CN116098233A

CN116098233A - Functional feed additive for preventing and treating acute hepatopancreatic necrosis of prawns and application thereof

Info

Publication number: CN116098233A
Application number: CN202211357289.3A
Authority: CN
Inventors: 谷晓倩; 刘梅; 王雷; 王宝杰; 蒋克勇
Original assignee: Shandong Academy Of Marine Sciences Qingdao National Marine Science Research Center; Institute of Oceanology of CAS
Current assignee: Shandong Academy Of Marine Sciences Qingdao National Marine Science Research Center; Institute of Oceanology of CAS
Priority date: 2022-11-01
Filing date: 2022-11-01
Publication date: 2023-05-12

Abstract

The invention relates to feed preparation, in particular to a functional feed additive and application thereof in preventing and treating acute hepatopancreatic necrosis of prawns. The functional feed additive is a recombinant protein of LvFABP. The additive is a recombinant protein of LvFABP shown in SEQ ID NO. 1, and the additive amount is 10mg/kg. The preparation method of the functional feed additive takes litopenaeus vannamei as an object, clones to obtain an LvFABP full-length coding sequence, connects an LvFABP coding gene to a pET-30 (a) vector, carries out heterologous high-efficiency expression in engineering bacteria E.coli BL21 (DE 3), adopts a Ni-NTA chromatographic column to carry out protein purification on recombinant LvFABP, and obtains recombinant prawn fatty acid binding protein LvFABP. The in vitro recombinant protein of LvFABP can effectively delay the occurrence of diseases and reduce the death rate after being added into feed. Compared with dsRNA, the LvFABP expressed by in vitro recombination has greater advantages in preparation, preservation and application, can be used as a specific functional feed additive for preventing and treating AHPND, and has wider industrialized application prospect.

Description

Functional feed additive for preventing and treating acute hepatopancreatic necrosis of prawns and application thereof

Technical Field

The invention relates to feed preparation, in particular to a functional feed additive and application thereof in preventing and treating acute hepatopancreatic necrosis of prawns.

Background

Litopenaeus vannamei (Litopenaeus vannamei) is also called as Penaeus vannamei, and has become an important aquaculture variety in China due to the advantages of rich nutrition, delicious meat taste, high growth speed, wide salinity range and the like ^[1] . The total yield of the Litopenaeus vannamei in 2020 China is 186.3 ten thousand, accounting for 86.54 percent of the total yield of the Litopenaeus vannamei ^[2] However, in recent years, due to the high-density intensive culture mode, bacterial diseases have caused serious harm to the culture and production of the litopenaeus vannamei, and the large-scale litopenaeus vannamei dies, so that the healthy development of the prawn culture industry is severely restricted ^[3] 。

Acute hepatopancreatic necrosis (Acute hepatopancreatic necrosis disease, AHPND) is the major bacterial disease in the current culture of Litopenaeus vannamei ^[4] The disease mainly infects shrimp fries about 10-40d, also called early death syndrome (Early mortality syndrome, EMS), and the main symptoms of the diseased litopenaeus vannamei are that shrimp bodies become soft, hepatopancreas atrophy, white color and empty stomach and jejunumReduced ingestion and mortality rate up to 90% or more ^[5] Has been described for China, philippines, mexico ^[6-8] And great economic loss is brought to the multi-country prawn breeding industry. Studies show that the acute hepatopancreatic necrosis of prawns is caused by carrying a polypeptide which can code for virulence protein pirA ^VP And pirB ^VP The virulence protein of the plasmid caused by partial vibrio can cause the shedding, necrosis and hepatopancreatic epithelial cell dysfunction of the prawn, thereby causing the acute death of the prawn ^[9] . Pathogenic bacteria which have been reported to cause acute hepatopancreatic necrosis of prawns include Vibrio parahaemolyticus (Vibrio parahaemolyticus) ^[10] Vibrio Erwinicus (V.owensii) ^[11] Vibrio harveyi (V.harveyi) ^[12] Vibrio bank (V.campbellii) ^[6] Etc.

Fatty Acid Binding Proteins (FABPs), which are members of the intracellular lipid binding protein superfamily, are low molecular weight cytoplasmic proteins with a number of amino acids between 126 and 137 and a molecular weight of about 15kDa ^[13] . FABPs are widely found in tissue cells of vertebrates and invertebrates, and can specifically bind to intracellular hydrophobic ligands and free amino acids, and are responsible for the transport and absorption of intracellular fatty acids, participating in fatty acid metabolism, regulating gene expression and cell growth ^[13] . FABPs are expressed in immune cells such as macrophages and monocytes to different extents, which indicates that FABPs can be involved in the immune process of the organism ^[14,15] 。

In the early stage of application, a cDNA library of dual hybridization of litopenaeus vannamei yeast is screened, and a gene and VP are identified _AHPND The toxin has a potentially interacting protein-fatty acid binding protein (LvFABP). Studies show that injection of LvFABP dsRNA can significantly reduce VP _AHPND Mortality rate of toxin attack. However, dsRNA has great difficulty in preparation, preservation and application, and the action mechanism of dsRNA is to play a role by regulating and controlling the expression of LvFABP genes. Whether the LvFABP protein can block the occurrence of diseases so as to achieve the effect of disease prevention and control has not been reported yet.

Disclosure of Invention

The invention aims to provide a functional feed additive and application thereof in preventing and treating acute hepatopancreatic necrosis of prawns.

In order to achieve the above purpose, the invention adopts the technical scheme that:

a functional feed additive is recombinant protein of LvFABP.

The additive is a recombinant protein of LvFABP shown in SEQ ID NO. 1, and the additive amount is 10mg/kg.

The preparation method of the functional feed additive takes litopenaeus vannamei as an object, clones to obtain an LvFABP full-length coding sequence, connects an LvFABP coding gene to a pET-30 (a) vector, carries out heterologous high-efficiency expression in engineering bacteria E.coli BL21 (DE 3), adopts a Ni-NTA chromatographic column to carry out protein purification on recombinant LvFABP, and obtains recombinant prawn fatty acid binding protein LvFABP.

The obtained LvFABP full-length coding sequence adopts the following primers:

an upstream primer F1:5'-ATGGGATCCAAGGCTCTGGGTGTTG-3';

the downstream primer R1:5'-CCGCTCGAGTAGTCCCAGTCATATCC-3'.

The PCR amplification reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 58℃for 30s, extension at 72℃for 30s, and repeating 30 cycles; extending at 72℃for 10min.

The LvFABP encoding gene is connected to a pET-30 (a) vector to obtain a recombinant expression vector LvFABP+pET-30 (a), and the recombinant expression vector LvFABP is transformed into E.coli BL21 (DE 3) and induced to be expressed in an IPTG-containing system to obtain a recombinant prawn fatty acid binding protein LvFABP; the concentration of IPTG in the system containing IPTG is 0.1mmol/L.

Use of a functional feed additive according to claim 1 for the control of acute hepatopancreatic necrosis syndrome in prawns.

The additive is added into prawn feed (commercial Litopenaeus vannamei compound feed with the protein content more than or equal to 39%), and the addition amount is 10mg/kg.

The invention has the advantages that:

the invention solves the problems that the dsRNA in the present stage has great difficulty in preparation, preservation and application, and can further effectively delay the occurrence of diseases and reduce the death rate after being added into feed for the in vitro recombinant protein of LvFABP. Compared with dsRNA, the LvFABP expressed by in vitro recombination has greater advantages in preparation, preservation and application, can be used as a specific functional feed additive for preventing and treating AHPND, and has wider industrialized application prospect.

Drawings

FIG. 1 is a SDS-PAGE analysis of LvFABP protein expression according to the embodiment of the present invention, wherein M: protein marker; lane 1: an induction agent (IPTG) -free LvFABP cell lysate supernatant; lane 2: adding an Inducer (IPTG) of LvFABP cell lysate supernatant; lane 3: precipitating LvFABP cell lysate without Inducer (IPTG); lane 4: lvFABP cell lysate precipitation with Inducer (IPTG) added.

FIG. 2 is a SDS-PAGE analysis chart of recombinant protein LvFABP purification provided by the embodiment of the invention, wherein M is a protein marker; lanes 1-8, elution purification of proteins with eluents containing different concentrations of imidazole (20 mmol/L, 40mmol/L, 60mmol/L, 80mmol/L, 100mmol/L, 120mmol/L, 160mmol/L, 200 mmol/L); lane 8 and lane 9, protein of interest LvFABP

Fig. 3 is a graph showing the effect of different addition amounts of recombinant LvFABP according to an embodiment of the present invention.

Fig. 4 is a graph showing the cumulative mortality effect of litopenaeus vannamei after toxicity attack by the AHPND according to the embodiment of the present invention.

Detailed Description

The following description of the embodiments of the present invention is further provided in connection with the accompanying examples, and it should be noted that the embodiments described herein are for the purpose of illustration and explanation only, and are not limiting of the invention.

EXAMPLE 1 construction of Litopenaeus vannamei LvFABP prokaryotic expression vector

An upstream primer F1 and a downstream primer R1 for specifically amplifying an LvFABP gene Open Reading Frame (ORF) of the litopenaeus vannamei are designed. According to the multi-cloning site of the pET-30 (a) vector, a BamH I enzyme cutting site is added at the 5 'end of the upstream primer F1, an Xho I enzyme cutting site is added at the 5' end of the downstream primer R1, and the LvFABP ORF of the Litopenaeus vannamei is cloned into the pET-30 (a) vector.

An upstream primer F1:5'-ATGGGATCCAAGGCTCTGGGTGTTG-3';

the downstream primer R1:5'-CCGCTCGAGTAGTCCCAGTCATATCC-3'.

Amplifying the LvFABP coding region fragment shown in SEQ ID NO. 1, taking litopenaeus vannamei cDNA as a template, and amplifying by using the primers designed above, wherein the PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 58℃for 30s, extension at 72℃for 30s, and repeating 30 cycles; extending at 72℃for 10min. And (3) recovering the PCR product by using an agarose gel purification kit, purifying and recovering the recovered PCR product after enzyme digestion of BamH I and Xho I, connecting the recovered PCR product with a BamH I and Xho I double enzyme digestion linearized pET-30 (a) vector, constructing a recombinant expression vector LvFABP+pET-30 (a), and carrying out sequencing identification on the recombinant expression vector for subsequent expression after the frame is accurate.

SEQ ID NO. 1:

ATGTCTCTTGCCGGCACCTACGAGTATGCTTCTAACGAGAACTACAGCGAGTGGCTCTCCGCCGTCGGTATTCCCGCCGAGTACGTAGCCAAGATGGTGGCCGCTAAGCCCGTGCTGGAAGTGTCCCAGAATGGCAATGTCGTCACCATCAAGACCGTTGCCGGCGACAAGAGCTTCACCAACACCATCAAGCTCGGCGAGGAGTCCAAGGCTAGCCTGCCCGGCGGCGTCGAGTACACGGTTAGCCTTTCTCAGTCTGGCAACACCCTGAAGGGAACCTGGGCCATGGGAGGCAAGTCAGGTGACGCCTGCGTGGAGGTCACCGGCAGCAACCTCATCCAGAGCATGAGCCTCGGAGGCGTCAAGGCCAAGAGGGTGTACAACCGCAAGTAG

EXAMPLE 2 inducible expression of recombinant expression vector LvFABP+pET-30 (a) in E.coli BL21 (DE 3)

The correctly sequenced recombinant expression vector LvFABP+pET-30 (a) was transformed into E.coli BL21 (DE 3) competent cells and expression was induced with IPTG.

The monoclonal colony obtained in the above example is picked up, inoculated in 5mL of LB liquid medium and cultured for 12h at 37 ℃ under 150 r/min; then, the culture was inoculated in 50mL of LB liquid medium (containing 50. Mu.g/mL kanamycin) at an inoculum size of 1wt%, and cultured at 37℃for 6 hours under 150 r/min; then respectively inoculating to 300mL of sterilized culture medium according to 1wt% of inoculation amount, continuously performing expansion culture, culturing at 37deg.C under 150r/min for 4 hr, and measuring OD by spectrophotometry ₆₀₀ When the ratio is about 0.6, addIPTG was cultured in an incubator at 16℃for 16h at a final concentration of 0.1mmol/L with shaking at 150 r/min. Centrifuging the induced bacterial liquid at 4 ℃ and 6000r/min for 20min, and discarding the supernatant; the cells were resuspended in buffer pH 7.0 (0.2 mol/L Na ₂ HPO ₄ -NaH ₂ PO ₄ ) The collected bacterial liquid is placed on ice and subjected to cell disruption by an ultrasonic cell disruption instrument: 150W of power, 2s/2s gap time and 30min of crushing time; centrifuging the crushed cell solution in a low-temperature centrifuge: cell lysate supernatant and cell lysate pellet were collected for SDS-PAGE analysis of LvFABP protein expression at 4℃at 10000r/min for 15min (see FIG. 1).

As can be seen from FIG. 1, IPTG can effectively induce the expression of recombinant LvFABP, the proportion of soluble expression is high, and the induction band of the LvFABP fusion protein can be detected in thalli after IPTG induction. EXAMPLE 3 purification of expression product of LvFABP+pET-30 (a) recombinant plasmid after IPTG induction in E.coli

Purifying by adopting Ni-NTA His Tag Kit, and purifying recombinant protein:

(1) Column

Placing anhydrous ethanol in a beaker, placing a small whiteboard for about 30min, then respectively placing 1mL of nickel column filler in four 2mL EP tubes, centrifuging in a centrifuge for 15min, pouring out supernatant on the upper layer, respectively adding 1mL of balance buffer solution, repeatedly centrifuging, and finally adding 1mL of balance buffer solution and standing. The opening of the column is placed into a white board, 5mL of balance buffer solution is added to enable the white board to slowly flow out, no bubbles are required to be arranged below the white board, no bubbles are ensured to be arranged below the liquid level, and the lower opening of the column is plugged; then the filler was blown with a pipette to mix uniformly and then slowly added to the column.

In the process, the nickel column filler is Ni-NTA agarose gel; balanced buffer (50 mmol/LNaH) ₂ PO ₄ 300mmol/L NaCl, 10mmol/L imidazole, naOH to adjust the pH to 8.0).

(2) Balancing

20ml of equilibration buffer was added to the column for equilibration of the nickel column.

(3) Loading sample

After cleavage in the above examples, the supernatant was filtered through a 0.45 μm filter, and the effluent was collected separately using a 2ml EP tube; then adding the mixture into a column, opening a lower port, and collecting a part of effluent by using a centrifuge tube; then the upper and lower openings are plugged by plugs and left standing for 30min.

(the flow rate of the sample to be fed to the column was controlled to be 0.5 ml/min)

(4) Washing

An appropriate amount of equilibration buffer was added to the column and the effluent was collected using a 2ml EP tube.

(5) Elution

Respectively adding imidazole eluents with different concentrations (20 mmol/L, 40mmol/L, 60mmol/L, 80mmol/L, 100mmol/L, 120mmol/L, 160mmol/L and 200 mmol/L) into a column for eluting, and respectively collecting effluent liquid under different eluents by using 2ml EP pipes;

the different imidazole eluents are buffers prepared by using balance buffer solution and containing different concentrations of imidazole.

(6) Regeneration of

Adding 10mL of high-concentration imidazole eluent with the concentration of 500mM to elute the impurity protein in the residual re-column, adding 10mL of pure water after the eluent flows out, adding 10mL of balance buffer solution, flowing out, and finally adding 20mL of absolute ethyl alcohol for preservation.

500mM high concentration imidazole eluent is formulated with equilibration buffer.

(7) Electrophoresis:

a series of samples collected were subjected to SDS-PAGE gel electrophoresis analysis (see fig. 2).

As can be seen from FIG. 2, the recombinant protein can be purified by a nickel column to obtain a single protein band, the concentration of imidazole in the eluent is 200mmol/L, and the result further proves that the target gene realizes correct expression in Escherichia coli.

Example 4 optimal addition of recombinant protein LvFABP in AHPND infection-resistant assay

The recombinant protein LvFABP obtained by purification is taken as an additive, different additive amounts are set, PBS is used for diluting the recombinant protein LvFABP with different concentrations, the final concentrations are respectively 1mg/kg,10mg/kg and 100mg/kg, and the recombinant protein LvFABP with different concentrations is sprayedThe recombinant protein LvFABP is sprayed on the surface of basic feed and is uniformly mixed, and the recombinant protein LvFABP is used as a feed additive and is prepared on site, so that the loss of protein activity is prevented. The experimental group (1 mg/kg,10mg/kg and 100 mg/kg) and the control group (0 mg/kg) were set up for 3 biological replicates. After 7d of feeding the prawn, the pathogenic vibrio parahaemolyticus VP-E1 (10) is preserved in a laboratory ⁷ CFU/mL), and continuously feeding corresponding experimental feeds for 4 days after toxin counteracting. Daily management during the challenge experiment was the same as during the culture experiment. After 4d of challenge, the cumulative mortality of litopenaeus vannamei was counted (see fig. 3).

The basic feed is compound feed (the protein content of the commercial Litopenaeus vannamei compound feed is more than or equal to 39%).

The data from each treatment of the experiment was analyzed by single factor anova using SPSS statistical software and when there was a significant difference between the treatments (P < 0.05), multiple comparisons were made using Tukey test. All values are expressed as mean ± standard error.

As shown in FIG. 3, with 0mg/kg added amount as the control group, after 4d of challenge, the cumulative mortality of the Litopenaeus vannamei decreases with the increase of the dose of the recombinant protein LvFABP, when the added amount of the recombinant protein LvFABP is 10mg/kg and 100mg/kg, the cumulative mortality of the Litopenaeus vannamei is significantly lower than that of the control group, and the results of the two groups of cumulative mortality are similar, and because the added amount of the recombinant protein LvFABP is 10mg/kg, the protein consumption can be greatly saved, the preparation cost and the preparation time can be saved, so that the optimal added amount of the recombinant protein LvFABP is finally determined to be 10mg/kg.

EXAMPLE 5 additive application of recombinant protein LvFABP in AHPND infection resistance test

The experiment was performed in 4 groups of 3 replicates each, 30 shrimp each.

Recombinant protein LvFABP challenge group (LvFABP-AHPND): the concentration of the recombinant LvFABP protein is added into the feed: 10mg/kg, and after 28 days of feeding, toxin is removed;

basic feed challenge group (PBS-AHPND): equal amount of PBS (the protein content of the commercial Litopenaeus vannamei compound feed is more than or equal to 39%) is added into the feed, and the feed is subjected to toxicity attack after 28 days of feeding;

recombinant protein LvFABP group (LvFABP): the concentration of the recombinant LvFABP protein is added into the feed: 10mg/kg;

basal feed group (PBS): equal amount of PBS was added to the feed.

Healthy litopenaeus vannamei (Litopenaeus vannamei) is purchased from the aquatic market, has an average weight of 20g, and is used after 5 days of temporary culture in a laboratory. The finishing boxes used in the experiment are all sterilized by potassium permanganate and cleaned by oxalic acid before the experiment. Two air stones are placed in each finishing box, the fresh seawater is filtered by sand as experimental water, the initial feeding amount is 5% of the weight of the prawns, and then the feeding amount is properly adjusted according to the actual feeding condition of the prawns. Each day at 8: 00. 14:00 and 20: feeding the prawns with 00 times, feeding for 2 hours, and sucking residual bait and feces. Continuous aeration is needed in the cultivation process, the salinity of seawater is about 30, the temperature of the seawater is controlled between 26 and 28 ℃, the pH is 7.8 to 8.2, and the dissolved oxygen in water is not lower than 6.5mg/L.

After 21 days of prawn feeding, the pathogenic vibrio parahaemolyticus VP-E1 (10) is preserved in a laboratory ⁷ CFU/mL), and continuously feeding corresponding experimental feeds for 12 days after toxin counteracting. Daily management during the challenge experiment was the same as during the culture experiment. After the toxicity attack experiment is finished, the accumulated mortality of the litopenaeus vannamei is counted (see fig. 4).

Cumulative mortality = D _t /D ₀ ×100％。

D in ₀ And D _t The initial mantissa and the accumulated death mantissa of the prawn in the toxicity attack experiment are respectively obtained.

The data and analysis results of the infection experiment are shown in fig. 4, and the results show that the addition of the recombinant protein LvFABP in the basic feed improves the survival rate of the litopenaeus vannamei after the toxicity attack of the AHPND. After toxicity attack, the half-life time LT50 of the PBS-AHPND group is 4d, and the half-life time LT50 of the LvFABP-AHPND group is 7d, so that the death of the Litopenaeus vannamei after toxicity attack of the AHPND is greatly delayed after the recombinant LvFABP is added; from the figure, compared with the basic feed challenge group (PBS-AHPND), after the litopenaeus vannamei is fed with the feed containing the LvFABP recombinant protein, the capability of resisting the AHPND infection (P < 0.05) can be obviously improved, the accumulated mortality of the experimental group is 78%, and the accumulated mortality of the basic feed group (PBS-AHPND) after the challenge is up to 100%. The addition of the recombinant protein LvFABP in the feed can obviously improve the survival rate of the prawns against AHPND infection.

The result shows that the recombinant protein LvFABP has the effect of improving the AHPND infection resistance of the prawns, and can be used as a functional additive in the production of prawn feed to prevent and treat acute hepatopancreatic necrosis of the litopenaeus vannamei.

Reference to the literature

[1] Chen Qin, xie Daxiang, tang Zehao. Adaptability test of young Penaeus vannamei Boone to salinity mutation [ J ]. Freshwater fishery, 2002,32 (5): 11-14.

[2] Chinese fishery statistics annual book [ M ] Beijing: chinese agricultural Press 2021:22-24.

[3]Thitamadee S，Prachumwata A，Srisala J，et al.Review of current disease threats for cultivated penaeid shrimp in Asia[J].Aquaculture,2016,452:69-87.

[4]Flegel T W.Historic emergence,impact and current status of shrimp pathogens in Asia[J].Journal of Invertebrate Pathology,2012,110(2):166-173.

[5] Wen Guo, caocheng, xu, et al, culture of prawn hepatopancreatic necrosis syndrome research progress [ J ]. Guangdong agricultural science 2015, 42 (11): 118-123.

[6]Dong X,Wang H L,Xie G S,et al.An isolate of Vibrio campbellii carrying the pir ^VP gene causes acute hepatopancreatic necrosis disease[J].Emerging Microbes&Infections,2017,6(1):e2.

[7]Pena L D,Cabillon N A,Catedral D D,et al.Acute hepatopancreatic necrosis disease(AHPND)outbreaks in Penaeus vannamei and P.monodon cultured in the Philippines[J].Diseases of Aquatic Organisms,2015,116(3):251-254.

[8]Nunan L,Lightner D,Pantoja C,et al.Detection of acute hepatopancreatic necrosis disease(AHPND)in Mexico[J].Diseases of Aquatic Organisms,2014,111(1):81-86.

[9]Lee C T,Chen I T,Yang Y T,et al.The opportunistic marine pathogen Vibrio arahaemolyticus becomes virulent by acquiring a plasmid that expresses a deadly toxin[J].Proceedings of the National Academy of Sciences of the United States of America,2015,112(34):10798-10803.

[10]Soto-Rodriguez S A,Gomez-Gil B,Lozano-Olvera R,et al.Field and experimental evidence of Vibrio parahaemolyticus as the causative agent of acute hepatopancreatic necrosis disease of cultured shrimp(Litopenaeus vannamei)in Northwestern Mexico[J].Applied and Environmental Microbiology,2015,81(5):1689-1699.

[11]Liu L Y,Xiao J Z,Xia X M,et al.Draft genome sequence of Vibrio owensii strain SH-14，which causes shrimp acute hepatopancreatic necrosis disease[J].Genome Announcements，2015,3(6):1395-1415.

[12]Kondo H,Van P T,Dang L T,et al.Draft genome sequence of non-Vibrio parahaemolyticus acute epatopancreatic necrosis disease strain KC13.17.5，isolated from diseased shrimp in Vietnam[J].Genome Announcements,2015,3(5):e00978-15.

[13]Zimmerman A W,Veerkamp J H.New insights into the structure and function of fatty acid-binding proteins[J].Cell Mol Life Sci,2002,59(7):1096-1116.

[14]Makowski L,Boord J B,Maeda K,et al.Lack of macrophage fatty-acid-binding protein aP2 protects mice deficient in apolipoprotein E against atherosclerosis[J].Nat Med,2001,7:699-705.

[15]Schachtrup C,Scholzen T E,Grau V,et al.L-FABP is exclusively expressed in alveolar macrophages within the myeloid lineage:evidence for a PPAR alphaindependent expression[J].Int J Biochem Cell Biol,2004,36:2042-2053。

Claims

1. A functional feed additive, characterized in that: the additive is a recombinant protein of LvFABP.

2. A functional feed additive according to claim 1, wherein: the additive is a recombinant protein of LvFABP shown in SEQ ID NO. 1, and the additive amount is 10mg/kg.

3. A method for preparing a functional feed additive according to claim 1, characterized in that: the method comprises the steps of taking litopenaeus vannamei as an object, cloning to obtain an LvFABP full-length coding sequence, connecting an LvFABP coding gene to a pET-30 (a) vector, carrying out heterologous efficient expression in engineering bacteria E.coli BL21 (DE 3), and carrying out protein purification on recombinant LvFABP by adopting a Ni-NTA chromatographic column to obtain recombinant prawn fatty acid binding protein LvFABP.

4. A process according to claim 3, wherein: the obtained LvFABP full-length coding sequence adopts the following primers:

an upstream primer F1:5'-ATGGGATCCAAGGCTCTGGGTGTTG-3';

the downstream primer R1:5'-CCGCTCGAGTAGTCCCAGTCATATCC-3'.

5. A process according to claim 3 or 4, wherein: the PCR amplification reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 58℃for 30s, extension at 72℃for 30s, and repeating 30 cycles; extending at 72℃for 10min.

6. A process according to claim 3, wherein: the LvFABP encoding gene is connected to a pET-30 (a) vector to obtain a recombinant expression vector LvFABP+pET-30 (a), and the recombinant expression vector LvFABP is transformed into E.coli BL21 (DE 3) and induced to be expressed in an IPTG-containing system to obtain a recombinant prawn fatty acid binding protein LvFABP; the concentration of IPTG in the system containing IPTG is 0.1mmol/L.

7. Use of the functional feed additive of claim 1, characterized in that: the additive is used for preventing and treating acute hepatopancreatic necrosis syndrome of prawns.

8. Use of a functional feed additive according to claim 7, characterized in that: the additive is added into prawn feed in an amount of 10mg/kg.