CN113061176B

CN113061176B - Grass carp antimicrobial protein LECT2, and preparation method and application thereof

Info

Publication number: CN113061176B
Application number: CN202110267641.3A
Authority: CN
Inventors: 张永安; 张旭杰; 胡亚珍
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2021-03-12
Filing date: 2021-03-12
Publication date: 2022-08-16
Anticipated expiration: 2041-03-12
Also published as: CN113061176A

Abstract

The invention discloses a grass carp antimicrobial protein LECT2, a preparation method and an application thereof, belonging to the technical field of genetic engineering, wherein the amino acid sequence of the grass carp antimicrobial protein LECT2 is shown in SEQ ID NO. 1. The invention adopts Escherichia coli BL21(DE3) Rosetta to express grass carp antimicrobial protein LECT2, and uses Ni to make it pass through ²⁺ And (3) obtaining LECT2 recombinant protein after TED sepharose gel column purification, enterokinase enzyme digestion and ion exchange chromatography purification, and finding that the LECT2 protein has obvious bactericidal effect on gram-negative bacteria and gram-positive bacteria, and can be used for preparing broad-spectrum antibacterial agents or antibacterial drugs to protect grass carp from bacterial infection. By injecting the antibacterial agent into the body of the infected grass carp, the resistance of the grass carp to bacterial infection is obviously enhanced, the survival rate of the grass carp is improved, the bacterial carrying capacity in each tissue is reduced, and the antibacterial agent has high application value.

Description

Grass carp antimicrobial protein LECT2, and preparation method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to grass carp antimicrobial protein LECT2, and a preparation method and application thereof.

Background

With the development of aquaculture industry, the problem of antibiotic resistance is increasingly serious due to continuous use of antibiotics, and the sustainable development of aquaculture industry is seriously influenced. Therefore, the development of new antibacterial drugs to replace traditional antibiotics in aquaculture industry is urgent. Antibacterial peptides (also called Antimicrobial peptides), antibiotic peptides (Antibiotics peptides)) and Antibacterial proteins are polypeptides or proteins which are produced by encoding specific genes of various biological cells and have the activity of broad-spectrum Antibacterial, antifungal, viral, protozoal, tumor cell inhibition and killing and the like. The compound has the characteristics of thermal stability, difficult acquisition of drug resistance, stable effect and the like, and is considered to have wide application prospect for disease prevention and control.

The mammalian Leukocyte-derived chemokine 2 (LECT 2) belongs to the metallopeptidase M23 family, is a multifunctional cytokine secreted by the liver, and is involved in biological processes such as regulation of liver regeneration, maintenance of natural killer T cell homeostasis and cell canceration; in addition, LECT2 regulates the cellular immune response of the body by participating in the directional chemotaxis of immune cells and the activation of phagocyte.

Disclosure of Invention

The invention aims to provide a grass carp antimicrobial protein LECT2, and a preparation method and application thereof. The invention discovers for the first time that the LECT2 protein derived from grass carp has broad-spectrum antibacterial activity and can be used for preparing broad-spectrum antibacterial agents to protect cultured fishes from bacterial infection.

The invention aims to provide grass carp antimicrobial protein LECT2, the amino acid sequence of which is shown in SEQ ID NO. 1.

The other purpose of the invention is to provide a gene for coding the grass carp antimicrobial protein LECT2, and the nucleotide sequence of the gene is shown as SEQ ID NO. 2.

It is a further object of the present invention to provide a vector comprising the above nucleotide sequence.

The fourth purpose of the invention is to provide an engineering bacterium, and the engineering bacterium comprises the carrier.

The fifth purpose of the invention is to provide the application of the grass carp antimicrobial protein LECT2 in preparing antibacterial drugs or antibacterial agents.

Further, the antibacterial drug or agent is useful against gram-negative bacteria and/or gram-positive bacteria.

Further, the gram-negative bacteria include: coli (Escherichia coli), Pseudomonas fluorescens p. fluoroscens, Vibrio mimicus v. mimicus (Vibrio mimicus), and Aeromonas hydrophila a. hydrophila (Aeromonas hydrophila);

the gram-positive bacteria include: staphylococcus aureus (Staphylococcus aureus), Streptococcus agalactiae (Streptococcus agalactiae), and Micrococcus luteus (Micrococcus luteus).

The invention also provides a preparation method of the grass carp antimicrobial protein LECT2, which comprises the following steps:

1, cloning a grass carp LECT2 gene;

step 2, connecting the grass carp LECT2 gene with a vector, and converting the grass carp LECT2 gene into an expression strain to obtain recombinant engineering bacteria;

and 3, inducing the recombinant engineering bacteria to express the target protein, and purifying the target protein to obtain the grass carp antibacterial protein LECT 2.

Further, in the step 1, the grass carp LECT2 gene is obtained by carrying out PCR amplification by using grass carp cDNA as a template and using an upstream primer shown in SEQ ID NO. 3 and a downstream primer shown in SEQ ID NO. 4.

Further, in the step 2, the grass carp LECT2 gene is connected with pET-32a plasmid and transformed into BL21(DE3) Rosetta expression strain to obtain recombinant engineering bacteria.

Further, in the step 3, the recombinant engineering bacteria are induced to express the target protein through Ni ²⁺ Purifying by a TED agarose gel column to obtain TrxA-LECT2 fusion protein, digesting by enterokinase, and purifying by ion exchange chromatography to obtain grass carp antimicrobial protein LECT2 shown in SEQ ID NO. 1.

Compared with the prior art, the invention has the beneficial effects that: the invention adopts Escherichia coli BL21(DE3) Rosetta to express grass carp antimicrobial protein LECT2, and uses Ni to make it pass through ²⁺ The method is characterized in that a TED sepharose gel column is purified, enterokinase digestion is carried out, ion exchange chromatography purification is carried out, and then LECT2 recombinant protein is obtained, and the fact that the recombinant protein LECT2 has obvious sterilization effects on gram-negative bacteria and gram-positive bacteria is found, namely the recombinant protein has broad-spectrum antibacterial activity, can be used for preparing broad-spectrum antibacterial agents or antibacterial drugs to protect cultured fishes from bacterial infection, the resistance of the grass carps to the bacterial infection is obviously enhanced by injecting the recombinant protein into grass carps with the bacterial infection, the survival rate of the grass carps is improved, the bacterial load in each tissue is reduced, and the antibacterial protein LECT2 has high application value.

Drawings

FIG. 1 is a diagram showing the results of the purification and detection of LECT2 recombinant protein in example 1 of the present invention, wherein the ratio of lane M: protein Marker; lane 1: TrxA-LECT2 fusion protein; lane 2: TrxA-LECT2 enzyme digestion product; lane 3: purified LECT2 recombinant protein;

fig. 2 is the survival rate statistical result of the infected grass carp in example 3 of the present invention injected with LECT2 protein, wherein fig. a is the survival rate statistical result of 3h injected with LECT2 protein and the control group after infection, and fig. B is the survival rate of 12h injected with LECT2 protein and the control group after infection;

fig. 3 is a result of statistics of bacterial loads of different tissues after injecting LECT2 protein into grass carp infected with the present invention in example 3, where Head-kidney is a result of statistics of bacterial loads of Head and kidney tissues, Intestine is a result of statistics of bacterial loads of intestinal tissues, Liver is a result of statistics of bacterial loads of Liver tissues, and streen is a result of statistics of bacterial loads of Spleen tissues.

Detailed Description

The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1 preparation of grass carp LECT2 recombinant protein

(1) Grass carp LECT2 gene amplification

According to the gene sequence of grass carp LECT2 on NCBI and the multiple cloning site on pET-32a vector, Primer Premier 5.0 software is used to design specific primers with Kpn I and EcoR I enzyme cutting sites and enterokinase enzyme cutting sites, wherein an upstream Primer (shown as SEQ ID NO: 3) and a downstream Primer (shown as SEQ ID NO: 4) are respectively:

Up:cgg ^a ggtacc ^b gacgacgacgacaag ^c AGTCGAGTGAAATTTGGCACC，

Down:ccg ^d gaattc ^e TCAAAAATACTTGGTGGGATCTGA。

wherein ^a And ^d represents a protective base of a restriction enzyme site, ^b and ^e respectively represent Kpn I and EcoR I enzyme cutting sites, ^c representing an enterokinase cleavage site.

The target gene LECT2 (the gene does not contain a signal peptide sequence) shown in SEQ ID NO. 2 is cloned by taking grass carp cDNA as a template, and a PCR product is recovered by using a PCR product recovery kit.

(2) BL21-pET-32a-LECT2 engineering bacteria

After the PCR recovery product in the step (1) and the pET-32a plasmid are subjected to double enzyme digestion through Kpn I and EcoR I, the enzyme digestion products are connected by using T4 DNA ligase, and then the enzyme digestion products are transformed into DH5 alpha competent cells, and positive clones are screened and sequenced. The strain with correct sequencing is transformed into BL21(DE3) Rosetta expression strain, and the positive clone is engineering bacterium (BL21-pET-32a-LECT2) containing pET-32a-LECT2 recombinant plasmid.

(3) Prokaryotic expression and purification of TrxA-LECT2 fusion protein

1) Preparation of binding buffer a, pH 7.4: 3.8mM Na ₂ HPO ₄ ，16.2mM NaH ₂ PO ₄ 300mM NaCl, 15mM imidazole, 10% glycerol; wash buffer B, pH 7.4: 3.8mM Na ₂ HPO ₄ ，16.2mM NaH ₂ PO ₄ 300mM NaCl, 50mM imidazole, 10% glycerol; elution buffer C, pH 7.4: 3.8mM Na ₂ HPO ₄ ，16.2mM NaH ₂ PO ₄ 300mM NaCl, 300mM imidazole, 10% glycerol.

2) The engineered bacterium BL21-pET-32a-LECT2 was inoculated into LB medium containing ampicillin (100. mu.g/mL) and kanamycin (15. mu.g/mL), and shake-cultured at 37 ℃ to OD ₆₀₀ When the concentration was 0.6, IPTG was added to a final concentration of 0.75mM, and the induction culture was carried out at 16 ℃ for 12 hours.

3) The cells (5000g, 10min) were collected by centrifugation and resuspended in 50mL of precooled A, crushed at high pressure for 10min and then centrifuged at 12000g for 60min, and the supernatant was collected.

4)100mL of solution A balance Ni ²⁺ And (3) incubating the supernatant and the purified filler for 1h at room temperature, washing with 200mL of solution A, washing with 200mL of solution B, and eluting the target protein with 20mL of solution C. The eluted target protein was dialyzed against buffer D (3.8mM Na) using an imidazole gradient, sodium chloride and glycerol gradient ₂ HPO ₄ ，16.2mM NaH ₂ PO ₄ 50mM NaCl, 2.5% glycerol, pH 7.4) to obtain a TrxA-LECT2 fusion protein fused with a TrxA tag.

(4) Purification of LECT2 recombinant protein

1) Preparation of binding buffer a, pH 7.4: 3.8mM Na ₂ HPO ₄ ，16.2mM NaH ₂ PO ₄ (ii) a Elution buffer B, pH 7.4: 3.8mM Na ₂ HPO ₄ ，16.2mM NaH ₂ PO ₄ ，1M NaCl。

2) And (2) mixing the enterokinase and TrxA-LECT2 fusion protein according to the volume ratio of 1: 1000, and performing enzyme digestion on the TrxA-LECT2 fusion protein for 9h to obtain an enzyme digestion product.

3) The method for purifying LECT2 protein by using an AKTA protein purification system and a HiTrap SP HP ion exchange column comprises the following steps: 100mL of A solution is used for balancing an ion exchange column, a TrxA-LECT2 fusion protein enzyme digestion product is combined with the ion exchange column at the flow rate of 0.5mL/min, 90% of A solution and 10% of B solution are mixed for impurity washing, and 70% of A solution and 30% of B solution are mixed for eluting LECT2 recombinant protein. And dialyzing the eluted target protein in solution A containing 15mM NaCl and 0mM NaCl for 12h in sequence, and performing ultrafiltration concentration to obtain LECT2 recombinant protein. The purification results of LECT2 recombinant protein are shown in FIG. 1, wherein the molecular weight of Lane M: protein Marker; lane 1: TrxA-LECT2 fusion protein; lane 2: TrxA-LECT2 enzyme digestion product; lane 3: purified LECT2 recombinant protein. The amino acid sequence of LECT2 recombinant protein is shown in SEQ ID NO. 1, and the nucleotide sequence for coding the protein is shown in SEQ ID NO. 2.

Example 2 detection of grass carp LECT2 protein in vitro antibacterial Activity

This example exemplifies a total of 7 gram-positive bacteria and gram-negative bacteria commonly found in the art to verify the in vitro broad-spectrum antibacterial activity of grass carp LECT2 protein, which includes: gram-positive bacteria: staphylococcus aureus s.aureus, streptococcus agalactiae s.agalactiae, micrococcus luteus m.luteus; gram-negative bacteria: coli, pseudomonas fluorescens, vibrio mimicus V.mimicus, aeromonas hydrophila A.hydrophila.

(1) Minimum Bactericidal Concentration (MBC) detection

1) Streaking 7 strains which are frozen and preserved at minus 80 ℃ on a TSA plate, and culturing for 18-24h at 37 ℃ (Escherichia coli, Pseudomonas fluorescens, Staphylococcus aureus, Streptococcus agalactiae and Micrococcus luteus) or 28 ℃ (Vibrio mimicus, Aeromonas hydrophila); selecting a single colony on a TSA plate, inoculating the single colony into 20mL of TSB culture medium, shaking to a logarithmic phase (3-5h), and centrifuging (5000g, 10min) to collect thalli;

2) the bacteria were washed twice (5000g, 10min) with 20mM Tris (pH 7.4) and resuspended to 5X 10 concentration ⁶ CFU/mL。

3) And (3) uniformly mixing 10 mu L of the bacterial liquid obtained in the step 2) with 90 mu L of LECT2 protein with different concentrations, incubating for 3h at 37 ℃ or 28 ℃, and counting the bacterial amount of each group by a CFU counting method.

4) The bacteriostatic rate was calculated according to the following formula:

the bacteriostasis rate is (number of negative control colony-number of experimental group colony)/number of negative control colony multiplied by 100%

The lowest protein concentration with the bacteriostasis rate more than 99 percent is the MBC, and the detection result is shown in Table 1.

TABLE 1 antibacterial Activity test results of LECT2 protein

According to the detection results in table 1, the LECT2 protein has good bactericidal activity on gram-positive bacteria and gram-negative bacteria, namely has good broad-spectrum antibacterial activity, and can be used for preparing antibacterial agents.

Example 3 application of grass carp antimicrobial protein LECT2

(1) Laboratory animal

The grass carp used in the test is 30 +/-5 g, purchased from a Bairong fine breed center farm in Jufeng county, Huanggang, Hubei, and raised in the aquaculture base of the aquatic institute of Huazhong agricultural university, and the formal test is started by random grouping after temporary culture for 2 weeks. During the temporary culture period, the feed is fed for 1 time, the water is changed for 1 time and the oxygenation is carried out for 24 hours, and the daily feeding amount is 2 percent of the physique amount.

(2) Establishment of abdominal cavity infection model

Taking aeromonas hydrophila as an example, a grass carp abdominal cavity infection model is established, and the method specifically comprises the following steps: taking an aeromonas hydrophila strain (ZYAH72) which is frozen and preserved at the temperature of-80 ℃, streaking and inoculating the aeromonas hydrophila strain on a TSA plate, and culturing the aeromonas hydrophila strain for 18-24h at the temperature of 28 ℃; selecting single colony on TSA plate, inoculating into 20mL TSB culture medium, shaking to logarithmic phase (3-5h), and centrifuging (5000g, 10 min); will be provided withIt was suspended in sterile PBS at 5X 10 ⁵ CFU/Tail, 1 × 10 ⁶ CFU/Tail, 2X 10 ⁶ CFU/Tail and 4X 10 ⁶ And C, injecting the bacterial liquid into the abdominal cavity at four concentrations of CFU/tail respectively, infecting 20-tailed grass carps at each concentration, observing and recording death conditions within 4 days after injection is finished, and selecting the bacterial liquid dosage corresponding to a grass carp 100% mortality group to establish an abdominal cavity infection model. The minimal lethal dose of Aeromonas hydrophila in the experiment was finally determined to be 2X 10 ⁶ CFU/tail.

(3) Therapeutic effect of LECT2 recombinant protein on grass carp diseases

Water temperature of 28 ℃ and 2X 10 of the minimum lethal dose in step (2) ⁶ CFU/tail infected grass carp, LECT2 recombinant protein (30 μ g/tail) was intraperitoneally injected 3h or 12h after infection, respectively, and blank PBS was injected 3h or 12h after infection of bacteria in control group. After continuously observing for 7 days, the death condition is counted and the survival rate is calculated, and the statistical result of the survival rate is shown in figure 2, wherein, a figure A is the statistical result of the survival rate of the control group and the LECT2 protein which is injected 3h after infection, and a figure B is the survival rate of the control group and the LECT2 protein which is injected 12h after infection. The results show that the incidence rate of the experimental group injected with LECT2 recombinant protein is remarkably reduced, the average survival rate of the 3h and 12h injection groups is 56% and 68% respectively, while the control group injected with blank PBS liquid is completely killed within 3d, which indicates that the injection of LECT2 recombinant protein can remarkably enhance the resistance of grass carp to aeromonas hydrophila infection and improve the average survival rate.

And (3) anaesthetizing the grass carps by using MS-222 48h after the grass carps are infected and injected with LECT2 recombinant protein, taking head kidneys, intestinal tracts, livers and spleens, diluting and homogenizing by PBS, uniformly coating the tissue liquid on the surface of an RS agar culture medium, incubating at the constant temperature of 28 ℃ for 24h, counting colonies, and taking the colony counting result of the grass carps tissue injected with the PBS as a control. The detection results are shown in fig. 3, wherein Head-kidney is the statistical result of the bacterial load of the Head and kidney tissues, Intestine is the statistical result of the bacterial load of the intestinal tissues, Liver is the statistical result of the bacterial load of the Liver tissues, and Spleen is the statistical result of the bacterial load of the Spleen tissues. The results show that the bacterial load of each tissue of the grass carp is obviously reduced after LECT2 protein is injected into the body of the infected grass carp, wherein the head kidney is reduced by 10-1000 times, and the intestinal tract, the liver and the spleen are reduced by 100-1000 times. The result shows that the LECT2 protein also has strong bactericidal effect in grass carp bodies, so that the LECT2 protein can be prepared into antibacterial drugs for treating diseases caused by bacterial infection.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are included in the scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

<120> grass carp antimicrobial protein LECT2, and preparation method and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 136

<212> PRT

<213> grass carp (Ctenophagogon idella)

<400> 1

Ser Arg Val Lys Phe Gly Thr Leu Cys Ser Arg Asn Pro Ser Asn Arg

1 5 10 15

Gln Arg Gly Cys Asp Lys Lys Tyr Gly Cys Gly His Tyr Gly Ala Lys

20 25 30

Arg Gly Asn Arg Lys His Met Gly Leu Asp Ile Met Cys Ala Asp Gly

35 40 45

Asp Thr Val Val Ala Pro Phe Asp Val Lys Leu Asn Gly Arg Ser Met

50 55 60

Pro Tyr Ser Gln Asn Asn Ala Ile Asn Asp Gly Ile Asn Leu Ser Gly

65 70 75 80

Gln Gly Leu Cys Phe Lys Leu Phe Tyr Val Lys Pro Asp Arg Tyr Ser

85 90 95

Gly Thr Leu Lys Lys Gly Gln Arg Ile Gly Arg Met Leu Pro Met Gln

100 105 110

Arg Val Tyr Pro Gly Ile Thr Ser His Val His Val Gln Met Cys Asp

115 120 125

Arg Ser Asp Pro Thr Lys Tyr Phe

130 135

<210> 2

<211> 411

<212> DNA

<213> grass carp (Ctenophagogon idella)

<400> 2

agtcgagtga aatttggcac cctctgcagt cgtaacccaa gtaaccgtca aagaggatgt 60

gataaaaagt atggctgtgg acactatgga gccaagcgtg ggaatcggaa acatatgggt 120

cttgacatta tgtgtgctga tggagacaca gttgttgctc catttgatgt gaagttgaac 180

ggcagatcta tgccatactc acagaacaac gctatcaatg atggcattaa cttgagcgga 240

caaggtctct gcttcaagct gttctacgtt aagccagacc gttactctgg gaccctaaag 300

aaagggcaga ggatcggacg tatgctccca atgcagaggg tttatcctgg catcacttcc 360

catgttcacg ttcaaatgtg tgacagatca gatcccacca agtatttttg a 411

<210> 3

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cggggtaccg acgacgacga caagagtcga gtgaaatttg gcacc 45

<210> 4

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccggaattct caaaaatact tggtgggatc tga 33

Claims

1. The application of the grass carp antimicrobial protein LECT2 in preparing antibacterial drugs or antibacterial agents is characterized in that the amino acid sequence of the grass carp antimicrobial protein LECT2 is shown as SEQ ID NO:1, and the antibacterial drugs or the antibacterial agents are used for resisting gram-negative bacteria and/or gram-positive bacteria.

2. Use according to claim 1, wherein the gram-negative bacteria comprise: escherichia coli, fluorescent Pseudomonas fluorescens, Vibrio mimicus, and Aeromonas hydrophila;

the gram-positive bacteria include: staphylococcus aureus, streptococcus agalactiae and micrococcus luteus.