WO2005007701A1

WO2005007701A1 - Intensified fusion protein fv-ldp-ae having angiogenesis inhibiting and antitumor activety and the use thereof

Info

Publication number: WO2005007701A1
Application number: PCT/CN2004/000842
Authority: WO
Inventors: Liang Li; Yongsu Zhen; Qingfang Miao; Boyang Shang; Xiujun Liu; Min Jiang
Original assignee: Institute Of Medicinal Biotechnology, Chinese Academy Of Medical Sciences
Priority date: 2003-07-22
Filing date: 2004-07-21
Publication date: 2005-01-27
Also published as: CN1475506A; CN1260367C

Abstract

The invention relates to a novel antibody-targeted medicine having the angiogenesis inhibiting effect, intensity killing effect on tumor cells and therapy effect of antitumor, an intensified fusion protein Fv-LDP-AE, the method of preparation thereof and the use of the intensified fusion protein for the preparation of antitumor medecine.

Description

Enhanced fusion protein Fv-LDP-AE with angiogenesis inhibiting and antitumor effects and uses thereof Field of the invention

The invention relates to a novel antibody-directed drug with an anti-angiogenic effect, strong killing of tumor cell activity and anti-tumor treatment effect, and strengthens a fusion protein.

Fv-LDP-AE, its preparation method, and its use for preparing antitumor drugs. Background technique

Matrix metalloproteinases play an important role in the invasion and metastasis of cancer cells, especially type IV collagenases MMP-2 and MMP-9 can degrade the extracellular base shield components such as type IV collagen and destroy the integrity of the basement membrane and extracellular matrix It is helpful for tumor cell invasion and metastasis, and its expression in tumor neovascular endothelial cells is higher than that in normal tissue vascular endothelial cells. Inhibition of matrix metalloproteinase activity can inhibit tumor cell invasion and metastasis and tumor angiogenesis. Thus, matrix metalloproteinase MMP-2 / MMP 9-monoclonal antibody as a drug carrier guide may be provided not only targeted tumor, and which itself has an anti-anti-tumor effect _Θ present invention ΜΜΡ-2 / Μ Li P-9 mAb 3G11 is immunologically positive for a variety of tumor cells and has specific binding ability to a variety of human tumor tissues ₉ especially digestive tract tumor tissues

Single-chain antibody (scFv) is typically a length of flexible peptide chain connecting the V _H and the minimum antibody fragment having functional complete antigen binding site thereof. The scFv is more stable than the B fragment, and the scFv molecule has a better ability to penetrate solid tumors than intact antibodies, so it is more suitable as a carrier for monoclonal antibody-directed drugs.

The highly active "warhead" drug Lidamycin (hereinafter referred to as LDM, also known as C-1027 or C1027) is isolated from the soil of Qianjiang County, Hubei Province, China. ^ iw ^ cesg / s wras, the strain deposit number is: CGMCC No. 0135) The enediyne antibiotics are the killing tumor cells reported to date. The strongest macromolecular peptide antitumor antibiotic. In vivo animal experiments show that LDM has a very significant effect on colon cancer 26 in mice, and it has significant effects on human transplanted tumors such as human liver cancer Bel-7402 and cecum cancer Hce-8693 transplanted in mice (Chinese Journal of Antibiotics 1994 , 19 <2>: 164-168 \

The molecule of LDM is composed of two parts: one is a chromophore with an enediyne structure, which has a cytotoxic effect, but is unstable; the other is a prosthetic protein (LDP) composed of 110 amino acid residues. The stability of the chromophore is protective. The chromophore in the LDM molecule exists in two forms: active chromophore (ie active enediyne, AE) and inactivated chromophore. The structure is extremely unstable, and almost all are inactivated after about 1 hour, that is, AE undergoes an irreversible aromatization reaction and is converted into a structurally stable inactivated chromophore. However, AE is the active part of LDM, and the only co-protein is To protect the function of AE, the level of AE content in the LDM molecule determines the strength of its effect. Therefore, in order for LDM to have high-strength biological activity, the high percentage of AE in the chromophore of LDM must be guaranteed.

The invention is based on the newly constructed fusion protein Fv-LDP, and strictly controls the quality of the chromophore used. The active enediyne chromophore (AE) is used to perform molecular strengthening to obtain a strengthened fusion protein Fv. -LDP-AE, as a new type of antibody-targeting drug with better anti-tumor activity. Summary of the invention

Miniaturization, high efficiency of monoclonal antibody-targeted drugs, and finding new specific tumor targets are the main effective ways to solve the current problems of monoclonal antibody therapeutics. According to the present invention, an immuno-directed fusion protein prepared by using single-chain antibody scFv constructed with genetic engineering technology and lidamycin can effectively direct an effector molecule to a specific tumor target site, compared with an immunocouple obtained by chemical coupling technology. The complex has the advantages of molecular uniformity and efficient miniaturization. One aspect of the present invention relates to the enhanced fusion protein Fv-LDP-AE, which is a single-chain antibody scFv (3G11) against matrix metalloproteinase MMP-2 / MMP-9, a lipamycin co-protein LDP, and two The fusion protein Fv-LDP formed by the flexible peptide spacer (GGGGS) and the histidine hexamer tail (His ₆ -tag) at the carboxyl group, and the daptomycin-active diene acetylene chromophore AE (molecular weight 843 kDa).

Fusion protein Fv-LDP

Specifically, the full-length encoding gene of the fusion protein Fv-LDP according to the present invention is 1119 bp (as shown in SEQ ID NO: 1), encodes 372 amino acids (as shown in SEQ ID NO: 2), and has a molecular weight of approximately 38.7 kDa. .

In our laboratory, an assembled fusion protein LDM-Fv (Pharmaceutical Journal 2000, 35 <7>: 488-491) was prepared in the past. Compared with the single-chain antibody of the present invention, the hybridoma cell line has different origin. The monoclonal antibody scFv (3G11) of the present invention is derived from mouse anti-type IV collagenase (including 92 kDa and 72 kDa) hybridoma cell line 3D6, and the assembled fusion protein LDM-Fv (Acta Pharmica Sinica 2000, 35 <7>: 488-491) and the derived scFv-M97 monoclonal antibody anti-mouse type IV collagenase (92 kDa) of the hybridoma cell lines of both C2H5 ₀ scFv gene sequences by homologous than the current 91 %, The full-length 741 eFv (3G11) encoding gene of the present invention encodes 741, and the full-length 732 bp gene of the seFv-M97 encoding gene; especially the single-chain antibody ∞FY (3G11) and scFv-M97 of the present invention Nucleotide sequences of two in the CDR2 region of the VH chain and six in the CDR3 region of the VH chain can cause differences in the encoded amino acid sequence.

The difference in nucleotide sequences between the two makes their encoded amino acid sequences different, so the scFv (3G11) of the present invention is significantly different from scFv-M97 in specific antigen recognition and antigen-antibody binding characteristics. difference.

The parental monoclonal antibody 3G11 of scFv (3G11) in the present invention has high immunocompatibility with its antigen MMP-2 / 9, and it has been confirmed by Western-blotting analysis; moreover, it is confirmed by experiments that it is derived from the hybridoma cell line 3D6 MAb 3G11 shows immunological activity in a variety of human tumor tissues (Li Liang, Liu Xiujun, Zhen Yongsu. Antibodies Study on the tumor targeting distribution of type IV collagenase mAb and its antitumor effect. 2002 National Oncology Academic Collection 2002: 202), and targeted distribution in xenograft AJjT cancer tissues in mice [Dai Yi, Jia Bing, Zhen Yongsu, et al. Immunoimaging of anti-type IV collagenase mAb in human lung cancer rat transplantation model. Cancer 2003, 22 (12): 1243-1248] Furthermore, studies have shown that the scFv (3G11) fragment still retains the immunological binding activity of the parental monoclonal antibody 3G11 (Tang Yong, Zhen Yongsu. Expression of anti-type IV collagenase single chain antibody and Inhibition of tumor cell invasion. Cancer 2001, 20: 801-805).

The newly constructed fusion protein Fv-LDP of the present invention inserts a small stretch of flexible peptide spacer (GGGGS) between the single chain antibody scFv (3G11) and lidamycin co-protein LDP, so that scFv and LDP can be correctly folded, respectively. Form their original spatial conformations so as not to affect their respective biological activities.

2. Active enediyne chromophore AE

The molecular weight of LDM is known to be 11349.1120 Da. The molecular weight of the co-protein LDP is 10505.7830 Da, and the molecular weight of the chromophore is 843,3295 Da. The chemical structure and molecular formula of the active and inactive chromophores of LDM are as follows:

Chemical name of LDM chromophore (Chinese and English)

(2R ₉ 7S _§ ¾ l®) -7-amino-7 _9- (2 * -chloro-6 * -hydroxy-1 4 * -phenylene) -10- (4 ⁵ -deoxy-4, -di Methylamino-5,, 5, -dimethyl-ribopyranosyl) -4,8-oxo-5-oxo-1,11,13-triene-15,18-diyne-tricyclo [ 7,7,3,0 ^{1 (),} ¹⁴ BU 2- nonadeca alcohol -2 3 ,, ,,, - ,, dihydro [7 - methoxy-2 ,, - ,, methylene-3 -Oxo-1 ,,, 4 ,,-benzoxazine-5 ,,-carboxylate.

(2R, 7S, 9R, 10R) -7-Amino-7,8- (2 * -chloro-6 * -hydroxy-l *, 4 * -phen ylene) -10- (4'-deoxy-4'- dimethylamino-5 ', 5'-dimethyI-ribopyranosid o) -4 _? 8-dioxa-5-oxo-l, ll, 13-trien-15,18-diyn-tricyclo [7,7,3,0 ^{10 14} ] -2-no ndecanyl― 2 ", 3" -dihydro-7 "-methoxy-

2 "-methylene-3"-oxo- l ", 4" -benzoxazine-5 "-carboxylate Chemical structural formula of chromophore (pictured):

Molecular formula: C ₄₃ H ₄₂ 0 ₁₃ N ₃ CI

It is known that the chromophore of LDM and prosthetic proteins are bound through non-covalent bonds, and the combination of the two is specific and robust. In addition, LDM can be resolved and molecularly strengthened. This unique molecular structure and its low molecular weight and high activity make LDM an ideal choice for the construction of new monoclonal antibody-directed drugs. "Warhead ,, Drug (Chinese Academy of Medical Sciences 2001) , 23 <6> S63-567 X

Another aspect of the present invention relates to the preparation of a strengthened fusion protein Fv-LDP-AE. Specifically, in the present invention, on the newly constructed fusion protein Fv-LDP, the quality of the chromophore used is strictly controlled, and the active enediyne chromophore (AE) with strong activity is used to perform molecular strengthening to obtain strengthening. The fusion protein Fv-LDP-AE is a novel antibody-directed drug with better antitumor effect. The fusion protein utilizes the binding specificity of an anti-MMP-2 / 9 single-chain antibody scFv (3G11) to target a highly effective adamycin chromophore (AE) to a tumor tissue site where an antigen is highly expressed, and exerts its effect on tumor cells. The high cytotoxic effect shows strong angiogenesis inhibitory activity, and has significant effects in in vivo animal experiments, showing a good application prospect. Specifically, the preparation technology route includes:

For the preparation method of the LDM used in the present invention, refer to the Chinese patent (patent application number: 00121527.2) filed with the Chinese Patent Office on August 10, 2000 and granted in October 2003. Generally, the activity of LDM products can be determined by measuring the relative content of AE in the total chromophore. HPLC analysis is usually used to determine the percentage of AE in the total chromophore in LDM products. AE is greater than or equal to 80% of the total chromophore as the quality standard for qualified LDM products.

In a specific embodiment of the present invention, the molecular strengthening is performed by the following steps: Fv-LDP / 0.01 M PBS (pH 7.0) and AE methanol solution are mixed and stirred at a molecular ratio of 1: 5 and a volume ratio of 1:50. Reaction at room temperature for 12 h to obtain the enhanced fusion protein Fv-LDP-AE ₀

The inventors have unexpectedly discovered that by using a high proportion of AE for molecular reinforcement, the activity of the resulting enhanced fusion protein can be greatly improved. In the present invention, an LDM qualified product with an AE percentage value greater than 80% is preferably used, and LM with an AE percentage value greater than the nutrient% is preferably used for molecular strengthening to prepare a reinforced fusion protein _β. In the present invention, AE in high-quality LDM The percentage value can be up to 90.63%.

In the past, the chromophore required to prepare the assembled fusion protein LDM-Fv in this laboratory was extracted from the low-activity LDM obtained by the old preparation method, of which the proportion of AE was only 60%, and a stronger tumor could not be obtained. Product of cellular cytotoxic activity. The cytotoxic activity of the assembled fusion protein LDM-Fv was determined by an in vitro clone formation method, and its IC _{5 ()} value was 9.5 × ^{10 15} M, which was higher than the IC ₅₀ value of the enhanced fusion protein Fv-LDP-AE according to the present invention (1.65 × ^{10 16} M) 58 times lower; no immune binding activity was observed in human colon cancer tissues, no strong angiogenesis inhibitory effect was seen, and its efficacy was not demonstrated in animal experiments. Another aspect of the present invention relates to the use of the enhanced fusion protein Fv-LDP-AE for the preparation and treatment of human malignant tumors, such as colon cancer, rectal cancer, esophageal cancer, gastric cancer, liver cancer, breast cancer, ovarian cancer, lung cancer and kidney cancer Use of pharmaceutical compositions for a variety of solid tumors, especially digestive tract tumors.

Yet another aspect of the present invention relates to a pharmaceutical composition containing a therapeutically effective amount of the fortified fusion protein Fv-LDP-AE of the present invention. Optionally, the pharmaceutical composition further comprises administration with the pharmaceutical composition. Modes and dosage forms are compatible with pharmaceutically acceptable carriers and excipients.

Yet another aspect of the present invention relates to a method for treating a malignant tumor, which comprises administering a therapeutically effective amount of a fortified fusion protein or a pharmaceutical composition of the present invention to a patient with a malignant tumor.

The research of the present invention proves that the enhanced fusion protein is selectively distributed in human colon cancer tissues with high expression of type IV collagenase, shows strong killing activity on tumor cells, and has a high inhibitory effect on angiogenesis. Animal experiments have very significant treatment effect. After a search, there have been no reports of similar enhanced fusion proteins at home and abroad, and it is currently known as the smallest molecular weight immune-directed fusion protein that has proven to have significant anti-cancer efficacy in vivo. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1: PCR amplification of scFv and LDP genes and restriction endonuclease analysis of recombinant cloning vectors. Among them: 1- DNA molecular weight standard; 2- scFv PCR product; 3- LDP PCR product; 4- Recombinant plasmid pGEM-T-scFv / Nde l + EcoR I; 5- Recombinant shield particle pGEM-T-LDP / EcoR I + Xho I.

Figure 2: Restriction endonuclease analysis of recombinant pEFL in the transformed strain CAMS / FLDFP. Among them: 1- DNA molecular weight standard; 2-plasmid pET-30a (+); 3-recombinant plasmid pEFL; 4- pET-30a (+) / Nde I + EcoR I; 5- pEFL / Nde I + EcoR I; 6 -pET-30a (+) / EcoR I + Xho I; 7- pEFL / EcoR I + Xho I; 8- pET-30a (+) flat e I + Xho I; 9- pEFL / Nde I + Xho l

Figure 3: SDS-PAGE analysis of the fusion protein Fv-LDP expression product. among them:

1-protein molecular weight standard; 2- BL21 (DE3) star ™ / pET-30a (+) whole bacterial protein before IPTG induction; 3- BL21 (DE3) star ™ / pET-30a (+) whole bacterial protein after IPTG induction; 4-Transformed strain CAMS / FLDFP before IPTG induction of whole bacterial protein; 5-Transformed strain CAMS / FLDFP after IPTG induction of whole bacterial protein; 6-Transformed strain CAMS FLDFP after IPTG induction of bacterial cell supernatant; 7- Transformed strain CAMS / FLDFP was induced by IPTG and the inclusion bodies were precipitated.

Figure 4: Western-blot analysis of the fusion protein Fv-LDP. Among them: A: Lidamycin co-protein monoclonal antibody F9 as the primary antibody; B: Antihistidine-labeled tail monoclonal antibody as the primary antibody; 1- BL21 (DE3) star ™ / pET-30a (+) IPTG Protein before induction

2- BL21 (DE3) star ™ / pET-30a (+) IPTG-induced whole bacterial protein; 3- transformed strain CAMS / FLDFP before IPTG-induced whole bacterial protein; 4- transformed strain CAMS / FLDFP after IPTG-induced bacterial whole Protein; 5- Transformed strains of CAMS / FLDFP were induced by IPTG and the inclusion bodies were precipitated; 6- Transformed strains of CAMS / FLDFP were induced by IPTG and the supernatant of the bacterial cells.

Figure 5: SDS-PAGE analysis of fusion protein purified by metal chelation chromatography. Among them: 1-protein molecular weight standard; 2 _¾ 5- sample before affinity column was not _loaded ; 4- liquid collected after column washing with binding buffer; 5- liquid collected after column washing with 20 mM imidazole washing buffer 6-10- Protein fractions collected every 1 h after washing the column with 1 M imidazole elution buffer.

Figure 6: Isolation and purification of the enhanced fusion protein Fv-LDP-AE. Where: Analytical column: PD-10; Mobile phase: PBS, pH 7.0; Peak 1- Purified fortified fusion protein Fv-LDP-AE; Peak 2- Unreacted excess AE.

Figure 7: ELISA analysis of the immunoreactivity of the fusion protein Fv-LDP with type IV collagenase and different tumor cells. Among them: AIV collagenase; ■ HT-29 cells; ♦ HT-1080 cells. Figure 8: Immunohistochemical analysis of the immunological activity of the fusion protein Fv-LDP with human colon cancer tissues. Among them: A: immunohistochemical staining of Fv-LDP in human colon cancer tissue; B: negative control, PBS instead of Fv-LDP as the primary antibody; magnification is 200 times, the scale in the figure is 20 j¾m.

Figure 9: Analysis of type IV collagenase enzyme i of HT-1080 cells by fusion protein Fv-LDP. Among them: 1-PBS; 2-empty vector obtained by IPTG induction of whole bacterial protein; 3-complete monoclonal antibody 3G11 (6 Μ); 4-fusion protein Fv-LDP (30 fM)

Figure 10: Inhibition of enhanced fusion protein Fv-LDP-AE on bFGF-stimulated angiogenesis in chicken embryos. Among them: A: chicken embryo urinary diaphragm blood vessels treated with PBS only; B: bFGF as stimulant, chicken embryo urinary diaphragm blood vessels treated with PBS; C: bFGF as stimulant, LDM (0.1 / ig / chicken (Embryo) treated chicken embryo with urinary membrane blood vessels; D: bvGF as stimulant, Fv-LDP-AE (0.4] ¾g / chicken embryo) treated chicken embryo urine diaphragm blood vessel.

Figure 11: Enhanced killing activity of the fusion protein Fv-LDP-AE on tumor cells HT-29. Of which: ♦ Fv-LDP-AE; ■ LDM

Figure 12: The inhibitory effect of the enhanced fusion protein Fv-LDP-AE on the growth of liver cancer H22 in mice: ♦ Control; ▲ Fv-LDP group; National LDM group; △ Fv-LDP-AE3, 2 group; ◊ Fv-IJDP -AE1,6 groups; □ Fv-LDP-AEi group

Figure 13: HPLC analysis of lidamycin. Among them: Analytical column: Delta-PAK C4 5μιη, 300A 150x3.9mm ID; mobile phase: acetonitrile / 0.025% trifluoroacetic acid (20%: 80%) = 23: 77, flow rate: 0.6 ml / min, detection wavelength: 350 nm

Figure 14: Mass spectrometric analysis of lidamycin active enediyne chromophore AE. Among them: Test instrument: Quattro LC tandem mass spectrometer; equipped with an electrospray ion source (UK MICROMASS company); the sample was dissolved in 50% acetonitrile at a concentration of 0.5mg / ml, and injected directly into the electrospray ion source for mass spectrometry through a syringe pump analysis. AE main peak m / z is 844.4 (M + 1); chromophore aromatization product peak m / z is 846.4 (M + 1); chlorine isotope peak m / z is 848 (M + 1); hetero peak May be due to insufficient sample purity or some variation Cloning of a fusion gene of Lidazun pro-protein LDP / anti-MMP-2 / 9 single-chain antibody scFv (33G11)

Recombinant plasmids pCANscFv or PIC-9kFvl027 and pIJ1027GRGDS contain scFv gene and LDP gene, respectively, which are stored in our laboratory. The GEM-T vector is a product of the American Promega company. The E. coli strain R coli DH5a was stored in this laboratory. The PCR primers were synthesized by Cyperion, and the corresponding restriction enzymes (TaKaRa products) restriction sites were introduced.

scFv 5, end primer (PH1, SEQ ID NO: 3):

5, CGCATATG CAGGTGAAGCTGCAGCAGTCT 3,

Nde l V _H

scFv 3, end primer (PL2, SEQ ID NO: 4):

5 ^? CGGAATTC TGAACCGCCTCCACC ACGTTTGATTTCCAG 3,

EcoR I spacer V _L

LDP 5, end primer (PLD1, SEQ ID NO: 5):

5, CGGAATTC GCGCCCGCCTTCTCCGTCAGTCCC 3 ^?

EcoR I LDP

) 1 * 3, end primer (? 0> 2, SEQ ID NO: 6):

5, CCGCTCGAG TCAGCCGAAGGTCAGAGCCACGTG 3,

Xho I LDP

The recombinant plasmid pCANscFv or pKFvl027 was used as a template, PHI was 5, primers, PL2 was 3, and the primers were PCR amplified to obtain a single-chain antibody scFv gene fragment with a small peptide spacer at the C-terminus; and the recombinant plasmid IJ1027GRGDS was used as a template , PLD1 is 5, primers, PLD2 is 3, primers are PCR amplified to obtain LDP gene fragments.

The PCR reaction system was pre-denatured at 94 ° C for 2 minutes, and then subjected to 25 PCR cycles: Denaturation at 94 ° C for 1 minute, 55 ° C (scFv gene amplification) or 58 ° C (LDP gene amplification) annealing for 1 minute, 72 ° C extension for 1 minute, and 72 after the last cycle. C was held for 10 minutes.

The two PCR products were purified and recovered using DNA fragment glass milk recovery kit (product of BioDev), and were connected to Promage's pGEM-T vector according to the method provided by Promage's kit to transform E. coli DH5, and the recombinant T vector pGEM- was selected. T-Fv and pGEM-T-LDP were identified by enzymatic digestion (Figure 1), and sequenced by Shanghai Bio-Biotech, respectively. The scFv (3G11) gene was 741 bp in length, encoding 247 acids, and the LDP gene was 342 bp in length. , Encoding 114 acids, 15 bp of flexible peptide spacer gene between the two, encoding 5 amino acids, 18 bp encoding the carboxy-terminal histamine hexamer tail, encoding 6 amino acids, and a stop codon 3 bp The gene is 1119 bp in length and encodes 372 amino acids. Example 2. Construction of the recombinant expression plasmid pEFL of the fusion protein E. coli The E. coli expression plasmid pET30a (+) (product of Invitrogen) selected by the present invention was stored in this laboratory. The recombinant cloning plasmid pGEM-T-Fv with Nde I and cloned recombinant plasmid EeoR 1 _¾ GEM-T-LDP with E! OR I ¾w I and the restriction fragments obtained after double digestion, is separated and recovered by agarose gel electrophoresis . The two fragments were cloned into the expression vector pET30a (+) digested with Nde I and Xho I, and transformed into competent cells of the host strain BL21 (DE3) star ™ (product of Invitrogen). Extract the recombinant plasmid.

Enzymatic digestion of the obtained recombinant expression plasmid showed that it contained the correct insert (Figure 2). Two T7 universal primers were used for sequencing. The results showed that the fusion gene Fv-LDP sequence was completely consistent with the expected sequence. The expression plasmid pET-30a (+) used in the present invention is fused with a gene sequence encoding a histidine hexamer tail (His _6- Tag) at the 3 and 3 ends of its multiple cloning site. After translation and expression, His _6- Tag facilitates the expression identification and purification of fusion proteins. Example 3. Induced expression of the fusion protein Fv-LDP in E. coli BL21 (DE3) star ™

The above transformants were picked from the LB plate and inoculated into an LB medium containing 50 μm of kanamycin, and shaken at 37 ° C overnight; the next day, the seed was transfected at 1:50, and cultured at 37Γ with shaking to OD ₆ . . At 0.9, add isopropylthio-3-D-galactoside (IPTG) at a final concentration of 0.8 mmol / L to the culture, induce culture for 4-6 hours, take 1 ml of culture solution, and centrifuge at 12000 rpm for 1 minute Collect the bacterial cells, remove the supernatant, resuspend the cells in 300 μΐ PBS, sonicate the cells, centrifuge at 12,000 rpm for 10 minutes, collect the supernatants, and resuspend the pellet in 300 μ 沉淀 PBS; 12% SDS- PAGE electrophoresis analysis of the expression of foreign proteins, the fusion protein was expressed in the form of insoluble inclusion bodies (Figure 3). The quantitative analysis of the imaging system showed that the expression level of the fusion protein induced by optimal conditions accounted for more than 30% of the total protein of the transformant strain. Finally, the transformant forest that optimally expressed the fusion protein was selected.

One of these strains contained a pEFL plasmid capable of expressing the fusion protein Fv-LDP, named CAMS / FLDFP, and was deposited on June 24, 2003 at the General Microbiology Center of the China Microbial Species Collection Management Committee in Beijing. . 0961

Using Western Blot detection and analysis, after 12% SDS-PAGE electrophoresis, a semi-dry electric transfer was performed in a Bio-Rad electric transfer tank. The conditions of the electric transfer were: constant current 0.65 mA / cm ² for about 1.5-2 hours. After the electroporation, PVDF membranes were incubated with F9 monoclonal antibody or His-Tag monoclonal antibody diluted with blocking solution, and HRP-labeled goat anti-mouse IgG antibody was used as a secondary antibody. FLDFP successfully expressed the fusion protein Fv-LDP (Figure 4). Example 4. Purification and separation of the fusion protein Fv-LDP by affinity chromatography Using His-Bind purification kit (Novagen) for denaturation ^ Purified protein samples. After pretreatment of the affinity column, equilibrate the column with 3 volumes of 6 M urea in 1x binding buffer (20 mM Tris-HCl, 0.5M NaCl, 5 mM imidazole, H 7.9), and then prepare as described in the above example. After the denatured protein sample was loaded on the column, 10 volumes of urea lx binding buffer (20 mM Tris-HCl, 0.5M NaCl, 5 mM imidazole, 6M urea, H 7.9), and 6 volumes of urea lx washing buffer ( 20mM Tris-HCl, 0.5M NaCl, 60 mM imidazole, 6M urea, pH 7.9), and finally wash the column with 6 volumes of 1x elution buffer containing 6M urea (20 mM Tris-HCl, 0.5M aCI, 1 M Imidazole, 6M urea, pH 7.9) was eluted, and the eluted fractions were collected to obtain a purified fusion protein Fv-LDP (Figure 5).

Following dialysis renaturation, the protein samples were sequentially renatured with buffer I (20 mM Tris-HCl, 0.5M NaCl, 3M urea, SmMEDTA, pH 8.0), renatured buffer 11 (20 mM Tris-HCl, 0.5 M NaCl, 1M urea, 5 mM EDTA, 0.2 mM GSSG, 2 mM GSH, 0.4 M L-Arg, pH 8.0) and renaturing buffer III (20 mM Tris-HCl, O.SMNaCl, SmMEDTA, p. 0), respectively Perform dialysis for 12-24 h, and then dialyze for 24 h with PBS (pH 7.4). Concentrate with 12,000 centrifugation in an ultrafiltration centrifuge tube, Cenrtiplus-YM or Ultrafree-MC, and desalinate and freeze-dry with PD-10 (Sephadex G25 commercial column). ₅ At -80. C Storage Example 5. Preparation of Lidamycin and Determination of Relative Content of Active Chromophore AE

Preparation of Lida Zunsu

Add 0.7 ml of saline-free tube to Lidamycin-producing bacteria (CGMCC NO.0135) to form a bacterial suspension, inoculate it with Gold's No. 1 slant culture medium, 28 ° C, 7- For 10 days, white aerial mycelium grew on the surface, and a small piece was inoculated into a first-level seed 100 ml / 500 ml Erlenmeyer flask culture (the fermentation medium contains: 1% starch, 0.5% corn slurry, 0.5% blood glucose, and glucose 0.5%, MgS0 ₄ 0.02%, KIO.06%, cornmeal 1.5%, CaC0 ₃ 0.4%, tap water preparation, pH 7.0, 15 pounds disinfection), 28 ° C, Cultivate on a rotary shaker for 48 h, and use the same fermentation medium as the secondary seed in a 1000 ml / 5000 ml vertical flask with 5% of the seed. 28. C, culture in a shaker for 18 h, put on a 200 L fermenter, fill a volume of 100 L, inoculate 2%, add 0.03% foaming agent as a defoamer, tank pressure 0.04, 28 ° C, stir 400 rpm, Airflow 1/1, pH 6.5-7.0, fermentation for 96 h to obtain the required fermentation broth. Take 10 L of the fermentation broth, centrifuge the supernatant, adjust to ρΗ 4.0 with HC1, and add (NH ₄ ) ₂ S0 ₄ 4.5 K to 8. C was stirred for 3 h, and the separated lidamycin was separated by centrifugation (4 ° C, 8000 rpm, 15 min). The obtained precipitate was dissolved by adding 200 ml of cold water, dialyzed, and then centrifuged to remove insoluble matter. Apatite column adsorption, 0.001 M phosphate buffer (pH 6.8) eluted, the active part was freeze-dried to obtain the crude product 1500 mgo. The crude product was dissolved in water, and the active part was lyophilized by Sephadex G-75 column chromatography. Obtained 145 mg antitumor high activity lidamycin white powder refined product o

2. Determination of the relative content of active chromophore AE

Compared with the LDM protein part, the chromophore has a smaller molecular weight, and its theoretical content is only 7.4% of lidamycin. Since the active portion LDM AE is functioning, apoprotein AE only protection function, it is generally by the relative content of AE in the total amount of chromophoric ₅ Determination i.e., may determine the level of activity of article LDM

The analysis of LDM by HPLC can measure the percentage of AE in the total chromophore. The specific method is:

The LDM product prepared as above was dissolved in an HPLC mobile phase (acetonitrile: water 23: 77), and separated on a FPLC fast protein chromatography instrument by Waters radial pressure C4 semi-preparative column, and the eluent was acetonitrile: water ( 23: 77), collected by an automatic collector, and the collected components were detected by an HPLC C4 analytical column.

The analysis results show (Figure 13) that the AE component of the LDM prepared by the inventors accounts for 90.63% of the total LDM chromophore. Through analysis, it was determined that the LDM product meets the LDM quality control standards. It is a high-quality AE LDM product. The LDM product was lyophilized and stored in a -80 ° C refrigerator for strengthening the fusion protein Fv-LDP-AE. System Equipment.

Quattro LC tandem mass spectrometer was used for mass spectrometry analysis of the chromophore (Figure 14). The main peak of the active chromophore AE component m / z was 844.4 (M + 1), and its molecular weight was 843 kDa. The molecular weight of its aromatization product is 845 kDa.

Because the ene diacetylenic structure of AE is extremely unstable, it is almost completely deactivated after about 1 h, so the above-mentioned entire operation process must be performed at 4. C. In the case of low temperature and dark, it should be completed continuously in the shortest possible time to reduce the generation of inactive chromophores. Example 6. Preparation and isolation of the enhanced fusion protein Fv-LDP-AE

Take 10 mg of LDM refined lyophilized product as determined by the relative content of AE, shake with 5 ml of cold methanol for 5 min, and place it at -20 ° C for 1 h, shake it once; at 0. C, centrifugation at 12000 r / min for 20 min, the supernatant was rich in AE, and the sediment was peptide chains, and the extraction was repeated twice. Concentrate the methanol solution by natural evaporation. C. Protect from light. Take a certain volume and concentration of Fv-LDP and dissolve it in 0.01 mol / L phosphate buffer solution (pH 7.0), add 5 times the molecular weight of AE methanol solution (the volume ratio of Fv-LDP to phosphate buffer solution is 1: 50 ), Mixed with shaking, and left at room temperature for 12 hours. Finally, the mixed solution was separated and purified by chromatography on a PD-10 column (commercial Sephadex G-25 column ₅ Pharmada product), and the excess unreacted AE, the components of the enhanced fusion protein Fv-LDP-AE were collected, concentrated by ultrafiltration, and freeze-dried to obtain purified Fv-LDP-AE at -80. CSave for future use. (Figure 6 ). Example 7. Immunological activity of the fusion protein Fv-LDP

Detected by indirect ELISA, 10 g / ml type IV collagen was dissolved in 0.05 M, pH 7.4 PBS) 100 μΐ / well coated 96-well microtiter plate, set at 4 ° C overnight as the antigen; 10 ⁴ / well HT-1080 cells or HT-29 cells were seeded in a 96-well plate at 37 ° C and cultured overnight; after discarding the supernatant, cells were fixed with 0.25% glutaraldehyde as the cell antigen; 100 μΐ 10% skim milk powder was used Block and add 100 μΐ of different concentration gradients to each well. The fusion protein Fv-LDP was incubated at 37 ° C for 1 hour, and then 100 μΐ 1 μ ^ ηύ anti-LDM monoclonal antibody F9 was used as the HPR-labeled goat anti-mouse IgG antibody and incubated at 37 ° C for 1 hour. Wash 3-4 times, and then add 100 μΐ OPD substrate reaction solution to each well for color reaction. The microplate reader measures the absorbance at 490 legs. The results showed that the fusion protein prepared as described in Example 4 was positive for type IV collagenase, HT-29 and HT-1080 tumor cells. The results are shown in FIG. 7. Example 8. Immunological activity of the fusion protein Fv-LDP and human tumor tissues. The streptavidin-biotin-enzyme-linked complex (SABC) staining method provided by immunohistochemistry kit (Boster) was added dropwise. Goat serum blocking solution, incubate at room temperature for 20 minutes; aspirate excess liquid, without washing, directly add the appropriately diluted fusion protein Fv-LDP, and incubate at room temperature; and then add the appropriately diluted F9 monoclonal antibody and biotinylated goat anti-mouse in order. IgG antibody, and finally SABC reagent was added dropwise. The color was developed with DAB kit at room temperature, the conventional hematoxylin was slightly counterstained, and the dehydrated transparent mount was used. Observe the staining results (Figure 8).

The results showed that the stained positive immunoreactivity Fv-LDP may occur with human colon adenocarcinoma MMP-2 / MMP-9, which positive nerve fibers located in the cytoplasm in Example 9 colon adenocarcinoma cells like tumor cells, glandular _β . Fusion protein Fv-LDP inhibits tumor cell type IV collagenase activity

Take human fibrosarcoma HT-1080 cells in logarithmic growth phase and add them to a 24-well culture plate at lxl0 ⁵ / ml / well and incubate for 24 h at 37 ° C, 5% C0 ₂ ; discard the culture medium and add 200 μΐ serum-free cells Growth medium (RPMI 1640, Roswell Park Memorial Institute 1640). After 2 h of incubation, add 100 μΐ of fusion protein Fv-LDP and incubate at 37 ° C for 24 h. Aspirate the culture medium, centrifuge at 500 g for 5 min, and take a small amount of cells. The supernatant was determined by the conventional protein quantification method (Bradford method) to determine the protein content, draw a standard curve and determine the concentration of the sample, and take the supernatant at the corresponding volume for non-denaturing PAGE electrophoresis. Electrophoresis completed Rinse in 100 ml of 2.5% Triton X-100 solution for 30 minutes, repeat once, rinse with distilled water twice, and add 100 ml of type IV collagenase buffer (50 mM Tris-HCl, pH 7.5, 200 mM NaCl, 10 mM CaCl ₂ , 1 μM ZnCl ₂ ), 37. C was incubated for 16 h; Coomassie Brilliant Blue R250 staining was used to observe the negatively stained gelatin hydrolysis bands.

The results showed that the fusion protein Fv-LDP significantly inhibited the activity of type IV collagenase secreted by tumor cells HT-1080 (Figure 9). Example 10. Inhibition of angiogenesis by the enhanced fusion protein Fv-LDP-AE The inhibition of angiogenesis by chicken embryo urinary membrane method was examined. Freshly fertilized white-skinned chicken eggs with the air chamber side facing up, incubate in a constant temperature room at 37 ° C, 60% ^ degrees, and then sterilize the egg shells later, pierce the needle with a needle, and inhale 2 ml of air into the air. Separate the chicken embryo urinary membrane from the vascular egg membrane in the room while grinding the shell with a grinding wheel. Carefully peel off the shell to form a small 2x2 cm ² window. Seal it immediately with scotch tape. Continue to a constant temperature of 37 ° C and 60% humidity. Incubate in the chamber for 24 h. Until the ninth day of incubation, carefully suck 10 μΐ of basic fibroblast growth factor (bFGF) dropwise into a prepared agar carrier plate, and simultaneously add different concentrations of the enhanced fusion protein Fv-LDP prepared in Example 6 -AE, place the carrier disc in the large blood vessel and the distal end of the embryo heart, seal the window and continue at 37 ° C, and incubate for 4 h in a 5% CO ₂ cell incubator. Observation of _Θ scab shows that ₅ FY-L P-AE is obvious. Inhibition of bFGF stimulated angiogenesis in chicken embryo urinary diaphragm (Figure 10). Example 11. Cytotoxic effect of enhanced fusion protein Fv-LDP-AE on tumor cells

Determined by the clone formation method. Logarithmic growth phase HT-29 cells were added to a 96-well culture plate, 50 cells / 0.2 ml per well, and cultured for 24 h. Dilute the drug to be tested 10 times, set 3 parallel wells for each concentration, incubate 50 μl per well, incubate for 1 h at 37 ° C, wash twice with serum-free PRMI 1640 medium, add fresh medium, continue incubating for 7 days, day 7 Cell colonies were counted under a microscope. The results show that Fv-LDP-AE prepared as in Example 6 Cells have a strong killing effect, and half of the clones inhibit IC ₅ . It is 1.65xlO_ ¹⁶ M (Figure 11). Example 12. Animal experimental treatment protocol for enhancing the fusion protein Fv-LDP-AE The drug administration method and dosage of animal experimental treatment were designed based on the preliminary screening results. Sixty Kunming mice with a body weight of 18-22 g were collected and randomly divided into a group of 10 each. On day 0 of the experiment, mice with liver cancer Η22 ascites were taken, diluted with physiological saline to a cell number of 1.5 × ^{10 6} / ml, and inoculated subcutaneously in the armpits of Kunming mice at 0.2 ml / only. Twenty-four hours after the mice were inoculated with H22 tumors subcutaneously, normal saline, Fv-LDP, free LDM, and three doses of Fv-LDP-AE were administered on the first and tenth days of the experiment, respectively. The tumor size was measured every 3-4 days during the experiment, and the tumor volume and tumor suppression rate were calculated with the formula V (cm ³ ) = 1 / 2ab ² (a: tumor long diameter, b: tumor short diameter).

The results on the 21st day of the experiment show that the enhanced fusion protein Fv-LDP-AE of the present invention prepared in Example 6 has a significant curative effect in vivo, and at doses of 0.8, 1.6, and 3.2 mg / kg, it can significantly inhibit liver cancer H22 subcutaneous tumors The growth is shown in the following table:

Fv-LDP-AE inhibits the growth of mouse transplanted liver cancer H22

Dose mouse number body weight change tumor volume ( _em ³ ) inhibition rate group

(mg / kg) Experiment start / end (g) i SD (%) Blank control-10/10 22 14.6 + 4.3

LDM 0.05 10/10 19.5 4.3 ± 2.6 70.3 *

Fv-LDP 2.4 10/10 15.7 11.9 ± 5.8 18.7

Fv-LDP-AE 3.2 10/10 4.5 0.6 + 0.3 95.9 "

Fv-LDP-AE 1.6 10/10 8.7 1.8 ± 1.2 87.8 * ^A

Fv-LDP-AE 0.8 10/10 9.7 2.1 ± 1.1 85.7 "

* Compared with the blank control group, P <0.01, ^A compared with the LDM group, <0.05. From the tumor growth curve (Figure 12), it can be seen that Fv-LDP-AE is particularly effective at a dose of 3.2 mg / kg, and its inhibition rates on days 14, 17, and 21 were 92.2%, 95.2%, 95.9%. During the treatment, there was no significant change in the body weight of the animal, and the general condition was good, indicating that the animal could tolerate the dose used.

Claims

Rights request

1. A reinforced fusion protein Fv-LDP-AE, characterized in that it consists of an anti-type IV collagenase single chain antibody scFv, lidamycin co-protein LDP, a flexible peptide spacer GGGGS, and histamine It consists of the fusion protein Fv-LDP formed by acid hexamer tail and the active chromophore AE.

2. The enhanced fusion protein Fv-LDP-AE according to claim 1, characterized in that the encoding gene of the fusion protein Fv-LDP is shown in SEQ ID NO: 1, and its acid sequence is shown in SEQ ID NO: 2 .

3. A method for preparing a strengthened fusion protein Fv-LDP-AE, comprising:

a. Preparation of fusion protein Fv-LDP;

b. Molecular strengthening is performed by using a high proportion of AE LDM with the fusion protein Fv-LDP.

The method of preparation according to claim 3, wherein the Fv-LDP / 0.01 M PBS ( H 7 J) and methanol according to the molecular ratio of AE 1: ₅₂ volume ratio of 1: 5® _s room temperature and stirring 12 h, Get enhanced fusion protein Fv-LDP-AE ₀

5. The preparation method according to claim 3, wherein the LAE with a high proportion of AE has a percentage value of AE of the total chromophore of at least 80%, and a particularly preferred percentage value of AE is 90%.

6. The use of the enhanced fusion protein Fv-LDP-AE according to claim 1 in the preparation of a novel antibody-directed drug that inhibits angiogenesis and antitumor.

7. The use according to claim 6, wherein the tumor comprises a solid tumor selected from the group consisting of colon cancer, rectal cancer, esophageal cancer, gastric cancer, liver cancer, and breast cancer, ovarian cancer, lung cancer, and kidney cancer.

8. A pharmaceutical composition comprising a therapeutically effective amount of the fortified fusion protein according to claim 1, and optionally, a pharmaceutically acceptable carrier and / or excipient.

A method for treating a tumor in a patient, comprising administering to the tumor patient a therapeutically effective amount of the fortified fusion protein of claim 1 or the pharmaceutical composition of claim 8.