CA2037907C - Homologous recombination for universal donor cells and chimeric mammalian hosts - Google Patents

Abstract

Homologous recombination is employed to inactivate genes, particularly genes associated with MHC antigens. particularly, the .beta.2-microglobulin gene is inactivated for reducing or eliminating Class I MHC antigens. The resulting cells may be used as universal donors. In addition, embryonic stem cells may be modified by homologous recombination for use in producing chimeric or transgenic mammalian hosts.

Description

2 4 3 7 9 0 7 34522 Cell-02/02~'O
HOMOLOGOOS RECOMBINATION FOR UNIVERSAL
DONOR C$LLS AND CHIMBRIC HAMHAI,IAN HOSTS
INTRODUCTION
Technical Field The field of the subject invention is the use of homologous recombination to modify and inactivate genes, to produce cells which may serve as universal donors in cellular therapies including :Z0 transplantation to produce chimeric non-human mammals.
Background To protect vertebrates from disease and infection, elaborate protective systems have evolved.
:!5 In mammals, the immune systems serves as the primary defense with many different types of cells and mechanisms to protect the host. A wide variety of hematopoietic cells exist, with the major protective lineages being lymphoid and myeloid. The immune 30 system which results from cells of the lymphoid and myeloid lineages is developed in vivo, so as to recognize self from non-self. Those aberrant situations where the immune system attacks self, such as rheumatoid arthritis, lupus erythematosus, and 35 certain forms of diabetes, are evidence of importance to the host that only foreign agents be attacked. The protective mechanism which protects the host from disease, as a result of invasion of viruses, bacteria, 20227186 "
072590 1, f?~~ ~~~-~~~x or other pathogens is also able to recognize cells which come from a different mammalian host, even an allogeneic host.
As part of the system for the self versus foreign recognition, the surface membrane protein major histocompatibility complex (MHC) antigens serve an important role. Each host has a personal set of Class I and II MHC antigens, which serve to distinguish that host from other hosts. The lymphoid system is predicated upon recognition of the presence of such I~iC antigens as self. Where transplantation from another allogeneic host occurs, unless the transplant is matched with the host or the host is immunocompromised, the transplant may be attacked and destroyed by the immune system. When a transplant occurs which includes lymphocytes, monocytes or progenitors thereof, particularly bone marrow, a graft may attack the host as foreign, resulting in graft-versus-host disease.
There are many situations where one may wish to transplant cells into a recipient host when the recipient's cells are missin~~, damaged or dysfunctional. When the host is immunocompromised, there may be an interest in transfusing specific white cells, particularly T-cells, which may protect the host from various diseases, When the host lacks the ability to raise a defense an~ainst a particular disease, there may also be ari interest in administering specific T-cells or B-cells or precursors thereof which may supplement the host's compromised immune system. ~~n other cases, where certain cells are lacking, s~ich as islets of Langerhans in the case of diabetes, or cells which secrete dopamine in the case of Parkinson's disease, :35 or bone marrow cells in varic>us hematopoietic diseases, or muscle cells in muscle wasting diseases or retinal epithelial cells i.n visual disorders, it would be desirable to be ablE:~ to provide cells which 072590 2, il ..F
~3 Mi could fulfill the desired function. In order for the cells to be effective, they must be safe from attack:
by the host, so that they may function without being destroyed by the immune system. It is therefore of interest to find effective ways to produce cells which may function, proliferate, and differentiate as appropriate, while being safe from attack by a recipient's immune system.
There is also substantial interest in being able to study various physiological processes in vivo in animal models. In many of these situations, one would wish to have a specific genes) inactivated or introduced in a site-directed fashion. Where all or a substantial proportion of the cells present in the host would be mutated, the various processes could be studied. In addition, heterozygous hosts having one wild-type gene and one mutated gene could be mated to obtain homozygous hosts, so that all of the cells would have the appropriate modification. Such genetically modified animals could serve for screening drugs, investigating physiologic processes, developing new products, and the like.
Relevant Literature .Z5 A number of papers describe the use of homologous recombination in mammalian cells, including human cells. Illustrative of these papers are Rucherlapati et al., Proc. Natl. Acad. Sci. USA
81:3153-3157, 1984; Kucherlapati et. al., Mol. Cell.
:30 Bio. 5s714-720, 1985; Smithies et al., Nature 317:230 234, 1985; Wake et al., Mol. Cell. Bio. 8:2080-2089, 1985; Ayares et. al., Genetics 111:375-388, 1985;
Ayares et. al., Mol. Cell. Bio. 7:1656-1662, 1986;
Song et. al., Proc. Natl. Acad. Sci. USA 84:6820-6824, X15 1987; Thomas et. al., Cell 44:419-428, 1986; Thomas and Capecchi, Cell 51: 503-512, 1987; Nandi et. al., Proc. Natl. Acad. Sci. USA 85:3845-3849, 1988; and Mansour et. al., Nature 336:348-352, 1988.

072590 3.

Various embodiments of this invention provide an isolated mammalian cell lacking at least one major histocompatibility complex (MHC) antigen as a result of introduction of a lesion at each of the loci of one subunit of said antigen by transformation of said mammalian cell with at least one DNA construct comprising a sequence homologous with at least a portion of said loci and said lesion and integration of said construct at said loci, the cell being otherwise normal in that it is capable of functioning in its native manner.
Various embodiments of this invention provide an isolated mammalian cell lacking Class I MHC antigens as a result of introduction of a lesion at each of the ~2-microglobulin loci by transformation of said mammalian cell with at least one DNA construct comprising a sequence homologous with at least a portion of said loci and said lesion and integration of said construct at said loci.
Various embodiments of this invention provide a method for producing a mammalian cell lacking at least one Class I MHC antigen as a result of introduction of a lesion at each of the loci of a subunit of said antigen by transformation of said mammalian cell with at least one DNA
construct comprising a sequence homologous with at least a portion of said loci and said lesion and integration of said construct at said loci, said method comprising: transforming a host cell with said at least one DNA construct, wherein said construct comprises a marker gene for selection of host cells comprising said DNA construct integrated into said host cell genome; screening selected cells comprising said construct for homologous integration; transforming cells having homologous integration with said construct; and selecting cells lacking said MHC antigen on the surface by the absence of said MHC antigen.
4a.

This invention also provides tissue comprising normal mammalian cells lacking at least one major histocompatibility complex (MHC) antigen as a result of introduction of a lesion at each of the loci of one subunit of said antigen by transformation of said mammalian cell with at least one DNA construct comprising a sequence homologous with at least a portion of said loci and said lesion and integration of said construct at said loci. This invention also provides the use of such tissue for treating a wound, including by administering the tissue to the wound.
Various embodiments of this invention provide use of keratinocytes lacking at least one major histo-compatibility complex (MHC) antigen as a result of introduction of a lesion at each of the loci of one subunit of said antigen by transformation of said mammalian cell with at least one DNA construct comprising a sequence homologous with at least a portion of said loci and said lesion and integration of said construct at said loci for treating a wound.
Various embodiments of this invention provide use of keratinocytes lacking at least one major histo-compatibility complex (MHC) antigen as a result of introduction of a lesion at each of the loci of one subunit of said antigen by transformation of said mammalian cell with at least one DNA construct comprising a sequence homologous with at least a portion of said loci and said lesion and integration of said construct at said loci for preparation of a medicament for treating a wound.
Various embodiments of this invention provide a method of producing a chimeric non-human mammal, said method comprising: transforming an embryonic stem cell of a selected non-human mammal with a DNA construct comprising a marker gene and at least 100 by of DNA sequence homologous 4b.

with a sequence of the a2-microglobulin locus present in a chromosome of said embryonic stem cell under conditions where said construct becomes integrated by homologous recombination, wherein the sequence homologous with the sequence of the ~2-microglobulin locus contains a lesion;
selecting for embryonic stem cells comprising said construct integrated into said ~2-microglobulin locus to provide selected cells; introducing said selected cells into the blastocoel of a blastocyst of said selected non-human mammal; and growing said blastocyst to produce said chimeric non-human mammal.
This invention also provides a non-human animal characterized by lacking Class I major histocompatibility complex antigens.
This invention also provides a mouse characterized as incapable of producing functional ~2-microglobulin, lacking Class I major histocompatibility complex antigens, and lacking mature CD8+ T cells.
This invention also provides a DNA construct comprising at least 100 by of a sequence homologous with a locus of a subunit of a Class I major histocompatibility complex (MHC) antigen and comprising a sequence encoding a marker gene capable of expression in a mammalian host, wherein the sequence encoding the marker gene may be flanking or may be contained within the sequence homologous to said locus, providing that if the sequence encoding the marker gene flanks the sequence homologous to said locus, the DNA construct does not encode an entire MHC antigen.
This invention also provides a DNA construct comprising at least 100 by of a sequence homologous with a locus of a subunit of a major histocompatibility complex (MHC) antigen flanking a sequence encoding a marker gene capable of expression in a mammalian host, wherein the 4c.

sequence encoding the marker gene may be flanking or may be contained within the sequence homologous to said locus, providing that if the sequence encoding the marker gene flanks the sequence homologous to said locus, the DNA
construct does not encode an entire MHC antigen subunit.
This invention also provides a DNA construct comprising at least 100 by of a sequence homologous with the a2-microglobulin locus flanking a sequence encoding a marker gene capable of expression in a mammalian host, wherein the sequence homologous with the a2-microglobulin locus contains a lesion.
4d.

2~~'~Q~~~~
aESCRIPTION OF SPECIFIC EMBODIMENTS
Homologous recombination is employed for inactivation or alteration of genes in a site-directed manner, particularly a gene associated with an MHC
antigen. Depending upon the nature of the cell, the cell lacking at least one competent MHC antigen may find use as a donor to an allogeneic host or if an embryonic stem cell, may find use in the production of chimeric mammalian hosts.
Of particular interest is the inactivation of at least one, preferably both, copies of a subunit of an MHC antigen, more particularly, p2-microglobulin. Where a mutation in the p2-microglobulin gene of an embryonic stem cell is produced, a mammalian host derived from the embryonic stem cell may be used for investigation of the immune system and the role of Class I MHC antigen in that system. Of particular interest are methods which provide for cells lacking at least one MHC antigen, Class I or Class II, preferably_Class I, which cells may serve a variety of functions in a viable host.
The method involves transfection of mammalian cells, particularly normal cells, of a predetermined species with DNA associated with one of the loci related to the ~B2-microglobulin gene, the a-subunit(s) of the Class I or Class II MHC antigens or the p-subunit(s) of the Class II MHC antigens. The human Class II MHC
antigens are HLA-DR, DP AND DQ, where DR is of primary :30 interest.
The DNA will comprise at least a portion of the genes) at the particular locus with introduction of a lesion into at least one, usually both copies, of the native gene(s), so as to prevent expression of a :35 functional MHC antigen molecule. The lesion may be an insertion, deletion, replacement or combination thereof. When the lesion is introduced into only one copy of the gene being inactivated, the cells having a 072590 5.

single unmutated copy of the target gene are amplified and may be subjected to a second transformation, where the lesion may be the same or different from the first lesion, usually different, and where a deletion, or replacement is involved may be overlapping at least a portion of the lesion or allele. The resulting transformants are screened for the absence of a functional target antigen and the DNA of the cell may be further screened to ensure the absence of a wild-type target gene. Alternatively, homozygosity as to a phenotype may be achieved by breeding hosts heterozygous for the mutation.
The cells which may be subjected to transformation may be any mammalian cells of interest, which may find use in cell therapy, research, interaction with other cells in vitro or the like.
Cells of particular interest include among other lineages the islets of Langerhans, adrenal medulla cells which may secrete dopamine, osteoblasts, osteoclasts, epithelial cells, endothelial cells, T-lymphocytes, neurons, glial cells, ganglion cells, retinal cells, embryonic stem cells, liver cells, bone marrow cells, and myoblast (muscle) cells.
These cells will be selected to achieve a particular function and be introduced into a mammalian host or used for research or other purpose. Also of interest will be the stem cells which act as the progenitors for any of the above cells, which may be the original progenitor or a progenitor cell which is already dedicated to a particular lineage. Of particular interest will be epidermal cells, such as keratinocytes, and retinal epithelial cells, and myoblasts and hematopoietic cells and other cells which may be readily manipulated in vitro, maintained :35 for long periods of time in culture and may be introduced into a host, where the cells will remain viable and functional for long periods of time.

072590 6.

For embryonic atom cells, an embryonic stem cell line may be employed or embryonic stem cells mny be obtained freshly from a host. The cells may be grown on nn appropriate fibroblast-feeder layer or grown in the presonce of leukemia inhibitory factor (LIF) and then used for mutation.
The procedures employed for inactivating one or both copies of a particular MHC antigen will be similar, differing primarily in the choice of sequence, selectable markers used, and the method used to identify the absence of the MHC antigen, although similar methods may be used to ensure the absence of expression of a particular antigen. Since the procedures are analogous, the inactivation of the p2 microglobulin gene will be used as an example. It as to be understood that substantially the same procedures but with other genetic sequences will suffice for the x- and /9-subunits of the Class II MHC
antigens.
DNA constructs may be employed which provide-for the desired introduction of the lesion into the cell. The constructs may be modified to include functional entities other than the mutated sequence which may find use in the preparation of the a5 construct, amplification, transformation of the host cell, and integration of the construct into the host cell. Techniques which~may be used include calcium phosphate/DNA coprecipitates, microinjection of DNA
into the nucleus, electroporation, bacterial ?~0 protoplast fusion with intact cells, transfection, or the like. The DNA may be single or double stranded, linear or circular, relaxed, or supercoiled DNA. For .various techniques for transforming mammalian cells, (see Keown et al., Methods in Enzymology (1990) v. 185, 35 p. 527-537.
The homologous sequence for tart;sting the construct may have one or more deletions, insertions, substitutions or combinations thereof. For exam~~lP, the /a2 -microglobulin ma~~ incl_ude a deletion at one 072590 7, r, site and an insertion at another site which includes a gene which may be used for selection, where the presence of the inserted gene will result in a defective inactive protein product. Preferably, replacements are employed. For an inserted gene, of particular interest is a gene which provides a marker, e.g., antibiotic resistance such as neomycin resistance, including 6418 resistance.
The deletion will be at least about 50 bp, more usually at least about 100 bp, and generally not more than about 20 kbp, where the deletion will normally include at least a portion of the coding region including a portion of or one or more exons, a portion of or one or more introns, and may or may not include a portion of the flanking non-coding regions, particularly the 5'-non-coding region (transcriptional regulatory region). Thus, the homologous region may extend beyond the coding region into the 5'-non-coding region or alternatively into the 3'-non-coding region. Insertions will generally not exceed 10 kbp, usually not exceed 5 kbp, generally being at least 50 bp, more usually at least 200 bp.
The homologous sequence should include at least about 100 bp, preferably at least about 150 bp, :Z5 more preferably at least about 300 by of the target sequence and generally not exceeding 20 kbp, usually not exceeding 10 kbp, preferably less than about a total of 5 kbp, usually having at least about 50 by on opposite sides of the insertion and/or the deletion in order to provide for double crossover recombination.
Upstream and/or downstream from the target gene construct may be a gene which provides for identification of whether a double crossover has :35 occurred. For this purpose, the herpes simplex virus thymidine kinase gene may be employed, since the presence of the thymidine kinase gene may be detected by the use of nucleoside analogs, such as acyclovir or 072590 8.

gancyclovir, for their cytotoxic effects on cells that contain a functional HSV-tk gene. The absence of sensitivity to these nucleoside analogs indicates the absence of the thymidine kinase gene and, therefore, where homologous recombination has occurred that a double crossover event has also occurred.
The presence of the marker gene inserted into the p2-microglobulin gene establishes the integration of the target construct into the host genome. However, DNA analysis will be required in order to establish whether homologous or non-homologous recombination occurred. This can be determined by employing probes for the insert and then sequencing the 5' and 3' regions flanking the insert for the presence of a2-microglobulin extending beyond the flanking regions of the construct or identifying the presence of a deletion, when such deletion is introduced.
The polymerase chain reaction may be used with advantage in detecting the presence of homologous recombination. Primers may be used which are complementary to a sequence within the construct and complementary to a sequence outside the construct and at the target locus. In this way, one can only :?5 obtain DNA duplexes having both of the primers present in the complementary chains if homologous recombination has occurred. By demonstrating the presence of the probe sequences or the expected size sequence, the occurrence of homologous recombination :30 is supported.
The construct may further include a replica-tion system which is functional in the mammalian host cell. For the most part, these replication systems will involve viral replication systems, such as Simian a5 Virus 40, Epstein-Barr virus, papilloma virus, adenovirus and the like.
Where a marker gene is involved, as an insert, and/or flanking gene, depending upon the 072~:~ 9.

nature of the gene, it may have the wild-type transcriptional regulatory regions, particularly the transcriptional initiation regulatory region or a different transcriptional initiation region. Whenever a gene is from a host where the transcriptional initiation region is not recognized by the transcriptional machinery of the mammalian host cell, a different transcriptional initiation region will be required. This region may be constitutive or inducible, preferably inducible. A wide variety of transcriptional initiation regions have been isolated and used with different genes. Of particular interest as promoters are the promoters of metallothionein-I
and II from a mammalian host, thymidine kinase, p-actin, immunoglobulin promoter, human cytomegalovirus promoters, and SV40 promoters. In addition to the promoter, the wildtype enhancer may be present or an enhancer from a different gene may be joined to the promoter region.
The construct may further include a replication system for prokaryotes, particularly _E.
coli, for use in preparing the construct, cloning after each manipulation, allowing for analysis, such as restriction mapping or sequencing, followed by :25 expansion of a clone and isolation of the plasmid for further manipulation. When necessary, a different marker may be employed for detecting bacterial transformants.
Once the vector has been prepared, it may be :30 further manipulated by deletion of the bacterial sequences as well as linearization, where a short deletion may be provided in the homologous sequence, generally not exceeding about 500 bp, generally being from about 50 to 300 bp. The small deletion will ~~5 generally be near ane or other end of the targeted structural gene.
Once the construct has been prepared and manipulated and the undesired sequences removed from 072590 10.

the vector, e.g., the undesired bacterial sequences, the DNA construct is now ready to be introduced into the target cells. As already indicated, any convenient technique for introducing the DNA into the target cells may be employed. After transformation of the target cells, many target cells are selected by means of positive and/or negative markers, as previously indicated, neomycin resistance and acyclovir or gancyclovir resistance. Those cells which show the desired phenotype may then be further analyzed by restriction analysis, electrophoresis, Southern analysis, polymerase chain reaction or the like. By identifying fragments which show the presence of the lesions) at the target gene site, one can identify cells in which homologous recombination has occurred to inactivate one of the two copies of the target gene.
The second construct will differ from the first construct in not necessarily requiring a marker for selection, since the absence of the target I~iC
antigen on the surface of the cells may be used as a marker. Thus, one may again use insertions, deletions or replacements as lesions for modifying and inactivating the target gene. Similarly, one may detect the absence of a Class II I~iC antigen on the surface as evidence of the absence of expression of the particular Class II l~iC antigen.
Transformation of the cells in which one of the copies has been inactivated may then be performed in the same or different way from the previous method of transformation. The resulting transformed cells may then be selected by the absence of the target l~iC
antigen on the surface of the cell. This can be achieved in a variety of ways. For example, one may use antibodies to any epitope of the target l~iC
antigen in conjunction with complement to kill any cells having the antigen. Alternatively, one may use conjugates of the appropriate antibody, particularly 072590 11.

2~~~"~ ~~~1 monoclonal antibody with a toxin, such as the A chain of ricin, abrin, diphtheria toxin, or the like.
Affinity chromatography may be employed, where antibodies may be used to remove cells comprising the target antigen. The resulting cells which survive should be free of at least one MHC antigen on their surface and now not be as subject to transplant rejection when introduced in vivo as wild-type cells.
The resulting cells will then be screened to ensure that substantially no Class I I~iC antigens are on the surface. This may be achieved as described above by selecting for cells lacking the Class I l~iC
antigen. The cells may then be grown in an appropriate nutrient medium for expansion and used in a variety of ways. For example, with keratinocytes, the cells may be used for replacement of skin in the case of burns, where keratinocytes may be grown to form a continuous layer prior to application.
Similarly, the keratinocytes may be used in the case of plastic surgery to replace skin removed from the host for use at another site. Other uses for the keratinocytes include transplantation in decubitus ulcers.
In the case of islets of Langerhans, they may be grown and introduced into capsules or otherwise for insertion into a host for the production of insulin. In the case of retinal epithelial cells, they could be injected into the subretinal space of the eye to treat visual disorders such as macular degeneration. In the case of immune cells, they could be injected into the bloodstream or elsewhere to treat immune deficiency. In the case of myoblasts they could be injected at various sites to treat muscle wasting, such as Duchenne~s muscular dystrophy.
Depending upon the nature of the cells, the therapy involved, and the disorder, the cells may be employed as films, introduced in containers for maintenance at a particular site, or as solid masses 072590 1"

4i impregnated in inert matrices or independent of a matrix. The number of cells administered will vary widely, depending upon the particular application and the manner in which the cells are administered.
Administration may be by injection, topical application, incision and placement, in the appropriate location.
For embryonic stem cells, after mutation, the cells may be plated onto a feeder layer in an appropriate medium, e.g., fetal bovine serum enhanced DMEM. Cells containing the construct may be detected by employing a selective medium and after sufficient time for colonies to grow, colonies may be picked and analyzed for the occurrence of homologous recombina--tion. As described previously, the polymerise chain reaction may be used, with primers within and without the construct sequence but at the target locus. Those colonies which show homologous recombination may then be used for embryo manipulating and blastocyst injection. Blastocysts may be obtained from 4 to 6 week old superovulated females by flushing the uterus 3.5 days after ovulation. The embryonic stem cells may then be trypsinized and the modified cells added to a droplet containing the blastocysts. At least one, usually at least about 10, and up to about 30 of the modified embryonic stem cells may be injected into the blastocoel of the blastocyst. After injection, at least one and not more than about 15 of the blastocysts are returned to each uterine horn of pseudopregnant females. Females are then allowed to go to term and the resulting litters screened for mutant cells having the construct. The blastocysts are selected for different parentage from the transformed ES cells. By providing for a different phenotype of the b.lastocyst and the ES cells, chimeric progeny can be readily detected. A
particularly useful phenotype is hair color, although any phenotype may be used or, if desired, one may look 072590 13.

s. t "-~ t1' J
to genotype, probing for the presence of the modified genomic DNA.
The pups will usually be born 16-18 days after introduction of the blastocysts into foster mothers. The chimeric animals are screened for the presence of the transformed genome and males and females comprising the transformed genome are mated.
The homozygous progeny lack Class I MHC cells and mature CD8 T-cells (TCR ap).
The mammals may be any non-human mammal, such as laboratory animals, domestic animals, pets, etc.
The following examples are offered by way of illustration and not by way of limitation.
EXPERIMENTAL
PROLIFERATION OF EPIDERMAL RERATINOCYTES
LACRING MHC ANTIGEN DUE TO INACTIVATION

Cells Mouse epidermal keratinocytes are obtained from the skin of a newborn mouse. The skin samples are rinsed in serum-free medium and minced into small fragments. The fragments are treated with trypsin and the resulting single cell suspension washed and plated on 3T3 fibroblast feeder layers. EGF (5 ng/ml) is added at the end of five days. The cells are maintained in media supplemented with hydrocortisone (10-6M), cholera toxin (10-7M), insulin (5 ng/ml), transferrin (5 ng/ml) T3 (2 x 10-8M) and 20% fetal calf serum. Unused cells are stored in liquid nitrogen.
Human epidermal keratinocytes are isolated using a fresh skin sample from a circumcised skin as the source of the keratinocytes. The sample is then treated substantially as described above.

072590 14.

~~r~~vr~
DNA Vectors The mouse and human ~B2-microglobulin genes as isolated and characterized by Parnes and Seidman, Cell 29:661-669, (1982) and Gussow, et al., J. Immunol, 139:3132-3138 (1987), respectively, are employed for homology.
Construction of Inactivation Vector 1 The inactivation vectors are constructed from 4kb HindIII fragment of the genomic DNA which encompasses the second, third and fourth exons of the ~B2-microglobulin gene. The 4kb HindIII subcloned into pBR322 is digested with EcoRI and the selectable neomycin phosphotransferase (neon) gene inserted. The neon gene is obtained from pSV2neo (Southern and Berg, Mol. Appl. Genet. 1:332, (1982)). The resulting vector is called B2R01.
Construction of Inactivation Vector 2 The starting plasmid for the construction of the second vector is B2R01. In_this case, the herpes simplex virus type 1 thymidine kinase gene is inserted at the HindIII site of B2R01.
Inactivation of One Co y of ~2-MicroQlobulin The DNA which is used for transformation in the first or second stage comprises the inserted sequence with flanking homologous sequences from the cloning plasmid B2K01 and the same sequence flanked at one end by tk gene free of the bacterial plasmid DNA.
The resulting DNA fragments are purified by ethanol precipitation and cleared by passage through a 0.22 micron filter. The DNA is isolated by conventional means and introduced into the keratinocyte cells by :35 microinjection (Capecchi, Cell 22:479-488 (1980).
Approximately 5-50 copies of the DNA constructs are injected into each nucleus. The cells are then grown In selective medium comprising 200 ~g/ml of 6418 072590 15.

~~y' J yi ai!
(Geneticin, Gibco Labs). For the second construct, the cells are also plated in Gancyclovir (Syntex Corp, Palo Alto, CA) or Ayclovir (Burrows-Wellcome, Research Triangle Park, NC). Cells from colonies are isolated and analyzed by the polymerase chain reaction and Southern blot hybridization. Cells demonstrating one copy of the p2-microglobulin being inactivated are used for knocking out the second copy.
Inactivation of The Second Copy of the ~2-Microglobulin Gene Gene Cells obtained from above with a single inactivated a2-microglobulin gene are microinjected as described above with the modified B2K02 plasmid and cells resistant to Gancylovir or Acyclovir isolated»
Cells which lack Class I gene expression are isolated by combining the cells with monoclonal antibodies specific for p2-microglobulin and complement as described by Parish et al. (19?4) Eur. J. Immunol.

4:808. Resulting viable cells are grown in selected medium and passed through an affinity column of the same monoclonal antibodies. The column is prepared as described by Harlow and Lane, 1988, Antibodies: A
Laboratory Manual, CSH Press. Southern blot analysis of the cells is performed to establish the proper locus of integration. The cells are then expanded and stored for further use.
Generation of Monolayer of Keratinocytes The resulting cells lacking Class I MHC are used to grow a monolayer of keratinocytes as described by Rheinwald and Green, Cell 6:331-343, 1975. This layer is transplanted onto allogenic mice as described by Rheinwald and Green, 1975, supra. The cells adhere to the surface and grow to provide a protective skin layer.

072590 16.

2~'~'~w~~~'~
Following the same procedure as described above for p2-microglobulin the HLA-DR genes may be inactivated by employing homologous sequences flanking the a-subunit of the HLA-DR gene of the host cell. In this way cells which have the Class II MHC antigen or may have the capability to have the expression of such antigen induced are prevented from expressing the primary Class II antigen associated with the cellular immune response .
In the next study, embryonic stem cells were modified by homologous recombination with one of the ,02-microglobulin genes.
Materials and Methods Construction of the TarQeting Plasmid The plasmid pKC~2B contains the entire p2m gene within an 8.4 kbp XhoI fragment (Ozato and Orrison, Proc. Natl. Acad. Sci USA 82:2427-2431, 1985; Warner et al., Bio. Reprod. 36:611-616, 1987).
The 5'XhoI to BamHI fragment of this gene was subcloned into pUCl9. Two K~nI restriction enzyme sites, one in the 5' flanking DNA and the other within the first intron, were removed by digestion with RpnI
followed by treatment with T4 polymerase and re-ligation. A unique ClaI site was created in exon 2 by partial digestion with EcoRI followed by treatment with Klenow polymerase and ligation with ClaI linkers.
The 1150 by XhoI to HI fragment of the plasmid pMCl :30 Neo (Kim and Smithies, Nucleic Acid Res. 16:8887-8903, 1988), containing a neomycin gene driven by the Herpes simplex virus thymidine kinase gene (HSV-tk) promoter and a polyoma enhancer, was inserted via linkers into this ClaI site. Two plasmids, C65.2.3 :35 and C65.5.9, were obtained that differed in the transcriptional orientation of the inserted fragment with respect to that of the p2-microglobulin gene.
The 5' XhoI to KpnI fragment of each of these was 072590 17.

4~
cloned into pUCl9 in order to obtain the targeting vectors used in our experiments. In plasmid C84.4B
the 5' to 3' orientation of the neomycin and ~2m promoters is identical. The opposite configuration occurs in plasmid C84.2D.
Culturing, Electro oration, and Selection of ES Cells The ES cell line E14TG2a (Sawicki et al., Nature 294:450-451, 1981) was cultured on mitomycin-treated primary embryonic fibroblast-feeder layers essentially as described (Ostrand-Rosenberg et al., Proc. Natl. Acad. Sci. 86:5084-5088, 1989). The embryonic fibroblasts were prepared from embryos from C57BL/6 females that had mated 14 to 17 days earlier with a male homozygous for a neomycin transgene (Evans and Raufman, Nature 292:154-156, 1981); these cells are capable of growth in media containing 6418.
Electroporation conditions were similar to those that have been described previously (Doetschman _et al., Nature 330:576-578, 1987). ES cells were trypsinized, resuspended in culture media at a concentration of 4x107/ml and electroporated in the presence of the targeting DNA at a concentration of l2nM in the first experiment and 5nM DNA in the second. A voltage of 300 V with a capacitance of 150-250 /~F was found optimal with an electroporation cell of 5 mm length and 100 mm2 cross section. 5x106 electroporated cells were plated onto mitomycin-treated fibroblasts in 100 mm dishes in the presence of Dulbecco's modified .30 Eagle's media (DMEM) supplemented with 15% fetal bovine serum (FBS) and 0.1 mM 2-mercaptoethanol. The media was replaced 24 hr after electroporation with media containing 200 ~tg/ml 6418.
Analysis of 6418 Resistant ES Cell Colonies ES colonies visible 10-14 days after electroporation were picked with drawn out capillary pipettes for analysis using the polymerase chain 072590 18.

e~
reaction (PCR). Half of each picked colony was saved in 24-well plates already seeded with mitomycin-treated feeder cells. The other halves, combined in pools of 3-4, were transferred to Eppendorf tubes containing approximately 0.5 ml of PBS and analyzed for homologous recombination by PCR. Conditions for PCR reactions were essentially as described (Linney and Donerly, Cell 35:693-699, 1983). The ES cells were pelleted, resuspended in 5 ~1 of phosphate buffered saline (PBS), and lysed by the addition of 55 dal of H20 to each tube. DNAses were inactivated by heating each tube at 95°C for 10 min. After treatment with proteinase K at 55°C for 30 min, 30 /a1 of each lysate was transferred to a tube containing 20 /a1 of a reaction mixture including PCR buffer, 1.5 ~g of each primer, 3U of Taq polymerase, 10% DMSO, and dATP, dCTP, dGTP and dTTP each at 0.2 mM. PCR was carried out for 55 cycles using a thermocycler modelled after one described previously (Kim and Smithies, supra, 1988), with 65 seconds melt at 92°C
and a 10 min annealing and extension time at 65°C.
The two priming oligonucleotides, TGGCGGACCGCTATAGGAC
and GATGCTGATCACATGTCTCG, correspond respectively to sequences located 650 bases 3' of the start codon of the neomycin gene and sequences located in exon 3 of the p2m gene. 20 ~1 of the reaction mix was electrophoresed on agarose gels and transferred to nylon membranes (Zeta Bind). Filters were probed with 32P-labelled 450 by EcoRI to KpnI fragment of the p2m 3 0 gene .
Preparation and Restriction Enzyme Analysis of Genomic DNA
Genomic DNA was prepared from ES cells, whole new born mice, and mouse tails by conventional methods. DNA was digested with restriction enzymes as directed by the manufacturers and fragments were separated on 0.7% agarose gels. DNA was transferred 072590 19.

~ :'; r t! ,~ r~ . .
to nylon membranes and probed with the 32P labelled fragment described above.
Embryo Manipulation and Blastocyst Infection Mice were purchased from either Jackson Laboratories (Bar Harbor, ME) or Charles River (Raleigh, NC). C578L/6 blastocysts were obtained from 3 to 4 week old superovulated females. Uteri were flushed with M2 media (Joyner et al., Nature 338, 153-156, 1989) 3.5 days after ovulation. Blastocysts were collected, washed several times in fresh M2 media, and placed in a 100 ~1 droplet of M2 under paraffin oil. ES cells were trypsinized, washed once with fresh DMEM media and diluted to approximately 2x106 cell/ml. 5 ~1 of cells were added to the droplet containing the blastocysts. 10 to 15 ES cells were injected into the blastocoel of each blastocyst.
Following injection 6 to 9 blastocyst were returned to each uterine horn of pseudopregnant females mated 2.5 days previously with vasectomized males. Both C57BL/6 x DBA Fl and C57BL/6 x CBA F1 mice proved to be excellent foster mothers, yielding a pregnancy rate close to 100% and able to raise small litters.
Isolation and Characterization of Targeted ES cells Two independent targeting experiments were carried out. In each, 2x107 cells were electroporated in the presence of the incoming DNA, and were then cultured in media containing 6418. After about two weeks, 6418 resistant colonies were readily apparent.
A portion of each colony was then transferred to an individual well of a 24-well plate, while the remaining portion was pooled with portions from two to four other colonies for PCR analysis. In the first .35 experiment, one pool gave a positive PCR signal out of 32 pools that included a total of 100 6418 resistant colonies. The three individual colonies that had 072590 20.

~~~ ~ja'~~
contributed to this positive pool were analyzed individually by PCR, and a positive clone, ES39B, was identified. Similar analysis of 134 6418 resistant colonies obtained in the second experiment also yielded a clone, ES22A, which generated the 910 by DNA
fragment indicating successful targeting when subjected to PCR.
In order to verify the targeted disruption of one copy of the ~i2m gene, (the gene is autosomal and present in two copies), the two PCR positive clones, ES39B and ES22A, were expanded, and their DNA
was isolated and then analyzed by Southern blotting using a probe that detects sequences from the second exon and part of the first intron of the p2m gene.
Patterns obtained with the restriction enzymes XbaI, BamHI and K~nI match those expected if one of the two copies of the ~2m gene had been disrupted in the planned manner in the PCR-positive clones. That is, one DNA fragment identical in size to that present in untreated cells, was present in untreated cells, but of decreased intensity in the PCR positive clones, with all three enzymes. An additional fragment of the size predicted for a homologous recombination event was present only in the PCR-positive clones. The insertion of the neomycin gene in the second exon by the recombination results in an XbaI fragment detectable with the p2m specific probe that is approximately 1 kb longer than the equivalent fragment in the native locus. A new BamHI site is introduced into the locus by the targetting DNA, reducing the size of the BamHI fragment detected by the ~2m probe from 10.6 kbp to 900 bp. A new fragment is also seen after KpnI digestion. In ES39B
the K~nI fragment is 7 kb in length, as predicted by a :35 crossover between the 5' end of the targeting plasmid and the native locus. In ES22A this new RpnI fragment is 4.0 kb in length, which indicates that the deleted K,~I sites were not incorporated into the locus. This 072590 21.

observation indicates that one of the crossovers in cell line ES22A resolved between the third K~nI site of the native locus and the inserted neomycin gene of the incoming DNA, presumably after branch migration of a crossover intermediate. Although the 5' crossover sites differ, both modified cell lines now contain a p2m gene disrupted in the planned way by insertion of a neomycin gene in exon 2. Re-hybridization of the filter used for the autoradiography with a probe for the neomycin gene shows that the only bands that hybridize are those predicted by the structure of the construct.
Chimeric Offsprinct of Tarcxeted ES Cells The two ES cell lines carrying the inactivated p2m genes are expected to allow the introduction of this mutation into the mouse germline.
Toward this end, we injected 10 to 15 cells into C57BL/6 blastocysts. Embryos were reimplanted into pseudopregnant females. Because the ES cell line E14TG2a was isolated from strain 129/01a embryos, it and all cell lines derived from it are expected to carry the coat color markers characteristic of this mouse strain. These include the dominant Aw allele at the agouti locus, the recessive chinchilla allele at the c-locus, and the recessive p-allele (pink-eyed dilution) at the p-locus (Quinn et al., J. Reprod.
Fertil. 66:161-168, 1981). Contribution of ES cells to the mesoderm-derived portions of hair follicles results in an agouti coat. Hair follicles to which melanocytes of ES cell origin (and therefore carrying the p and cch mutations) have migrated produce cream colored hairs. Both of these coat colors are easily distinguished from the solid black coat seen in pups derived from non-agouti C57BL/6 host blastocysts.
More than 70$ of surviving pups are chimeras. The intensity of the 6~.1 XbaI band diagnostic of the targeted p2m locus shows that the 072590 22.

'~ ~ ~'~ r~
modified ES cells contributed extensively to the tissue of this animal.
Generation of Chimeric Mice Three to four week old C57BL/6 female mice were superovulated by the sequential injection of PMS
and hCG and mated with fertile males of similar strain. Four days after mating, the female mice were sacrificed, and blastocysts obtained by flushing the uterus with M9 media. The collected blastocysts were transferred to a droplet of the same media that was submerged in paraffin oil and also contained some ES22a cells. These cells had been prepared for injection by trypsinization followed by washing and resuspending in M2 media. Ten to fifteen ES22a cells were introduced into the blastocoel of each blastocyst using standard micromanipulation techniques. The ES
cell containing blastocysts were then transferred to the uterus of a pseudopregnant foster mother. Foster mothers were obtained by mating B6/D2 females with vasectomized male mice. Females which had mated 2.5 days prior to the date of transfer, as asserted by the presence of a vaginal plug were used as foster mothers for the ES cell containing blastocysts. Development of the blastocysts continues in vivo and pups were generally born 16-18 days later. The contribution of the ES cells to the offspring could be judged visually by examination of the coat color of the pups.
The blastocysts were obtained from C578L/6 mice, which are solid black in color. The ES cell line E14TG2a, the parental line from which ES22a was derived was isolated from 129/01a mice. This mouse strain is cream in color, the combined effect of three coat color genes, the dominant Aw allele at the agouti MI5 locus, recessive pink-eyed-dilute allele at the p locus and the recessive cch at the C locus. Offspring in which the ES22a had participated in the formation of the animal had coats containing brown and cream 072590 23.

hairs. About 80% of the pups from blastocysts containing ES22a cells showed some degree of coat color chimerism.
Generation of Animals Heterozygous for the Mutated m Gene.
If ES22a cells contribute to the gonads the animals would be expected to generate sperm which contain the ES22a genome and pass it on to its offspring. The ES22a genome is homozygous for the dominant color coat marker Aw. If the chimera is mated with an animal that is non-agouti such as a C57BL/6 or B6/D2, offspring that arise from sperm or ES cell origin can be distinguished from those derived from sperm or blastocyst origin by their coat color.
50% of these agouti animals would be expected to inherit the mutated p2m gene. These can be identified by analysis of DNA isolated from the tails. 1 cm of tail was therefore removed from the agouti animals, and DNA prepared by standard techniques. DNA was digested with either the restriction enzyme XbaI or HindIII and analyzed by Southern blotting and probing with a radioactively labelled fragment of the p2m gene. The presence of an XbaI or HindIII fragment 1Kb larger than that found in control mice is indicative of the presence of the mutated p2m gene in the animal.
Generation of Animals Homozyaous for the Mutated ~2m Gene. -Male and female animals whose DNA indicated that they were carrying one copy of the mutated p2m gene were mated. Offspring of these coatings were again analyzed for the presence of the larger XbaI or HindIII fragments. As expected one quarter of the :35 offspring from such coatings were homozygous for the defective gene. These animals now represent a new mouse strain which carries the mutation that was 072590 2~, ~~,~~'~~.~~~~1 originally introduced by homologous recombination into the ES cell E14TG2a.
Determination of the Phenotype of the ,B2m -/- Mice To determine whether as expected, the mutation of the p2m protein resulted in loss of class I expression, two animals homozygous for the ~B2m mutation were sacrificed and examined for the presence of cell surface class I expression. Cells isolated from lymph node, spleen and thymus were examined with monaclonal antibodies directed against the Class I antigens H-2Rb and H-2Db. Both 129/01a, the mouse strain from which the ES cell line was derived and C57BL/6 the strain with which the chimera giving rise to these animals had been mated, express the H-2b haplotype. No staining above background was seen with cells obtained from the homozygous ~92m -/-mice in any of the tissues examined. Therefore, as predicted, the inactivation of ~B2m gene resulted in an animal that fails to express Class I antigens at the cell surface. The animals appeared healthy and could not be distinguished visibly from their litter mates.
The effect of lack of class I antigens on the maturation of T-cells was examined by isolating and staining thymocytes with antibodies that delineate various stages of T-cell differentiation. The data showed that the CD4-8-, CD4+8+, and CD4+8- cell populations in the thymuses of normal, ~32m -/-, and heterozygous animals are identical. In contrast, the CD4-8+ populations differ between animals of the different genotypes. CD4-8+ cells represent 10% of the cells of the normal thymus but less than 1% of the cells in the thymus of the p2m mice. Interestingly, the number of these cells in the heterozygote is also somewhat reduced. -To determine whether the absence of the Class I genes affected the maturation of T-cells as indicated by the expression of the T cell receptor 072590 25.

genes, thymocytes were stained with antibodies directed against either TCRap or TCR~rB receptor. No significant difference in the profile of ap cell receptor positive cells was seen in p2m -/- animals compared to normal, indicating that Class I antigens are not needed for the maturation of thymocytes to TCR
bearing CD4+g+, or CD4+8- cells.
Next, peripheral T-cells were examined for expression of ap TCR and CD4 and CD8. The yields of T-cells bearing ap TCRs from the spleen and lymph nodes of animals lacking p2m were not significantly different from those of normal littermate controls.
Between 20% and 32% of all T-cells bearing a~B TCRs also bore CD8 in a2m +/+ and +/- animals. Although CD4-, CD8+ thymocytes were somewhat depleted in p2m heterozygous animals, the level of peripheral CD8+ T-cells in these mice were comparable to those of normal littermates. By contrast, virtually none of the ai0 TCR-bearing T-cells expressed CD8 in animals homozygous for the p2m mutation. A preliminary experiment was done to find out whether the few a~ T-cells which appeared CD8+ in mutant mice were due to noise in the staining procedures. T-cells from these animals were therefore grown for several days on plastic coated with anti-CD3 antibody and in interleukin-2, a procedure which often stimulates the proliferation of CD8+ T-cells preferentially. CD8 bearing a~B+ T-cells did not appear in greater numbers after such treatment, although 78 bearing T cells did grow out. The conclusion is that CD8+, ap cells are virtually absent in animals which lack Class I MHC
expression.
Thymocytes and T-cells from spleen and lymph node were also examined fox expression of gb TCRs.
The numbers of these cells were similar in /92m -/-mice and controls. An outgrowth experiment (described above) showed that the 7b-bearing cells from ~B2m could proliferate and, moreover, preliminary 072590 26.

examination of these cells indicated that about a quarter of them bore CD8. Therefore these studies indicate that 7S T-cells may not require Class I
expression for their existence, even if they also bear CD8.
In accordance with the above results, cells can be provided which will not be subject to immune destruction as a result of the presence of Class I MHC
antigens. The cells may find wide use, since they will not be subject to immune attack when introduced into an allogeneic host, while they will still be capable of functioning in their native manner. In this way, a wide range of diseases resulting from the loss of number and or function of cells may be treated, where the introduced cells will survive, multiply and function. Therefore, not only may diseases as a result of burns, abrasions, pathogens or the like be treated, but also diseases as a result of genetic defects.
Also, embryonic stem cells may be modified by homologous recombination to provide for chimeric mammalian hosts. The chimeric mammalian hosts may then be selected and used for breeding to produce homozygous hosts lacking the inactivated gene.
All publications and patent applications cited In this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually Indicated to be incorporated by reference.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it:
will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. ' 2022?186 072590 27.

Claims (27)

WHAT IS CLAIMED IS:

1. ~An isolated mammalian cell lacking at least one major histocompatibility complex (MHC) antigen as a result of introduction of a lesion at each of the loci of one subunit of said antigen by transformation of said mammalian cell with at least one DNA construct comprising a sequence homologous with at least a portion of said loci and said lesion and integration of said construct at said loci, the cell being otherwise normal in that it is capable of functioning in its native manner.

2. ~A mammalian cell according to Claim 1, wherein said antigen is a Class I MHC antigen.

3. ~A mammalian cell according to Claim 1, wherein said antigen is a Class II MHC antigen.

4. ~A isolated mammalian cell lacking Class I MHC antigens as a result of introduction of a lesion at each of the .beta.2-microglobulin loci by transformation of said mammalian cell with at least one DNA construct comprising a sequence homologous with at least a portion of said loci and said lesion and integration of said construct at said loci.

5. ~A mammalian cell according to Claim 4, wherein said cell is an epidermal cell.

6. ~A mammalian cell according to Claim 4, wherein each of said loci have a different lesion.

7. ~A mammalian cell according to Claim 4, 5, or 6, wherein said lesion is an insertion of a marker gene in the coding region of said .beta.2-microglobulin loci.

8. A mammalian cell according to Claim 7, wherein said marker gene is a neomycin resistance gene.

9. A mammalian cell according to any one of Claims 4 to 8, wherein said cell is murine.

10. A mammalian cell according to any one of Claims 4 to 8, wherein said cell is human.

11. A method for producing a mammalian cell lacking at least one Class I MHC antigen as a result of introduction of a lesion at each of the loci of a subunit of said antigen by transformation of said mammalian cell with at least one DNA
construct comprising a sequence homologous with at least a portion of said loci and said lesion and integration of said construct at said loci, said method comprising:

transforming a host cell with said at least one DNA
construct, wherein said construct comprises a marker gene for selection of host cells comprising said DNA construct integrated into said host cell genome;

screening selected cells comprising said construct for homologous integration;

transforming cells having homologous integration with said construct; and selecting cells lacking said MHC antigen on the surface by the absence of said MHC antigen.

12. ~A method according to Claim 11, wherein said locus is the .beta.2-microglobulin locus.

13. A method according to Claim 12, wherein said selecting of cells lacking .beta.2-microglobulin is by using a cytotoxic agent specific for an epitope of a Class I MHC antigen.

14. A method according to any one of Claims 11 to 13, wherein two different constructs are employed for the two steps of transforming.

15. A method according to Claim 14, wherein each of said constructs comprises a different marker gene for selection of transformed cells.

16. A method according to Claim 15, wherein one of said marker genes provides resistance to neomycin and the other of said marker genes provides sensitivity to acyclovir or gancyclovir.

17. Use of keratinocytes lacking at least one major histocompatibility complex (MHC) antigen as a result of introduction of a lesion at each of the loci of one subunit of said antigen by transformation of a mammalian cell with at least one DNA construct comprising a sequence homologous with at least a portion of said loci and said lesion and integration of said construct at said loci for treating a wound.

18. Use of keratinocytes lacking at least one major histocompatibility complex (MHC) antigen as a result of introduction of a lesion at each of the loci of one subunit of said antigen by transformation of a mammalian cell with at least one DNA construct comprising a sequence homologous with at least a portion of said loci and said lesion and integration of said construct at said loci for preparation of a medicament for treating a wound.

19. A DNA construct comprising at least 100 by of a sequence homologous with a locus of a subunit of a Class I
major histocompatibility complex (MHC) antigen and comprising a sequence encoding a marker gene capable of expression in a mammalian host, wherein the sequence encoding the marker gene may be flanking or may be contained within the sequence homologous to said locus, providing that if the sequence encoding the marker gene flanks the sequence homologous to said locus, the DNA construct does not encode an entire MHC antigen.

20. A DNA construct comprising at least 100 by of a sequence homologous with a locus of a subunit of a major histocompatibility complex (MHC) antigen flanking a sequence encoding a marker gene capable of expression in a mammalian host, wherein the sequence encoding the marker gene may be flanking or may be contained within the sequence homologous to said locus, providing that if the sequence encoding the marker gene flanks the sequence homologous to said locus, the DNA construct does not encode an entire MHC antigen subunit.

21. A DNA construct according to Claim 20, wherein said antigen is a Class II MHC antigen.

22. A DNA construct comprising at least 100 by of a sequence homologous with the .beta.2-microglobulin locus flanking a sequence encoding a marker gene capable of expression in a mammalian host, wherein the sequence homologous with the .beta.2-microglobulin locus contains a lesion.

23. A DNA construct according to Claim 22, wherein said marker gene is antibiotic resistance.

24. A mammalian cell according to Claim 7 or 8, wherein said mammalian cell is an embryonic stem cell.

25. A method of producing a chimeric non-human mammal, said method comprising:
transforming an embryonic stem cell of a selected non-human mammal with a DNA construct comprising a marker gene and at least 100 bp of DNA sequence homologous with a sequence of the .beta.2-microglobulin locus present in a chromosome of said embryonic stem cell under conditions where said construct becomes integrated by homologous recombination, wherein the sequence homologous with the sequence of the .beta.2-microglobulin locus contains a lesion;
selecting for embryonic stem cells comprising said construct integrated into said .beta.2-microglobulin locus to provide selected cells;
introducing said selected cells into the blastocoel of a blastocyst of said selected non-human mammal; and growing said blastocyst to produce said chimeric non-human mammal.

26. A method according to Claim 25, wherein said selecting is by means of said marker gene and polymerase chain reaction.

27. A method according to Claim 26, wherein said polymerase chain reaction employs two primers, one primer within said construct and one primer external to said construct but at the locus of said target gene.