPmar(10)#l was greater than 90-95% over 20-30 cell divisions, and 80-85% over 60 cell divisions with or without selection, suggesting that mardel(lθ) was largely stable though carried a very low loss rate (Table 5). NC-MiC 1 was found to be slightly less stable in mouse ES 129.1 cells, with a retention rate of 65-75% and 55-70%) with and without selection after 45 and 60 cell divisions, respectively. Immunofluorescence using CREST6 autoimmune anti-centromere serum (du Sart et al, 1997 supra) and specific antiserum to centromere protein CENP-A were positive on both mardel(lθ) and NC-MIC 1. Detailed FISH analysis using human COT1, total genomic mouse DNA, mouse centromeric major and minor satellite DNAs, and various BAC probes at and surrounding the 10q25 neocentromere, demonstrated that both the mardel(lθ) and NC-MiC 1 remained structurally intact following MMCT transfer and had not acquired any mouse genomic sequences including centromeric elements (Figures 13 and 14). Thus, not withstanding the low measurable loss rate that appears to slow down after 30-45 divisions, this demonstrates the overall functioning of human neocentromeres to support mitotic stability of intact mardel(lθ) and NC-MiC 1 minichromosome in the mouse ES cell background.
Chimeric mice retained mardel(lθ) and NC-MiCl episomally and relatively stably in many tissue types
Microinjection of ESGFP cells containing mardel(lθ) [ESGFPmar(10)# 1] or NC-MiCl (ESGFPNC-MIC1#2) into mouse blastocysts followed by reimplantation into foster female mice resulted in 19 and 65 high-grade chimeric mice, respectively. None of the mice generated showed any abnormal phenotype. Analysis of tissue samples from adult animals by PCR using human chromosome 10q25-specific primers demonstrated the presence of both mardel(lθ) and NC-MiC 1 in a variety of mouse tissues, with results from two exemplifying animals for each of mardel(lθ) and NC-MiC 1 shown in Tables 9 and 10. In total, tissues from 85.7% and 84.6% of chimeric mice were found to be positive for mardel(lθ) and NC-MiC 1, respectively. Of the positive chimeric mice, the percentage of ESI 29.1 -derived tissues had retained the transchromosomes. The presence of ES129.1 cells was identified by PCR using primers corresponding to a part of the neomycin resistance gene that was present in these cells. The results (some examples shown in Tables 5 and 6) indicated that 69.5% and 74.6% of ES 129.1 -containing tissues were positive for mardel(lθ) and NC-MiC 1, respectively. Together, the above analyses indicated approximately 15% loss rate for the transchromosomes during chimeric mouse production, and 25-30% loss rate within the ES cell-positive tissues of the transchromosomal mice.
Different tissues were collected from the transchromosomal chimeras (up to 22 tissues) for FISH analysis in order to determine the structural status ofthe introduced chromosomes. A combination of human and mouse cotl DNA, whole human chromosome-10 paint, and neocentromere-specific BACs were used as FISH probes. In all the tissues that were positive for the transchromosomes, the transchromosomes were shown to be episomal, structurally intact, and contained no detectable mouse sequences (some examples shown in Figures 15 and 16). In a small proportion (8.9%) of cells derived from NC-MiC 1 chimeric tissues, two transchromosomes were observed, suggesting a certain level of missegregation.
Specific experiments were performed to isolate haemopoietic stem cells from two chimeric mice, one carrying mardel(lθ) and the other NC-MiC 1. ES129.1-GFP-derived cells were isolated by FACS sorting of bone marrow cells for haemopoietic stem cells stained positive for Sca-1 marker and expressing GFP. When subjected to PCR analysis using human 10q25-neocentromere-specific primers, the FACS-purified cells from both animals were found to be positive suggesting the presence of mardel(lθ) or NC-MiC 1 chromosome within these stem cells. FISH study on metaphases of cells cultured from other tissues (such as kidney, lung and spleen) from both animals have demonstrated that the transchromosomes in these animals were episomal and structurally intact.
TABLE 9 Results of screening mouse tissue for mardel(lθ)
Screening of various tissues for the presence of mardel(lθ) in chimeric mouse PL (A) and CH (B) by PCR using specific primers to mardel(lθ). "ESI 29.1" denotes PCR detection of neomycin- resistance gene that was present in ESI 29.1 -derived tissues. "+ve" and "-ve" denote the presence and absence of mardel(lθ) or the neomycin-resistance gene in a particular tissue, respectively.
(A) Chimeric mouse PL.
Tissues Mardel(lO) ES129.1 Tissues Mardel(lO) ES129.1 left lung +ve +ve adrenal -ve -ve right lung -ve +ve uterus -ve -ve left kidney +ve +ve ovary -ve -ve right kidney -ve -ve tongue -ve -ve thymus -ve +ve oesophagus -ve -ve caecum +ve +ve salivary gland -ve -ve small intestine -ve -ve liver +ve +ve large intestine -ve +ve bone marrow +ve +ve heart +ve +ve spleen +ve +ve brain +ve +ve pancreas -ve +ve stomach -ve -ve tail -ve -ve pale back skin +ve +ve left leg -ve -ve sternum +ve +ve right leg -ve +ve
(B) Chimeric mouse CH.
Tissues Mardel(lO) ES129.1 Tissues Mardel(lO) ES129.1 left lung +ve +ve adrenal +ve +ve right lung -ve +ve uterus +ve +ve left kidney +ve +ve ovary -ve +ve right kidney +ve +ve tongue -ve +ve thymus -ve -ve oesophagus -ve -ve caecum +ve +ve salivary gland -ve +ve small intestine -ve +ve liver +ve +ve large intestine -ve -ve bone marrow +ve +ve heart +ve +ve spleen +ve +ve brain -ve -ve pancreas +ve +ve stomach -ve -ve tail +ve +ve pale back skin +ve +ve left leg -ve -ve sternum -ve -ve right leg -ve -ve
TABLE 10 Results of screening mouse tissue for NC-MiCl
Screening of various tissues for presence of NC-MiC 1 in chimeric mouse THO and JN by PCR using specific primers to NC-MiC 1. "ES 129.1" denotes PCR detection of neomycin- resistance gene that was present in ESI 29.1 -derived tissues. "+ve" and "-ve" denote the presence and absence of NC-MiC 1 or the neomycin-resistance gene in a particular tissue, respectively.
(A) Chimeric mouse THO.
Tissues NC-MiCl ES129.1 Tissues NC-MiCl ES129.1 left lung +ve +ve testis 4-ve +ve right lung +ve +ve oesophagus -ve -ve left kidney -ve -ve liver +ve +ve right kidney +ve +ve bone marrow +ve +ve small intestine -ve -ve spleen +ve +ve large intestine -ve -ve tail +ve +ve heart +ve +ve eye -ve +ve brain +ve +ve skeletal muscle +ve +ve stomach +ve +ve skin +ve +ve thymus +ve +ve left eye +ve +ve adrenal -ve +ve right eye -ve -ve
(B) Chimeric mouse JN.
Tissues NC-MiCl ES129.1 Tissues NC-MiCl ES129.1 left lung +ve +ve uterus -ve -ve right lung +ve +ve ovary -ve +ve left kidney -ve +ve oesophagus -ve +ve right kidney +ve +ve liver +ve +ve small intestine -ve +ve bone marrow +ve +ve large intestine +ve +ve spleen -ve +ve heart -ve -ve pancreas +ve +ve brain -ve +ve tail -ve -ve stomach +ve +ve eye +ve +ve thymus -ve +ve skeletal muscle +ve +ve adrenal +ve +ve
Expression of genes on mardel(lθ) and NC-MiCl in chimeric mouse tissues In addition to assaying for transchromosome retention in animal tissues, RT-PCR analysis was performed on RNA samples collected from the chimeric mice to determine the expression status of a number of genes present in the 10q25 DNA contained within mardel(lθ) and NC-MiCl. A wide variety of tissues from ESGFPmar(lO) (eg. animal KYM) and 4 ESGFPNC-MiCl (eg. animal AIR) mice were obtained and subjected to analysis using previously optimised RT-PCR assays (Saffery et al, 2001 supra; primer pairs listed in Table 11). From this analysis, it was clear that many ofthe genes present on mardel(lθ) and NC-MiC 1 are expressed within the chimeric animal tissues (Table 12). TABLE 11 Chromosome 10 genes used in expression analysis
hCG40995 FI 5' - AAATACCTGGAACCGGCTTTAC Rl 5' - ATTCAGTGTCCAGTGGCAATG hCG40945 tudor domain containing 1 FI 5' - GCAGCTTCAAAGAGGTAAGCA TDRD1 Rl 5' - GCACGGTACCACTGATCATCC hCG1781461 hypothetical protein FLJl 0188 FI 5' - GCAGCTTCAAAGAGGTAAGCA Rl 5' - GGATTCAGACTGAAGCTGTGCA hCG1811159 FI 5' - AAGGATTTAGCAGCCATTCCG Rl 5' - TGGTACCCTTCTGCTGATGGA hCG40950 FI 5' - GGATGGAACAGGCCAACAAGA Rl 5' - TTCATACAGCTGGTGCAACC hCG40944 FI 5' - GGCTGCAAAGTGCCTTACACA Rl 5' - CCAAGCCCCAGTTAATTGCTT hCG40949 tRNA Pseudouridine sythetase F3 5' - AGCCCG AGG AGTTCTGGTTGTT TRUB1 R3 5' - TTTCCCCAGTTCTCCAATGGC hCG39837 Attractin-like gene F2 5'-ACACAACACTACTACAGTGGCTTC R2 5' -CATACACTCCATGCCATTGC hCG40963 GDNF family receptor alpha 1, F3 5' - AGATCTCGCCTTGCGGATTT GFRAl R3 5' - ATGACTGTGCCAATAAGCCCC hCG40964 FI 5' - TATTGCTTGCTCCTTCAGACTG Rl 5' - CTCCCTCTTTCCCTTTTATTCC
TABLE 12 Results of screening mouse tissue for mardel(lθ) and NC-MiCl
A) Chimeric Mouse KYM carrying mardel(lθ)
Tissues Expressed genes Genes not expressed
Brain hCG40949, hCG40963, hCG40944, hCG39837, hCG40950 hCG40964
Oesophagus hCG40949, hCG40963, hCG40944 hCG40964
Tongue hCG40949, hCG40963, hCG40944 hCG40964
Stomach hCG40949, hCG40963, hCG40944, hCG40950 hCG40964
Duodenum hCG40949, hCG40963, hCG40944 hCG40964
Large Intestine hCG40949, hCG40963, hCG40944, hCG1811159, hCG40964 hCG39837, hCG40950
Caecum hCG40949, hCG40963, hCG40944, hCG1811159, hCG40995 hCG40964
Salivary Gland hCG40949, hCG40963, hCG40944, hCG1811159 hCG40964
Liver hCG40949, hCG40963, hCG40944, hCG1811159 hCG40964
Spleen hCG40949, hCG40963, hCG40944, hCG1811159, hCG40964 hCG40950, hCG40995
Lung hCG40949, hCG40963, hCG40944, hCG1811159 hCG40964
Heart hCG40949, hCG40963, hCG40944, hCG1811159, hCG40964 hCG40950, hCG40995
Kidney hCG40949, hCG40963, hCG40944, hCG1811159, hCG40964 hCG39837, hCG40950, hCG40995, hCG40995
Thymus hCG40949, hCG40963, hCG40944, hCG1811159 hCG40964
Adrenal hCG40949, hCG40963, hCG40944, hCG1811159, hCG40964 hCG39837, hCG40950, hCG40995
Right Skeletal Muscle hCG40949, hCG40963, hCG40944, hCG1811159, hCG40964 hCG40950, hCG40995
Left Skeletal Muscle hCG40949, hCG40963, hCG40944, hCG1811159, hCG40950 hCG40964
Testis hCG40949, hCG40963, hCG40944, hCG1811159, hCG40964 hCG39837, hCG40950
Seminal Vesicle hCG40949, hCG40963, hCG40944, hCG1811159, hCG40964 hCG40950, hCG40995
Bulbo Urethral Gland hCG40949, hCG40963, hCG40944, hCG1811159 hCG40964
Epididymus hCG40949, hCG40963, hCG40944, hCG1811159, hCG40950 hCG40964 B) Chimeric Mouse AIR carrying NC-MiC 1
Tissues Expressed genes tongue hcg40944, hcg40949 eye hcg40944, hcg40949 adrenal hcg40944, hcg40950 tail hcg40944, hcg40949, hcg40950 lung. hcg40944, hcg40949, hcg40950 skin hcg40944, hcg40949, hcg40950 small intestine hcg40944, hcg40949, pancreas hcg40944, hcg40949, hcg40950 stomach hcg40944, hcg40949, hcg40950 brain hcg40944, hcg40949, kidney hcg40944, hcg40949, hcg40950 heart hcg40944, hcg40949, hcg40950 liver hcg40944, hcg40949
Germline transmission and mitotic instability of NC-MiCl in FI mouse embryos Although several studies have now demonstrated germline transmission of human chromosomal fragments containing α-satellite-based centromeres, to date no such analysis has been performed on neocentromere-based marker chromosomes or minichromosomes. To test for the germline transmissibility of such chromosomes, PCR analysis was carried out to test chimeric mice for the presence of the transchromosomes in sperm samples. A total of 14%) was first carried out and 67%> of the chimeric mice were found to be positive for mardel(lθ) and NC-MiC 1, respectively, indicating the successful transmission of neocentromere-based markers through mouse meiosis to the male gametes. These positive mice were crossed with C57BL mice to generate FI mouse progeny in order to determine the germline transmissibility ofthe transchromosomes. The mice were mated continuously over a period of 12 months to optimise the number of progeny from each animal. From the small number of sperm-positive mardel(10)-containing chimeric animals, no mardel(lθ)- positive embryo or live born progeny were produced some suggestion of either mitotic dysfunction or a developmental incompetence of mardel(10)-containing embryos. Despite the use of a significantly larger number of sperm-positive chimeric mice carrying NC-MiC 1 in the FI -production experiment, again no live born progeny containing NC- MiC 1 was observed. This prompted a more detailed examination of embryos harvested from some ofthe pregnant mice on days 2.5 (16 embryos in total; 4 of which were positive by PCR of the neomycin-resistance gene ) and 9.5 (18 embryos in total; 5 positive by neomycin resistance-gene PCR) post coitum (p.c.) of gestation. FISH analysis using human cotl probe performed on these embryos showed that NC-MiC 1 was detected at the early stages but was lost at a relatively high rate during embryogenesis even at 2.5 days p.c (examples shown in Figure 17 and Table 13). Furthermore, the older embryos showed a greatly increased number of cells containing more than one copy of NC-MiC 1 in each cell (Figure 17 and Table 13). The NC-MiC 1 has remained as an episomal entity in all the embryos analyzed. TABLE 13 FISH analysis of embryos derived from chimeric mouse JL at days 9.5 and 2.5 pc, showing the presence ofNC-MiCl
Figure imgf000082_0001
Examples 9 to 19 relate to modulating stem cells using the subject constructs. Examples of suitable stem cells contemplated herein are provided in Table 3. EXAMPLE 9 A method for differentiating a stem cell
Stem cells are obtained from any ethically convenient source and may be primary isolated stem cells or artificially created stem cells using methods well known to those of skill in the art (Evans and Kaufman, Nature 292(5819): 154-156, 1981; Thomson et al, Science 282(5391): 1145-1147, 1998; Jiang et al, Nature 418(6893): 41-49, 2002; Reynolds and Weiss Science 255(5052): 1707-1710, 1992).
Once the ES are isolated, the mardel(lθ) chromosome containing a heterologous gene that, when expressed causes differentiation of the stem cell, is transferred into the ES using MMCT. The stem cells are then maintained in culture and allowed to either fully or partially differentiate and proliferate, prior to being administered to a subject. EXAMPLE 10 A method for differentiating a stem cell into a neural cell
Using the methods described herein, an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a neural cell is transferred into an isolated stem cell. The stem cell is maintained in culture and allowed to proliferate and differentiate into a neural cell.
EXAMPLE 11 A method for differentiating a stem cell into an epidermal cell
Using the methods described herein, an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into an epidermal cell is transferred into an isolated stem cell. The stem cell is maintained in culture and allowed to proliferate and differentiate into an epidermal cell. EXAMPLE 12 A method for differentiating a stem cell into a skin cell
Using the methods described herein, an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a skin cell is transferred into an isolated stem cell. The stem cell is maintained in culture and allowed to proliferate and differentiate into a skin cell.
EXAMPLE 13 A method for differentiating a stem cell into a insulin-producing cell
Using the methods described herein, an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into an insulin producing cell is transferred into an isolated stem cell. The stem cell is maintained in culture and allowed to proliferate and differentiate into an insulin-producing cell.
EXAMPLE 14 A method for differentiating a stem cell into a kidney cell
Using the methods described herein, an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a kidney cell is transferred into an isolated stem cell. The stem cell is maintained in culture and allowed to proliferate and differentiate into a kidney cell. EXAMPLE 15 A method for differentiating a stem cell into a liver cell
Using the methods described herein, an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a liver cell is transferred into an isolated stem cell. The stem cell is maintained in culture and allowed to proliferate and differentiate into a liver cell.
EXAMPLE 16 A method for differentiating a stem cell into a breast cell
Using the methods described herein, an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a breast cell is transferred into an isolated stem cell. The stem cell is maintained in culture and allowed to proliferate and differentiate into a breast cell.
EXAMPLE 17 A method for differentiating a stem cell into a lung cell
Using the methods described herein, an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a lung cell is transferred into an isolated stem cell. The stem cell is maintained in culture and allowed to proliferate and differentiate into a lung cell.
EXAMPLE 18 A method for differentiating a stem cell into a muscle cell
Using the methods described herein, an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a muscle cell is transferred into an isolated stem cell. The stem cell is maintained in culture and allowed to proliferate and differentiate into a muscle cell. EXAMPLE 19 A method for differentiating a stem cell into a heart cell
Using the methods described herein, an artificial chromosome comprising a heterologous gene capable of differentiating a stem cell into a heart cell is transferred into an isolated stem cell. The stem cell is maintained in culture and allowed to proliferate and differentiate into a heart cell.
Gene numbers refer to those shown in Figure 1 A. Celera Gene ID and corresponding gene name (where applicable) are shown. Domain refers to the location ofthe gene in relation to domains of chromatin modification identified in the current study. The relative expression levels of genes are shown for somatic hybrid cell lines in different genetic backgrounds. Relative expression levels were calculated as follows. The CT value for a particular gene amplification within a particular RNA sample refers to the PCR Cycle at which SYBR green incorporation reaches a Threshold level indicating logarithmic amplification. This is directly related to the quantity of a particular RNA within the starting sample, with highly expressed genes having a lower CT than poorly expressed genes. ΔCT relates gene expression levels to the 18s rRNA endogenous control allowing direct comparison of expression levels of different genes within an RNA sample [ΔCT = CT (gene of interest) - CT(18s rRNA)]. ΔCT values are used to calculate ΔΔCT values [ΔΔCT = ΔCT (cell line containing normal chromosome 10) - ΔCT(mardel(10) cell line)]. Relative expression levels (2"ΛΛCT) are a direct comparison of expression level to the normal chromosome. 'Pooled N10 v M10' refers to a pooled analysis of all ΔCT values for normal chromosome 10 or mardel(lθ) for each gene in each of the 3 hybrid pairs combined. At least 4 independent measurements of the expression level for each gene from 4 different RNA isolations from each cell line were obtained. Statistical significance of any difference in expression level between cell lines was calculated using ΔCT values in a Student's t-test. Pairs of hybrids [mardel(lθ) versus normal 10] were used for each analysis. No statistically significant differences (values shown only for pooled N10 v M10) were detected in gene expression for any ofthe cell lines tested. NE, no expression detected. EXAMPLE 20 Stability studies
HECs, as autonomous entities that can function and segregate like their normal chromosome counterparts provide a useful tool to study centromere and chromosome biology, and a potential novel strategy for the ex vivo gene therapy of a variety of clinical conditions. Neocentromeres that are fully functional and formed spontaneously on non- centromeric region offer an alternative source of centromere function for the construction of HECs. HEC (NC-MiC 1) generates from the neocentric mardel(lθ) chromosome in mice and the corresponding parental mardel(lθ) chromosome. Both mardel(lθ) and NC-MiC 1 were found to be relatively stable in mouse ES cells, with a respective retention rate of ~85% and 65% without selection after 45 cell divisions, implying a small loss rate over time. The initial loss rate appears to slow down after 30-45 divisions as the human transchromosomes "adapt" to the mouse genetic background, suggesting that there are slight differences in the properties associated with mitotic activity between a human and mouse chromosome. This loss rate compares favourably to those seen in other α-satellite DNA-based HECs in mouse background, where loss rates as high as 4.5% per generation have been described (Alazami et al, Genomics 53:844-851, 2004-08-18, Shen et al, Hum Mol Genet 5:1375-1382., 1997, Shen et al, Chromosoma 709:524-535, 2001). No structural modifications to the mardel(lθ) and NC-MiC 1 transchromosomes were detected in the various ES cell lines produced. These results indicate the mitotic and structural stability of the neocentric transchromosomes, and therefore the proper functioning of the human neocentromere not only in human cells but also in mouse cells. This observation provides further evidence in support of the dispensability of the normal centromeric repetitive DNA in the propagation of centromeric activity across mammalian species.
The behaviour of the 60-Mb neocentromere-based mardel(lθ) and its 3.5-Mb derivative NC-MiC 1 were analysed in mice. Chimeric mice carrying either of these chromosomes were successfully generated. Analysis of tissue samples from adult animals by PCR using mardel(lθ) and NC-MiC 1 -specific primers has demonstrated the presence of structurally intact, episomal mardel(lθ) and NC-MiC 1 in many different mouse tissues including lung, kidney, heart, brain, skin, adrenal, uterus, testis, liver, bone marrow, spleen, pancreas, tail, and others. The presence of an extra human neocentromere-based transchromosome does not appear to significantly affect the differentiation of the mouse ES cells into many different functional cell types. Specifically, the presence of mardel(lθ) and NC-MiC 1 were detected in the haemopoietic stem cells isolated from the bone marrow. These results illustrate that both mardel(lθ) and NC-MiC 1 are structurally stable and mitotically functional in mice throughout the development ofthe animals.
In addition to mitotic competence, the meiotic function of the neocentric transchromosomes were examined in the chimeric mice. The detection of the transchromosomes in the sperm samples of 14%> and 67% of mardel(lθ) and NC-MiC 1- positive chimeric mice, respectively, is consistent with the competent meiotic segregation function of the transchromosomes. Proof of germline transmission of NC-MiC 1 comes from the direct demonstration of intact episomal NC-MiC 1 in FI embryos. However, it is also evident, from the rapid decline in the proportion of NC-MiC 1-positive cells and the sharp increase in the number of cells carrying more than one copy of NC-MiC 1 from the
2.5- to 9.5-day old embryos, that NC-MiCl is relatively unstable in the mouse embryo background. This rapid loss of NC-MiC 1 due to postzygotic mitotic missegregation provides the explanation for our failure to observe NC-MiC 1-positive FI mice despite a continuous effort to breed the relatively large number of sperm-positive chimeric animals
(>40).
The expression of numerous genes from both mardel(lθ) and NC-MiC 1 were demonstrated in a variety of mouse tissues. In addition, tissue-specific expression for several genes was observed indicating that the introduced transchromosomes were subjected to the same genetic controls that regulate gene expression from the endogenous mouse counterparts.
Notwithstanding the measurable variable rate of mitotic error, the data presented herein evidences that the human neocentromere and its associated marker chromosome and derivative minichromosome are mitotically (and meiotically) functional in mouse ES cells and in mice. Transchromosomes are shown to be transmitted in many different tissue types. Transmission in haemopoietic stem cells evidences a utility in particular of the neocentromere-based minichromosomes for somatic cell therapy through the stem cell route. Genes can be positively and differentially expressed from the minichromosome in a large spectrum of mouse tissues. These results enable the use of these minichromosomes for therapeutic gene replacement strategies.
Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.
BIBLIOGRAPHY
Alazami et al, Genomics 53:844-851, 2004-08-18
Alison et al, J. Pathol 197(4): 419-423, 2002
Amor and Choo, Am. J. Hum. Genet. 71(4): 695-714, 2002
Barry et al, Genome Res. 10(6): 832-838, 2000
Bernard and Allshire, Trends Cell Biol. 12(9): 419, 2002
Bernard et al, Science 294(5551): 2539-2542, 2001
Bernat et α/., J. Cell. Biol. Ill: 1519-1533, 1990
Bickmore and Oghene, Cell 84(1): 95-104, 1996
Bishop et al, J Comp Neurol 457(4): 345-360, 2003
Bradley et al, Ciba Found Symp, 165:256-269; 1992
Brown et al, Hum. Mol. Genet. 3: 1227-1237, 1994
Choo, Dev. Cell 1: 165-177, 2001
Cortes-Canteli et al, JBiol Chem 277(7): 5460-5467, 2002
Di Palma et al, Proc. Natl. Acad. Sci. USA 99(23): 14994-14999, 2002
du Sart et α/., Nat. Genet. 16(2): 144-153, 1997 Earnshaw and Mackay, FASEB J. 8: 947-956, 1994
Earnshaw et al, Chromosoma 98: 1-12, 1989
Ellis et al, Genes Dev 15(17): 2307-2309, 2001
Evans and Kaufman, Nature 292(5819): 154-156, 1981
Farr et al, EMBQ Journal 14: 5444-5454, 1995
Fukagawa et al, EMBO J. 20(16): 144-153, 2001
Haaf et al, Cell 70: 681-696, 1992
Hanashima et al, J Neurosci 22(15): 6526-6536, 2002
Howman et al, Proc, Natl. Acad. Sci. USA 97(3): 1148-1153, 2000
Hudson et al, J. Cell Biol. 141: 309-319, 1998
Jiang et al, Nature 418(6893): 41-49, 2002
Kalitsis et al, Proc. Natl. Acad. Sci. USA 95: 1136-1141, 1998
Kermer et al, Cell Death Differ. 9(4): 405-413, 2002
Larin et /., Hum. Mol. Genet. 3: 689-695, 1994
Le Douarin et al, EMBO J. 15(23): 6701-6715, 1996 Liebl et al, Proc. Natl. Acad. Sci USA 97(5): 2297-2302, 2000
Liu et al, Nat. Cell Biol. 5: 341-345, 2003
Lo et al, EMBOJ. 20(8): 2087-2096, 2001 A
Lo et al, Genome Res. 11(3): 448-457, 2001B
Mann et al, J Reprod Fertil, 99:505-512, 1993
Nishihashi et al, Dev. Cell 2: 463-476 2002
Nishioka et al, J Invest Dermatol 119(3): 632-638, 2002
Oghene, Cell 84(1): 95-104, 1996
Oh et al, Proc. Natl. Acad. Sci USA 99(8): 5430-5435, 2002
Page et l, Hum. Mol. Genet. 4: 289-294, 1995
Paulson and Laemmli, Cell 12: 8178-828, 1977
Pinsky et al, Dev. Cell. 3(1): A-6, 2002
Pluta et /., Science 270: 1591-1594, 1995
Pluta et α/., Trends Biochem. 15: 181-185, 1990
Qian et al, Genes Dev 16(10): 1220-1233, 2002
Reid et al, Development 122(12): 3911-3919, 1996 Reynolds and Weiss Science 255(5052): 1707-1710, 1992
Rodda et al, IntJDev Biol. 46(4): 449-458, 2002
Saffery et al, Hum. Mol. Genet. 9(2): 175-185, 2000
Saffery et al, Proc. Natl. Acad. Sci USA 98(10): 5705-5710, 2001
Saitoh et al, Bioassays 17(9): 2919-2926, 1995
Schmid et al, Proc. Natl. Acad. Sci. USA 100(7): 4251-4256, 2003
Shen et al, Hum Mol Genet 5:1375-1382., 1997
Shen et al, Chromosoma 709:524-535, 2001
Schulze et al, Mol Gen. Genet. 264(6): 782-789, 2001
Seidah et al, Proc. Natl. Acad. Sci. USA 100(3): 928-933, 2003
Su et al, Proc. Natl Acad. Sci. USA 99: 4465-4470, 2002
Sugata et al, Hum. Mol. Genet. 9: 2919-2926, 2000
Sugata et al, J. Biol. Chem. 274: 27343-27346, 1999
Sullivan and Schwartz, Hum. Mol. Genet. 4: 2189-2197, 1995
Thomson et al, Science 282(5391): 1145-1147, 1998 Tomkiel et al, J Cell. Biol. 125: 531-545, 1994
Turnley et al, Nat Neurosci 5(11): 1155-1162, 2002
Tyler-Smith et al, Nature Genet 5: 368-375, 1993
VagnareUi et al, Chromsoma 110(6): 393-401, 2001
Van Hooser et al, J. Cell. Sci. 114(19): 3529-3542, 2001
Vicario-Abejon et al, J Neurosci 23(3): 895-906, 2003
Wallis et al, Development 130(1): 221-232, 2003
Wong et al, Gene Ther 9: 724-726, 2002
Xuan et al, Neuron 14(6): 1141-1152, 1995

Claims

1. A stem cell comprising a self-replicating artificial chromosome comprising a neocentromere having centromeric chromatin domains wherein the artificial chromosome comprises expressible genetic material within the centromeric chromatin domains or in a region proximal thereto which modifies or introduces at least one trait in said stem cell.
2. A method of modulating the genetic potential of a stem cell, said method comprising introducing into said stem cell or a parent of said stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises expressible genetic material within the centromeric chromatin domains or in a region proximal thereto which modifies or introduces at least one trait in said stem cell
3. A method for directing differentiation, proliferation or self-renewal of a stem cell by introducing into the stem cell or a parent of said stem cell an artificial chromosome comprising a neocentromere having centromeric chromatin domains which comprises genetic material within the centromeric chromatin domains or in a region proximal thereto which is capable of generating an expression production which modulates stem cell differentiation, proliferation and/or self-renewal.
4. The stem cell of Claim 1 or 2 or 3, wherein said stem cell is selected from the group consisting of: embryonic stem cells, somatic stem cells, germ stem cells, epidermal stem cells, adult neural stem cells, keratinocyte stem cells, melanocyte stem cells, adult renal stem cells, embryonic renal epithelial stem cells, embryonic endodermal stem cells, hepatocyte stem cells, mammary epithelial stem cells, bane marrow-derived stem cells, skeletal muscle stem cells, bone marrow mesenchymal stem cells, CD34+ hematopoietic stem cells, mesenchymal stem cells.
5. The stem cell of Claim 1 or 2 or 3, wherein the stem cell differentiates into a cell selected from the group consisting of: keratinocytes, fibroblasts, pancreatic islets, pancreatic β-cells, kidney epithelial cells, hepatocytes, bile duct epithelial cells, lung fibroblasts, bronchial epithelial cells, alveolar type II pneumocytes, cardiomyocytes, simple squamous epithelial cells, descending aortic endothelial cells, aortic arch endothelial cells, aortic smooth muscle cells, corneal epithelial cells, osteoblasts, peripheral blood mononuclear progenitor cells, osteoclasts, stromal cells, splenic precursor cells, splenocytes, CD4 T-cells, CD8+ T-cells, NK cell, monocytes, macrophages, dendritic cells, B-cells, gablet cells, pseudostriated ciliated columnar cells, pseudostratified ciliated epithelium, stratified epithelial cells, ciliated columnar cells, basal cells, cricopharyngeus muscle cells.
6. The stem cell of Claim 1 or 2 or 3, wherein the genetic material corresponds to a
DNA sequence encoding a cytokine, growth factor or receptor selected from the group consisting of Activin RIA (Activin Receptor), ADAM (A Desintegrin and Metalloprotease-like Domain), ADAMTS (A Disintegrin-like and Metalloproteinase Domain with Thrombospondin Type I Motifs), ALCAM (Activated Leukocyte Cell Adhesion Molecule), ALK (Activin Receptor-like Kinase) ANG (Angiogenin), Ang (CC Chemokine Receptors), APAF-1 (Apoptosis Protease Activating Factor- 1), APE (AP Endonuclease), APJ (A Seven Transmembrane-domain Receptor), APP (Amyloid Precursor Protein), APRIL (a Proliferation-inducing Ligand), AR (Amphiregulin), ARC (Agouti-related Transcript), ART (Fibroblast Growth Factor), Axl (a Receptor Tyrosine Kinase),β2M (β 2 Microglobulin), B7-H (B7 Homolog), BACE (β-site APP Cleaving Enzyme), Bad (Bcl-xL/Bcl-2 Associated Death Promoter), BAFF (B cell Activating Factor), Bag-1 (Bcl-2-associated Anthanogene-1), BAK (Bcl-2 Antagonist/Killer), Bax (Bel Associated X Protein), BCA-1 (B-Cell-attracting Chemokine 1), BCAM (Basal-cell Adhesion Molecule), Bel (B-Cell Lymphoma/Leukemia), BCMA (B Cell Maturation Factor), BDNF (Brain-derived Neurotrophic Factor), β-ECGF (β Endothelial Cell Growth Factor), BID (BH3 Interacting Domain Death Agonist), Bik (Bcl-2 Interacting Killer), BIM (Bcl-2 Interacting Mediator of Cell Death), BLC (B-Lymphocyte Chemoattractant), BL-CAM (B-lymphocyte Cell Adhesion Molecule), BLK (Bik-like Killer Protein), BMP (Bone Morphogenetic Protein), BMPR (Bone Morphogenetic Protein Receptor), β-NGF (β Nerve Growth Factor), BOK (Bcl-2-related Ovarian Killer), BPDE (Benzo[a]Pyrene- Guanosine-BSA), BPDE-DNA (Benzo[a]Pyrene-Diol Epoxide-DNA), BTC (β cellulin), CIO (a Novel Mouse CC Chemokine), CAD-8 (Cadherin-8), cAMP (Cyclic AMP), Caspase (Caspase-1), CCI (CC Chemokine Inhibitor), CCL (CC Chemokine Ligands), CCR (CC Chemokine Receptors), CD (Cluster of Differentiation), CD30L (CD30 Ligand), CD40L (CD40 Ligand), CFTR (Cystic Fibrosis Transmembrane Conductance Regulator), cGMP (Cyclic GMP), CINC (Cytokine-induced Neutrophil Chemotactic Factor), CKβ8-l (Chemokine β 8-1), CLC (Cardiotrophin-like Cytokine), CMV UL (Cytomegalovirus ORFUL), CNTF (Ciliary Neurotrophic Factor), CNTN-1 (Contactin-1), COX (Cyclooxygenase), C-Ret (a Receptor Tyrosine Kinase), CRG-2 (a Mouse CXC Chemokine), CT-1 (Cardiotrophin 1), CTACK (Cutaneous T-cell Attracting Chemokine), CTGF (Connective Tissue Growth Factor), CTLA-4 (Cytotoxic T-lymphocyte-associated Molecule 4), CXCL (CXC Chemokine Ligands), CXCR (CXC Chemokine Receptors), DAN (Differential Screening-selected Gene Aberrant in Neuroblastoma), DCC (Deleted in Colorectal Cancer), DcR3 (Decoy Receptor 3), DC-SIGN (Dendritic Cell-specific ICAM- 3-grabbing Nonintegrin), Dhh (Desert Hedgehog), DNAM-1 (DNAX Accessory Molecule 1), Dpp (Decapentaplegic), DR (Death Receptor), Dtk (Developmental Tyrosine Kinase), ECAD (E-Cadherin), EDA (Ectodysplasin-A), EDAR (Ectodysplasin Receptor), EGF (Epidermal Growth Factor), EMMPRIN (Extracellular Matrix Metalloproteinase Inducer, CD 147), ENA (Epithelial-derived Neutrophil Attractant), eNOS (Endothelial Nitric Oxide Synthase), Eot (Eotaxin Epo Erythropoietin), ErbB3 (Erb B3 Receptor Protein Tyrosine Kinase), ERCC (Excision Repair Cross-complementing), ET-1 (Endothelin- 1), Fas (Fibroblast-associated), FEN-1 (Flap Endonuclease), FGF (Fibroblast Growth Factor), FL (Fas Ligand FasL), FLIP (FLICE Inhibitory Proteins), Flt-3 (fms-like Tyrosine Kinase 3), Fractalkine, Gas 6 (Growth-arrest-specific Protein 6), GCP-2 (Granulocyte Chemotactic Protein 2), G-CSF (Granulocyte Colony Stimulating Factor), GDF (Growth Differentiation Factor), GDNF (Glial cell line-derived Growth Factor), GFAP (Flial Fibrillary Acidic Protein), GFRα-1 (Glial Cell Line-derived Neurotropic Factor Receptor α 1), GITR (Glucocorticoid Induced TNF Receptor Family Related Gene), Glut 4 (Insulin Regulated Glucose Transporter Protein), GM-CSF (Granulocyte Macrophage Growth Factor), gpl30 (glycoprotein 130), GRO (Growth Related Protein α), HB-EGF (Heparin Binding Epidermal Growth Factor), HCC (Hemofiltrate CC Chemokine), HCMV UL (Human Cytomegalovirus ORFUL), HGF (Hepatocyte Growth Factor), HRG (Heregulin), Hrk (Harakiri HVEM Herpes virus Entry Mediator), 1-309 (a human CC chemokine), IAP (Inhibitors of Apoptosis), ICAM (Intercellular Adhesion Molecule, ICOS (Inducible Co- stimulator), IFN (Interferon Ig Immunoglobulin), IGF (Insulin-like Growth Factor), IGFBP (Insulin-like Growth Factor Binding Protein), IL-la (hlnterleukin-la), hIL-lb (Interleukin- lb), hIL-2(Interleukin-2 ), hIL-3 (Interleukin-3), hIL-4 (Interleukin-4), hIL-5 (Interleukin- 5), hIL-6 (Interleukin-6), hIL-7 (Interleukin-7), hlT-lO (Interleukin-10), hIL-11 (Interleukin-11), hIL-12 (Interleukin-12), hIL-13 (Interleukin-13), hIL-15 (Interleukin-15), hIL-18 (Interleukin-18), iNOS (Inducible Nitric Oxide Synthase), IP-10 (Interferon gamma Inducible Protein 10), I-TAC (Interferon-inducible T-cell α Chemoattractant), JE (Mouse homologue of human MCP-1), KC (Mouse homologue of human GRO), KGF (Keratinocyte Growth Factor), LAMP (Limbic System-associated Membrane Protein), LAP (Latency-associated Peptide), LBP (Lipopolysaccharide-binding Protein), LDGF (Leukocyte-derived Growth Factor), LECT2 (Leukocyte Cell-Derived Chemotaxin 2), LFA-1 (Lymphocyte Function-associated Molecule-lLfo), Lfo (Lactoferrin), LIF (Leukemia Inhibitory Factor), LIGHT (Name derived from Homologous to Lymphotoxins, Inducible expression, competes with HSV Glycoprotein D for HVEM, a receptor expressed on T-lymphocytes), LIX (LPS-induced CXC Chemokine), LKN (Leukotactin), Lptn (Lymphotactin), LT-α (Lymphotoxin α (aka TNF-β)), LT-β (Lymphotoxin β (aka p33)), LTB4 (Leukotriene B4), LTBP-1 (Latent TGF-β bpl), MAG (Myelin-associated Glycoprotein), MAP2 (Microtubule-associated Protein 2), MARC (Mast Cell Activation- Related Chemokine), MCAM (Melanoma Cell Adhesion Molecule (aka MUC 18, CD 146)), MCK-2 (Mouse Cytomegalovirus Viral CC Chemokine Homolog 2), MCP (Monocyte Chemotactic Protein), M-CSF (Macrophage Colony Stimulating Factor), MDC (Macrophage-derived Chemokine (aka STP-1)), Mer (Tyrosine Protein Kinase), MGMT (O-6 Methylguanine-DNA Methyltransferase), MIF (Macrophage Migration Inhibitory Factor), MIG (Monokine Induced by IFN-g), MIP (Macrophage Inflammatory protein), MK (Midkine), MMAC1 (Mutated in Multiple Advanced Cancers Protein 1), MMP (Matrix Metalloproteinase), MPIF (Myeloid Progenitor Inhibitory Factor), Mpo (Myeloperoxidase), MSK (Mitogen- and Stress-activated Protein Kinase), MSP (Macrophage Stimulating Protein), Mug (Mismatch Uracil DNA Glycosylase), MuSK (Muscle-specific Kinase), NAIP (Neuronal Apoptosis Inhibitor Protein), NAP (Neutrophil Activation Protein), NCAD N-Cadherin (N-Cadherin Neural Cadherin), NCAM (Neural Cell Adhesion Molecule), nNOS (Neuronal Nitric Oxide Synthase), NO (Nitric Oxide), NOS (Nitric Oxide Synthase), Npn (Neuropilin), NRG-3 (Neuregulin-3), NT (Neurotrophin), NTN (Neurturin), OB (Leptin, product of the ob gene), OGG1 (8- oxoGuanine DNA Glycosylase), OPG (Osteoprotegerin), OPN (Osteopontin), OSM (Oncostatin M), PADPr (Poly (ADP-ribose) Polymer), PARC (Pulmonary and Activation-regulated Chemokine), PARP (Poly (ADP-ribose) Polymerase), PBR (Peripheral-type Benzodiazepine Receptorlnterleukin-la (hIL-la), Interleukin-lb (hIL-lb), Interleukin-2 (hIL-2), Interleukin-3 (hIL-3), Interleukin-4 (hIL-4), Interleukin-5 (hIL-5), Interleukin-6 (hIL-6), Interleukin-7 (hIL-7), Interleukin-10 (hIL-10), Interleukin-11 (ML- 11), Interleukin-12 (hIL-12), Interleukin-13 (hIL-13), Interleukin-15 (hIL-15), Interleukin- 18 (hIL-18), PBSF (Pre-B Cell Growth Stimulating Factor (aka SDF-l)Interleukin-la (hIL-la), Interleukin-lb (hIL-lb), Interleukin-2 (hIL-2), Interleukin-3 (hIL-3), Interleukin- 4 (hIL-4), Interleukin-5 (hIL-5), Interleukin-6 (hIL-6), Interleukin-7 (hIL-7), Interleukin- 10 (hIL-10), Interleukin-11 (hIL-11), Interleukin-12 (hIL-12), Interleukin-13 (hIL-13), Interleukin-15 (hIL-15), Interleukin-18 (hIL-18), PCAD (P-Cadherin Placental Cadherin), PCNA (Proliferating Cell Nuclear Antigen), PDGF (Platelet-derived Growth Factor), PDK-1 (Phosphoinositide Dependent Kinase-1), PECAM (Platelet Endothelial Cell Adhesion Molecule), PF4 (Platelet Factor 4), PGE (Prostaglandin E), PGF (Prostaglandin F), PGI2 (Prostacyclin PGJ2 Prostaglandin J2), PIN (Protein Inhibitor of Neuronal Nitric Oxide Synthase), PLA2 (Phospholipase A2), P1GF (Placenta Growth Factor), PLP (Proteolipid Protein), PP14 (Placental Protein 14), PS (Presenilin), PTEN (Protein Tyrosine Phosphatase and Tensin Homolog, see MMAC PTN Pleiotrophin), R51 (S. cerevisiae homolog of RAD51), RANK (Receptor Activator of NF-kappa-B), RANTES (Regulated upon activation, normal T cell Expressed and Secreted), Ret (Proto-oncogene Tyrosine-protein Kinase Receptor), RPA2 (Replication Protein A2), RSK (Ribosomal Protein S6 Kinase II), SCF/KL (Stem Cell Factor KIT Ligand), SDF-1 (Stromal Cell- derived Factor 1 (aka PBSF)), sFRP-3 (Secreted Frizzled Related Protein), Shh (Sonic Hedgehog), SIGIRR (Single Ig Domain Containing IL-1 Receptor-related Molecule), SLAM (Signaling Lymphocytic Activation Molecule), SLPI (Secretory Leukocyte protease Inhibitor), SMAC (Second Mitochondria-derived Activator of Caspase), SMDF (Sensory and Motor Neuron-derived Factor), SOD (Superoxide Dismutase), SPARC (Secreted Protein Acidic and Rich in Cysteine), Stat (Signal Transducer and Activator of Transcription), TACE (TNF-α-Converting Enzyme), TACI (Transmembrane Activator and CAML Interactor), TARC (Thymus and Activation-regulated Chemokine), TCA-3 (a CC Chemokine), TECK (Thymus-expressed Chemokine), TERT (Telomerase Reverse Transcriptase), TfR (Transferrin Receptor), TGF (Transforming Growth Factor), Thymus Ck-1 (Thymus Chemokine 1), Tie (Tyrosine Kinase with Immunoglobulin and Epidermal Growth Factor Homology Domains), TIMP (Tissue Inhibitors of Metalloproteinases) TIQ (N-methyl-6,7-dihydroxytetrahydroisoquinoline), Tmpo (Thymopoietin), TNF-R (TNF- Receptor), TNF (Tumor Necrosis Factor), TP-1 (Trophoblast Protein- 1), Tpo (Thrombopoietin), TRAIL (TNF-related Apoptosis-inducing Ligand), TRAIL R (TRAIL Receptor), TRANCE (TNF-related Activation-induced Cytokine), TRF (Telomeric Repeat Binding Factor), Trk (Neurotrophic Tyrosine Kinase Receptor), TROP-2 (Tumor Associated Calcium Signal Transducer), TSG (Twisted Gastrulation), TSLP (Thymic Stromal Lymphopoietin), TWEAK (TNF-like and Weak Inducer of Apoptosis), TXB2 (Thromboxane B2), Ung (Uracil-N-Glycosylase), uPAR (Urokinase-type Plasminogen Activator Receptor), uPAR-1 (Urokinase-type Plasminogen Activator Receptor 1), VCAM-1 (Vascular Cell Adhesion Molecule 1), VECAD (VE-Cadherin Vascular Epithelium Cadherin), VEGF (Vascular Endothelial Growth Factor), VEGI (Vascular Endothelial Growth Inhibitor), VIM (Vimentin), VLA-4 (Very Late Antigen-4), WIF-1 (Wnt Inhibitory Factor), XIAP (X-linked Inhibitor of Apoptosis) or XPD (Xeroderma Pigmentosum D).
7. The stem cell of Claim 1 or 2 or 3, wherein said heterologous DNA sequence encodes a protein selected from the group consisting of Bcl-2, Bcl-w and Bcl-xy, Bcl-2- associated athanogene 1, CCAAT/enhancer binding protein (C/ΕBP), empty spiracles homolog 1 (Drosophila), empty spiracles homolog 2 (Drosophila), forkhead box Gl, proprotein convertase subtilisin/kexin type 9, suppressor of cytokine signaling 2, T-cell leukemia, homeobox 1, T-cell leukemia, homeobox 3, insulin-like growth factor 1, neuregulin 1, neurotrophin 5, cut-like 1 (Drosophila), growth factor independent 1, mucolipin 3, mucosal vascular addressin cell adhesion molecule 1, tumor susceptibility gene 101, endothelin 3, endothelin receptor type B and/or a bone morphogenetic protein (BMP) such as BMP1, BMP2, BMP3 or BMP4.
8. The stem cell of Claim 1 or 2 or 3, wherein said artificial chromosome is a human artificial chromosome.
9. A method for altering the genetic potential of a stem cell or a daughter cell thereof, said method comprising incorporating into a stem cell or parent thereof at least one artificial chromosome comprising a neocentromere having centromeric chromatin domains of mammalian, avian or other higher eukaryote DNA origin, said nucleic acid molecule comprising a heterologous nucleic acid molecule inserted within a centromeric chromatin domain of the neocentromeric region or immediately adjoining or proximal region and which when the heterologous nucleic acid is expressed adds to or modifies a trait in the stem cell.
10. The stem cell of Claim 1 or 2 or 3, wherein said stem cell is selected from the group consisting of: embryonic stem cells, somatic stem cells, germ stem cells, epidermal stem cells, adult neural stem cells, keratinocyte stem cells, melanocyte stem cells, adult renal stem cells, embryonic renal epithelial stem cells, embryonic endodermal stem cells, hepatocyte stem cells, mammary epithelial stem cells, bane marrow-derived stem cells, skeletal muscle stem cells, bone marrow mesenchymal stem cells, CD34+ hematopoietic stem cells, mesenchymal stem cells.
11. The stem cell of Claim 1 or 2 or 3, wherein the stem cell differentiates into a cell selected from the group consisting of: keratinocytes, fibroblasts, pancreatic islets, pancreatic β-cells, kidney epithelial cells, hepatocytes, bile duct epithelial cells, lung fibroblasts, bronchial epithelial cells, alveolar type II pneumocytes, cardiomyocytes, simple squamous epithelial cells, descending aortic endothelial cells, aortic arch endothelial cells, aortic smooth muscle cells, corneal epithelial cells, osteoblasts, peripheral blood mononuclear progenitor cells, osteoclasts, stromal cells, splenic precursor cells, splenocytes, CD4+ T-cells, CD8+ T-cells, NK cell, monocytes, macrophages, dendritic cells, B-cells, gablet cells, pseudostriated ciliated columnar cells, pseudostratified ciliated epithelium, stratified epithelial cells, ciliated columnar cells, basal cells, cricopharyngeus muscle cells.
12. The stem cell of Claim 1 or 2 or 3, wherein the genetic material corresponds to a DNA sequence encoding a cytokine, growth factor or receptor selected from the group consisting of Activin RIA (Activin Receptor), ADAM (A Desintegrin and Metalloprotease-like Domain), ADAMTS (A Disintegrin-like and Metalloproteinase Domain with Thrombospondin Type I Motifs), ALCAM (Activated Leukocyte Cell Adhesion Molecule), ALK (Activin Receptor-like Kinase) ANG (Angiogenin), Ang (CC Chemokine Receptors), APAF-1 (Apoptosis Protease Activating Factor- 1), APE (AP Endonuclease), APJ (A Seven Transmembrane-domain Receptor), APP (Amyloid Precursor Protein), APRIL (a Proliferation-inducing Ligand), AR (Amphiregulin), ARC (Agouti-related Transcript), ART (Fibroblast Growth Factor), Axl (a Receptor Tyrosine Kinase),β2M (β 2 Microglobulin), B7-H (B7 Homolog), BACE (β-site APP Cleaving Enzyme), Bad (Bcl-xL/Bcl-2 Associated Death Promoter), BAFF (B cell Activating Factor), Bag-1 (Bcl-2-associated Anthanogene-1), BAK (Bcl-2 Antagonist/Killer), Bax (Bel Associated X Protein), BCA-1 (B-Cell-attracting Chemokine 1), BCAM (Basal-cell Adhesion Molecule), Bel (B-Cell Lymphoma/Leukemia), BCMA (B Cell Maturation Factor), BDNF (Brain-derived Neurotrophic Factor), β-ECGF (β Endothelial Cell Growth Factor), BID (BH3 Interacting Domain Death Agonist), Bik (Bcl-2 Interacting Killer), BIM (Bcl-2 Interacting Mediator of Cell Death), BLC (B-Lymphocyte Chemoattractant), BL-CAM (B-lymphocyte Cell Adhesion Molecule), BLK (Bik-like Killer Protein), BMP (Bone Morphogenetic Protein), BMPR (Bone Morphogenetic Protein Receptor), β-NGF (β Nerve Growth Factor), BOK (Bcl-2-related Ovarian Killer), BPDE (Benzo[a]Pyrene- Guanosine-BSA), BPDE-DNA (Benzo[a]Pyrene-Diol Epoxide-DNA), BTC (β cellulin), CIO (a Novel Mouse CC Chemokine), CAD-8 (Cadherin-8), cAMP (Cyclic AMP), Caspase (Caspase-1), CCI (CC Chemokine Inhibitor), CCL (CC Chemokine Ligands), CCR (CC Chemokine Receptors), CD (Cluster of Differentiation), CD30L (CD30 Ligand), CD40L (CD40 Ligand), CFTR (Cystic Fibrosis Transmembrane Conductance Regulator), cGMP (Cyclic GMP), CINC (Cytokine-induced Neutrophil Chemotactic Factor), CKβ8-l (Chemokine β 8-1), CLC (Cardiotrophin-like Cytokine), CMV UL (Cytomegalovirus ORFUL), CNTF (Ciliary Neurotrophic Factor), CNTN-1 (Contactin-1), COX (Cyclooxygenase), C-Ret (a Receptor Tyrosine Kinase), CRG-2 (a Mouse CXC Chemokine), CT-1 (Cardiotrophin 1), CTACK (Cutaneous T-cell Attracting Chemokine), CTGF (Connective Tissue Growth Factor), CTLA-4 (Cytotoxic T-lymphocyte-associated Molecule 4), CXCL (CXC Chemokine Ligands), CXCR (CXC Chemokine Receptors), DAN (Differential Screening-selected Gene Aberrant in Neuroblastoma), DCC (Deleted in Colorectal Cancer), DcR3 (Decoy Receptor 3), DC-SIGN (Dendritic Cell-specific ICAM- 3-grabbing Nonintegrin), Dhh (Desert Hedgehog), DNAM-1 (DNAX Accessory Molecule 1), Dpp (Decapentaplegic), DR (Death Receptor), Dtk (Developmental Tyrosine Kinase), ECAD (E-Cadherin), EDA (Ectodysplasin-A), EDAR (Ectodysplasin Receptor), EGF (Epidermal Growth Factor), EMMPRIN (Extracellular Matrix Metalloproteinase Inducer, CD 147), ENA (Epithelial-derived Neutrophil Attractant), eNOS (Endothelial Nitric Oxide Synthase), Eot (Eotaxin Epo Erythropoietin), ErbB3 (Erb B3 Receptor Protein Tyrosine Kinase), ERCC (Excision Repair Cross-complementing), ET-1 (Endothelin- 1), Fas (Fibroblast-associated), FEN-1 (Flap Endonuclease), FGF (Fibroblast Growth Factor), FL (Fas Ligand FasL), FLIP (FLICE Inhibitory Proteins), Flt-3 (fins-like Tyrosine Kinase 3), Fractalkine, Gas 6 (Growth-arrest-specific Protein 6), GCP-2 (Granulocyte Chemotactic Protein 2), G-CSF (Granulocyte Colony Stimulating Factor), GDF (Growth Differentiation Factor), GDNF (Glial cell line-derived Growth Factor), GFAP (Flial Fibrillary Acidic Protein), GFRα-1 (Glial Cell Line-derived Neurotropic Factor Receptor α 1), GITR (Glucocorticoid Induced TNF Receptor Family Related Gene), Glut 4 (Insulin Regulated Glucose Transporter Protein), GM-CSF (Granulocyte Macrophage Growth Factor), gpl30 (glycoprotein 130), GRO (Growth Related Protein α), HB-EGF (Heparin Binding Epidermal Growth Factor), HCC (Hemofiltrate CC Chemokine), HCMV UL (Human Cytomegalovirus ORFUL), HGF (Hepatocyte Growth Factor), HRG (Heregulin), Hrk (Harakiri HVEM Herpesvirus Entry Mediator), 1-309 (a human CC chemokine), IAP (Inhibitors of Apoptosis), ICAM (Intercellular Adhesion Molecule, ICOS (Inducible Co- stimulator), IFN (Interferon Ig Immunoglobulin), IGF (Insulin-like Growth Factor), IGFBP (Insulin-like Growth Factor Binding Protein), IL-la (hlnterleukin-la), hIL-lb (Interleukin- lb), hIL-2(Interleukin-2 ), hIL-3 (Interleukin-3), hIL-4 (Interleukin-4), hIL-5 (Interleukin- 5), hIL-6 (Interleukin-6), hIL-7 (Interleukin-7), hIL-10 (Interleukin-10), hIL-11 (Interleukin-11), hIL-12 (Interleukin-12), hIL-13 (Interleukin-13), hIL-15 (Interleukin-15), hIL-18 (Interleukin-18), iNOS (Inducible Nitric Oxide Synthase), IP-10 (Interferon gamma Inducible Protein 10), I-TAC (Interferon-inducible T-cell α Chemoattractant), JE (Mouse homologue of human MCP-1), KC (Mouse homologue of human GRO), KGF (Keratinocyte Growth Factor), LAMP (Limbic System-associated Membrane Protein), LAP (Latency-associated Peptide), LBP (Lipopolysaccharide-binding Protein), LDGF (Leukocyte-derived Growth Factor), LECT2 (Leukocyte Cell-Derived Chemotaxin 2), LFA-1 (Lymphocyte Function-associated Molecule- ILfo), Lfo (Lactoferrin), LIF (Leukemia Inhibitory Factor), LIGHT (Name derived from Homologous to Lymphotoxins, Inducible expression, competes with HSV Glycoprotein D for HVEM, a receptor expressed on T-lymphocytes), LIX (LPS-induced CXC Chemokine), LKN (Leukotactin), Lptn (Lymphotactin), LT-α (Lymphotoxin α (aka TNF-β)), LT-β (Lymphotoxin β (aka p33)), LTB4 (Leukotriene B4), LTBP-1 (Latent TGF-β bpl), MAG (Myelin-associated Glycoprotein), MAP2 (Microtubule-associated Protein 2), MARC (Mast Cell Activation- Related Chemokine), MCAM (Melanoma Cell Adhesion Molecule (aka MUC 18, CD 146)), MCK-2 (Mouse Cytomegalovirus Viral CC Chemokine Homolog 2), MCP (Monocyte Chemotactic Protein), M-CSF (Macrophage Colony Stimulating Factor), MDC (Macrophage-derived Chemokine (aka STP-1)), Mer (Tyrosine Protein Kinase), MGMT (O-6 Methylguanine-DNA Methyltransferase), MIF (Macrophage Migration Inhibitory Factor), MIG (Monokine Induced by IFN-g), MIP (Macrophage Inflammatory protein), MK (Midkine), MMAC1 (Mutated in Multiple Advanced Cancers Protein 1), MMP (Matrix Metalloproteinase), MPIF (Myeloid Progenitor Inhibitory Factor), Mpo (Myeloperoxidase), MSK (Mitogen- and Stress-activated Protein Kinase), MSP (Macrophage Stimulating Protein), Mug (Mismatch Uracil DNA Glycosylase), MuSK (Muscle-specific Kinase), NAIP (Neuronal Apoptosis Inhibitor Protein), NAP (Neutrophil Activation Protein), NCAD N-Cadherin (N-Cadherin Neural Cadherin), NCAM (Neural Cell Adhesion Molecule), nNOS (Neuronal Nitric Oxide Synthase), NO (Nitric Oxide), NOS (Nitric Oxide Synthase), Npn (Neuropilin), NRG-3 (Neuregulin-3), NT (Neurotrophin), NTN (Neurturin), OB (Leptin, product of the ob gene), OGG1 (8- oxoGuanine DNA Glycosylase), OPG (Osteoprotegerin), OPN (Osteopontin), OSM (Oncostatin M), PADPr (Poly (ADP-ribose) Polymer), PARC (Pulmonary and Activation-regulated Chemokine), PARP (Poly (ADP-ribose) Polymerase), PBR (Peripheral-type Benzodiazepine Receptorlnterleukin-la (hIL-la), Interleukin-lb (hIL-lb), Interleukin-2 (hIL-2), Interleukin-3 (hIL-3), Interleukin-4 (hIL-4), Interleukin-5 (hIL-5), Interleukin-6 (hIL-6), Interleukin-7 (hIL-7), Interleukin-10 (hIL-10), Interleukin-11 (hlL- 11), Interleukin-12 (hIL-12), Interleukin-13 (hIL-13), Interleukin-15 (hIL-15), Interleukin- 18 (hIL-18), PBSF (Pre-B Cell Growth Stimulating Factor (aka SDF-l)Interleukin-la (hIL-la), Interleukin-lb (hIL-lb), Interleukin-2 (hIL-2), Interleukin-3 (hIL-3), Interleukin- 4 (hIL-4), Interleukin-5 (hIL-5), Interleukin-6 (hIL-6), Interleukin-7 (hIL-7), Interleukin- 10 (hIL-10), Interleukin-11 (hIL-11), Interleukin-12 (ML- 12), Interleukin-13 (hIL-13), Interleukin-15 (hIL-15), Interleukin-18 (hIL-18), PC AD (P-Cadherin Placental Cadherin), PCNA (Proliferating Cell Nuclear Antigen), PDGF (Platelet-derived Growth Factor), PDK-1 (Phosphoinositide Dependent Kinase-1), PECAM (Platelet Endothelial Cell Adhesion Molecule), PF4 (Platelet Factor 4), PGE (Prostaglandin E), PGF (Prostaglandin F), PGI2 (Prostacyclin PGJ2 Prostaglandin J2), PIN (Protein Inhibitor of Neuronal Nitric Oxide Synthase), PLA2 (Phospholipase A2), P1GF (Placenta Growth Factor), PLP (Proteolipid Protein), PP14 (Placental Protein 14), PS (Presenilin), PTEN (Protein Tyrosine Phosphatase and Tensin Homolog, see MMAC PTN Pleiotrophin), R51 (S. cerevisiae homolog of RAD51), RANK (Receptor Activator of NF-kappa-B), RANTES (Regulated upon activation, normal T cell Expressed and Secreted), Ret (Proto-oncogene Tyrosine-protein Kinase Receptor), RPA2 (Replication Protein A2), RSK (Ribosomal Protein S6 Kinase II), SCF/KL (Stem Cell Factor/KIT Ligand), SDF-1 (Stromal Cell- derived Factor 1 (aka PBSF)), sFRP-3 (Secreted Frizzled Related Protein), Shh (Sonic Hedgehog), SIGIRR (Single Ig Domain Containing IL-1 Receptor-related Molecule), SLAM (Signaling Lymphocytic Activation Molecule), SLPI (Secretory Leukocyte protease Inhibitor), SMAC (Second Mitochondria-derived Activator of Caspase), SMDF (Sensory and Motor Neuron-derived Factor), SOD (Superoxide Dismutase), SPARC (Secreted Protein Acidic and Rich in Cysteine), Stat (Signal Transducer and Activator of Transcription), TACE (TNF-α-Converting Enzyme), TACI (Transmembrane Activator and CAML Interactor), TARC (Thymus and Activation-regulated Chemokine), TCA-3 (a CC Chemokine), TECK (Thymus-expressed Chemokine), TERT (Telomerase Reverse Transcriptase), TfR (Transferrin Receptor), TGF (Transforming Growth Factor), Thymus Ck-1 (Thymus Chemokine 1), Tie (Tyrosine Kinase with Immunoglobulin and Epidermal Growth Factor Homology Domains), TIMP (Tissue Inhibitors of Metalloproteinases) TIQ (N-methyl-6,7-dihydroxytetrahydroisoquinoline), Tmpo (Thymopoietin), TNF-R (TNF- Receptor), TNF (Tumor Necrosis Factor), TP-1 (Trophoblast Protein-1), Tpo (Thrombopoietin), TRAIL (TNF-related Apoptosis-inducing Ligand), TRAIL R (TRAIL Receptor), TRANCE (TNF-related Activation-induced Cytokine), TRF (Telomeric Repeat Binding Factor), Trk (Neurotrophic Tyrosine Kinase Receptor), TROP-2 (Tumor Associated Calcium Signal Transducer), TSG (Twisted Gastrulation), TSLP (Thymic Stromal Lymphopoietin), TWEAK (TNF-like and Weak Inducer of Apoptosis), TXB2 (Thromboxane B2), Ung (Uracil-N-Glycosylase), uPAR (Urokinase-type Plasminogen Activator Receptor), uPAR-1 (Urokinase-type Plasminogen Activator Receptor 1), VCAM-1 (Vascular Cell Adhesion Molecule 1), VECAD (VE-Cadherin Vascular Epithelium Cadherin), VEGF (Vascular Endothelial Growth Factor), VEGI (Vascular Endothelial Growth Inhibitor), VIM (Vimentin), VLA-4 (Very Late Antigen-4), WIF-1 (Wnt Inhibitory Factor), XIAP (X-linked Inhibitor of Apoptosis) or XPD (Xeroderma Pigmentosum D).
13. The stem cell of Claim 1 or 2 or 3, wherein said heterologous DNA sequence encodes a protein selected from the group consisting of Bcl-2, Bcl-w and Bcl-xy, Bcl-2- associated athanogene 1, CCAAT/enhancer binding protein (C/EBP), empty spiracles homolog 1 (Drosophila), empty spiracles homolog 2 (Drosophila), forkhead box Gl, proprotein convertase subtilisin/kexin type 9, suppressor of cytokine signaling 2, T-cell leukemia, homeobox 1, T-cell leukemia, homeobox 3, insulin-like growth factor 1, neuregulin 1, neurotrophin 5, cut-like 1 (Drosophila), growth factor independent 1, mucolipin 3, mucosal vascular addressin cell adhesion molecule 1, tumor susceptibility gene 101, endothelin 3, endothelin receptor type B and/or a bone morphogenetic protein (BMP) such as BMP1, BMP2, BMP3 or BMP4.
14. The method of Claim 9 wherein the artificial chromosome is a human artificial chromosome.
15. Use of an isolated nucleic acid molecule comprising a nucleotide sequence corresponding to a neocentromeric region of human DNA and having a centromeric chromatin domain, said nucleic acid molecule further comprising a second nucleic acid molecule inserted within the centromere chromatin domain or immediately adjoining or proximal region and which second nucleic acid molecule is expressible and wherein the expression product alters the genetic potential of a stem cell or its daughter cells wherein the neocentromeric region comprises a q and p arm domain, CENP-H, HPl domain and a scaffold domain and comprises a gene selected from but not limited to hCG41809, hCG40976, hCG1811152, hCG1781464, hCG39839, hCG1781461, hCG40945, hCG1818126, hCG1811159, hCG40944, hCG40949, hCG39837, hCG40963, hCG40964.
16. A method differentiating a stem cell comprising introducing an artificial or engineered chromosome comprising a neocentromere having centromeric chromatin domains of mammalian, avian or plant or higher eukaryote DNA, said nucleic acid molecule comprising a heterologous nucleic acid molecule inserted within the centromeric chromatin domains or immediately adjoining or proximal region and which heterologous nucleic acid molecule is expressible or otherwise differentiates the stem cell.
17. A method for differentiating a stem cell comprising introducing into a stem cell a mammalian artificial or engineered chromosome comprising a neocentromere having centromeric chromatin domains of mammalian origin, said nucleic acid molecule comprising a heterologous nucleic acid molecule inserted within the centromeric chromatin domains or immediately adjoining or proximal region and which heterologous nucleic acid molecule is expressible or differentiates said stem cell.
18. The method of Claim 16 or 17, wherein said stem cell is selected from the group consisting of embryonic stem cells, somatic stem cells, germ stem cells, epidermal stem cells, adult neural stem cells, keratinocyte stem cells, melanocyte stem cells, adult renal stem cells, embryonic renal epithelial stem cells, embryonic endodermal stem cells, hepatocyte stem cells, mammary epithelial stem cells, bane marrow-derived stem cells, skeletal muscle stem cells, bone marrow mesenchymal stem cells, CD34+ hematopoietic stem cells, mesenchymal stem cells.
19. The method of Claim 16 or 17, wherein said stem cell differentiates into a cell selected from the group consisting of keratinocytes, fibroblasts, pancreatic islets, pancreatic β-cells, kidney epithelial cells, hepatocytes, bile duct epithelial cells, lung fibroblasts, bronchial epithelial cells, alveolar type II pneumocytes, cardiomyocytes, simple squamous epithelial cells, descending aortic endothelial cells, aortic arch endothelial cells, aortic smooth muscle cells, corneal epithelial cells, osteoblasts, peripheral blood mononuclear progenitor cells, osteoclasts, stromal cells, splenic precursor cells, splenocytes, CD4+ T-cells, CD8+ T-cells, NK cell, monocytes, macrophages, dendritic cells, B-cells, gablet cells, pseudostriated ciliated columnar cells, pseudostratified ciliated epithelium, stratified epithelial cells, ciliated columnar cells, basal cells, cricopharyngeus muscle cells.
20. The method of Claim 16 or 17, wherein said genetic material corresponds to a DNA sequence encoding a cytokine, growth factor or receptor selected from the group consisting of Activin RIA (Activin Receptor), ADAM (A Desintegrin and Metalloprotease-like Domain), ADAMTS (A Disintegrin-like and Metalloproteinase Domain with Thrombospondin Type I Motifs), ALCAM (Activated Leukocyte Cell Adhesion Molecule), ALK (Activin Receptor-like Kinase) ANG (Angiogenin), Ang (CC Chemokine Receptors), APAF-1 (Apoptosis Protease Activating Factor- 1), APE (AP Endonuclease), APJ (A Seven Transmembrane-domain Receptor), APP (Amyloid Precursor Protein), APRIL (a Proliferation-inducing Ligand), AR (Amphiregulin), ARC (Agouti-related Transcript), ART (Fibroblast Growth Factor), Axl (a Receptor Tyrosine Kinase),β2M (β 2 Microglobulin), B7-H (B7 Homolog), BACE (β-site APP Cleaving Enzyme), Bad (Bcl-xL/Bcl-2 Associated Death Promoter), BAFF (B cell Activating Factor), Bag-1 (Bcl-2-associated Anthandgene-1), BAK (Bcl-2 Antagonist/Killer), Bax (Bel Associated X Protein), BCA-1 (B-Cell-attracting Chemokine 1), BCAM (Basal-cell Adhesion Molecule), Bel (B-Cell Lymphoma/Leukemia), BCMA (B Cell Maturation Factor), BDNF (Brain-derived Neurotrophic Factor), β-ECGF (β Endothelial Cell Growth Factor), BID (BH3 Interacting Domain Death Agonist), Bik (Bcl-2 Interacting Killer), BIM (Bcl-2 Interacting Mediator of Cell Death), BLC (B-Lymphocyte Chemoattractant), BL-CAM (B-lymphocyte Cell Adhesion Molecule), BLK (Bik-like Killer Protein), BMP (Bone Morphogenetic Protein), BMPR (Bone Morphogenetic Protein Receptor), β-NGF (β Nerve Growth Factor), BOK (Bcl-2-related Ovarian Killer), BPDE (Benzo[a]Pyrene- Guanosine-BSA), BPDE-DNA (Benzo[a]Pyrene-Diol Epoxide-DNA), BTC (β cellulin), CIO (a Novel Mouse CC Chemokine), CAD-8 (Cadherin-8), cAMP (Cyclic AMP), Caspase (Caspase-1), CCI (CC Chemokine Inhibitor), CCL (CC Chemokine Ligands), CCR (CC Chemokine Receptors), CD (Cluster of Differentiation), CD30L (CD30 Ligand), CD40L (CD40 Ligand), CFTR (Cystic Fibrosis Transmembrane Conductance Regulator), cGMP (Cyclic GMP), CINC (Cytokine-induced Neutrophil Chemotactic Factor), CKβ8-l (Chemokine β 8-1), CLC (Cardiotrophin-like Cytokine), CMV UL (Cytomegalovirus ORFUL), CNTF (Ciliary Neurotrophic Factor), CNTN-1 (Contactin-1), COX (Cyclooxygenase), C-Ret (a Receptor Tyrosine Kinase), CRG-2 (a Mouse CXC Chemokine), CT-1 (Cardiotrophin 1), CTACK (Cutaneous T-cell Attracting Chemokine), CTGF (Connective Tissue Growth Factor), CTLA-4 (Cytotoxic T-lymphocyte-associated Molecule 4), CXCL (CXC Chemokine Ligands), CXCR (CXC Chemokine Receptors), DAN (Differential Screening-selected Gene Aberrant in Neuroblastoma), DCC (Deleted in Colorectal Cancer), DcR3 (Decoy Receptor 3), DC-SIGN (Dendritic Cell-specific ICAM- 3-grabbing Nonintegrin), Dhh (Desert Hedgehog), DNAM-1 (DNAX Accessory Molecule 1), Dpp (Decapentaplegic), DR (Death Receptor), Dtk (Developmental Tyrosine Kinase), ECAD (E-Cadherin), EDA (Ectodysplasin-A), EDAR (Ectodysplasin Receptor), EGF (Epidermal Growth Factor), EMMPRIN (Extracellular Matrix Metalloproteinase Inducer, CD147), ENA (Epithelial-derived Neutrophil Attractant), eNOS (Endothelial Nitric Oxide Synthase), Eot (Eotaxin Epo Erythropoietin), ErbB3 (Erb B3 Receptor Protein Tyrosine Kinase), ERCC (Excision Repair Cross-complementing), ET-1 (Endothelin- 1), Fas (Fibroblast-associated), FEN-1 (Flap Endonuclease), FGF (Fibroblast Growth Factor), FL (Fas Ligand FasL), FLIP (FLICE Inhibitory Proteins), Flt-3 (fins-like Tyrosine Kinase 3), Fractalkine, Gas 6 (Growth-arrest-specific Protein 6), GCP-2 (Granulocyte Chemotactic Protein 2), G-CSF (Granulocyte Colony Stimulating Factor), GDF (Growth Differentiation Factor), GDNF (Glial cell line-derived Growth Factor), GFAP (Flial Fibrillary Acidic Protein), GFRα-1 (Glial Cell Line-derived Neurotropic Factor Receptor 1), GITR (Glucocorticoid Induced TNF Receptor Family Related Gene), Glut 4 (Insulin Regulated Glucose Transporter Protein), GM-CSF (Granulocyte Macrophage Growth Factor), gpl30 (glycoprotein 130), GRO (Growth Related Protein α), HB-EGF (Heparin Binding Epidermal Growth Factor), HCC (Hemofiltrate CC Chemokine), HCMV UL (Human Cytomegalovirus ORFUL), HGF (Hepatocyte Growth Factor), HRG (Heregulin), Hrk (Harakiri HVEM Herpesvirus Entry Mediator), 1-309 (a human CC chemokine), IAP (Inhibitors of Apoptosis), ICAM (Intercellular Adhesion Molecule, ICOS (Inducible Co- stimulator), IFN (Interferon Ig Immunoglobulin), IGF (Insulin-like Growth Factor), IGFBP (Insulin-like Growth Factor Binding Protein), IL-la (hlnterleukin-la), hIL-lb (Interleukin- lb), hIL-2(Interleukin-2 ), hIL-3 (Interleukin-3), hIL-4 (Interleukin-4), hIL-5 (Interleukin- 5), hIL-6 (Interleukin-6), hIL-7 (Interleukin-7), hIL-10 (Interleukin-10), hIL-11 (Interleukin-11), hIL-12 (Interleukin-12), hIL-13 (Interleukin-13), hIL-15 (Interleukin-15), hIL-18 (Interleukin-18), iNOS (Inducible Nitric Oxide Synthase), IP-10 (Interferon gamma Inducible Protein 10), I-TAC (Interferon-inducible T-cell α Chemoattractant), JE (Mouse homologue of human MCP-1), KC (Mouse homologue of human GRO), KGF (Keratinocyte Growth Factor), LAMP (Limbic System-associated Membrane Protein), LAP (Latency-associated Peptide), LBP (Lipopolysaccharide-binding Protein), LDGF (Leukocyte-derived Growth Factor), LECT2 (Leukocyte Cell-Derived Chemotaxin 2), LFA-1 (Lymphocyte Function-associated Molecule- ILfo), Lfo (Lactoferrin), LIF (Leukemia Inhibitory Factor), LIGHT (Name derived from Homologous to Lymphotoxins, Inducible expression, competes with HSV Glycoprotein D for HVEM, a receptor expressed on T-lymphocytes), LIX (LPS-induced CXC Chemokine), LKN (Leukotactin), Lptn (Lymphotactin), LT-α (Lymphotoxin α (aka TNF-β)), LT-β (Lymphotoxin β (aka p33)), LTB4 (Leukotriene B4), LTBP-1 (Latent TGF-β bpl), MAG (Myelin-associated Glycoprotein), MAP2 (Microtubule-associated Protein 2), MARC (Mast Cell Activation- Related Chemokine), MCAM (Melanoma Cell Adhesion Molecule (aka MUC 18, CD 146)), MCK-2 (Mouse Cytomegalovirus Viral CC Chemokine Homolog 2), MCP (Monocyte Chemotactic Protein), M-CSF (Macrophage Colony Stimulating Factor), MDC (Macrophage-derived Chemokine (aka STP-1)), Mer (Tyrosine Protein Kinase), MGMT (O-6 Methylguanine-DNA Methyltransferase), MIF (Macrophage Migration Inhibitory Factor), MIG (Monokine Induced by IFN-g), MIP (Macrophage Inflammatory protein), MK (Midkine), MMAC1 (Mutated in Multiple Advanced Cancers Protein 1), MMP (Matrix Metalloproteinase), MPIF (Myeloid Progenitor Inhibitory Factor), Mpo (Myeloperoxidase), MSK (Mitogen- and Stress-activated Protein Kinase), MSP (Macrophage Stimulating Protein), Mug (Mismatch Uracil DNA Glycosylase), MuSK (Muscle-specific Kinase), NAIP (Neuronal Apoptosis Inhibitor Protein), NAP (Neutrophil Activation Protein), NCAD N-Cadherin (N-Cadherin Neural Cadherin), NCAM (Neural Cell Adhesion Molecule), nNOS (Neuronal Nitric Oxide Synthase), NO (Nitric Oxide), NOS (Nitric Oxide Synthase), Npn (Neuropilin), NRG-3 (Neuregulin-3), NT (Neurotrophin), NTN (Neurturin), OB (Leptin, product of the ob gene), OGG1 (8- oxoGuanine DNA Glycosylase), OPG (Osteoprotegerin), OPN (Osteopontin), OSM (Oncostatin M), PADPr (Poly (ADP-ribose) Polymer), PARC (Pulmonary and Activation-regulated Chemokine), PARP (Poly (ADP-ribose) Polymerase), PBR (Peripheral-type Benzodiazepine Receptorlnterleukin-la (hIL-la), Interleukin-lb (hIL-lb), Interleukin-2 (hIL-2), Interleukin-3 (hIL-3), Interleukin-4 (hIL-4), Interleukin-5 (hIL-5), Interleukin-6 (hIL-6), Interleukin-7 (hIL-7), Interleukin-10 (hIL-10), Interleukin-11 (hlL- 11), Interleukin-12 (hIL-12), Interleukin-13 (hIL-13), Interleukin-15 (hIL-15), Interleukin- 18 (hIL-18), PBSF (Pre-B Cell Growth Stimulating Factor (aka SDF-l)Interleukin-la (hIL-la), Interleukin-lb (hIL-lb), Interleukin-2 (hIL-2), Interleukin-3 (hIL-3), Interleukin- 4 (hIL-4), Interleukin-5 (hIL-5), Interleukin-6 (hIL-6), Interleukin-7 (hIL-7), Interleukin- 10 (hIL-10), Interleukin-11 (hIL-11), Interleukin-12 (hIL-12), Interleukin-13 (hIL-13), Interleukin-15 (hIL-15), Interleukin-18 (hIL-18), PC AD (P-Cadherin Placental Cadherin), PCNA (Proliferating Cell Nuclear Antigen), PDGF (Platelet-derived Growth Factor), PDK-1 (Phosphoinositide Dependent Kinase- 1), PEC AM (Platelet Endothelial Cell Adhesion Molecule), PF4 (Platelet Factor 4), PGE (Prostaglandin E), PGF (Prostaglandin F), PGI2 (Prostacyclin PGJ2 Prostaglandin J2), PIN (Protein Inhibitor of Neuronal Nitric Oxide Synthase), PLA2 (Phospholipase A2), P1GF (Placenta Growth Factor), PLP (Proteolipid Protein), PP14 (Placental Protein 14), PS (Presenilin), PTEN (Protein Tyrosine Phosphatase and Tensin Homolog, see MMAC PTN Pleiotrophin), R51 (S. cerevisiae homolog of RAD51), RANK (Receptor Activator of NF-kappa-B), RANTES (Regulated upon activation, normal T cell Expressed and Secreted),. Ret (Proto-oncogene Tyrosine-protein Kinase Receptor), RPA2 (Replication Protein A2), RSK (Ribosomal Protein S6 Kinase II), SCF/KL (Stem Cell Factor/KIT Ligand), SDF-1 (Stromal Cell- derived Factor 1 (aka PBSF)), sFRP-3 (Secreted Frizzled Related Protein), Shh (Sonic Hedgehog), SIGIRR (Single Ig Domain Containing IL-1 Receptor-related Molecule), SLAM (Signaling Lymphocytic Activation Molecule), SLPI (Secretory Leukocyte protease Inhibitor), SMAC (Second Mitochondria-derived Activator of Caspase), SMDF (Sensory and Motor Neuron-derived Factor), SOD (Superoxide Dismutase), SPARC (Secreted Protein Acidic and Rich in Cysteine), Stat (Signal Transducer and Activator of Transcription), TACE (TNF-α-Converting Enzyme), TACI (Transmembrane Activator and CAML Interactor), TARC (Thymus and Activation-regulated Chemokine), TCA-3 (a CC Chemokine), TECK (Thymus-expressed Chemokine), TERT (Telomerase Reverse Transcriptase), TfR (Transferrin Receptor), TGF (Transforming Growth Factor), Thymus Ck-1 (Thymus Chemokine 1), Tie (Tyrosine Kinase with Immunoglobulin and Epidermal Growth Factor Homology Domains), TIMP (Tissue Inhibitors of Metalloproteinases) TIQ (N-methyl-6,7-dihydroxytetrahydroisoquinoline), Tmpo (Thymopoietin), TNF-R (TNF- Receptor), TNF (Tumor Necrosis Factor), TP-1 (Trophoblast Protein- 1), Tpo (Thrombopoietin), TRAIL (TNF-related Apoptosis-inducing Ligand), TRAIL R (TRAIL Receptor), TRANCE (TNF-related Activation-induced Cytokine), TRF (Telomeric Repeat Binding Factor), Trk (Neurotrophic Tyrosine Kinase Receptor), TROP-2 (Tumor Associated Calcium Signal Transducer), TSG (Twisted Gastrulation), TSLP (Thymic Stromal Lymphopoietin), TWEAK (TNF-like and Weak Inducer of Apoptosis), TXB2 (Thromboxane B2), Ung (Uracil-N-Glycosylase), uPAR (Urokinase-type Plasminogen Activator Receptor), uPAR-1 (Urokinase-type Plasminogen Activator Receptor 1), VCAM-1 (Vascular Cell Adhesion Molecule 1), VECAD (VE-Cadherin Vascular Epithelium Cadherin), VEGF (Vascular Endothelial Growth Factor), VEGI (Vascular Endothelial Growth Inhibitor), VIM (Vimentin), VLA-4 (Very Late Antigen-4), WIF-1 (Wnt Inhibitory Factor), XIAP (X-linked Inhibitor of Apoptosis) or XPD (Xeroderma Pigmentosum D).
21. The method of Claim 16 or 17, wherein said heterologous DNA sequence encodes a protein selected from the group consisting of Bcl-2, Bcl-w and Bcl-xy, Bcl-2- associated athanogene 1, CCAAT/enhancer binding protein (C/EBP), empty spiracles homolog 1 (Drosophila), empty spiracles homolog 2 (Drosophila), forkhead box Gl, proprotein convertase subtilisin kexin type 9, suppressor of cytokine signaling 2, T-cell leukemia, homeobox 1, T-cell leukemia, homeobox 3, insulin-like growth factor 1, neuregulin 1, neurotrophin 5, cut-like 1 (Drosophila), growth factor independent 1, mucolipin 3, mucosal vascular addressin cell adhesion molecule 1, tumor susceptibility gene 101, endothelin 3, endothelin receptor type B and/or a bone morphogenetic protein (BMP) such as BMP1, BMP2, BMP3 or BMP4.
22. The method of Claim 16 or 17, wherein said artificial chromosome is a human artificial chromosome.
23. A method of treating a subject therapeutically or prophylactically comprising administering to said subject a stem cell of Claim 1 or a stem cell generated according to the method of any one of Claims 2 or 3 or 16 or 17.
24. The method of Claim 23, wherein said subject is a human.
PCT/AU2004/001469 2003-10-27 2004-10-25 Compositions and methods for differentiating stem cells WO2005040391A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2003905894 2003-10-27
AU2003905894A AU2003905894A0 (en) 2003-10-27 Compositions and methods for differentiating stem cells

Publications (1)

Publication Number Publication Date
WO2005040391A1 true WO2005040391A1 (en) 2005-05-06

Family

ID=34468641

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2004/001469 WO2005040391A1 (en) 2003-10-27 2004-10-25 Compositions and methods for differentiating stem cells

Country Status (1)

Country Link
WO (1) WO2005040391A1 (en)

Cited By (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005120547A1 (en) * 2004-06-11 2005-12-22 The Institute Of Cancer Research Use of neuregulin-3 for inducing mammary cell differentiation and for the treatment of breast cancer
WO2007060278A1 (en) * 2005-11-28 2007-05-31 Consejo Superior De Investigaciones Científicas Use of type ii pneumocytes in the treatment of pulmonary diseases associated with pulmonary fibrosis
US20080025953A1 (en) * 2006-07-25 2008-01-31 Kiminobu Sugaya Vigor Enhancement of Animals Via Administration of Stem Cells
CN100465279C (en) * 2006-03-30 2009-03-04 中国人民解放军第二军医大学 Prepn and application of epiderm or hair follicle stem cell from souce of human early embryo
WO2010099576A1 (en) * 2009-03-04 2010-09-10 Sydney West Area Health Service Compositions and methods for enhancing immune responses
EP2324023A1 (en) * 2006-11-28 2011-05-25 University Of Central Florida Vigor enhancement via administration of pyrimidine derivatives
CN103025155A (en) * 2010-05-24 2013-04-03 迪格纳生物技术公司 Composition for the cold storage of organs
US8791128B2 (en) 2008-09-16 2014-07-29 University Of Central Florida Research Foundation, Inc. Compositions for treating or delaying the onset of hair loss
WO2016083613A3 (en) * 2014-11-27 2016-08-18 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium
US20160326488A1 (en) * 2013-12-25 2016-11-10 Toagosei Co., Ltd. Method for inducing differentiation of pluripotent stem cells into endodermal cells
US9549914B2 (en) 2014-04-03 2017-01-24 The Johns Hopkins University Treatment of human cytomegalovirus by modulating Wnt
CN109517051A (en) * 2018-12-03 2019-03-26 洛阳轩智生物科技有限公司 Human epidermal stem cell induction is the method for corneal epithelial cell
CN110066863A (en) * 2019-05-22 2019-07-30 山西医科大学 A kind of identification method of BPDE adduction gene
US10421944B2 (en) 2015-09-29 2019-09-24 Toagosei Co. Ltd. Method for producing neural stem cells using synthetic peptide
US10441654B2 (en) 2014-01-24 2019-10-15 Children's Hospital Of Eastern Ontario Research Institute Inc. SMC combination therapy for the treatment of cancer
US10597633B2 (en) 2014-05-16 2020-03-24 Koninklijke Nederlandse Akademie Van Wetenschappen Culture method for organoids
US10894065B2 (en) 2012-12-21 2021-01-19 Astellas Institute For Regenerative Medicine Methods for production of platelets from pluripotent stem cells and compositions thereof
US10947510B2 (en) 2009-02-03 2021-03-16 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for epithelial stem cells and organoids comprising the stem cells
US10961511B2 (en) 2014-11-27 2021-03-30 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for expanding breast epithelial stem cells
JP2021048862A (en) * 2015-01-26 2021-04-01 フェイト セラピューティクス，インコーポレイテッド Cells with increased immuno-regulatory properties and methods for their use and manufacture
US11034935B2 (en) 2010-07-29 2021-06-15 Koninklijke Nederlandse Akademie Van Wetenschappen Liver organoid, uses thereof and culture method for obtaining them
CN113061176A (en) * 2021-03-12 2021-07-02 华中农业大学 Grass carp antimicrobial protein LECT2, and preparation method and application thereof
US11274279B2 (en) 2020-03-11 2022-03-15 Bit Bio Limited Method of generating hepatic cells
CN114209814A (en) * 2021-12-15 2022-03-22 南开大学 Application of TNFSF15 protein in promoting differentiation of bone marrow stem cells into macrophages and amplification
CN114317444A (en) * 2022-03-10 2022-04-12 北京大橡科技有限公司 Intestinal cancer organoid culture solution, culture reagent composition and culture method
US11566228B2 (en) 2006-04-14 2023-01-31 Astellas Institute For Regenerative Medicine Hemangio-colony forming cells
US11591572B2 (en) 2016-03-01 2023-02-28 Koninklijke Nederlandse Akademie Van Wetenschappen Differentiation method
US11642378B2 (en) 2015-07-21 2023-05-09 The Children's Medical Center Corporation PD-L1 expressing hematopoietic stem cells and uses
US11879137B2 (en) 2017-09-22 2024-01-23 The Children's Medical Center Corporation Treatment of type 1 diabetes and autoimmune diseases or disorders
US12076347B2 (en) 2018-05-08 2024-09-03 Astellas Institute For Regenerative Medicine Methods for production of platelets from pluripotent stem cells and compositions thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002067665A2 (en) * 2001-02-23 2002-09-06 Infigen, Inc. Cloning of transgenic animals comprising artificial chromosomes
US20020160970A1 (en) * 1996-04-10 2002-10-31 Gyula Hadlaczky Artificial chromosomes, uses thereof and methods for preparing artificial chromosomes
WO2004057006A1 (en) * 2002-12-23 2004-07-08 Murdoch Childrens Research Institute Genetic therapy and genetic modification using neocentromeric minichromosomes

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020160970A1 (en) * 1996-04-10 2002-10-31 Gyula Hadlaczky Artificial chromosomes, uses thereof and methods for preparing artificial chromosomes
WO2002067665A2 (en) * 2001-02-23 2002-09-06 Infigen, Inc. Cloning of transgenic animals comprising artificial chromosomes
WO2004057006A1 (en) * 2002-12-23 2004-07-08 Murdoch Childrens Research Institute Genetic therapy and genetic modification using neocentromeric minichromosomes

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005120547A1 (en) * 2004-06-11 2005-12-22 The Institute Of Cancer Research Use of neuregulin-3 for inducing mammary cell differentiation and for the treatment of breast cancer
WO2007060278A1 (en) * 2005-11-28 2007-05-31 Consejo Superior De Investigaciones Científicas Use of type ii pneumocytes in the treatment of pulmonary diseases associated with pulmonary fibrosis
ES2308877A1 (en) * 2005-11-28 2008-12-01 Consejo Superior Investig. Cientificas Use of type ii pneumocytes in the treatment of pulmonary diseases associated with pulmonary fibrosis
US9610305B2 (en) 2005-11-28 2017-04-04 Consejo Superior De Investigaciones Cientificas Method for using type II pneumocytes in pulmonary fibrosis
CN100465279C (en) * 2006-03-30 2009-03-04 中国人民解放军第二军医大学 Prepn and application of epiderm or hair follicle stem cell from souce of human early embryo
US11566228B2 (en) 2006-04-14 2023-01-31 Astellas Institute For Regenerative Medicine Hemangio-colony forming cells
US20080025953A1 (en) * 2006-07-25 2008-01-31 Kiminobu Sugaya Vigor Enhancement of Animals Via Administration of Stem Cells
EP2324023A1 (en) * 2006-11-28 2011-05-25 University Of Central Florida Vigor enhancement via administration of pyrimidine derivatives
EP2324023A4 (en) * 2006-11-28 2011-12-28 Vigor enhancement via administration of pyrimidine derivatives
US8791128B2 (en) 2008-09-16 2014-07-29 University Of Central Florida Research Foundation, Inc. Compositions for treating or delaying the onset of hair loss
US10947510B2 (en) 2009-02-03 2021-03-16 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for epithelial stem cells and organoids comprising the stem cells
WO2010099576A1 (en) * 2009-03-04 2010-09-10 Sydney West Area Health Service Compositions and methods for enhancing immune responses
CN103025155A (en) * 2010-05-24 2013-04-03 迪格纳生物技术公司 Composition for the cold storage of organs
CN103025155B (en) * 2010-05-24 2015-03-18 迪格纳生物技术公司 Composition for the cold storage of organs
US11034935B2 (en) 2010-07-29 2021-06-15 Koninklijke Nederlandse Akademie Van Wetenschappen Liver organoid, uses thereof and culture method for obtaining them
US11400118B2 (en) 2012-12-21 2022-08-02 Astellas Institute For Regenerative Medicine Methods for production of platelets from pluripotent stem cells and compositions thereof
US10894065B2 (en) 2012-12-21 2021-01-19 Astellas Institute For Regenerative Medicine Methods for production of platelets from pluripotent stem cells and compositions thereof
US10100284B2 (en) * 2013-12-25 2018-10-16 Toagosei Co. Ltd. Method for inducing differentiation of pluripotent stem cells into endodermal cells
US20160326488A1 (en) * 2013-12-25 2016-11-10 Toagosei Co., Ltd. Method for inducing differentiation of pluripotent stem cells into endodermal cells
US10441654B2 (en) 2014-01-24 2019-10-15 Children's Hospital Of Eastern Ontario Research Institute Inc. SMC combination therapy for the treatment of cancer
US9549914B2 (en) 2014-04-03 2017-01-24 The Johns Hopkins University Treatment of human cytomegalovirus by modulating Wnt
US10597633B2 (en) 2014-05-16 2020-03-24 Koninklijke Nederlandse Akademie Van Wetenschappen Culture method for organoids
US11725184B2 (en) 2014-05-16 2023-08-15 Koninklijke Nederlandse Akademie Van Wetenschappen Culture method for organoids
US10961511B2 (en) 2014-11-27 2021-03-30 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium for expanding breast epithelial stem cells
US11130943B2 (en) 2014-11-27 2021-09-28 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium
AU2015352351B2 (en) * 2014-11-27 2021-12-23 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium
WO2016083613A3 (en) * 2014-11-27 2016-08-18 Koninklijke Nederlandse Akademie Van Wetenschappen Culture medium
JP2021048862A (en) * 2015-01-26 2021-04-01 フェイト セラピューティクス，インコーポレイテッド Cells with increased immuno-regulatory properties and methods for their use and manufacture
AU2021202391B2 (en) * 2015-01-26 2023-10-12 The Children’s Hospital Corporation Cells with increased immuno-regulatory properties and methods for their use and manufacture
JP7304844B2 (en) 2015-01-26 2023-07-07 ザ チルドレンズ ホスピタル コーポレイション Cells with increased immunomodulatory properties and methods for their use and manufacture
US11642378B2 (en) 2015-07-21 2023-05-09 The Children's Medical Center Corporation PD-L1 expressing hematopoietic stem cells and uses
US10421944B2 (en) 2015-09-29 2019-09-24 Toagosei Co. Ltd. Method for producing neural stem cells using synthetic peptide
US11591572B2 (en) 2016-03-01 2023-02-28 Koninklijke Nederlandse Akademie Van Wetenschappen Differentiation method
US11879137B2 (en) 2017-09-22 2024-01-23 The Children's Medical Center Corporation Treatment of type 1 diabetes and autoimmune diseases or disorders
US12076347B2 (en) 2018-05-08 2024-09-03 Astellas Institute For Regenerative Medicine Methods for production of platelets from pluripotent stem cells and compositions thereof
CN109517051A (en) * 2018-12-03 2019-03-26 洛阳轩智生物科技有限公司 Human epidermal stem cell induction is the method for corneal epithelial cell
CN109517051B (en) * 2018-12-03 2020-10-16 拉菲尔(深圳)投资咨询有限公司 Method for inducing human epidermal stem cells into corneal epithelial cells
CN110066863B (en) * 2019-05-22 2023-01-31 山西医科大学 Identification method of BPDE addition gene
CN110066863A (en) * 2019-05-22 2019-07-30 山西医科大学 A kind of identification method of BPDE adduction gene
US11274279B2 (en) 2020-03-11 2022-03-15 Bit Bio Limited Method of generating hepatic cells
CN113061176B (en) * 2021-03-12 2022-08-16 华中农业大学 Grass carp antimicrobial protein LECT2, and preparation method and application thereof
CN113061176A (en) * 2021-03-12 2021-07-02 华中农业大学 Grass carp antimicrobial protein LECT2, and preparation method and application thereof
CN114209814A (en) * 2021-12-15 2022-03-22 南开大学 Application of TNFSF15 protein in promoting differentiation of bone marrow stem cells into macrophages and amplification
CN114209814B (en) * 2021-12-15 2024-02-23 南开大学 Application of TNFSF15 protein in promoting differentiation of bone marrow stem cells into macrophages and expansion
CN114317444A (en) * 2022-03-10 2022-04-12 北京大橡科技有限公司 Intestinal cancer organoid culture solution, culture reagent composition and culture method

Similar Documents

Publication Publication Date Title
WO2005040391A1 (en) Compositions and methods for differentiating stem cells
JP3333902B2 (en) Transgenic animals, cells and cell lines obtained therefrom, and uses thereof
JP4015183B2 (en) Isolation, selection, and expansion of animal transgenic stem cells
US20050066375A1 (en) Cell and transgenic animal modelling human antigenic presentation and their uses
CA2128862C (en) Homogenotization of gene-targeting events
JP3734831B2 (en) Homologous recombination for universal donor cells and chimeric mammalian hosts
US5416260A (en) Homologous recombination for universal donor cells and chimeric mammalian hosts
US5413923A (en) Homologous recombination for universal donor cells and chimeric mammalian hosts
US11234421B2 (en) Genetically modified non-human animal with human or chimeric IL15
KR102190661B1 (en) Non-human animals with disruption at the C9ORF72 locus
Gilchrist et al. Labeling of hematopoietic stem and progenitor cells in novel activatable EGFP reporter mice
JP4890269B2 (en) Modified cells co-expressing Blimp1 and reporter molecule and methods of use thereof
Furuta et al. Recent innovations in tissue‐specific gene modifications in the mouse
JP4033390B2 (en) Immortalized natural killer cell line
CA2131433A1 (en) Mice deficient in neurotrophin receptors
Miles Expression of the Ly-6e. 1 (Sca-1) gene in transgenic mice for the study of haematopoietic stem cells during development
WO2024163650A1 (en) Animals comprising a modified klhdc7b locus
US20040115803A1 (en) Transgenic cells and animals for the study of the polarization of the immune response
Casola et al. Sergei B. Koralov, Jane Seagal, Zhenyue Hao, Ari Waisman, Angela Egert, Dvora Ghitza, and Klaus Rajewsky
WO2004057006A1 (en) Genetic therapy and genetic modification using neocentromeric minichromosomes
Korets-Smith Embryonic stem cell-based technology to study gene function in the mouse
Zhang Activation of the megakaryocyte/platelet-specific gene platelet basic protein (PBP) by the ETS family factor PU. 1
Flores-Garcia Transcriptional regulation of the platelet-derived growth factor alpha receptor (PDGFRA) gene during development
Alvarez The accessibility model of V (D) J recombination: Insights from TCR (beta)-chain transgenic mice and SATB1-deficient mice
Tzouanacou Genetic and cellular approaches for the analysis of anteroposterior axis development in mouse

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DPEN Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase