WO2005120547A1

WO2005120547A1 - Use of neuregulin-3 for inducing mammary cell differentiation and for the treatment of breast cancer

Info

Publication number: WO2005120547A1
Application number: PCT/GB2005/002321
Authority: WO
Inventors: Alan Ashworth; Beatrice Howard
Original assignee: The Institute Of Cancer Research; Breakthrough Breast Cancer
Priority date: 2004-06-11
Filing date: 2005-06-13
Publication date: 2005-12-22
Also published as: GB0413005D0

Abstract

A method of promoting the differentiation of a mammary cell, the method comprising contacting the mammary cell with Neuregulin-3 (Nrg3) or a variant thereof which has mammary cell differentiation activity. A method of producing mammary tissue in vitro, the method comprising culturing cells in a 3D culture matrix and contacting the cells with Nrg3 or a variant thereof which has mammary cell differentiation activity. A method of preventing breast cancer in an individual, the method comprising administering to the individual Nrg3 or a variant thereof which has mammary cell differentiation activity.

Description

OF NEUREGULIN-3 FOR INDUCING MAMMARY CELL DIFFERENTIATION AND FOR THE TREATMENT OF BREAST CANCER

The present invention relates to the uses of neuregulin-3, or a variant thereof that has mammary differentiation activity.

Breast cancer is a significant health problem for women throughout the world. Although advances have been made in detection and treatment of the disease, breast cancer remains the second leading cause of cancer-related deaths in women, affecting more than 180,000 women in the United States each year. For women in North America, the life-time odds of getting breast cancer are now one in eight.

In the UK, breast cancer is by far the commonest cancer in women, with 34,600 new cases in 1998. Over ninety-nine percent of breast cancers occur in women. Breast cancer incidence has been rising over the past five decades, but recently it has slowed which may reflect a period of earlier detection of breast cancers by mammography. The risk of developing breast cancer increases with age. A number of other factors can increase a woman's risk of having the disease, and these include a history of prior breast cancer, significant radiation exposure, strong family history of breast cancer, upper socioeconomic class, nulliparity, early menarche, late menopause, and age at first pregnancy greater than 30 years. Prolonged use of oral contraceptives earlier in life appears to increase risk slightly as does prolonged postmenopausal oestrogen replacement therapy.

Breast cancer is a heterogeneous disease. Although female hormones play a significant role in driving the origin and evolution of many breast tumours, there are a number of other factors involved, both recognised and unknown. Over- expression of oncogenes such as HER-2, the epidermal growth factor receptor genes, and cyclin DI have been associated with a significantly poorer prognosis. Similarly, mutation or deletion of tumour suppressor genes, such as the p53 gene, have been well documented in breast cancer and are also associated with a poorer prognosis. Also, the genes BRCA1 and BRCA2 are predictive of premenopausal familial breast cancer. Early diagnosis of breast cancer is vital to securing the most favourable outcome for treatment. Many countries with advanced healthcare systems have instituted screening programs for breast cancer which typically takes the form of regular x- ray of the breast (mammography). Health authorities in many countries have also promoted the importance of regular breast self-examination by women. Abnormalities detected during these screening procedures and cases presenting as symptomatic would typically be confirmed by aspiration cytology, core needle biopsy with a stereotactic or ultrasound technique for nonpalpable lesions, or incisional or excisional biopsy. At the same time other information relevant to treatment options and prognosis, such as oestrogen and progesterone receptor status would typically be determined.

Most women with breast cancer will have some type of surgery. The purpose of surgery is to remove as much of the cancer as possible. This may be in the form of lumpectomy or more radical mastectomy with breast reconstruction. Surgery may also be combined with other treatments like chemotherapy, hormone therapy, or radiation therapy. Surgery may also be performed to find out whether breast cancer has spread to the lymph nodes under the arm (axillary dissection), to restore a more normal appearance (reconstructive surgery), or to relieve symptoms of advanced cancer.

The major challenges in breast cancer treatment are to improve early detection rates, to find new non-invasive markers that can be used to follow disease progression and identify relapse, and to find improved and less toxic therapies, especially for more advanced disease where five-year survival is still very poor.

There is also a great need to identify agents that can be used to prevent or lower the risk of getting breast cancer. Additionally, there is a need to develop methods for growing breast tissue for use in breast reconstruction after the surgical treatment of breast cancer.

Neuregulin-3 (Nrg3) was first identified in 1997 by Zhang et al as a protein that is structurally related to Neuregulin-1 (Nrgl) which belongs to a family of membrane-bound or secreted proteins produced by neurons and mesenchymal cells, with multiple effects on a wide range of cell types. Nrg3 was predicted to contain an extracellular domain with an epidermal growth factor (EGF) motif, a transmembrane domain, and a large cytoplasmic domain. Zhang et al (1997) showed that the expression of Nrg3 is highly restricted to the developing and adult nervous system, and suggested that Nrg3 is a neural-enriched ligand for ErbB4.

Hijazi et al (1998) studied Nrg3 in human breast cancer cell lines with confusing and contradictory results. Nrg3 was found to be expressed in the breast cancer cell line MCF-7 which also expresses the oestrogen receptor and high levels of ErbB4, and exogenous Nrg3 was found to stimulate growth of this cell line. However, Nrg3 was not expressed in the breast cancer cell line MDA-MB-468, which does not express the oestrogen receptor, and which expresses only ErbBl and ErbB3, and exogenous Nrg3 was found to inhibit the growth of this cell line.

Nrg3 is known to be a ligand for ErbB4 (Zhang et al, 1997; Hobbs et al, 2002). Although, ErbB4 has been suggested to be involved in breast cancer (Sartor et al, 2001), its role is not clear. Not only do a large number of ligands with EGF domains, including neuregulins, bind to ErbB4 (Jones et al, 1999; Sweeney et al, 2000) the biological activity of ErbB4 is different for each ligand, leading to different tyrosine phosphorylation patterns, different stimulation of intracellular kinases, and different recruitment of signaling molecules (Sweeney et al, 2000).

There has been no teaching or suggestion in the literature of any involvement of Nrg3 in mammary gland development or mammary cell differentiation. Dunn et al (2004) have shown that Nrg3 is expressed in about 75% of samples of breast cancer tissue, although it was expressed at a variety of levels and proportion of cells within the tissue samples. Nevertheless, there is no known role for Nrg3 in breast cancer. There is also an indication that the phosphoinositol kinase pathway may be regulated by Nrg3 signaling (Tiao & Busfield 2003).

The inventors have identified the gene which encodes Nrg3 as the most likely candidate for scaramanga, the mouse mammary gland mutant. The inventors have also shown that Nrg3 is expressed during the initial stages of mammary gland formation, and that Nrg3 is sufficient to induce ectopic -mammary gland formation, ie cells in the ectoderm of the mouse embryo are competent to respond to Nrg3 by forming mammary epithelial buds. Nrg3 has been shown to stimulate differentiation of embryonic mammary tissue and the inventors believe that application of Nrg3 may promote mammary differentiation.

Mammary stem cells and mammary cell differentiation are discussed by Smalley & Ashworth (2003), Darcy et al (2000) and Welm et al (2003). At the time a mammary bud is committed, the stem cell population of that bud is delimited. With respect to mammary stem cells, it is assumed that there is a progenitor that gives rise to both myoepithelial and luminal cells, the two epithelial populations of the mature breast. The inventors' functional data indicate that Nrg3 promotes mammary epithelial differentiation by promoting specification of the mammary cell fate to the precursor population. Since Nrg3 is expressed at the RNA and protein level throughout the postnatal development of the mammary gland, as are the receptors, the inventors believe that Nrg3 will continue to promote differentiation of mature mammary cells.

Since it is known that differentiation of mammary tissue has a protective effect against breast cancer, the inventors believe that Nrg3, or a variant thereof that promotes mammary cell differentiation, can be administered to women to prevent, or reduce the risk of developing, breast cancer. The inventors have also realised that Nrg3, or a variant thereof that promotes mammary cell differentiation, would be useful for the formation of mammary tissue.

The inventors have further realised that Nrg3 has potential uses outside breast cancer. For example, Nrg3 may be used to produce animals with larger or extra mammary glands, which may be of use in the farming industry or for the recombinant production of proteins in milk.

A first aspect of the invention provides a method of promoting the differentiation of a mammary cell, the method comprising contacting the mammary cell with Neuregulin-3 (Nrg3) or a variant thereof that has mammary cell differentiation activity.

In other words, the invention includes the use Nrg3 or a variant thereof that has mammary cell differentiation activity for promoting the differentiation of a mammary cell.

By a mammary cell we include the meaning of a cell that is committed to the mammary cell lineage. Typically a mammary cell expresses mammary cell markers, for example MUCl, K8, K18, K19, CD10, CALLA and K14, and such cells can be identified by immunohistochemistry or fluorescent activated cell sorting (FACS) using the mammary cell markers.

The mammary cell may also be a mammary stem cell, a precursor mammary epithelial cell, a stem-cell like mammary cell, a mammary gland cell precursor, or an other undifferentiated or progenitor mammary cell.

By "promoting the differentiation of a mammary cell" we include the meaning of enhancing or progressing the differentiation of a mammary cell towards becoming a fully differentiated mammary cell. This includes stimulating a non-fully differentiated mammary cell to become a fully differentiated mammary cell.

There are two epithelial lineages present in the differentiated breast, luminal cells and myoepithelial cells, each of which expresses specific markers. For example, luminal cells express epithelial specific antigen MUCl, K8, K18 and K19, and myoepithelial cells express CD 10, CALLA and K14 (Welm et al, 2003). Thus by "promoting the differentiation of a mammary cell" we include the meaning of stimulating a precursor mammary epithelial cell to become a luminal cell or to become a myoepithelial cell. We also include the meaning of progressing the differentiation of a mammary epithelial cell along the luminal cell differentiation pathway or along the myoepithelial cell differentiation pathway. A second aspect of the invention provides a method of promoting the differentiation of a cell into a mammary cell, the method comprising contacting the cell with Nrg3 or a variant thereof that has mammary cell differentiation activity.

In other words, the invention includes the use Nrg3 or a variant thereof that has mammary cell differentiation activity for promoting the differentiation of an undifferentiated cell, such as an undifferentiated epithelial cell, into a mammary cell. Suitable undifferentiated cells include ES cells, umbilical cord blood cells, and skin epithelial (stem) cells.

Typically, in this context, the cell to be differentiated into a mammary cell is one that is not committed to the mammary cell lineage.

By "promoting the differentiation of a cell into a mammary cell" we include the meaning of stimulating a cell that is not a mammary epithelial cell to become a mammary epithelial cell. We also include the meaning of enhancing or progressing the differentiation of a non-mammary cell towards becoming a fully differentiated mammary cell. This includes stimulating a non-mammary cell to become a partially or fully differentiated mammary cell.

In other word, Nrg3 has the ability to stimulate precursor cells to become determined as mammary cells, ie Nrg3 alters the fate of undifferentiated precursor cells to become mammary cells.

The invention also includes a method of directing a precursor epithelial cell to become a mammary epithelial cell, the method comprising contacting the precursor epithelial cell with Nrg3 or a variant thereof which has mammary cell differentiation activity.

By a "precursor epithelial cell" we include the meaning of an epithelial cell that has not yet been committed to a particular developmental programme, such as mammary development. A precursor mammary epithelial cell is expected to display expression of particular molecular markers, such as Lefl and WntlOb for precursor embryonic mammary epithelial cells, and K14 and K18 for precursor post-natal mammary epithelial cells, and not express another subset of molecular markers that are distinct for other stem cell/tissue/organ types. In a strict developmental definition, a cell is committed to becoming a mammary cell if it is removed from its normal environment and still only develops as a mammary cell (i.e. it is committed to that lineage).

Typically the precursor epithelial cell is isolated from, or is derived from, skin or mammary gland tissue or a combination of both skin and mammary gland tissue.

It will be appreciated that Nrg3 or a variant thereof that has mammary cell differentiation activity can be used to promote or stimulate the progression of a cell along the mammary cell differentiation pathway. Thus Nrg3 can be used to encourage the differentiation of a cell that is not committed to the mammary cell lineage into a mammary cell, and to promote the differentiation of a cell that is committed to the mammary cell lineage along a mammary cell differentiation pathway.

The invention further includes a method of inducing the growth and/or differentiation of a mammary stem cell, the method comprising contacting the mammary stem cell with Nrg3 or a variant thereof which has mammary cell differentiation activity.

It is appreciated that the cell must be competent to respond to the Nrg3 signal, ie it must express ErbB4.

The current method for obtaining a population of cells enriched for mammary stem cells is to isolate the SP (side population that effluxes Hoechst dye) fraction from postnatal mammary glands (Smalley & Ashworth 2003).

The invention also includes a method of encouraging a cell population that contains undifferentiated cells, at least some of which are able to differentiate into a mammary stem cell, to produce mammary stem cells, the method comprising contacting said cell population with Nrg3 or a variant thereof which has mammary cell differentiation activity.

Typically the undifferentiated cells are stem cells, such as embryonic stem cells.

In another embodiment, the invention further includes a method of identifying a mammary stem cell in a population of cells that comprises a mammary stem cell, the method comprising identifying a cell that expresses Nrg3.

In an embodiment, the method of identifying a mammary stem cell comprises identifying a cell that further expresses one or more of Lefl (van Genderen et al, 1994), WntlOb, P63 (Gama et al, 2003), Sca-1 (stem cell antigen) and keratin-6 (Welm et al, 2003). It is appreciated, however, that embryonic epithelial bud markers are distinct from adult mammary epithelial markers. For example, embryonic mammary epithelial buds express Lefl and WntlOb but mature mammary cells do not express these markers. Thus, in this embodiment, identifying a mammary stem cell by identifying a cell that further expresses one or more of Lefl and WntlOb is typically performed on a population of embryonic cells.

Typically, the method may also comprise identifying a cell that in addition does not express a neural stem cell marker, such as nestin, Map-2, gfap, Musashi-1 or Soxl .

Usually, the method further comprises isolating and/or culturing the cell thus identified.

It is appreciated that the above methods are typically performed in vitro.

It is further appreciated that, where appropriate, some of the above methods may be performed in vivo. It is appreciated that since Nrg3 is the ligand for the ErbB4 receptor, in an embodiment, the various methods of the first and second aspects of the invention may comprise contacting a cell that expresses ErbB4 with Nrg3 or the variant thereof. In a further embodiment, the method may also comprise the (usually prior) step of determining whether the cell expresses ErbB4.

It is possible that Nrg3 may also signal via an ErbB4/ ErbB2 heterodimer as well as via an ErbB4 homodimer. ErbB2 is the preferred heterodimerisation partner for all of the erbB receptors, Thus, in a further embodiment, the method may also comprise the (usually prior) step of determining whether the mammary cell expresses ErbB4 and/or Erbb2.

By a "variant of Nrg3 that has mammary cell differentiation activity" we include the meaning of a variant that has at least some of the ability of Nrg3 to stimulate a cell to become a mammary cell or to promote the differentiation of a mammary cell.

Typically, the variant of Nrg3 has at least 30% of the mammary cell differentiation activity of Nrg3, or of the Nrg3 EGF domain. It is more preferred if the fragment has at least 50%>, preferably at least 70% and more preferably at least 90% of the mammary cell differentiation activity of Nrg3 or of the Nrg3 EGF domain. Most preferably, the fragment has 100%) or more of the mammary cell differentiation activity of Nrg3 or of the Nrg3 EGF domain.

It is appreciated that a person of average skill in the art can readily identify a variant of Nrg3 that has mammary cell differentiation activity using the ectopic mammary bud formation assay described in Example 1. Furthermore, the relative activity of a variant of Nrg3 can also readily be determined by a person of average skill in the art using the ectopic mammary bud formation assay described in Example 1. The nucleotide sequence of the human Nrg3 cDNA, and the amino acid sequence of the human Nrg3 protein can be found in GenBank Accession Nos. XM_166086 and XP_166086, respectively, and are listed as SEQ ID Nos. 1 and 2, respectively.

By a "variant" of Nrg3 we include a fragment, sequence variant, modification or fusion of Nrg3, or combinations thereof.

The variants may be made using protein chemistry techniques for example using partial proteolysis (either exolytically or endolytically), or by de novo synthesis. Alternatively, the variants may be made by recombinant DNA technology. Suitable techniques for cloning, manipulation, modification and expression of nucleic acids, and purification of expressed proteins, are well known in the art and are described for example in Sambrook et al (2001) "Molecular Cloning, a Laboratory Manual", 3^rd edition, Sambrook et al (eds), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, incorporated herein by reference.

By "fragment" of Nrg3 we mean any portion of the full length polypeptide that comprises the EGF domain. A preferred fragment of Nrg3 is the EGF domain. The EGF domain of human Nrg3 spans amino acid residues 285-332, and the sequence is shown in SEQ ID No: 3.

Both the human and mouse Nrg3 EGF domain contains two EGF repeats. It is preferred if the variant of the EGF domain contains both EGF repeats.

In an embodiment, the variant of Nrg3 includes any polypeptide that comprises the EGF domain of human Nrg3 (with the exception of full length human Nrg3 as defined in SEQ ID No: 2).

It is appreciated that when the Nrg3 or variant thereof is for administration to a human individual, the Nrg3 is typically human Nrg3 and the variant is typically a variant of human Nrg3. Mouse and human Nrg3 proteins are 93% identical at the amino acid level and 100%o identical in the EGF domain. Rat Nrg3 is 99%o identical at the nucleotide level.

Similarly, when the Nrg3 or variant thereof is for administration to a non-human individual, the Nrg3 is typically of the same species as its intended recipient, and the variant is typically a variant of Nrg3 from the same species as its intended recipient.

We have also found multiple isoforms of Nrg3 expressed in the developing mammary gland. Thus by Nrg3 we also include the meaning of any naturally occurring isoform of Nrg3 that comprises the EGF domain.

A "sequence variant" of Nrg3 refers to Nrg3, or a fragment thereof comprising the EGF domain, that has been altered by an amino acid insertion, deletion and/or substitution, either conservative or non-conservative, at one or more positions. By "conservative substitutions" is intended combinations such as Gly, Ala; Val, He, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr. Such modifications may be made using the methods of protein engineering and site-directed mutagenesis, as described in Sambrook et al 2001, supra.

Preferably, the sequence variant of Nrg3 has at least 70%o sequence identity with SEQ ID No: 2. It is more preferred if the sequence variant has at least 80%>, more preferably at least 85%> and still more preferably at least 90%> sequence identity with SEQ ID No: 2. Most preferably, the sequence variant has 91 or 92 or 93 or 94 or 95 or 96 or 97 or 98 or 99% or more sequence identity with SEQ ID No: 2.

A "sequence variant" of Nrg3 also refers to a polypeptide that comprises or consists of a sequence variant of the Nrg3 EGF domain. Thus the variant may be Nrg3 or a fragment thereof, or a polypeptide other than a fragment of Nrg3, that comprises a sequence variant of the Nrg3 EGF domain. By a "sequence variant of the Nrg3 EGF domain" we include the Nrg3 EGF domain that has been altered by an amino acid insertion, deletion and/or substitution, either conservative or non-conservative, at one or more positions. Preferably, the sequence variant EGF domain of Nrg3 has at least 90 or 91 or 92 or 93 or 94 or 95 or 96 or 97 or 98 or 99% or more sequence identity with SEQ ID No: 3.

It is preferred if the sequence variant of the Nrg3 EGF domain has 5 or 4 or 3 or 2 amino acid alterations, or only one amino acid alteration.

As will be appreciated by a person of skill in the art, certain amino acid residues within the Nrg3 EGF domain can not be altered and still retain mammary differentiation ability. Such invariant residues include the C at position 6, C at position 14, G at position 18, C at position 20, C at position 33, C at position 35, G at position 41, R at position 43 and C at position 44 of the Nrg3 EGF domain (SEQ ID No: 3). These residues are the ones that were found to be conserved in the EGF domains from growth factors of a wide range of species (Landgraf et al, 1999).

The percent sequence identity between two polypeptides may be determined using suitable computer programs, for example the GAP program of the University of Wisconsin Genetic Computing Group and it will be appreciated that percent identity is calculated in relation to polypeptides whose sequence has been aligned optimally.

The alignment may alternatively be carried out using the Clustal W program (Thompson et al., (1994) Nucleic Acids Res 22, 4673-80). The parameters used may be as follows: Fast pairwise alignment parameters: K-tuple(word) size; 1, window size; 5, gap penalty; 3, number of top diagonals; 5. Scoring method: x percent. Multiple alignment parameters: gap open penalty; 10, gap extension penalty; 0.05. Scoring matrix: BLOSUM. A "modification" of Nrg3 refers to Nrg3 or a sequence variant or fragment thereof in which one or more of the amino acid residues has been chemically modified. Such modifications include forming salts with acids or bases, especially physiologically acceptable organic or inorganic acids and bases, forming an ester or amide of a terminal carboxyl group, attaching amino acid protecting groups such as N-t-butoxycarbonyl and glycosylation. Such modifications may protect the enzyme from in vivo metabolism or decrease antigenicity.

The invention also includes a fusion of Nrg3 or the Nrg3 EGF domain, or a fragment or sequence variant or modification thereof, which has Nrg3 mammary differentiation activity, to another compound. For example, the Nrg3 or variant may be fused to a molecule that can target the fusion protein to the mammary gland.

In vitro differentiation into mammary cells or glandular structures Reconstruction of the female breast after cancer surgery is a demanding task where the methods used today suffer from several disadvantages. Huss & Kratz (2001) investigated the possibility of tissue engineering methods to regenerate human autologous breast tissue. Human mammary epithelial cells and preadipocytes were derived from breast tissue biopsies from healthy women undergoing reduction mammoplasty, and the two cell types were co-cultured with conventional cell culture methods as well as in 3D matrices. The study showed that it is possible to harvest both human mammary epithelial cells and preadipocytes in a single session, propagate several subcultures, and that the cells maintain a normal intercellular distribution and growth-pattern when co-cultured in a 3D collagen gel.

We propose that growth and formation of a tissue closely resembling normal human breast tissue can be enhanced by the use of Nrg3 or a variant thereof in an in vitro cell culture set-up using basic tissue engineering principles, as well as in vivo. This concept may be of great importance in the development of new methods for reconstruction of the human breast. A third aspect of the invention thus provides a method of producing mammary tissue, the method comprising culturing cells and contacting the cells with Nrg3 or a variant thereof which has mammary cell differentiation activity.

Typically, the tissue will be epithelial cell or duct tissue, rather than fat.

Basic tissue engineering principles, as applied to mammary tissue engineering, are well known to a person of skill in the art, and are described for example in Patrick (2000), Patrick (2001), Bianco & Robey (2001), Huss & Kratz (2001), Parmar et al (2002) and Brey & Patrick (2000).

In an embodiment, the cells are contacted with the Nrg3 or variant thereof prior to being cultured.

Additionally or alternatively, the cells are contacted with the Nrg3 or variant thereof during culture.

Typically, the cells are cultured in a in a 3D scaffold. Suitable scaffolds are well known to a person of skill in the art and include a collagen matrix and collagen gel, for example a gel made from type I collagen and Matrigel, and porous biodegradable polymer foams, such as PLGA.

It is appreciated that the cells may be cultured together with additional factors and hormones that have been shown to influence mammary tissue differentiation, for example glucocorticoid, growth hormone, IGF-1, insulin, prostaglandins, thyroid hormone, and oestrogen, and possibly aFGF, bFGF and PDGF (Patrick, 2001)

It is preferred if the cells to be cultured are or include epithelial cells. The method can also be performed on mammary stem cells, fibroblasts and pre-adipocytes. The cells may be isolated from, or derived from, skin or mammary gland tissue or a combination of both skin and mammary gland tissue, both of which can be obtained from reduction mammoplasties.

It is appreciated that the cells can be cultured to produce mammary tissue in vitro or in vivo.

It is appreciated that not only can the mammary tissue produced be used for breast reconstruction after surgery, but it can also be used for cosmetic breast augmentation treatment, and to test new agents or carcinogenic processes to develop preventative therapies.

It is preferred that when the mammary tissue thus produced is intended to be introduced into a particular individual, the cells are isolated from, or derived from, that particular individual.

The invention thus includes a method of preparing mammary tissue for transplantation to a specific patient, the method comprising providing cells that have been obtained from the patient, and producing mammary tissue as described above.

The method may further comprise introducing the mammary tissue thus produced into the patient.

It is also appreciated that in another embodiment, the cells can be cultured in the patient in vivo, typically using a scaffold, ie the mammary material may be grown in situ.

Thus the invention includes the use of Nrg3 or a variant thereof which has mammary cell differentiation activity in the preparation of a medicament for producing mammary tissue in vivo.

Modification of mammary gland size and number We have shown that addition of Nrg3 to the mouse embryo leads to ectopic production of mammary glands. Without being bound by theory, we also believe that Nrg3 could be used to increase the size and/or number of mammary glands.

A fourth aspect of the invention thus provides a method of producing a non-human female mammal with extra and/or larger mammary glands, the method comprising administering Nrg3 or a variant thereof which has mammary cell differentiation activity to the embryo of said non-human mammal.

The invention includes the use of Nrg3 or a variant thereof which has mammary cell differentiation activity in the preparation of a medicament for producing a non-human female mammal with extra and/or larger mammary glands. Typically the medicament is formulated for administration to the embryo.

By increasing the size of mammary glands, we include the meaning that the average size of the mammary glands produced are as a result of practising the methods of the invention are larger than the average size of those produced by an animal of the same species and strain, in the absence of the methods of the invention.

The mammal may be any female mammal where an increased mammary size would be useful. Typically, the mammal will be one which is used commercially for milk production, such as a sheep, goat or cow. The mammal may also one where an increased mammary size would be useful in feeding large number of young from a single litter.

Methods and apparatus for administering an agent to the embryo are well known to a person of skill in the art. For example, the Nrg3 or variant thereof may be administered to the embryo in utero. Alternatively, the Nrg3 or variant thereof may be administered to the embryo in vitro, and the embryo subsequently inserted into the uterus of a non-human mammal. In this embodiment, the method may optionally include the prior step of removing the embryo from the uterus of a pregnant a non-human female mammal. However, this prior step is optional and a suitable embryo can be obtained via in vitro fertilisation techniques.

In an embodiment, administering the Nrg3 or variant thereof comprises administering a polynucleotide that encodes the Nrg3 or variant thereof to the embryo of the non-human mammal or to a precursor cell of the embryo.

The polynucleotide may comprise regulatory sequences that lead to expression of the Nrg3 or variant at the site of breast development.

The polynucleotide may comprise regulatory sequences that lead to expression of the Nrg3 or variant thereof immediately preceding and/or during mammary development and preferably in the region of the developing mammary bud and mammary gland. Suitable promoters may include the WntlOb promoter.

A fifth aspect of the invention provides a transgenic non-human mammal comprising an exogenous polynucleotide that encodes Nrg3, or a variant thereof which has mammary cell differentiation activity.

The exogenous polynucleotide may express Nrg3 or the variant thereof in the embryo immediately preceding and/or during mammary development, and preferably in the region of the developing mammary bud and mammary gland.

Additionally or alternatively, the exogenous polynucleotide may express Nrg3 or the variant thereof in the adult mammary gland.

Pharmaceutical Compositions

A sixth aspect of the invention provides a pharmaceutical composition comprising Nrg3 or a variant thereof which has mammary cell differentiation activity, or a polynucleotide that encodes the Nrg3 or derivative thereof, and a pharmaceutically acceptable carrier, diluent or excipient. Whilst it is possible for the Nrg3 or variant thereof to be administered alone, it is preferable to present it as a pharmaceutical formulation, together with one or more acceptable carriers. The carrier(s) must be "acceptable" in the sense of being compatible with the compound of the invention and not deleterious to the recipients thereof. Typically, the carriers will be water or saline which will be sterile and pyrogen free.

The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Such methods include the step of bringing into association the Nrg3 or variant thereof with the carrier which constitutes one or more accessory ingredients. In general the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

The pharmaceutical composition may be formulated for systemic administration.

Formulations suitable for parenteral administration include aqueous and non- aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets and the like.

In a preferred embodiment, the Nrg3 or variant thereof is stored as a freeze-dried powder ready to be made up as a solution for injection as required. Typically, the contents of a vial of freeze dried agent are reconstituted with sterile normal saline (0.9%) w/v), immediately before use. Alternatively, the pharmaceutical composition may be formulated for topical administration to the breast.

For application topically to the skin, the compounds of the invention can be formulated as a suitable ointment containing the active compound suspended or dissolved in, for example, a mixture with one or more of the following: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water. Alternatively, they can be formulated as a suitable lotion or cream, suspended or dissolved in, for example, a mixture of one or more of the following: mineral oil, sorbitan monostearate, a polyethylene glycol, liquid paraffin, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.

Preferred unit dosage formulations are those containing a daily dose or unit, daily sub-dose or an appropriate fraction thereof, of the Nrg3 or variant thereof.

It should be understood that in addition to the ingredients particularly mentioned above the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question.

An seventh aspect of the invention provides Nrg3, or a variant thereof which has mammary cell differentiation activity, or a polynucleotide that encodes the Nrg3 or derivative thereof, for use in medicine.

Prevention of breast cancer

The breast is not fully differentiated until after a full-term pregnancy. Younger age at first pregnancy and increased parity is associated with lower breast cancer risk. Nrg3 or a variant thereof may be used as a differentiating agent to promote differentiation of the epithelial cells in the breast without having an early pregnancy thus lowering the risk for breast cancer. Nrg3 or the variant thereof may be used to confer or maintain a differentiated mammary phenotype to epithelial cells in the breast, thus lowering the risk for breast cancer.

Typically, the cells to be differentiated are those that express ErbB4, and these include epithelial, myoepithelial and stromal cells.

A eighth aspect of the invention provides a method of preventing breast cancer in an individual, the method comprising administering to the individual Nrg3 or a variant thereof which has mammary cell differentiation activity, or a polynucleotide that encodes the Nrg3 or derivative thereof.

In other words, the invention provides a method of lowering an individual's risk of developing breast cancer, the method comprising admimstering to the individual Nrg3 or a variant thereof which has mammary cell differentiation activity, or a polynucleotide that encodes the Nrg3 or derivative thereof.

A ninth aspect of the invention provides a method of lowering the incidence of breast cancer in a population, the method comprising administering Nrg3 or a variant thereof which has mammary cell differentiation activity, or a polynucleotide that encodes the Nrg3 or derivative thereof, to a plurality of individuals in the population.

The Nrg3 or variant thereof will normally be administered by any parenteral route, in the form of a pharmaceutical formulation comprising the active ingredient, optionally in the form of a non-toxic organic, or inorganic, acid, or base, addition salt, in a pharmaceutically acceptable dosage foπn. Depending patient, as well as the route of administration, the compositions may be administered at varying doses.

The Nrg3 or variant thereof can be administered parenterally, for example, intravenously, intra-arterially, intraperitoneally, intrathecally, intraventricularly, intrasternally, intracranially, intra-muscularly or subcutaneously, or they may be administered by infusion techniques. They are best used in the form of a sterile aqueous solution which may contain other substances, for example, enough salts or glucose to make the solution isotonic with blood. The aqueous solutions should be suitably buffered (preferably to a pH of from 3 to 9), if necessary. The preparation of suitable parenteral formulations under sterile conditions is readily accomplished by standard pharmaceutical techniques well-known to those skilled in the art.

The Nrg3 or variant thereof or a formulation thereof may be administered by any conventional method including parenteral (eg subcutaneous or intramuscular) injection. The treatment may consist of a single dose or a plurality of doses over a period of time.

In an embodiment, the Nrg3 or variant thereof may be administered systemically. Most preferably, the Nrg3 or variant thereof or a formulation thereof is administered intravenously.

In an alternative embodiment the Nrg3 or variant thereof may be administered locally to the breast. Preferably, the Nrg3 or variant thereof is administered topically to the breast.

Formulations suitable for parenteral administration include aqueous and non- aqueous sterile injection solutions as described above. Alternatively, the Nrg3 or variant thereof can be administered topically using an ointment lotion or cream as described above.

Typically, the Nrg3 or variant thereof is administered to a female individual. However, there are approximately 200 cases in the UK per year of breast cancer in males, and Nrg3 may also applicable in these individuals.

In an embodiment, the Nrg3 or variant thereof is administered to a female individual who has not undergone a full-term pregnancy. The age at which the Nrg3 or variant thereof is administered to the individual may be determined by a physician. Typically, the Nrg3 or variant thereof will only be administered to an individual has undergone puberty.

Typically, the Nrg3 or variant thereof will only be administered to an individual over eighteen years of age. However, the Nrg3 or variant thereof may be administered to a young woman between the ages of 14-18, or to a woman between the ages of 18-25, or between the ages of 25-30, or between the ages of 30-35, or between the ages of 35-40, or between the ages of 40-45, or between the ages of 45-50 or to a woman over the age of 50.

Whether or not a particular patient is one who is expected to benefit from treatment may be determined by the physician.

The dose of the Nrg3 or variant thereof administered to the patient will typically be determined by the physician based on considerations such as the age, sex and size of the patient, and so on.

Thus the patient may be administered a dose of Nrg3, or the variant thereof, of less than 100mg/m², or between 100mg/m² and 500mg/m², or between 500mg/m² and 1 g/m², or higher. The average adult human (70kg) has a surface area of 1.5-1.75m², and absolute doses can be calculated accordingly.

The frequency, timing and dosage of administration of the Nrg3 or variant thereof may be determined by the physician.

It is appreciated that polypeptides may be delivered using an injectable sustained- release drug delivery system. These are designed specifically to reduce the frequency of injections. An example of such a system is Nutropin Depot which encapsulates recombinant human growth hormone (rhGH) in biodegradable microspheres that, once injected, release rhGH slowly over a sustained period. An alternative method of protein and peptide delivery is the ReGel injectable system that is thermo-sensitive. Below body temperature, ReGel is an injectable liquid while at body temperature it immediately forms a gel reservoir that slowly erodes and dissolves into known, safe, biodegradable polymers. The active drug is delivered over time as the biopolymers dissolve.

It is further appreciated that admimstering the Nrg3 may comprise administering a polynucleotide that encodes it. Similarly, when the variant of Nrg3 is a polypeptide, administering the variant may also comprise admimstering a polynucleotide that encodes it. This will lead to in vivo expression of the Nrg3 or variant thereof. Suitable vectors and methods are well known to a person of skill in the art.

A tenth aspect of the invention provides the use of Nrg3 or a variant thereof which has mammary cell differentiation activity, or a polynucleotide that encodes the Nrg3 or derivative thereof, in the preparation of a medicament for promoting the differentiation of a mammary cell in an individual.

The invention includes the use of Nrg3 or a variant thereof which has mammary cell differentiation activity, or a polynucleotide that encodes the Nrg3 or derivative thereof, in the preparation of a medicament for promoting the differentiation of a cell into a mammary cell.

An eleventh aspect of the invention provides the use of Nrg3 or a variant thereof which has mammary cell differentiation activity, or a polynucleotide that encodes the Nrg3 or derivative thereof, in the preparation of a medicament for preventing breast cancer in an individual.

In other words, the invention includes the use of Nrg3 or a variant thereof which has mammary cell differentiation activity, or a polynucleotide that encodes the Nrg3 or derivative thereof, in the preparation of a medicament for lowering an individual's risk of developing breast cancer. A twefth aspect of the invention provides the use of Nrg3 or a variant thereof which has mammary cell differentiation activity, or a polynucleotide that encodes the Nrg3 or derivative thereof, in the preparation of a medicament for lowering the incidence of breast cancer in a population of individuals.

Preferences for the formulation of the medicament are described above.

Screening methods

Further aspects of the present invention relate to screening methods for agents such as drugs that have a protective effect against breast cancer, or lead compounds for the development of such drugs.

The Nrg3 used in the screening methods and assays may be human Nrg3 as defined above. It is appreciated that the variant of Nrg3 used in the screening methods may be one as described above in the first aspect of the invention, providing that it has mammary cell differentiation activity.

In a thirteenth aspect, the invention provides a method of screening for an agent that has a protective effect against breast cancer, the method comprising: (a) providing mammary cells or mammary tissue produced according to the first, second or third aspects of the invention; (b) providing a test agent; (c) providing a cancer-inducing agent; and (d) assessing the rate and/or extent of tumourigenesis in the mammary cells or mammary tissue, wherein a reduction in the rate and/or extent of tumourigenesis in the presence of the test agent indicates that the test agent may have a protective effect against breast cancer.

In a fourteenth aspect, the invention also provides a method of screening for an agent that has a protective effect against breast cancer, the method comprising: (a) providing mammary cells or mammary tissue produced according to the first, second or third aspects of the invention; (b) inducing tumourigenesis in the mammary cells or mammary tissue; (c) providing a test agent; and (d) assessing the rate and/or extent of tumourigenesis in the mammary cells or mammary tissue, wherein a reduction in the rate and/or extent of tumourigenesis in the presence of the test agent indicates that the test agent may have a protective effect against breast cancer.

An agent tested in these screening methods may be an organic compound or another chemical. The agent includes, but is not limited to, a compound which may be obtainable from or produced by any suitable source, whether natural or not. The agent can be a peptide or polypeptide, or a chemical variant thereof, or a combination thereof. The agent may even be a nucleotide sequence - which may be a sense sequence or an anti-sense sequence. The agent may be designed or obtained from a library of compounds which may comprise peptides, as well as other compounds, such as small organic molecules, such as lead compounds.

In a fifteenth aspect, the invention provides a method of screening for a variant of Nrg3 that has a protective effect against breast cancer, the method comprising: (a) providing mammary cells or mammary tissue; (b) exposing the mammary cells or mammary tissue to a variant of Nrg3 that has mammary cell differentiation activity; (c) assessing the rate and/or extent of tumourigenesis in the mammary cells or mammary tissue, wherein a reduction in the rate and/or extent of tumourigenesis in the presence of the variant of Nrg3 agent indicates that the variant may have a protective effect against breast cancer.

This method allows the identification of particular variants of Nrg3 that may be especially useful in preventing breast cancer. In this embodiment, the mammary cells or mammary tissue used may have a tendency to become tumourigenic in the absence of a cancer-inducing agent, typically through genetic modification.

In an alternative embodiment, the method further comprises providing a cancer- inducing agent, before step (c).

A large number of cancer-inducing agents are known in the art and include chemical agents such as carcinogens, genetic agents such as oncogenes, and regulators of the genetic agents. Appropriate agents can readily be selected by a person of skill in the art.

Suitable assays for determining whether or not an agent has an anti-cancer effect, ie for assessing the rate and/or extent of tumourigenesis, are well known in the art. Cancer modelling in the mouse is reviewed by Dyke & Jacks (2002).

It will be appreciated that in the screening methods described herein, the agent identified may be a drug-like compound or lead compound for the development of a drug-like compound. The invention thus includes a method of identifying a drug-like compound or lead compound for the development of a drug-like compound that has a protective effect against breast cancer, using the screening methods described above. The invention therefore includes modifying an agent identified as a result of the screening methods described above, or taking a further compound having or expected to have similar properties to an agent identified as a result of the screening methods, and screening the modified agent or further compound as described above.

Typically, the test agents which have the desired effects in the above assays are selected for further investigation. Preferably, they are screened further, for example in a cell and/or animal model of breast cancer and test agents are selected from these assays for further study if they are seen to have a desirable effect in the further screen. Suitable models of breast cancer are known in the art and include MCF-7 cells xenografted into nude mice. A sixteenth aspect of the invention provides a method for inhibiting the differentiation of a mammary cell, the method comprising contacting the mammary cell with an antagonist of Nrg3.

The invention also includes a method of preventing a precursor epithelial cell becoming a mammary epithelial cell, the method comprising contacting the precursor epithelial cell with an antagonist of Nrg3.

The invention also includes a method of reversing the differentiation of a mammary cell, the method comprising contacting the mammary cell with an antagonist of Nrg3.

Typically, the antagonist of Nrg3 is an anti-Nrg3 antibody. Polyclonal antibodies to the EGF domain of Nrg3 can be obtained from R&D Systems, and are described in Dunn et al (2004).

Other antagonists of Nrg3 may include ErbB4 inhibitors such as anti-ErbB4 antibodies. Anti-ErbB4 antibodies of rabbit origin can be obtained from a number of commercial sources including Santa Cruz Biotechnologies.

All of the documents referred to herein are incorporated herein, in their entirety, by reference.

The listing or discussion of a prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.

The invention will now be described in more detail by reference to the following figures and Examples.

Figure Legends Figure 1: Mammary bud 3 is absent and ectopic mammary buds form in A/J mice. Lefl expression marks the position of mammary buds. Numbers denote the positions of the five mammary gland anlage. FL, forelimb bud. HL, hindlimb bud. A-B: Mammary buds are first observed in 48 somite embryos when bud 2 has not yet formed. Mammary bud 3 has not formed in an A/J embryo (A) shown by comparison with B6 (B). C-E: Mammary buds in E12.5 embryos. C: 53 somite A/J embryo with absent bud 3. D: 55 somite B6 embryo. E: 54 somite A/J embryo with supernumerary mammary bud adjacent to mammary bud 4. This is shown in magnified view in the inset. The ectopic bud is denoted by an arrow and a line of Lefl expressing cells connecting bud 4 to the ectopic bud is marked by an arrowhead. At this stage, there is a line of Lefl expressing cells connecting bud 4 to bud 5 (denoted by a black line).

Figure 2: Genetic and physical maps of the ska genomic region. Map of a 13.32 Mb genomic interval between markers D14MU14 and D14MU129 on mouse chromosome 14. Genetic markers from transcription units and polymorphic sequences in intragenic regions used to delimit the position of the ska mutation are highlighted. Primer sequences for these markers are given in Table 1. The

Newegulin3 intron-exon structure is indicated in the lower exploded view. Asterisks indicate Nrg3 introns which contain polymorphic genetic marker(s). A J bacteriophage lambda clones (λ A, B, and C) are indicated. The location of three

A/J BAC clones (Chori27: 2G18, 2H17, and 8M5) and one B6 BAC clone (RP24-

199A21) used to sequence the 75.6 kb candidate interval are indicated. A 2.5 kb gap in the Ensembl Celera genomic assemblies was sequenced and this location is indicated. Haplotype data of informative recombinant inbred mice are shown.

Each column represents the type of chromosome identified in these mice. A black square represents the B6 allele and an open square denotes the A/J allele.

Figure 3: Expression of Neuregulin3 in the ventral surface of El 0.75, El 1.0, El 1.75, and E13.5 (B6) embryos. Wholemounts of embryos subjected to in situ hybridization with digoxigenin-labelled Nrg3 probes. A-E: Nrg3 transcript distribution in the presumptive mammary region. A: El 0.75: 38 somite-stage embryo with dermal comet of Nrg3 expression surrounding future site of number 3 mammary gland. B: Higher magnification of (a). C: El 1.0: 45 somite-stage embryo, Nrg3 expression in dermis around area where buds 3 and 4 will subsequently form. D: frozen cross section (10 μm) of region where number three mammary bud will form of embryo shown in (c) showing Nrg3 expression in the mesenchyme surrounding the nascent mammary anlage. E: El 1.75: 47 somite- stage embryo showing Nrg3 expression in the mesenchyme surrounding mammary buds 3 and 4. F: El 3.0: 60 somites showing Nrg3 expression in the mesenchyme surrounding the mammary buds and in the mammary bud proper in buds 2, 3, and 4. Numbers denote the positions of the five mammary gland anlage.

Figure 4: Expression of FgflO in El l.75 embryos. 47 somite embryos (El 1.75) just before morphological appearance of the mammary gland bud number three were subject to in situ hybridisation with FgflO probe. A: The line of FgflO expression extends to somite 18 in A/J embryo. B: The line of FgflO expression extends to somite 17 in B 6 embryo.

Figure 5: Nrg3 can induce ectopic mammary gland bud formation and Lefl expression in cultured mouse embryos. A: Whole mount in situ hybridisation with a Lefl antisense probe of B6 embryo implanted with two Nrg3-soaked beads and cultured for 24 hours. One bead (bl) was implanted slightly dorsal to the site along the anterior-posterior axis where bud three should subsequently form and the other bead (b2) was implanted along the level that mammary buds are expected to form but at a position along the anterior-posterior axis between the sites of mammary buds 3 and 4 (at the level spanning somite 20 to 21). The endogenous mammary gland buds 2 (mg2) and 3 (mg3) formed during the culture period and are indicated by arrows. B-G: Paraffin sections of Nrg3-soaked beads implanted in B6 mouse embryo explant shown in (a). B: Section through level of somite 17 shows Lefl expression in bud 3 on both sides of embryo and the location of bead 1 (bl) below endogenous bud 3. C: Section through ectopic bud 1 (ectl) shows Lefl expression in endogenous bud 3 and ectopic expression induced by Nrg3-soaked bead. D: Higher magnification section through ectl showing Lefl expression adjacent to bead. E-F: Lefl expression and two ectopic mammary buds are induced by Nrg3-soaked bead implanted at the level of somite 20 along the "mammary line". E: Section through the anterior edge of bead 2 (b2) at level of ectopic bud 2 (ect 2). Ectopic Lefl expression is observed adjacent to implanted bead (b2). F: Section through the posterior edge of bead 2 at level of ectopic bud 3 (ect 3) with induced Lefl expression, fib, forelimb bud

Figure 6: Genomic sequence spanning the polymorphic microsatellite sequence within intron seven of Nrg3. 6A: A/J, Balb/c, C3H, DBA/1J, DBA/2J SSR consensus (SEQ ID No. 4); 6B: B6 SSR consensus (SEQ ID No. 5). Microsatellite sequence is underlined in A/J and B6 genomic sequence. Exon 7 of Nrg3 is indicated by bold, italic typeface, and the primers used for amplifying the microsatellite are indicated in boldface.

Figure 7: Expression of Neuregulin3 and Neuregulin3 in the presumptive mammary region of E10.75, El 1.0, El 1.75, and E12.5 (B6) embryos. Wholemount in situ hybridization of embryos with digoxigenin-labelled Nrg3 probes and immunohistochemical detection of Nrg3. Numbers denote the positions of the mammary gland anlage. FL, forelimb bud. HL, hindlimb bud. The presumptive site of mammary bud 3 (at somite 18) is boxed and of bud 4 (at somite 24) is indicated by an arrow in embryos where mammary buds are not yet morphologically distinct. When the buds are morphologically distinct, they are indicated by numbers. A-M, Nrg3 transcript and Nrg3 protein distribution in the presumptive mammary region.

A. E10.75: 38 somite-stage embryo with a comet of Nrg3 expression underlying the future site of number 3 mammary gland. Boxed area at level of somite 18 is magnified in inset.

B. El 1.0: 41 somite-stage embryo with dermal comet of Nrg3 expression surrounding future site of number 3 mammary gland.

C. Higher magnification of (B) at level of somite 18. D. Higher magnification of (B) at level of somite 24.

E. El 1.5: 45 somite-stage embryo, Nrg3 expression in dermal mesenchyme underlying where buds 3 and 4 will subsequently form. F. Vibratome cross section (40 μm) across level of somite 18 where number three mammary bud will form in embryo shown in (E) showing Nrg3 expression in the mesenchyme underlying the nascent mammary anlage.

G. Higher magnification of (E) at level of somite 18. H. El 1.75: Vibratome cross section (60 μm) across level of somite 18 where mammary bud 3 has just formed in a 47 somite stage embryo showing Nrg3 expression in the epithelia of the nascent mammary anlage. Bud 3 is boxed and shown in magnification in insets. I. El 1.75: Vibratome cross section (60 μm) across level of somite 24 where number 4 mammary bud has just formed in the same 47 somite stage embryo in (H) showing Nrg3 expression the nascent mammary anlage 4 and 5. The region where bud 4 and 5 are forming is boxed and shown in magnification in the inset. Nrg3 is expressed in the epithelia of bud 4 and in the mesenchyme underlying the future site of mammary bud 5. J. E12.5 sagittal section 54 somite stage embryo showing Νrg3 expression.

Widespread neural expression is observed as well as expression in mammary buds 1 and 4 which are boxed. Inset 1 shows higher magnification mammary gland anlage 1. Arrows denote Nrg3 expression in the mesenchyme adjacent to the mammary epithelia. A few mammary epithelial cells express Nrg3 (arrowheads). Arrowhead denotes nerve expressing Nrg3. Inset 4 shows higher magnification of mammary gland bud 4. An arrow denotes the epithelial cells of the mammary bud which express Nrg3. The epithelia adjacent to the mammary bud also express Nrg3. K. El 3.0: Section from 60 somite stage embryo showing Nrg3 expression in the mammary bud 4 and adjacent epithelia.

L. E13.0: Section stained with hematoxylin from 60 somite stage embryo showing mammary bud 4 and adjacent epithelia.

Figure 8: Nrg3 isoforms expressed in presumptive mammary region of B6 and A/J mice. In order to determine the isoform(s) relevant for mammary gland morphogenesis, we isolated RNA from microdissected lateral plate mesoderm and overlying ectoderm at stages prior to mammary bud formation. RT-PCR analysis revealed the subset of Nrg3 isoforms that are expressed in the presumptive mammary region during embryogenesis. Numbers denote exons. The Egf domain, extracellular, transmembrane and cytoplasmic domains are indicated. A variant in exon 4 in which the first three basepairs are skipped is indicated by +/- CAG. Inclusion of intronic sequences between exons 7 and 8 are indicated by +21 and +24.

Figure 9: Nrg3 isoforms expressed in presumptive mammary region.

A. Tissues were microdissected from the presumptive mammary region from El l embryos between 43-45 somites and 46-48 somites so that the region spanning where buds 2 to 4 will form (between somite 11-24 of the presumptive mammary region) were isolated. FL, forelimb bud. HL, hindlimb bud.

B. Differential expression of Nrg3 was observed in the lateral plate mesoderm and overlying ectoderm isolated from the A/J strain compared to that isolated from B6. Quantitative real time RT-PCR was used to deteπnine the level of Nrg3 expressed in the presumptive mammary region. Table shows the relative number of transcripts encoding Nrg3 isoforms containing the Egf domain after normalization to Gapdh.

C. Summary of Nrg3 transcription in the mammary region as determined by qRT-PCR and WMISH. "+" indicates Nrg3 transcript levels at future bud sites. "-" indicates no detectable Nrg3 transcripts at site (as determined by WMISH). "X" denotes hypoplastic bud. Numbers denote buds that are morphologically distinct; these transcripts are post-specification. The region of tissue used for analysis in (A) is boxed.

Figure 10: Tbx3 levels as determined by semi-quantitative RT-PCR as a dissection control to assess microdissection of lateral plate mesoderm and overlying ectodeπn. Gapdh was amplified in parallel as a control.

Figure 11: Erbb4 expression in the presumptive mammary region. A-F, Expression of Erbb4 in the presumptive mammary region of El 1.0, El 1.5, and El 2.5 (B6) embryos. Wholemounts of embryos were subjected to in situ hybridization with digoxigenin-labelled Erbb4 probes. Numbers denote the positions of the mammary gland anlage. FL, forelimb bud. HL, hindlimb bud. The site of presumptive mammary bud 3 (at somite 18) is boxed and of bud 4 (at somite 24) is indicated by an arrow in embryos where mammary buds are not yet morphologically distinct. Mammary bud 3 is boxed and indicated by "3" in embryos where this bud is morphologically distinct. A-F, Erbb4 transcript distribution in the presumptive mammary region; H-K, Expression of Erbb2 and Erbb4 in the mammary region at E12.5-E13.

A. El 0.75: 40 somite-stage embryo with comet of Erbb4 expression underlying future site of number 3 mammary gland. B. Higher magnification of (A) at level of somite 18.

C. El 1.5: 46 somite-stage embryo, Erbb4 expression in dermal mesenchyme underlying area where buds 3 and 4 will subsequently form.

D. Higher magnification of (C) at level of somite 18.

E. Vibratome sagittal section (60 μm) of mammary bud 4 in embryo shown in (C) showing Erbb4 expression in the mesenchyme underlying the future site of mammary bud 4.

F. El 2.5 53 somite stage embryo showing Erbb4 expression in the mammary buds 2, 3, and 4. Magnified insets are adjacent to the mammary buds.

G. Vibratome cross section (60 μm) of mammary bud 3 in embryo shown in (E) showing Erbb4 expression in the outer epithelial layer of the mammary bud.

H. E12.5: Section from 54 somite stage embryo showing Erbb2 expression in the mammary bud 1 epithelia and underlying mesenchymal cells and adjacent epithelia.

I. E12.5: Section from 54 somite stage embryo showing Erbb4 expression in the mammary bud 1 and adjacent epithelia.

J. E13.0: Section from 60 somite stage embryo showing Erbb2 expression in the mammary bud 4 and adjacent epithelia.

K. El 3.0: Section from 60 somite stage embryo showing Erbb4 expression in the mammary bud 4 and adjacent epithelia.

Figure 12: Expression patterns of major regulators of mammary gland organogenesis in A/J and B6 strains of mice as determined by whole mount in situ hybridization. Arrows indicates end of mammary line expression at edge of somite 18. Boxed areas indicate mammary line expression between limb buds. FL, forelimb bud. HL, hindlimb bud. This figure shows:

FgflO expression in the presumptive mammary region of: A. B6 33 somite-stage embryo.

B. Mammary line from B6 33 somite-stage embryo shown in A.

C. A/J 32 somite-stage embryo.

D. Mammary line from A/J 32 somite-stage embryo shown in C.

E. B6 46 somite-stage embryo. F. A/J 46 somite-stage embryo.

Tbx3 expression in the presumptive mammary region of: G. B6 42 somite-stage embryo. H. A/J 40 somite-stage embryo.

WntlOb expression in the presumptive mammary region of: I. B6 50 somite-stage embryo.

J. A/J 52 somite-stage embryo

Figure 13: Cartoon depicting genes regulating early mammary gland morphogenesis in ska mutant and wild-type mice, and the genetic control of early stages of mammary gland morphogenesis.

A. Mammary gland morphogenesis begins with the expression oϊ FgflO in the lateral plate mesoderm in the 30 somite stage embryo. FgflO expression extends as a line from the forelimb bud to the level of somite 18 (the future site of mammary gland 3) in the dermamyotome.

B. This is followed by expression of Tbx3 from somite stages 32 through 46. Tbx3 expression extends from the forelimb bud to the hindlimb bud and marks the presumptive mammary line. The expression of both FgflO and Tbx3 is unaltered in ska mutant mice.

C. At 38 somite stage, there is localized expression of Nrg3 at the level of somite 18 in the lateral plate mesoderm. This is absent in ska mutant mice. 33

D. Nrg3 induces expression of Lefl in the overlying ectoderm, thereby determining its fate to become mammary bud.

Figure 14: Nrg3 can induce ectopic mammary gland bud formation and Lefl expression in cultured mouse embryos. Numbers denote the positions of the mammary gland anlage which have formed during the culture period. FL, forelimb bud. HL, hindlimb bud.

A. Whole mount in situ hybridization with a Lefl antisense probe of B6 embryo (implanted at 41 somite stage) with an Nrg3 -soaked bead and cultured for 24 hours. Bead was implanted along the "mammary line" between the sites where buds 3 and 4 will subsequently form. The boxed area highlights the ectopic bud that has formed adjacent to the implanted bead and is indicated by the circled area in the magnified inset.

B. Paraffin section through Nrg3 -soaked bead shown in (A) shows Lefl expression is confined to ectopic bud.

C. Hematoxylin- stained section through Nrg3-soaked bead shown in (A) shows location of ectopic bud.

D. Higher magnification of (C). Black arrows indicate dense mesenchyme adjacent to ectopic bud. E. Sagittal hematoxylin-stained section through B6 embryo (implanted at 42 somite stage) with an Nrg3-soaked bead and cultured for 24 hours. Bead was implanted along the "mammary line" between the sites where buds 2 and 3 will subsequently form. The * indicates the location of the bead. An arrow indicates the location of the ectopic bud. F. Higher magnification of (E). Arrows indicate dense mesenchyme observed in wild-type (B6) mice along the putative mammary line.

Figure 15. Controls for Nrg3 functional assay. Whole mount in situ hybridizations were performed with a Lefl antisense probe for B6 embryos implanted with beads soaked in BSA, EGF, or HRG-B and cultured for 24 hours. The beads were implanted along the "mammary line" between the sites where bud three and four should subsequently form. No Lefl expression was observed adjacent to implanted beads. No buds were observed adjacent to implanted beads. FL, forelimb bud. HL, hindlimb bud. WD, wolffian duct.

A. Whole mount in situ hybridization for Lefl of B6 embryo implanted with a BSA-soaked bead and cultured for 24 hours. The boxed area highlights the area adjacent to the implanted bead.

B. Hematoxylin- stained section through BSA-soaked bead.

C. Whole mount in situ hybridization for Lefl in B6 embryo implanted at 42 somite stage with an Egf-soaked bead and cultured for 24 hours. No Lefl expression is observed adjacent to bead. D. Hematoxylin- stained section through BSA-soaked bead.

E. Whole mount in situ hybridization for Lefl in B6 embryo implanted at 42 somite stage with an HrgB-soaked bead and cultured for 24 hours. No Lefl expression is observed adjacent to the bead.

F. Hematoxylin- stained section through HrgB -soaked bead.

Figure 16: Dense mammary line mesenchyme is observed in wild-type (B6) mice at sites where mammary buds form.

A. Sagittal H and E- stained section of a 46 somite B6 embryo. Numbers denote mammary buds 3 and 4. B. Magnification of (A) around bud 3. Arrows indicate dense mesenchyme at sites where mammary buds form.

C. Magnification of (A) around bud 4. Arrows indicate dense mesenchyme at sites where mammary buds form.

Figure 17: Nrg3 can induce ectopic mammary gland bud formation and Lefl expression in cultured A/J mouse embryos. Numbers denote the positions of the mammary gland anlage which have formed during the culture period. FL, forelimb bud. HL, hindlimb bud. A. Whole mount in situ hybridization with a Lefl antisense probe of A J embryo implanted (at 40 somite stage) with two Nrg3-soaked beads and cultured for 24 hours. The beads were implanted along the "mammary line" between the sites where buds 3 and 4 will subsequently form. The boxed area highlights the ectopic bud that has formed adjacent to the implanted beads and is indicated by arrowheads in the magnified inset.

B. Sagittal hematoxylin- stained section through A J embryo shown in (A). The *s indicate the locations of the beads. An arrow indicates the location of the ectopic bud. This bud spans the anterior-posterior axis that the 2 beads span and is either larger than a normal bud or the result of the fusion of 2 nascent buds.

C. Higher magnification of (B). Arrows indicate the dense mesenchyme along the putative mammary line but in ska (A/J) mice this has a more disorganized appearance. D. Whole mount in situ hybridization with a Lefl antisense probe of 41 somite stage A/J embryo implanted at the level of somite 20 with an Nrg3-soaked bead and cultured for 24 hours.

E. Sagittal hematoxylin- stained section through A/J embryo shown in (D). The * indicates the location of the bead. An arrow indicates the location of the ectopic bud.

F. Higher magnification of (E). Arrows indicate dense mammary line mesenchyme.

Figure 18. Nrg3 functional assay in BAT-gal and (BAT-gal x B6) mice. Nrg3 can induce BAT-gal expression in cultured mouse embryos. Cells expressing the BAT-gal transgene appear blue. FL, forelimb bud. HL, hindlimb bud. Somite 18, the future site of bud 18 is indicated. The * indicates the location of the bead.

A-E. Whole-mount X-gal stained BAT-gal embryos. Arrows indicate the streak of blue-staining cells that occurs in the presumptive mammary line between the limb buds. Arrowheads indicate blue-staining cells on the surface of the embryo adjacent to Nrg3-soaked bead. We observe an increase in reporter gene expression in explanted embryos implanted with Nrg3 -soaked beads along the presumptive mammary line when compared to BSA-soaked beads.

A. Whole-mount X-gal stained BAT-gal embryos (implanted at 40 somite stage) with an Nrg3-soaked bead and cultured for 24 hours. Bead was implanted along the "mammary line" between the sites where buds 3 and 4 will subsequently form.

B. Higher magnification of presumptive mammary region from the embryo shown in A. C. Sagittal section of presumptive mammary region from embryo shown in A. The mesenchymal cells along the presumptive mammary line and cells adjacent to the Nrg3-soaked bead (marked by *) express BAT-gal.

D. Whole-mount X-gal stained BAT-gal embryos (implanted at 41 somite stage) with a BSA-soaked bead and cultured for 24 hours. Bead was implanted along the "mammary line" between the sites where buds 3 and 4 will subsequently form.

E. Sagittal section showing presumptive mammary region from embryo shown in D. The cells adjacent to the site of the BSA-soaked bead are marked by *. Mesenchymal cells along the presumptive mammary line express BAT-gal.

F-O. Whole-mount X-gal stained (BAT-gal x B6) embryos. In B6 x BAT-gal embryos, which are heterozygous for the BAT-gal reporter gene (and display lower levels of reporter gene expression than homozygotes), we observe an increase in reporter gene expression in explanted embryos implanted with Nrg3- soaked beads along the presumptive mammary line when compared to BSA- soaked beads.

F. Whole-mount X-gal stained (B6 X BAT-gal) embryo (implanted at 39 somite stage) with an Nrg3 -soaked bead and cultured for 24 hours. Bead was implanted at somite 20 along the "mammary line" between the sites where buds 3 and 4 will subsequently form.

G. Vibratome cross section (60 μm) across level of somite 20 from embryo shown in F. Boxed area shows region adjacent to Nrg3-soaked bead which displays increased BAT-gal expression in both mesenchymal and epithelial cells. H. Magnification of boxed region in G. Arrowhead indicates blue-staining localized epithelial thickening of cells on the surface of the embryo adjacent to Nrg3 -soaked bead.

I. Whole-mount X-gal stained (B6 X BAT-gal) embryo (implanted at 39 somite stage) with an Nrg3-soaked bead and cultured for 24 hours. Bead was implanted at somite 19 along the "mammary line" between the sites where buds 3 and 4 will subsequently form.

J. Vibratome cross section (60 μm) across level of somite 19 from embryo shown in I. Boxed area shows region adjacent to Nrg3 bead which has increased BAT-gal expression in both mesenchymal and epithelial cells.

K. Magnification of boxed region in J. Arrowheads indicate blue-staining epithelial thickening of cells on the surface of the embryo adjacent to Nrg3-soaked bead that extends dorsally.

L. Whole-mount X-gal stained (B6 X BAT-gal) embryo (implanted at 40 somite stage) with a BSA-soaked bead and cultured for 24 hours. Bead was implanted at somite 19 along the "mammary line" between the sites where buds 3 and 4 will subsequently form.

M. Vibratome cross section (60 μm) across level of somite 19 from embryo shown in L. Boxed area shows region adjacent to BSA bead which has increased BAT-gal expression in Nrg3 -implanted embryos.

N. Magnification of boxed region in M.

O. Vibratome cross section (60 μm) across level of somite 18 from embryo shown in L. Boxed area shows region where bud 3 will subsequently form.

P. Magnification of boxed region in O. Arrowheads indicate blue-staining localized epithelial thickening of cells on the surface of the embryo at the presumptive bud 3 region that extends dorsally.

Example 1: Positional cloning of scaramanga implicates the ErbB4 ligand Neuregulin3 in mammary gland specification

Introduction

The selectable and heritable nature of mammary gland number in sheep was demonstrated by Alexander Graham Bell over 100 years ago¹. Subsequent analysis in mice supported the suggestion that a genetic component was involved². Specification of the mammary epithelial phenotype is thought to occur during embryogenesis when signals from the mesenchyme pattern the overlying ectoderm such that the epithelial cells aggregate locally to form the mammary bud (Propper and Gomot 1967; Hogan 1999). Genetic studies have implicated FgflO, Lefl, and Tbx3 in the control of developmental processes such as competency and determination during early mammary gland morphogenesis (van Genderen et al. 1994; Mailleux et al. 2002; Davenport et al. 2003; Eblaghie et al. 2004). However, none of these genes have yet been directly implicated in mammary gland specification er se and the precise genetic interactions and hierarchies involved in the initial stages of mammary gland morphogenesis remain to be elucidated (Veltmaat et al. 2003).

The mouse scaramanga (ska) mutation impairs some of the earliest aspects of mammary gland development^3,4. In ska homozygotes, the number three mammary bud is hypoplastic from embryonic day 11.75, leading to a reduced sized or absent bud. In addition, ska homozygotes form supernumerary glands at a high frequency indicating ectopic induction events. Here we provide evidence that the gene affected in ska mice encodes the ErbB4 ligand, Neuregulin3^5"7. First, we used positional cloning to narrow the interval containing ska to 86kb containing the distal part of the Nrg3 gene. Within this region the only sequence difference between ska and wild-type mice is in a microsatellite repeat within intron 7. This alteration correlates with variations in Nrg-3 expression profiles both at the whole embryo level and locally in the presumptive mammary region in ska mice.

Secondly, localised Nrg3 expression in the presumptive mammary region prior to morphological appearance of buds and the expression of bud epithelial markers suggest an inductive role for Νrg3. Finally, we have shown that Nrg3 -soaked beads induce ectopic mammary bud formation in mouse embryo explant cultures, and epithelial bud formation can be observed histologically, suggesting initiation of mammary bud development occurs. These results indicate that a Neuregulin signaling pathway is involved in the earliest stages of embryonic mammary gland morphogenesis and support the long held view that mesenchymal signal(s) are responsible for mammary gland induction.

In most strains of mice, five pairs of mammary glands form at precise and invariant positions along the anterior-posterior, dorsal-ventral axis. Variable positions and numbers of mammary glands are observed in the A/J strain of mice whereas the C57BL/6 (B6) strain is wild-type for mammary gland patterns. The gene altered in A/J mice responsible for variation in mammary gland location is called scaramanga (skάf^A. The mammary phenotypes of ska mutant mice are variable but highly penetrant; one or both number 3 mammary buds are absent or drastically reduced in size and ectopic mammary buds also form at a high frequency. Mammary buds 1, 2, 4 and 5 foπn normally but deviations from the stereotypic positions may occur. The ska mutant phenotype is easily detected from somite number 48 stage (embryonic day 11.75) onward during embryonic development using differences in expression of an early mammary epithelial bud marker, Lefl (Figure 1). In ska homozygotes, the number three mammary bud is hypoplastic from embryonic day 11.75, leading to a reduced sized or absent bud indicating a defective inductive event (Howard and Gusterson 2000a; Howard and Gusterson 2000b). In addition, supernumerary glands are formed at a high frequency in ska mice demonstrating ectopic induction. The mammary phenotypes observed in the A/J strain are consistent with abnormal inductive events occurring prior to the morphological appearance of the mammary bud.

We previously mapped ska to the proximal region of mouse Chromosome (Chr) 14 between microsatellite markers D14MH14 and D14M 129 using the AXB/BXA recombinant inbred (RI) mouse strains⁴'⁸. DNA sequence from mouse genome databases (Celera Genomics and Ensembl) indicated that these markers delimited a 13.32 Mb portion of chromosome 14⁹.

Methods Genetic and physical mapping

Scaramanga (ska) was previously described and characterized³'⁴. Genomic DNAs from the AXB/BXA recombinant inbred mice were purchased from the Jackson Laboratories. PCR genotyping was done by standard protocols²⁷. B6 genomic sequence was obtained from the Mouse Genome Sequencing Consortium, Mouse Assembly 3 February 2002 freeze⁹. To obtain DNA sequence from the A/J strain, a bacteriophage λ library from A/J genomic DNA was prepared and screened by hybridisation with probes derived from the ska critical region. Additional A/J DNA sequences were obtained from the Celera mouse genome database. Whole-mount in situ hybridization

Mouse embryos were from timed B6 or A/J matings. In situ hybridization protocols were as described²⁸. Digoxigenin-labelled sense and anti-sense RNA was synthesised following standard protocols (Roche). Probes were generated from plasmids containing mouse FgflO (nucleotide (nt) position 266-926 of Genbank accession no. NM_008002), Lefl (nt positions 1777-2385 of Genbank accession no. NM 310703), Tbx3 (nt positions 3390-4230 of Genbank accession no. NM_011535) and WntlOb (nt positions 263-2030 of Genbank accession no. NM_01 1718). Five Nrg3 probes corresponding to nt 1-680, nt 1242-1850 and 1923-2538, nt 827-1321 for ex 2-3, and nt 1435-1922 of Genbank accession no. NM_008734) were generated. All Nrg3 anti-sense probes gave similar results and sense probes gave no specific signal (data not shown). An Erbb4 anti-sense probe corresponding to nt 558-1527 of Genbank accession no. XM_136682 was generated. A sense probe gave no specific signal (data not shown).

Embryo explant cultures

Recombinant Nrg3 was prepared as described by Hobbs²⁹. The coding region of

Nrg3 spanning the two EGF repeats (Ser284-Gln360) was amplified and subcloned into pMTBiP- V5HisB (Invitrogen). S2 Schneider cells were co- tranfected with this construct and with pCoHygro. Transfected S2 cells were selected with Hygromycin and were pooled to select stable cell lines. Cell lines were expanded and grown in serum-free insect cell media supplemented with ImM CuSO4 to induce recombinant Nrg3 (rNrg3) expression. rNrg3 was purified and concentrated by ultrafiltration, dialysis, and chromatography using Ni²⁺ beads.

Affigel blue agarose beads (Bio-Rad) were washed in PBS and incubated with solutions of 1 mg/ml BSA, 1 mg/ml Nrg3, 1 mg/ml EGF, or 37 μg/ml Heregulin- 1B solution (HRG- IB) for 2 hours at room temperature and then overnight at 4°C in silconised microfuge tubes. Mouse EGF was obtained from Roche and HRG- 1B was obtained from Upstate. Explant cultures were prepared from A J or C57BL/6 or BAT/gal embryos (Maretto et al, 2003) harvested between day El 0.5 and El 1.5. Beads soaked in protein (EGF, NRG3, HRG-1B or BSA) were implanted in the flank of the embryo along the line where the mammary buds should form. Organotypic culture in F12/DMEM 1 :1 media supplemented with streptomycin, penicillin, glutamine and 4% BSA (ICN, True Cohn)) of the embryos proceeded in Falcon 353037 organ culture dishes for 24 hours in a 5% CO2 chamber. The embryos were fixed in 4% paraformaldehyde and processed for whole mount in situ hybridisation and probed with Lefl antisense and sense probes. No specific signal was observed surrounding BSA, EGF, or Heregulin-IB soaked beads when hybridized with either Lefl antisense or sense probes. BAT- gal and (B6 x BAT-gal) explanted embryos were fixed and stained with X-gal (5- bromo-4-chloro-3-indolyl-D-galactoside)(Hogan et al. 1994). Sections from BAT-gal embryos were counterstained with nuclear fast red..

cDNA sequencing

Reverse transcription with oligo(dT) was performed with Thermoscript (Invitrogen) on total RNA isolated from whole embryos or from microdissected tissue. Gene specific primers were used to amplify cDNA using PCR. PCR products were directly sequenced or subcloned into pTOPO4 (Invitrogen) and sequenced.

Quantitative real-time reverse transcriptase-polymerase chain reaction

Tissues from the presumptive mammary region of El l -El 1.5 embryos were microdissected spanning the level of somite 11 through 24. 5 μg of total RNA was reverse-transcribed using Thermoscript (Invitrogen). lμl of the cDNA obtained was subjected to quantitative real-time amplification on the ABI 7700 Sequence Detector using the TaqMan universal PCR Master Mix (ABI). Primer sequences are:

Nrg3F: TTGTGATTGAGACCCTGACAGG (SEQ ID No. 6) Nrg3R: GGCTACCAAGGAGTCCGTTG (SEQ ID No. 7)

Amplification cycles consisted of an initial 2 min at 50°C, and then 10 min at 95°C, followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min. Analysis was perfoπned using ABI Prism Sequence Detector System (version 1.7 software). Reactions lacking reverse transcriptase were performed to control for genomic DNA amplification. Relative standard curves for both genes were obtained by perfoπning two-fold dilutions of a cDNA pool. The relative concentrations were normalized to the Rodent glyceraldehyde 3-phosphate dehydrogenase (Gapdh) (ABI) levels. Fold changes were obtained of A/J relative to B6 samples. Each experiment was repeated using two independent sources of RNA and within each experimental repeat amplifications were performed in triplicate. Relative expression of the gene was calculated. The average fold change ratio and the standard error of the mean were determined.

Tbx3 levels were also determined by semi-quantitative RT-PCR as a dissection control to assess microdissection of lateral plate mesoderm and overlying ectoderm. cDNAs used in quantitative RT-PCR experiments were analyzed for Tbx3 mRNA. A 0.5ul portion of each cDNA was used as a template in PCR containing 0.3μM of each primer, 2.25mM MgC12, 0.5mM of each dNTP and 2.5U of Expand long template enzyme mix (Roche). The amplification conditions were 92°C for 2 min, followed by 25 cycles of 92°C for 10 s, 65°C for 30 s, 68°C for 3mins and a final step at 68°C for 7mins. The following primers were used to amplify part of the Tbx3 coding region: Tbx3F: AAGCGATCACGCAACGTGGCA (SEQ ID No. 8) Tbx3R: TGCCATTGCCAGTGTCTCGAA (SEQ ID No. 9) As a control, Gapdh was amplified in parallel.

Immunohistochemistry

Sections from Carnoy's-fixed time-mated B6 mouse embryos were incubated with primary antibodies overnight at room temperature. Rabbit polyclonals Erbb2 (C- 18, Santa Cruz) Erbb4 (C-18, Santa Cruz), Nrg3 (Orbigen) and Nrg3 (Abgent) and goat polyclonal Nrg3 (R&D Systems) were used. Antibody dilutions were: Erbb2, 1 :300, Erbb4, 1 :400, Nrg3 (Abgent), 1 :50, Nrg3 (Orbigen), 1 :350 and Nrg3 (R&D Systems), 1 :50. Peroxidase labelled polymer (Envision rabbit, DAKO) was used for detection of primary antibodies raised in rabbits. Biotin-labeled donkey anti- goat IgG antibody (Molecular Probes) was used for detection of the goat antibody using Vector ABC kit (Vector Labs). 3,3' diaminobenzidine was used as chromagen and sections were counterstained with hematoxylin. Results

Analysis of the ska genomic region between mouse Chromosome 14 markers D14M 14 and D14M 129 resulted in the identification of novel markers polymoφhic between the two parental strains, A/J and B/6. These were mapped onto the RI panel narrowing the candidate interval initially to 86 kb and then to 76.2 kb (Figure 2, Figure 6 and Table 1). This critical region contains the distal part of the Neuregulin3 (Nrg3) gene, which encodes a secreted growth factor of the Neuregulin family.

Nrg3 is a large gene spanning over 1 Mb of Chr 14. Polymorphic SNPs or SSRs located 100 kb and 8 kb upstream from the transcription initiation site of Nrg3, within introns 1, 2, 3 and 4, and 18 kb (17.3 kb) downstream of the 3'UTR were used to exclude these regions from the ska locus. Nrg3 intron 4 and exons 5 to 10 and 18 kb beyond the 3'UTR of the gene remain within the candidate interval (Figure 2). No DNA sequence differences in any exons or in intron/exon junctions were observed between the A/J and B6 strains. Complete sequence analysis of the entire 75,614 bp region revealed that there is only a single sequence difference in a microsatellite within Nrg3 intron 7 between A J and B6 (Figure 6). This SSR was found to completely co-segregate with the ska phenotype. Therefore the distal half of Nrg3 is coincident with the critical minimal genomic region containing ska. This same microsatellite variant is also present in several other closely related "Castle" inbred strains (Balb/c, C3H/HeJ, DBA/1 and DBA/2) that also display the ska mutant phenotype providing further support for ska as an allele of Nrg3 (Witmer et al. 2003) (Figure 6).

At this stage we considered Nrg3 to be a strong candidate for ska since the most well-known member of the Neuregulin family, Neuregulin 1/Heregulin has been implicated in a variety of cell fate and patterning processes, including that of the postnatal mammary gland^10"15. Therefore, we examined the pattern of expression of Nrg3 during embryogenesis to assess whether it was consistent with a role in early moφhogenesis of the mammary gland. Nrg3 is expressed at many sites in the mid-gestation embryo, including widespread neural expression as previously reported⁶ but also in the branchial arches, otic vesicles, limb buds, and atria (data not shown). We also examined Nrg3 expression using immunohistochemical analysis.

As shown in Figure 3, prior to the development of the mammary gland, we observed expression along the lateral plate mesoderm at the future site of mammary bud number 3, which is the first of the five buds to form (Figures 3 A- B). Expression prior to actual formation of the mammary buds is consistent with a role for Nrg3 in early initiating events. Nrg3 is expressed from somite stage 38 (El 0.75 days) as a comet in the somitic mesoderm/dermal mesenchyme spanning the level of somite 16-17. Later, from somite stage 48 onwards, when bud 3 is moφhologically distinguishable, expression is detected in the dermal mesenchyme underlying the mammary buds (Figures 3 D, E, F). When the other four buds form, expression is also detected in the underlying mesenchyme. By somite stage 60, expression is seen in the mammary bud epithelia proper (Figure 3G).

As shown in Figure 7, localized Nrg3 expression in the presumptive mammary region is observed from somite stage 38 (El 0.75 days) when Nrg3 is expressed as a comet in the lateral plate mesoderm spanning the level of somites 17 to 18, the future site of mammary bud 3 (Figure 7A,B). From somite stage 40, a comet of Nrg3 expressing cells is also observed in the lateral plate mesoderm at the future site of mammary bud 4, followed by the appearance of Nrg3 expressing cells at the other sites of mammary bud formation (Figure 7B-D). At the 45 somite stage, Nrg3 is expressed in the lateral plate mesoderm around the anlage outlining a distinct bud shape (Figure 7E-G). Later, from somite stage 48 onwards, when bud 3 is moφhologically distinct, expression is first detected in the mammary bud epithelia (Figure 7H). The other four buds form slightly later (and asynchronously in the order 4, 1 , 2 and 5), and localized mesenchymal expression is also detected in the lateral plate mesoderm prior to the appearance of each bud followed by epithelial expression once the bud has formed (Figure 71). By somite stage 54, when the bud proper has formed, the epithelial cells of bud 3 express Nrg3 (data not shown). Since the buds form asynchronously, bud 3 and 4 which form first, express Nrg3 in the epithelia while bud 1 which forms slightly later expresses Nrg3 in the mesenchyme (Figure 7J). By day El 3, all mammary buds express Nrg3 in the epithelia (Figure 7K). In A/J mice (and also in another ska mutant strain, Balb/c), Nrg3 is not expressed in a localized fashion around the site of presumptive bud 3 at comparable embryo stages (data not shown). Expression prior to actual moφhological formation of the mammary buds is consistent with a role for Nrg3 in early initiating events.

Nrg3 displays a complex transcriptional profile and expression is locally decreased in the presumptive mammary region Transcript analysis was determined by direct sequencing of RT-PCR products. This revealed that multiple isoforms of Nrg3 are expressed in mid-gestation mouse embryos, providing further intricacy to this highly complex signalling network. We have found that multiple Nrg3 isoforms are locally expressed in the lateral plate mesoderm of the presumptive mammary region prior to the appearance of the mammary bud (Figure 8, and also see the mouse Nrg3 exon structure in Table 2). We have observed altered levels of expression of Nrg3 in the region where buds 2, 3, and 4 will subsequently form (as determined by quantitative RT-PCR (qRT- PCR) of microdissected lateral plate mesoderm and its overlying ectoderm from the presumptive mammary region (Figure 9A) in stage matched samples from A/J and B6 mice at stages prior to mammary bud formation). To assess the microdissection we performed semi-quantitative RT-PCR using Tbx3 as a marker for lateral plate mesoderm (Figure 10). We observed (on average) a 5.0 fold reduction in Nrg3 mRNA levels in the region where buds 2, 3, and 4 will subsequently form in A/J mice in 43-45 somite stage embryos (Figure 9B). In addition, a 1.7 fold reduction in Nrg3 levels in the region where buds 2, 3, and 4 form in A/J mice in 46-48 somite stage embryos (Figure 9B) was observed.

Erbb2 andErbb4 are expressed in the presumptive mammary region

We examined the expression pattern of the cognate receptor for Nrg3, Erbb4, in the presumptive mammary region (Figure 11). Like Nrg3, Erbb4 expression also precedes the moφhological appearance of the mammary buds and mirrors the expression pattern of Nrg3 (Figure 11A-E). Erbb4 is expressed in 40-46 somite stage embryos in the lateral plate mesoderm at the sites of future mammary buds (Figure HE). From the 52 somite stage (El 2.5), Erbb4 is expressed in the outer layer of the mammary bud epithelial (Figure 1 1F,G). Erbb2, the preferred heterodimerization partner for all Erbb receptors, is expressed in the nascent mammary anlage in both the epithelia and adjacent mesenchyme (Figure 1 1H). From the first moφhological appearance of the mammary bud, Erbb4 is expressed in the bud epithelia (Figure 1 11). By day El 3, all of the mammary buds express Erbb4, as well as Erbb2 (Figure 1 1J,K). Therefore, the Nrg3 ligand and the receptors, Erbb2 and Erbb4 are expressed at very early stages of mammary gland organogenesis, consistent with functional early roles.

Expression patterns of major regulators of mammary gland organogenesis in the presumptive mammary region

The precise genetic pathway for mammary gland organogenesis has not yet been elucidated although several genes (FgflO, Lefl, Tbx3) have been implicated in mammary gland moφhogenesis (van Genderen et al. 1994; Mailleux et al. 2002; Davenport et al. 2003). We have determined the expression patterns of these genes in both wild-type and ska mutant embryos. FgflO expression precedes that oϊNrg3 in the presumptive mammary region (with the first appearance of FgflO at the 30 somite stage in the presumptive mammary region) (Figure 12A,B, and Figure 13A). From 30-45 somites, FgflO expression extends as a line from the forelimb bud to the level of somite 18 (where bud 3 will subsequently form) (Figure 12E, Figure 13C) in the dermamyotome¹⁸. Tbx3 expression is also observed as a line spanning the entire presumptive mammary region prior to mammary gland moφhogenesis from 32-45 somite stages in the lateral plate mesoderm (Figure 12G, Supplementary Figure 13B). FgflO and Tbx3 expression patterns are unaltered in ska mutants at stages prior to mammary bud formation (Figure 12C, F, H). Lefl and WntlOb expression is altered in ska mutants, with decreased or absent expression at bud 3 and ectopic expression associated with supernumerary buds (Figure 1, Figure 12I-J, Figure 13D).

Since the expression pattern of Nrg3 suggests that it plays a role in developmental processes that initiate mammary gland formation, we examined the expression of genes in A/J and B6 mice which have been previously implicated in embryonic mammary gland development. Lefl null mice form mammary buds, which developmentally arrest and fail to progress past the bud stage which suggests that inductive signalling is unperturbed but subsequent epithelia-mesenchymal signalling is impaired¹⁶'¹⁷. Lefl is expressed after the buds have initiated and appears to mark the mammary bud epithelia from somite stage 48 onward¹⁸. However Lefl expression is absent in A/J mice in the region where mammary bud three would normally form (Figure IB). Lefl expression is also frequently seen slightly dorsal to the endogenous bud 4 at the site of ectopic mammary buds in A/J mice (Figure IE). These ectopic buds are often much smaller than the normal mammary buds and appear connected to the endogenous bud 4 by a line of Lefl expressing cells at somite stage 54 (Figure IE).

FgflO has also been suggested to have a major role in the development of several organs including the mammary gland¹⁹'²⁰. FgflO null mice fail to form mammary buds with the exception of bud number 4, raising the possibility that the initiation of at least some of the five pairs of mammary buds in mice is under distinct genetic control¹⁸. FgflO expression is first apparent in the presumptive mammary region from E10.5, somite stage 30 and persists until El 1.75, somite stage 47. FgflO expression may be a molecular marker for the "mammary line", a moφhologically distinct entity visible in many mammals, but not obvious in mice. Intriguingly, in B6 mice, FgflO expression is present in the future mammary region as a line starting adjacent to the forelimb bud which continues just to somite 17, where Nrg3 expression is first observed as a diffuse comet-shape in the mesenchyme in the same spatial region in which bud 3 will later form (Figure 4b). The line of FgflO expression extends to the level of somite 18-19 in A/J mice (Figure 4a). Therefore Nrg3, FgflO and Lefl expression patterns appear in a sequential manner suggesting developmentally significant and possibly interacting roles during early mammary gland development.

Ectopic formation of mammary glands

The data presented above indicates that Nrg3, which encodes a growth factor that binds and activates the ErbB4 tyrosine kinase receptor⁶, maps to the minimal ska interval and has an expression pattern consistent with a role in mammary gland development. We investigated whether Nrg3 could induce the expression of epithelial mammary bud markers and induce formation of mammary glands. We purified recombinant Nrg3 from an insect cell expression system and demonstrated that it was able to stimulate phosphotyrosine formation in MCF7 cells (data not shown).

We then conducted embryonic explant culture experiments of E10 and El l B6 embryos. Agarose beads soaked in recombinant Nrg3 or EGF or Heregulin-IB were placed along the ventral surface of E10 and El 1 B6 embryos. Remarkably, Nrg3 but not the related factors EGF and Heregulin-IB, induced ectopic expression of the epithelial mammary bud marker Lefl as well as formation of a moφhological mammary bud when placed below the surface of the ventral ectoderm along the presumptive "mammary line" where buds will normally form (Figures 5, 14 and 15). Ectopic mammary buds only form when Nrg3-soaked beads are placed adjacent to the dense mesenchyme along the mouse "mammary line", an entity that has been identified in mouse by molecular marker (FgflO, Tbx3 and WntlOb) expression (Mailleux et al. 2002; Eblaghie et al. 2004; Veltmaat et al. 2004)(Figure 12A-F, Figure 15A-F). We have observed condensed mesenchyme which the nascent mammary buds abut, similar to dense mesenchyme that has been previously described by Balinsky (Balinsky 1949- 1950) underlying the milk line as it forms in the rabbit, in El 1.0 B6 embryos in histological sections (Figure 16). We observed both endogenous and ectopic mammary buds forming adjacent to this line of condensed mesenchyme after twenty- four hours of culture (Figures 14-17). We have not observed any difference in responses to Nrg3- soaked beads implanted at various positions along the anterior-posterior axis of this line (Figure 14, Figure 18). Nrg3-soaked beads implanted in locations outside of the lateral plate such as the head, did not result in ectopic mammary bud marker expression (data not shown). We have also implanted Nrg3 and BSA-soaked beads into the BAT-gal reporter mouse strain (which contain a lacZ gene under the control of B-catenin/T cell factor (TCF) responsive elements) (Maretto et al. 2003) and shown by X-gal staining on whole- mounted embryos that TCF activity is increased by implantation with Nrg3- soaked beads when compared to BSA-soaked beads (Figure 18). Consistent with a previous study of canonical Wnt signaling in the mammary region prior to bud formation, we observed BAT-gal expression in both the surface epithelium and underlying mesenchyme (Figure 18) (Chu et al. 2004). Both epithelial and mesenchymal expression of BAT-gal is increased along the mammary line adjacent to implanted Nrg3-soaked beads (Figure 18).

These results indicate that Nrg3 is sufficient, in the context of lateral plate mesoderm, for mammary gland specification. Nrg3 -soaked beads implanted into A/J embryos can also induce ectopic mammary bud marker expression and a histological bud both adjacent to the site of bud 3, and at other locations along the presumptive "mammary line" (Figure 18). This suggests that the ectoderm in ska mutant mice is competent to respond to the signal provided by localized Nrg3 expression and the ska phenotype (absent or hypoplastic gland) is due to a reduction in Nrg3 expression in lateral plate mesoderm.

Conclusions

Our genetic, gene expression, and functional data strongly suggest that ska is an allele of Nrg3 that results in altered expression of the gene. Although, there are no coding region or splice-site DNA sequence differences between A/J and B6 that might account for the ska phenotype, we have identified a sequence alteration in intron 7 of the gene that may explain the altered pattern of expression of Nrg3 in ska mice. Similar sequence alterations have been suggested to cause aberrant expression of other genes²¹'²². Although Nrg3 is widely expressed during development, the A/J strain lacks gross moφhologically obvious defects, which is consistent with a subtle, hypomoφhic, mutation underlying the observed mammary phenotypes. The absence of Nrg3 expression and the resulting failure to form mammary bud 3 in A/J mice suggests that Nrg3 is the specification signal for this bud. However, it is possible that Nrg3 is also involved in specification of the other mammary buds but the ska mutation may not affect formation of these glands. The presence of ectopic glands could be the result of another distinct function for Nrg3 such as influencing the location of mammary gland signalling centres. This would be consistent with the observation of misplaced number 3 glands in some A/J mice as well as the high frequency of supernumerary glands. Regionally reduced expression of Nrg3 occurs in the presumptive mammary region of ska mice

There is decreased expression of Nrg3 in the presumptive mammary region where buds 2, 3 and 4 will subsequently form in ska mice, as determined by quantitative RT-PCR of microdissected lateral plate mesoderm and overlying ectoderm from the presumptive mammary region (Figure 9B). Without wishing to be bound by theory we propose that a decreased expression of spatially-specific Nrg3 isoforms is the cause of mammary gland abnormalities in ska mice. The decreased expression of Nrg3 is more pronounced at developmental stages (43-45 somites) slightly prior to when the mammary buds 3 and 4 become moφhologically distinct (Figure 9B-C). Mammary bud 3, which forms first, is the most severely affected bud. At slightly later developmental stages (46-48 somites) when the first pairs of buds (3 and 4) are moφhologically distinct, Nrg3 levels are also decreased but to a lesser extent such that bud formation proceeds relatively normally in the later forming buds (Figure 9B-C). The reduced levels of localized Nrg3 expression in the lateral plate mesoderm and the resulting failure to form mammary bud 3 in ska mice suggests that Nrg3 is a specification signal for bud formation. We suggest that the failure of normal specification of the future mammary cells is due to insufficient levels of Nrg3 in the presumptive bud 3 region. Local expression of Nrg3 around the other future bud sites is presumably not sufficiently altered to prevent overt changes to their specification in ska mutants. However, we have observed subtle phenotypic alterations (variable size and position) associated with the other mammary buds in ska mutant mice suggesting involvement of Nrg3 signalling in their specification. The mis-specification of cells in the region near bud 4 causing misplaced and ectopic gland formation may be a consequence of the failure of bud 3 formation and/or altered Nrg3 expression surrounding future bud 4 site. It is possible that the specification of the mammary line is itself defective in ska mutant mice. The dense mammary mesenchyme appears less organized in ska strains when compared to B6 mice (Figures 14, 16, 17). Expression of FgflO and Tbx3, mesodermal mammary line markers, appear normal in ska mutants (Figure 12A-H). It is also possible that Nrg3 is acting to transmit signals from FgflO and/or Tbx3 to the precursor mammary epithelial cells (which appear to express WntlOb) (Chu et al. 2004; Veltmaat et al. 2004)) and that aberrant Nrg3 signals result in abnormalities in placode formation off of the mammary line.

Genetic pathways that regulate early mammary gland morphogenesis The EGF-receptor superfamily member Erbb4, which is the receptor for Nrg3 is also expressed in the presumptive mammary region (Zhang et al. 1997). (Figure 11) Therefore, the expression pattern of both the ligand Nrg3 and its cognate receptor Erbb4 are consistent with a functional role in mammary gland organogenesis. These two genes are the earliest yet described which are locally expressed in the mesenchyme underlying the future site of mammary buds. Mouse models have established that Erbb4 signalling through the homodimer is essential for normal terminal differentiation in the postnatal mammary gland (Long et al. 2003; Tidcombe et al. 2003). As mice lacking Erbb4 do form mammary buds, it is likely that Nrg3 can signal in the absence of Erbb4 homodimers through other Erbbs to specify the embryonic mammary buds. This complex and interrelated network may normally elicit mammary specification through the Nrg3/Erbb4 axis but the inherent redundancy of its signalling capacities is likely to provide alternate means of signalling (Riese et al. 1995; Falls 2003). It is not yet clear if the variety of Nrg3 isoforms contribute to signalling diversity by eliciting distinct biological responses but this is an exciting possibility.

Knockout studies show that both FgflO and Tbx3 are required for bud formation (Mailleux et al. 2002; Davenport et al. 2003). The genetic hierarchy of FgflO and Tbx3 remains to be elucidated but the severity of the phenotype when either is absent indicates that they are both upstream of Nrg3, which is expressed later and in a spatially restricted manner in the presumptive mammary region (Figure 7, Supplementary Figure 13C). Both FgflO and Tbx3 expression is normal in ska mutants (in stages prior to mammary bud formation as assessed by WMISH, Figure 12A-H). The exact role of FgflO and Tbx3 in mammary gland moφhogenesis remains to be clarified (van Genderen et al. 1994; Davenport et al. 2003). In contrast to FgflO, Tbx3 is also expressed in the bud proper once the mammary buds have initially formed (Davenport et al. 2003). Lefl -deficient mice can form mammary buds and as both Lefl and WntlOb expression is altered in ska mutants, (Figure 1, Figure 12I-J, Figure 13D), it is likely that Nrg3 is upstream of both of these genes. BAT-gal reporter gene expression is increased in the epithelia and mesenchyme adjacent to implanted Nrg3 -soaked beads in cultured explanted embryos (Figure 18). Although canonical Wnt signalling is required for mammary gland inductive events, it is not yet known which Wnts are involved and whether the epithelial or mesenchymal Wnts are required for mammary gland initiation (Andl et al. 2002; Chu et al. 2004).

The five pairs of mammary glands have inherent distinctive genetic differences in mouse. Mammary bud 4 is genetically distinct as both FgflO and Fgfr2b null mice fail to form all buds (buds 1, 2, 3 and 5) except for bud 4 (Mailleux et al. 2002). Buds 3 and 5 (which form first and last, respectively) are reported to be absent in GH3-I- mice (Mailleux et al. 2002). Buds 4 and 5 are initially connected (and it would appear that Lefl and WntlOb -expressing cells migrate as a line from bud 4 to bud 5 (FigurelC-E, Figure 7I-J). It remains to be determined whether the five pairs of mammary buds develop independently of one another or if any type of developmental cascade exists. Our observations would suggest that lack of bud 3 formation does not preclude formation of subsequent glands. However, as we often observe unusual placement of the other (later forming) buds, it is possible that these aberrations are a direct consequence of the abnormal specification of mammary bud three.

Ectopic mammary buds forms adjacent to Nrg3-soaked beads when placed along the "mammary line" mesenchyme

Mammary epithelial buds often form adjacent to Nrg3 -soaked beads (Figures 14, 17, and 18). Ectopic mammary buds were shown to form only when Nrg3-soaked beads were placed adjacent to the dense mesenchyme along the mouse "mammary line". Previously both light and scanning electron microscopy have failed to detect a moφhological mammary line in the mouse although a histological ridge has recently been described (Veltmaat et al. 2004). We observed condensed mesenchyme which the nascent mammary buds abut, and we observed both endogenous and ectopic mammary buds forming adjacent to this line of condensed mesenchyme after twenty-four hours of culture. In addition, we have demonstrated an increase in TCF activity in explanted embryos implanted along the presumptive mammary line with Nrg3 -soaked beads in the BAT-gal reporter mouse strain (Figure 18). This suggests that Nrg3 increases Wnt signalling in both mesenchymal and epithelial cells in the presumptive mammary region. It is believed that mammary induction requires Wnt signalling, although it is not yet clear which particular Wnt(s) are required or how localized canonical Wnt signalling is achieved (Chu et al. 2004). Without wishing to be bound by theory we believe that it is possible that Nrg3 acts to induce localized Wnt signalling along the mammary line or to prime cells in the presumptive mammary region to respond to Wnt signals. Mammary buds are thought to form from the localized migration of epithelial cells (Propper 1978). Fgf, Tbx, Wnt and Nrg3/Erbb4 signals are expressed in the presumptive mammary region at the time when inductive processes should occur. As Erbb4 signalling can regulate neural progenitor migration and placement in the adult forebrain (Anton et al. 2004), it is possible that Nrg3 signalling may act by influencing the migration of the precursors to mammary epithelial cells.

It has been suggested that the initiating signal for mammary gland formation is mesenchymal²³ and the properties of Nrg3 suggest it as a strong candidate for mediating this signal. Both hypoplastic and ectopic glands are likely to be caused by aberrations during the initial epithelial-mesenchymal signal exchanges. Variable mammary gland phenotypes, whereby both absent and ectopic glands occur, may reflect the sensitivity of mammary moφhogenesis to local levels of growth factors as have been described in the human ulnar mammary syndrome (UMS) (Bamshad et al. 1997). It appears that the presumptive mammary region in the mouse is extremely sensitive to variation in local levels of Nrg3, in a manner similar to that observed with respect to the effects of Tbx3 haploinsufficiency within UMS families.

The dynamic expression pattern of Nrg3 as the gland develops (both embryonically and postnatally) also suggests that this factor provides a means of epithelial/mesenchymal communication that is maintained beyond very early gland development. Nrg3 has the ability to direct precursor epithelial cells to become mammary epithelial cells presumably by defining or specifying a mammary stem cell population. Therefore, it will be interesting to explore whether Nrg3 can induce the growth of mammary stem cells in vitro which might have applications in tissue engineering. In addition, Bell's approach¹ to increase mammary gland number by classical genetic selection methods may now be possible using transgenic Nrg3 expression. Supernumerary nipples in humans are common and it has been estimated these may be present in as many as one in eighteen people²⁴, and misregulation of Neuregulin signaling may be responsible for some of these.

Example 2: Prevention of breast cancer by administration of the Nrg3 EGF domain

An 18 year-old female individual who has not been through a full-term pregnancy, and who does not have, and who has not had breast cancer, is administered the Nrg3 EGF domain. The individual does not develop breast cancer.

Table 1. Genetic markers from transcription units used to delimit the position of the ska mutation used to construct physical map of ska locus shown in Fig. 2. Table of primer sequences used to amplify polymoφhic genetic markers. Position in Mb on Cliromosome 14 of polymorphic marker is indicated.

Table 2. Exon structure of Mus musculus Neuregulin 3.

Exon boundaries of Nrg3 using NM_008734:

The coding sequence is located between 289 and 2430bp.

References for Example 1

1. Bell, A. G. (1898) On the development by selection of supernumerary mammae in sheep. Science 9, 6337-6339.

2. Little, C. C. & McDonald, H. (1965) Abnormalities of the mammae in the house mouse. J Hered 36, 285-288 (1965).

3. Howard, B. A. & Gusterson, B. A. (2000) The characterization of a mouse mutant that displays abnormal mammary gland development. Mamm Genome 11, 234-7.

4. Howard, B. A. & Gusterson, B. A. (2000) Mammary gland patterning in the AXB/BXA recombinant inbred strains of mouse. Mech Dev 91, 305-309.

5. Gizatullin, R. Z. et al. (2000) Human NRG3 gene Map position 10q22- q23. Chromosome Res 8, 560.

6. Zhang, D. et al. (1997) Neuregulin-3 (NRG3): a novel neural tissue-enriched protein that binds and activates ErbB4. Proc NatlAcad Sci USA 94, 9562-7.

7. Hijazi, M. M. et al. (1998) NRG-3 in human breast cancers: activation of multiple erbB family proteins. Int J Oncol 13, 1061-7.

8. Marshall, J. D. et al. (1992) The AXB and BXA set of recombinant inbred mouse strains. Mamm Genome 3, 669-680.

9. Waterston, R. H. et al. (2002) Initial sequencing and comparative analysis of the mouse genome. Nature 420, 520-62.

10. Troyer, K. L. & Lee, D. C. (2001) Regulation of mouse mammary gland development and tumorigenesis by the ERBB signaling network. J Mammary Gland Biol Neoplasia 6, 7-21.

1 1. Stern, D. F. (2003) ErbBs in mammary development. Exp Cell Res 284, 89-98.

12. Falls, D. L. (2003) Neuregulins: functions, forms, and signaling strategies. Exp Cell Res 284, 14-30 (2003). 13. Li, L. et al. (2002) The breast proto-oncogene, HRGalpha regulates epithelial proliferation and lobuloalveolar development in the mouse mammary gland. Oncogene 21 , 4900-7 (2002).

14. Burden, S. & Yarden, Y. (1997) Neuregulins and their receptors: a versatile signaling module in organogenesis and oncogenesis. Neuron 18, 847-55.

15. Yang, Y. et al. (1995) Sequential requirement of hepatocyte growth factor and neuregulin in the moφhogenesis and differentiation of the mammary gland. Journal of Cell Biology 131, 215-226.

16. van Genderen, C. et al. (1994) Development of several organs that require inductive epithelial-mesenchymal interactions is impaired in LEF-1 -deficient mice. Genes Dev 8, 2691-2703.

17. Robinson, G. W., Karpf, A. B. & Kratochwil, K. (1999) Regulation of mammary gland development by tissue interaction. J Mammary Gland Biol Neoplasia 4, 9-19.

18. Mailleux, A. A. et al. (2002) Role of FGF10/FGFR2b signaling during mammary gland development in the mouse embryo. Development 129, 53-60.

19. Ohuchi, H. et al. (2000) FGF10 acts as a major ligand for FGF receptor 2 Illb in mouse multi-organ development. Biochem Biophys Res Commun 277, 643- 9.

20. Sekine, K. et al. (1999) FgflO is essential for limb and lung formation. Nat Genet 21, 138-41.

21. Chiba-Falek, O. et al. (1998) The molecular basis of disease variability among cystic fibrosis patients carrying the 3849+10 kb C— >T mutation. Genomics 53, 276-83.

22. Suzuki, N., Hirata, M. & Kondo, S. (2003) Traveling stripes on the skin of a mutant mouse. Proc Natl Acad Sci V S A 100, 9680-5. 23. Cunha, G. R., Young, P., Hamamoto, S., Guzman, R. & Nandi, S. (1992) Developmental response of adult mammary epithelial cells to various fetal and neonatal mesenchymes. Epithelial Cell Biol 1, 105-18.

24. Schmidt, H. (1998) Supernumerary nipples: prevalence, size, sex and side predilection - a prospective clinical study. Eur J Pediatr 157, 821-3.

25. Salomon, D. S., Brandt, R., Ciardiello, F. & Normanno, N. (1995) Epidermal growth factor-related peptides and their receptors in human malignancies. Crit Rev Oncol Hematol 19, 183-232.

26. Bieche, I et al. (2003) Prognostic value of ERBB family mRNA expression in breast carcinomas. Int J Cancer 106, 758-65.

27. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular cloning: a laboratoiγ manual (ed. Nolan, C.) Cold Spring Harbor Laboratory Press.

28. Wilkinson, D. G. & Nieto, M. A. (1993) Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Methods Enzymol 225, 361- 73.

29. Hobbs, S. S. et al. (2002) Neuregulin isoforms exhibit distinct patterns of ErbB family receptor activation. Oncogene 21, 8442-52.

Other references

30. Bianco P & Robey PG. (2001) Stem cells in tissue engineering. Nature 414(6859): 118-21.

31. Darcy KM et al (2000) Changes in ErbB2 (her-2/neu), ErbB3, and ErbB4 during growth, differentiation, and apoptosis of normal rat mammary epithelial cells. JHistochem Cytochem. 48(1): 63-80.

32. Dunn M et al (2004) Co-expression of neuregulins 1, 2, 3 and 4 in human breast cancer. JPathol. 203(2):672-80.

33. Gama A et al (2003) p63: a novel myoepithelial cell marker in canine mammary tissues. Vet Pathol. 40(4): 412-20. 34. Hijazi MM et al (1998) NRG-3 in human breast cancers: activation of multiple erbB family proteins. Int J Oncol. 13(5): 1061-7.

35. Huss FR & Kratz G. (2001) Mammary epithelial cell and adipocyte co- culture in a 3-D matrix: the first step towards tissue-engineered human breast tissue. Cells Tissues Organs 169(4):361 -7.

36. Jones JT, et al (1999) Binding specificities and affinities of egf domains for ErbB receptors. FEBSLett. 447(2-3): 227-31.

37. Landgraf R et al (1999) Analysis of heregulin symmetry by weighted evolutionary tracing. Protein Engineering 12(11): 943-951.

38. Parmar H et al (2002) A novel method for growing human breast epithelium in vivo using mouse and human mammary fibroblasts. Endocrinology. 143(12):4886-96.

39. Patrick CW Jr. (2000) Adipose tissue engineering: the future of breast and soft tissue reconstruction following tumor resection. Semin Surg Oncol. 19(3): 302-1 1.

40. Patrick CW Jr. (2001) Tissue engineering strategies for adipose tissue repair. Anat Rec. 263(4): 361-6.

41. Sartor CI, et al (2001) Her4 mediates ligand-dependent antiproliferative and differentiation responses in human breast cancer cells. Mol Cell Biol. 21(13): 4265-75.

42. Sweeney C, et al (2000) Ligand discrimination in signaling through an ErbB4 receptor homodimer. J Biol Chem. 275(26): 19803-7.

43. van Genderen C et al (1994) Development of several organs that require inductive epithelial-mesenchymal interactions is impaired in LEF-1 -deficient mice. Genes Dev. 8(22): 2691-703.

44. Welm et al (2003) Isolation and characterization of functional mammary gland stem cells. Cell Prolif 36 (Suppl. 1): 17-32. 45. Zhang D et al (1997) Neuregulin-3 (NRG3): a novel neural tissue-enriched protein that binds and activates ErbB4. Proc Natl Acad Sci USA. 94(18): 9562-7.

46. Brey EM & Patrick CW Jr. (2000) Tissue engineering applied to reconstructive surgery. IEEE Eng Med Biol Mag. 19(5): 122-5.

47. Dyke & Jacks (2002) Cancer modeling in the modern era: progress and challenges. Cell 108:135-144.

48. Tiao & Busfield (2003) Neuregulin 3 cytoplasmic domain interacts specifically with 14-3-3zeta and Pick-1 - potential for bi-directional signaling. Oral Presentation Session 13, 30 September 2003, ComBio 2003, Melbourne, Australia.

49. Andl, T., S.T. Reddy, T. Gaddapara, and S.E. Millar. 2002. WNT signals are required for the initiation of hair follicle development. Dev Cell 2: 643-53.

50. Anton, E.S., et al (2004) Receptor tyrosine kinase ErbB4 modulates neuroblast migration and placement in the adult forebrain. Nat Neurosci 7: 1319- 28.

51. Balinsky, B. 1949-1950. On the developmental processes in mammary glands and other epidermal structures. Transactions of the Royal Society Edinburgh 62: 1-31.

52. Bamshad, M. et al (1997). Mutations in human TBX3 alter limb, apocrine and genital development in ulnar -mammary syndrome. Nat Genet 16: 31 1-5.

Buerger, H., et al (2004) Allelic length of a CA dinucleotide repeat in the egfr gene correlates with the frequency of amplifications of this sequence— first results of an inter-ethnic breast cancer study. JPathol 203: 545-50.

53. Chu, E.Y. et al (2004). Canonical WΝT signaling promotes mammary placode development and is essential for initiation of mammary gland moφhogenesis. Development 131: 4819-29. 54. Cunha, G.R. and Y.K. Horn. 1996. Role of mesenchymal-epithelial interactions in mammary gland development. J Mammary Gland Biol Neoplasia 1: 21-35.

55. Cunha, G.R., et al (1995) Mammary phenotypic expression induced in epidermal cells by embryonic mammary mesenchyme. Acta Anat (Basel) 152:

195-204.

56. Davenport, T.G., L.A. Jerome-Majewska, and V.E. Papaioannou. 2003. Mammary gland, limb and yolk sac defects in mice lacking Tbx3, the gene mutated in human ulnar mammary syndrome. Development 130: 2263-73.

57. Eblagbie, M.C., et al (2004) Interactions between FGF and Wnt signals and Tbx3 gene expression in mammary gland initiation in mouse embryos. J Anat 205: 1-13.

58. Gebhardt, F., K.S. Zanker, and B. Brandt. 1999. Modulation of epidermal growth factor receptor gene transcription by a polymoφhic dinucleotide repeat in intron 1. J Biol Chem 274: 13176-80.

59. Graus-Porta, D., R.R. Beerli, J.M. Daly, and N.E. Hynes. 1997. ErbB-2, the preferred heterodimerization partner of all ErbB receptors, is a mediator of lateral signaling. Embo J 16: 1647-55.

60. Hogan, B., R. Beddington, F. Constantani, and E. Lacy. 1994. Manipulating the Mouse Embryo: a laboratory manual. Cold Spring Harbor

Laboratory Press.

61. Hogan, B.L. 1999. Moφhogenesis. Cell 96: 225-33.

Jones, F.E., et al (1996). Heregulin induces in vivo proliferation and differentiation of mammary epithelium into secretory lobuloalveoli. Cell Growth Differ 7: 1031-8.

62. Long, W., et al (2003) Impaired differentiation and lactational failure of Erbb4-deficient mammary glands identify ERBB4 as an obligate mediator of STAT5. Development 130: 5257-68. 63. Lynch, T.J., et al (2004). Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. NEngl JMed 350: 2129-39.

64. Maretto, S., et al (2003). Mapping Wnt/beta-catenin signaling during mouse development and in colorectal tumors. Proc Natl Acad Sci U S A 100:

3299-304.

65. Paez, J.G., et al (2004). EGFR Mutations in Lung Cancer: Correlation with Clinical Response to Gefitinib Therapy. Science.

66. Propper, A. and L. Gomot. 1967. [Tissue interactions during organogenesis of the mammary gland in the rabbit embryo]. C R Acad Sci Hebd Seances Acad

Sci D 264: 2573-5.

67. Propper, A.Y. 1978. Wandering epithelial cells in the rabbit embryo milk line. A preliminary scanning electron microscope study. Dev Biol 67: 225-31.

68. Riese, D.J., 2nd, et al (1995). The cellular response to neuregulins is governed by complex interactions of the erbB receptor family. Mol Cell Biol 15:

5770-6.

69. Tidcombe, H., A. et al (2003). Neural and mammary gland defects in ErbB4 knockout mice genetically rescued from embryonic lethality. Proc Natl Acad Sci US A im 8281-6.

70. Veltmaat, J.M., et al 2003. Mouse embryonic mammogenesis as a model for the molecular regulation of pattern formation. Differentiation 71: 1-17.

71. Veltmaat, J.M., W. Van Veelen, J.P. Thiery, and S. Bellusci. 2004. Identification of the mammary line in mouse by WntlOb expression. Dev Dyn 229: 349-56. _

72. Witmer, P.D. et al (2003) The development of a highly informative mouse Simple Sequence Length Polymoφhism (SSLP) marker set and construction of a mouse family tree using parsimony analysis. Genome Res 13: 485-91. Sequences

Human Nrg3 cDNA taken from XMJ 66086 (SEQ ID No: 1)

1 ATGAGTGAAG GGGCGGCCGC TGCCTCGCCA CCTGGTGCCG CTTCGGCAGC CGCCGCCTCG

61 GCCGAGGAGG GCACCGCGGC GGCTGCGGCG GCGGCAGCGG CGGGCGGGGG CCCGGACGGC 121 GGCGGCGAAG GGGCGGCCGA GCCCCCCCGG GAGTTACGCT GTAGCGACTG CATCGTGTGG

181 AACCGGCAGC AGACGTGGCT GTGCGTGGTA CCTCTGTTCA TCGGCTTCAT CGGCCTGGGG

241 CTCAGCCTCA TGCTTCTCAA ATGGATCGTG GTGGGCTCCG TCAAGGAGTA CGTGCCCACC

301 GACCTAGTGG ACTCCAAGGG GATGGGCCAG GACCCCTTCT TCCTCTCCAA GCCCAGCTCT

361 TTCCCCAAGG CCATGGAGAC CACCACCACT ACCACTTCCA CCACGTCCCC CGCCACCCCC 421 TCCGCCGGGG GTGCCGCCTC CTCCAGGACG CCCAACCGGA TTAGCACTCG CCTGACCACC

481 ATCACGCGGG CGCCCACTCG CTTCCCCGGG CACCGGGTGC CCATCCGGGC CAGCCCGCGC 541 TCCACCACAG CACGGAACAC TGCGGCCCCT GCGACGGTCC CGTCCACCAC GGCCCCGTTC 601 TTCAGTAGCA GCACGCTGGG CTCCCGACCC CCGGTGCCAG GAACTCCAAG TACCCAGGCA 661 ATGCCCTCCT GGCCTACTGC GGCATACGCT ACCTCCTCCT ACCTTCACGA TTCTACTCCC 721 TCCTGGACCC TGTCTCCCTT TCAGGATGCT GCCTCCTCTT CTTCCTCTTC TTCCTCCTCC 781 GCTACCACCA CCACACCAGA AACTAGCACC AGCCCCAAAT TTCATACGAC GACATATTCC 841 ACAGAGCGAT CCGAGCACTT CAAACCCTGC CGAGACAAGG ACCTTGCATA CTGTCTCAAT 901 GATGGCGAGT GCTTTGTGAT CGAAACCCTG ACCGGATCCC ATAAACACTG TCGGTGCAAA 961 GAAGGCTACC AAGGAGTCCG TTGTGATCAA TTTCTGCCGA AAACTGATTC CATCTTATCG 1021 GATCCAAAGA GTGAAGAAGT TTATCAAAGG CAGGTGCTGT CAATTTCATG TATCATCTTT 1081 GGAATTGTCA TCGTGGGCAT GTTCTGTGCA GCATTCTACT TCAAAAGCAA GAAACAAGCT 1141 AAACAAATCC AAGAGCAGCT GAAAGTGCCA CAAAATGGTA AAAGCTACAG TCTCAAAGCA 1201 TCCAGCACAA TGGCAAAGTC AGAGAACTTG GTGAAGAGCC ATGTCCAGCT GCAAAATTAT 1261 TCAAAGGTGG AAAGGCATCC TGTGACTGCA TTGGAGAAAA TGATGGAGTC AAGTTTTGTC 1321 GGCCCCCAGT CATTCCCTGA GGTCCCTTCT CCTGACAGAG GAAGCCAGTC TGTCAAACAC 1381 CACAGCCCAG GGCAAAGAAG TGGCATGCTC CATAGGAATG CCTTCAGAAG GACACCCCCG 1441 TCACCCCGAA GTAGGCTAGG TGGAATTGTG GGACCAGCAT ATCAGCAACT CGAAGAATCA 1501 AGGATCCCAG ACCAGGATAC GATACCTTGC CAAGGGATAG AGGTCAGGAA GACTATATCC 1561 CACCTGCCTA TACAGCTGTG GTATTCATCC AGTGGTTTAA AAACCCAACG AAATACATCA 1621 ATAAATATGC AACTGCCTTC AAGAGAGACA AACCCCTATT TTAATAGCTT GGAGCAAAAG 1681 GACCTGGTGG GCTATTCATC CACAAGGGCC AGTTCTGTGC CCATCATCCC TTCAGTGGGT

17 1 TTAGAGGAAA CCTGCCTGCA AATGCCAGGG ATTTCTGAAG TCAAAAGCAT CAAATGGTGC 1801 AAAAACTCCT ATTCAGCTGA CGTTGTCAAT GTGAGTATTC CAGTCAGCGA TTGTCTTATA

1861 GCAGAACAAC AAGAAGTGAA AATATTGCTA GAAACTGTCC AGGAGCAGAT CCGAATTCTG 1921 ACTGATGCCA GACGGTCAGA AGACTACGAA CTGGCCAGCG TAGAAACCGA GGACAGTGCA

1981 AGCGAAAACA CAGCCTTTCT CCCCCTGAGT CCCACAGCCA AATCAGAACG AGAGGCGCAA 2041 TTTGTCTTAA GAAATGAAAT ACAAAGAGAC TCTGCATTGA CCAAGTGA Human Nrg3 protein taken from XP 66086 (SEQ ID No: 2)

1 MSEGAAAASP PGAASAAAAS AEEGTAAAAA AAAAGGGPDG GGEGAAEPPR ELRCSDCIVW

61 NRQQT LCW PLFIGFIGLG LSLMLLKWIV VGSVKEYVPT DLVDSKGMGQ DPFFLSKPSS

121 FPKA ETTTT TTSTTSPATP SAGGAAΞSRT PNRI STRLTT ITRAPTRFPG HRVPIRASPR 181 STTARNTAAP ATVPSTTAPF FSSSTLGΞRP PVPGTPSTQA MPSWPTAAYA TSSYLHDSTP

241 S TLSPFQDA ASSSSSSΞSS ATTTTPETST SPKFHTTTYS TERSEHFKPC RDKDLAYCLN

301 DGECFVIETL TGSHKHCRCK EGYQGVRCDQ FLPKTDSILS DPKSEEVYQR QVLSISCIIF

361 GIVIVGMFCA AFYFKSKKQA KQIQEQLKVP QNGKSYSLKA SSTMAKΞENL VKSHVQLQNY

421 ΞKVERHPVTA LEKMMESSFV GPQSFPEVPS PDRGSQSVKH HSPGQRSGML HRNAFRRTPP 481 SPRSRLGGIV GPAYQQLEES RIPDQDTIPC QGIEVRKTIS HLPIQLWYSS SGLKTQRNTS

54 1 INMQLPΞRET NPYFNSLEQK DLVGYSSTRA SΞVPI IPSVG LEETCLQMPG ISEVKSIKWC

601 KNSYSADVVN VSIPVSDCLI AEQQEVKILL ETVQEQIRIL TDARRΞEDYE LASVETEDSA

661 ΞENTAFLPLΞ PTAKΞEREAQ FVLRNEIQRD SALTK

The EGF domain of human Nrg3, residues 285-332 (SEQ ID No: 3)

1 EHFKPCRDKD LAYCLNDGEC FVIETLTGΞH KHCRCKEGYQ GVRCDQFL

Claims

1. A method of promoting the differentiation of a mammary cell, the method comprising contacting the mammary cell with Neuregulin-3 (Nrg3) or a variant thereof which has mammary cell differentiation activity.

2. A method according to Claim 1 wherein the mammary cell is selected from a mammary gland cell precursor, a mammary stem cell, a precursor mammary epithelial cell, or other undifferentiated or progenitor mammary cell.

3. A method according to Claim 1 or 2 that is performed in vivo.

4. A method of promoting the differentiation of a cell into a mammary cell, the method comprising contacting the cell with Nrg3 or a variant thereof that has mammary cell differentiation activity.

5. A method of directing a precursor epithelial cell to become a mammary epithelial cell, the method comprising contacting the precursor epithelial cell with Nrg3 or a variant thereof which has mammary cell differentiation activity.

6. A method according to Claim 5 that is performed in vivo.

7. A method according to Claim 5 or 6 wherein the precursor epithelial cell is isolated from, or is derived from, skin or mammary gland tissue or a combination of both skin and mammary gland tissue.

8. A method of inducing the growth and/or differentiation of a mammary stem cell, the method comprising contacting the mammary stem cell with Nrg3 or a variant thereof which has mammary cell differentiation activity.

9. A method according to any of Claims 1 to 8 further comprising the prior step of determining whether the cell expresses ErbB4.

10. A method of encouraging a cell population that contains undifferentiated cells, at least some of which are able to differentiate into a mammary stem cell, to produce mammary stem cells, the method comprising contacting said cell population with Nrg3 or a variant thereof which has mammary cell differentiation activity.

11. A method according to Claim 10 wherein the undifferentiated cells are stem cells.

12. A method according to Claim 11 wherein the stem cells are embryonic stem cells.

13. A method of identifying a mammary stem cell from a population of cells that comprises a mammary stem cell, the method comprising identifying a cell that expresses Nrg3.

14. A method according to Claim 13 comprising identifying a cell that further expresses a marker selected from Lefl, P63, Sca-1 and keratin-6.

15. A method according to Claim 13 or 14 further comprising identifying a cell that in addition does not express a neural stem cell marker.

16. A method according to any of Claims 13 to 15 further comprising isolating the identified cell.

17. A method according to Claim 16 further comprising culturing the identified cell.

18. A method according to any of Claims 10 to 15 further comprising the prior step of determining whether cells in the cell population express ErbB4.

19. A method according to any of Claims 1, 2, 4, 5, 7 to 16 and 18 that is performed in vitro.

20. A method of producing mammary tissue, the method comprising culturing cells and contacting the cells with Nrg3 or a variant thereof which has mammary cell differentiation activity.

21. A method according to Claim 20 wherein the cells are contacted with the Nrg3 or variant thereof prior to being cultured.

22. A method according to Claim 20 or 21 wherein the cells are contacted with the Nrg3 or variant thereof during culture.

23. A method according to any of Claims 20 to 22 wherein the cells are cultured in a 3D scaffold.

24. A method according to Claim 23 wherein the 3D scaffold is a collagen matrix or collagen gel.

25. A method according to any of Claims 20 to 24 wherein the cells are or include epithelial cells.

26. A method according to any of Claims 20 to 25 wherein the cells are isolated from, or derived from, skin or mammary tissue or a combination of both skin and mammary tissue.

27. A method according to any of Claims 20 to 26 wherein the cells are isolated from, or derived from, a patient into whom the mammary tissue is intended to be introduced.

28. A method according to any of Claims 20 to 27 wherein the cells are cultured in vitro.

29. A method according to any of Claims 20 to 27 wherein the cells are cultured in vivo.

30. A method of preparing mammary tissue for transplantation to a patient, the method comprising: providing cells that have been obtained from the patient; and producing mammary tissue according to the method of any of Claims 20 to

29.

31. A method according to Claim 30, further comprising introducing the mammary tissue thus produced into the patient.

32. A method of preparing mammary tissue in situ in the breast of a patient, the method comprising: providing cells that have been obtained from the patient; inserting the cells into the breast of the patient; and producing mammary tissue according to the method of any of Claims 20 to

27.

33. A method according to any of Claims 30 to 32, wherein the mammary tissue is for breast reconstruction after surgery.

34. A method according to any of Claims 30 to 32, wherein the mammary tissue is for cosmetic breast augmentation.

35. A pharmaceutical composition comprising Nrg3 or a variant thereof which has mammary cell differentiation activity and a pharmaceutically acceptable carrier, diluent or excipient.

36. A pharmaceutical composition according to Claim 35 which is formulated for systemic administration.

37. A pharmaceutical composition according to Claim 35 which is formulated for topical administration to the breast.

38. Nrg3 or a variant thereof which has mammary cell differentiation activity, for use in medicine.

39. A method of preventing breast cancer in an individual, the method comprising administering to the individual Nrg3 or a variant thereof which has mammary cell differentiation activity.

40. A method of lowering an individual's risk of developing breast cancer, the method comprising admimstering to the individual Nrg3 or a variant thereof which has mammary cell differentiation activity.

41. A method of lowering the incidence of breast cancer in a population, the method comprising admimstering Nrg3 or a variant thereof which has mammary cell differentiation activity to a plurality of individuals in the population.

42. A method according to any of Claims 39 to 41 wherein the individual is a female individual.

43. A method according to Claim 42 wherein the female individual has not undergone a full-term pregnancy.

44. A method according to any of Claims 39 to 43 wherein the individual has undergone puberty.

45. A method according to any of Claims 39 to 44 wherein the Nrg3 or variant thereof is administered systemically.

46. A method according to any of Claims 39 to 44 wherein the Nrg3 or variant thereof is administered locally to the breast.

47. A method according to Claim 46 wherein the Nrg3 or variant thereof is administered topically.

48. Use of Nrg3 or a variant thereof which has mammary cell differentiation activity in the preparation of a medicament for promoting the differentiation of mammary cells in an individual.

49. Use of Nrg3 or a variant thereof which has mammary cell differentiation activity in the preparation of a medicament for preventing breast cancer in an individual.

50. Use of Nrg3 or a variant thereof which has mammary cell differentiation activity in the preparation of a medicament for lowering an individual's risk of developing breast cancer.

51. Use of Nrg3 or a variant thereof which has mammary cell differentiation activity in the preparation of a medicament for lowering the incidence of breast cancer in a population of individuals.

52. Use according to any of Claims 48 to 51 wherein the medicament is formulated for systemic administration.

53. Use according to any of Claims 48 to 52 wherein the medicament is formulated for topical administration.

54. Use according to any of Claims 48 to 53 wherein the individual is a female individual.

55. A method of producing a non-human female mammal with extra and/or larger mammary glands, the method comprising administering Nrg3 or a variant thereof which has mammary cell differentiation activity to the embryo of said non- human mammal.

56. A method according to Claim 55 wherein the Nrg3 or variant thereof is administered to the embryo in utero.

57. A method according to Claim 55 wherein the Nrg3 or variant thereof is administered to the embryo in vitro, and the embryo is subsequently inserted into the uterus of a non-human mammal.

58 A method according to Claim 57 further comprising the prior step of removing the embryo from the uterus of a pregnant non-human female mammal.

59. A method according to Claim 55 wherein admimstering the Nrg3 or variant thereof comprises administering a polynucleotide that encodes the Nrg3 or variant thereof to the embryo of the non-human mammal or to a precursor cell of the embryo.

60. A method according to Claim 59 wherein the polynucleotide expresses the Nrg3 or variant at the site of breast development.

61. A method according to Claim 59 or 60 wherein the polynucleotide expresses the Nrg3 or variant thereof immediately preceding and/or during breast development.

62. A transgenic non-human mammal comprising an exogenous polynucleotide that expresses Nrg3 or a variant thereof which has mammary cell differentiation activity in the embryo at the site of mammary development immediately preceding and/or during mammary development.

63. A transgenic non-human mammal comprising an exogenous polynucleotide that expresses Nrg3 or a variant thereof which has mammary cell differentiation activity in the mature mammary gland.

64. A method or a use or a composition or a transgenic animal according to any of the preceding claims, wherein the variant of Nrg3 which has mammary cell differentiation activity is a polypeptide that comprises or consists of the EGF domain ofNrg3.

65. A method or a use or a composition or a transgenic animal according to any of the preceding claims, wherein the variant of Nrg3 which has mammary cell differentiation activity comprises or consists of a sequence variant, fusion or modification of the EGF domain of Nrg3.

66. A method of screening for an agent that has a protective effect against breast cancer, the method comprising (a) providing mammary cells or mammary tissue produced using the method of any of Claims 1 to 29; (b) providing a test agent; (c) providing a cancer-inducing agent; and (d) assessing the rate or extent of tumourigenesis in the mammary cells or mammary tissue, wherein a reduction in the rate or extent of tumourigenesis in the presence of the test agent indicates that the test agent may have a protective effect against breast cancer.

67. A method of screening for an agent that has a protective effect against breast cancer, the method comprising (a) providing mammary cells or mammary tissue produced using the method of any of Claims 1 to 29; (b) inducing tumourigenesis in the mammary cells or mammary tissue; (c) providing a test agent; and (d) assessing the rate or extent of tumourigenesis in the mammary cells or mammary tissue, wherein a reduction in the rate or extent of tumourigenesis in the presence of the test agent indicates that the test agent may have a protective effect against breast cancer.

68. A method of screening for a variant of Nrg3 that has a protective effect against breast cancer, the method comprising (a) providing mammary cells or mammary tissue; (b) exposing the mammary cells or mammary tissue to a variant of Nrg3 that has mammary cell differentiation activity; (c) optionally, providing a cancer-inducing agent; and (d) assessing the rate and/or extent of tumourigenesis in the mammary cells or mammary tissue, wherein a reduction in the rate and/or extent of tumourigenesis in the presence of the variant of Nrg3 agent indicates that the variant may have a protective effect against breast cancer.

69. A method for inhibiting the differentiation of a mammary cell, the method comprising contacting the mammary cell with an antagonist of Nrg3.

70. A method of preventing a precursor epithelial cell becoming a mammary epithelial cell, the method comprising contacting the precursor epithelial cell with an antagonist of Nrg3.

71. A method for reversing the differentiation of a mammary cell, the method comprising contacting the mammary cell with an antagonist of Nrg3.

72. A method according to any of Claims 69 to 71 wherein the antagonist of Nrg3 is an anti-Nrg3 antibody.

73. Use of Nrg3 or a variant thereof that has mammary cell differentiation activity to promote the progression of a cell along a mammary cell differentiation pathway.