CN1260367C - Fortified fusion protein FV-LDP-AE possessing angiopoiesis inhibiting and antitumour actions - Google Patents

Abstract

The present invention relates to a reinforced fusion protein Fv-LDP-AE having anti-tumor effect, which is mainly prepared by two technical lines of genetic engineering construction and molecular reinforcement of a fusion protein; the total length of a fusion protein Fv-LDP gene is 1119 bp, 372 amino acids are encoded and the molecular weight is 38.7kDa. The present invention has strong damaging effect on tumor cells and can obviously inhibit generation of new vessels of chick embryo allantois membranes; animal experiments prove that the present invention has obvious curative effect on mouse transplantation liver cancer H22, a tolerable dose is used, and the tumor-inhibiting rate can reach 95.9%(P<0.001). The reinforced fusion protein shows the characteristics of miniaturization and high efficiency of antibody target medicines and can become a new target medicine used for treating tumors clinically.

Description

Has the energized fusion protein Fv-LDP-AE that suppresses vasculogenesis and antitumor action

Technical field:

The present invention relates to a kind of novel antibody targeted drug that suppresses angiogenic action, strong tumor cell killing activity and antineoplaston effect that has.

Background technology:

Matrix metalloproteinase is being played the part of important role in cancer cells Invasion and Metastasis process, especially extracellular matrix components such as gelatinase MMP-2 and MMP-9 degradable IV Collagen Type VI, destroy the integrity of basilar membrane and extracellular matrix, help invasion by tumor cells and transfer, be higher than the healthy tissues vascular endothelial cell at the expression amount of endothelial cells in tumor neogenetic blood vessels.The activity that suppresses matrix metalloproteinase can suppress invasion by tumor cells and shift and tumor-blood-vessel growth.Therefore, not only can provide the target of tumour with matrix metalloproteinase MMP-2/MMP-9 monoclonal antibody as the carrier of targeted drug, and itself just has anti-tumour effect.Anti-MMP-2/MMP-9 monoclonal antibody 3G11 involved in the present invention all is the immunology positive reaction to kinds of tumor cells, and with multiple body tumor tissue especially digestive tract tumor tissue specific binding capacity is arranged.Single-chain antibody (scFv) normally uses one section flexible peptide chain with V _HAnd V _LThe minimum antibody functional fragment that connects and composes with complete antigen binding site.ScFv is more stable than the Fv fragment, and the scFv molecule is strong to the penetrating power of solid tumor than complete antibody, thereby is more suitable for the carrier as the monoclonal antibody targeted drug.

Highly active " bullet " medicine lidamycin (LDM) (LDM), also claim C-1027 or C1027, be from Qianjiang county, China Hubei Province soil, separate obtain by a strain styreptomyces globispotus strain (Streptiomyces globisporus, culture presevation number is: the enediyne class microbiotic of Chan Shenging CGMCC No.0704) is the large-molecular peptides antitumor antibiotics the strongest to the tumor cytotoxicity effect that hitherto reported is crossed.Interior animal experiment shows, LDM has the curative effect of highly significant to mouse junction cancer 26, to transplant in multiple human body transplantation tumors such as the people's liver cancer Bel-7402 of nude mice and carcinoma of cecum Hce-8693 all have significant curative effect (Chinese microbiotic magazine 1994,19＜2 〉: 164-168).The molecule of LDM is made up of two portions: one is the chromophoric group of enediyne structure, has cytotoxicity, but unstable; It two is the apoprotein (LDP) that 110 amino-acid residues are formed, and chromophoric stability is shielded.Chromophoric group in the LDM molecule exists with two kinds of forms: (be active form enediyne activity form active enediyne, AE) with inactivation type chromophoric group (inactivatedchromophore), the former is easy to become the latter through aromizing the active form chromophoric group.The height of AE content determines the intensity of its effect in the LDM molecule.Because the chromophoric group in the LDM molecule has high-intensity biological activity by the conversion of active form to the inactivation type for making LDM, must keep high-load AE.Chromophoric group combines by non covalent bond with apoprotein, and both combinations have specificity and stability.LDM can split and carry out molecule and strengthen, and with its distinctive molecular structure can become ideal " bullet " medicine that makes up novel monoclonal antibody targeted drug (Chinese Academy of Medical Sciences's journal 2001,23＜6 〉: 563-567).

The miniaturization of monoclonal antibody targeted drug, high efficiency and to seek new specific tumour target be to solve the in-problem main effective way of current monoclonal antibody therapeutical agent.The immune guiding fusion rotein of the single-chain antibody scFv that the utilization genetic engineering technique make up to obtain and the lidamycin (LDM) preparation specific tumour target site that can effectively effector molecule be led, the immune conjugate with the acquisition of chemical coupling technology has more advantages such as molecule homogeneity and efficient miniaturization.This laboratory had prepared packaging fusion rotein LDM-Fv (Acta Pharmaceutica Sinica 2000 in the past, 35＜7 〉: 488-491), but because the chromophoric group that uses derived from general LDM at that time, fail to obtain to have the fusion rotein of stronger tumor cell killing activity, fail to observe the restraining effect to vasculogenesis, also failing proves its curative effect in experimentation on animals.Studies have shown that energized fusion protein shows the intensive killing activity to tumour cell, the inhibition angiogenic action of height is arranged, experimentation on animals has the result of treatment of highly significant.By retrieval, do not see the relevant report that similar energized fusion protein is arranged so far both at home and abroad as yet.

The objective of the invention is on the basis that makes up new fusion protein F v-LDP, the used chromophoric quality of strict control, use has extremely strong active activated form enediyne (AE) and carries out the molecule reinforcement, with preparation intensified type fusion protein F v-LDP-AE, as the better novel antibody targeted drug of antitumous effect.

Summary of the invention:

The said energized fusion protein Fv-LDP-AE of the present invention is made of the fusion protein F v-LDP (molecular weight is about 38.7kDa) of the histidine six aggressiveness urogenesis of antigelatinase single-chain antibody scFv, Lidamycin agon albumen LDP and carboxyl terminal and activated form enediyne chromophoric group AE (molecular weight is 843kDa), full length gene 1119bp, 372 amino acid of encoding, its technology of preparing route is:

The energized fusion protein Fv-LDP-AE that the present invention adopts technological lines such as DNA reorganization and molecule reinforcement to make up has embodied a concentrated reflection of the lower characteristics of miniaturization, high efficiency and immunogenicity.The binding specificity that this fusion rotein utilizes antigelatinase single-chain antibody scFv with the lidamycin (LDM) target strengthened in the tumor tissues position of antigen high expression level, performance is to the strong killing activity of tumour cell, have intensive and suppress angiogenic action, test has notable therapeutic effect in vivo, has showed good prospects for application.

1. the clone of Lidamycin agon albumen LDP/ antigelatinase single-chain antibody scFv gene makes up: recombinant plasmid pPIC-9kFv1027 and pIJ1027GRGDS contain scFv gene and LDP gene respectively, are preserved by this laboratory.PGEM-T vector is a U.S. Promega company product, and intestinal bacteria bacterial classification E.coli DH5a is that preserve in this laboratory.The PCR primer is synthetic by match Parkson company, introduces corresponding restriction enzyme site respectively.

ScFv 5 ' end primer (PH1): 5 ' CG CATATG CAGGTGAAGCTGCAGCAGTCT3 '

Nde I V _H

ScFv 3 ' end primer (PL2): 5 ' CG GAATTC TGAACCGCCTCCACC ACGTTTGATTTCCAG3 '

EcoR I spacer

V _L

LDP 5 ' end primer (PLD1): 5 ' CG GAATTC GCGCCCGCCTTCTCCGTCAGTCCC3 '

EcoR I LDP

LDP 3 ' end primer (PLD2): 5 ' CCG CTCGAG TCAGCCGAAGGTCAGAGCCACGTG3 '

Xho I LDP

With recombinant plasmid pPIC-9kFv1027 is template, and PH1 is 5 ' primer, and PL2 is that 3 ' primer carries out pcr amplification, obtains the single-chain antibody scFv gene fragment that the C end has one section little peptide spacer; Be template with recombinant plasmid pIJ1027GRGDS simultaneously, PLD1 is 5 ' primer, and PLD2 is that 3 ' primer carries out pcr amplification, obtains the LDP gene fragment.The PCR reaction system is 94 ℃ of pre-sex change 2 minutes, carry out 25 then and take turns PCR circulation: 94 ℃ of sex change 1 minute, 55 ℃ (amplification of scFv gene) or 58 ℃ (amplification of LDP gene) annealing 1 minute, 72 ℃ were extended 1 minute, and last circulation back was 72 ℃ of insulations 10 minutes.

After two kinds of PCR product utilization dna fragmentation glass milk reclaim the recovery of test kit (BioDev company product) purifying, provide method to link to each other according to Promage company test kit with the pGEM-T carrier of Promage company, transformed into escherichia coli DH5 α, filtering out reorganization T carrier pGEM-T-Fv and pGEM-T-LDP carries out enzyme and cuts evaluation (Fig. 1), give birth to worker biotech firm by Shanghai respectively and carry out sequencing, scFv full length gene 738bp, 246 amino acid of encoding, LDP full length gene 345bp, 115 amino acid of encoding, flexible peptide gene 15bp between the two, 5 amino acid of encoding, the gene of the histidine six aggressiveness tails of coding carboxyl terminal is 18bp, 6 amino acid and terminator codon 3bp encode, gene number 1119bp, 372 amino acid of encoding.

2. the structure of fusion rotein intestinal bacteria recombinant expression plasmid pEFL: the colibacillus expression plasmid pET30a (+) that the present invention selects for use (Invitrogen company product) preserves for this laboratory.Recombinant clone plasmid pGEM-T-Fv is carried out double digestion acquisition enzyme with Nde I and EcoR I, recombinant clone plasmid pGEM-T-LDP with EcoR I and Xho I cut the back fragment, through the agarose gel electrophoresis Separation and Recovery.Above-mentioned two fragment clonings in the expression vector pET30a (+) that Nde I and Xho I enzyme are cut, are transformed into host bacterium BL21 (DE3) star ^TMThe competent cell of (Invitrogen company product), screening obtains transformant and extracts recombinant plasmid.The recombinant expression plasmid that obtains is carried out enzyme cut evaluation, show and wherein contain correct insertion fragment (Fig. 2).Use two T7 universal primers and check order, the result shows that the sequence of this fusion gene Fv-LDP sequence and expection is in full accord.The expression plasmid pET30a (+) that the present invention uses holds fusion that the gene order of one section encoding histidine, six aggressiveness tails (His6-Tag) is arranged in 3 ' of its multiple clone site, and behind accurate translation, His6-Tag is convenient to Expression of Fusion Protein and is identified and separation and purification.

3. fusion protein F v-LDP is at e. coli bl21 (DE3) star ^TMIn abduction delivering: the above-mentioned transformant of picking is inoculated into the LB substratum that contains 50 μ g/ml kantlex from the LB flat board, 37 ℃ of shaken overnight; Next day was by 1: 50 transferred species, 37 ℃ of shaking culture are 0.9 to OD 600, and adding final concentration in culture is the IPTG (β-isopropyl-) of 0.8mmol/L, inducing culture 4-6 hour, get the 1ml nutrient solution, 12000rpm collected thalline in centrifugal 1 minute, removed supernatant, and somatic cells is resuspended among the 300 μ l PBS, behind the ultrasonication thalline, centrifugal 10 minutes of 12000rpm collects supernatant respectively, and precipitation is resuspended among the 300 μ l PBS; With the expression of 12% SDS-PAGE electrophoretic analysis foreign protein, fusion rotein obtains expressing (Fig. 3) with insoluble inclusion body form.The gel imaging system quantitative analysis shows, the Expression of Fusion Protein amount that obtains with the top condition abduction delivering accounts for more than 30% of transformant bacterial strain total protein, finally pick out the conversion bacterial strain of optimal expression fusion rotein, wherein contain can expressed fusion protein Fv-LDP the pEFL plasmid, called after CAMS/FLDFP, deliver in June, 2003 and to be positioned at the common micro-organisms center preservation of Pekinese China Committee for Culture Collection of Microorganisms, deposit number: CGMCC No.0960.

With Western Blot check and analysis, in Bio-Rad electrotransfer groove, to carry out half-dried electricity behind the 12% SDS-PAGE electrophoresis and change, the electrotransfer condition is: continuous current 0.65mA/cm ², about 1.5-2 of time hour.The pvdf membrane that electricity changes after finishing is hatched with the anti-F9 or the anti-His-Tag monoclonal antibody that contain the confining liquid dilution respectively, with the sheep anti-mouse igg antibody of HRP mark is two anti-, carry out chromogenic assay, transformed bacterial strain CAMS/FLDFP successful expression fusion protein F v-LDP (Fig. 4).

4. the affinitive layer purification of fusion protein F v-LDP and separation preparation: adopt Hisbind purification kit (Novagen company product) purified protein samples under the sex change condition.Behind the pre-treatment affinity column, 1 * Binding Buffer balance the chromatography column that contains 6M urea with 3 volumes, again with behind the metaprotein sample upper prop, contain urea 1Xbinding buffer (20mM Tris-HCl with 10 volumes successively, 0.5M NaCl, the 5mM imidazoles, 6M Urea, pH 7.9), 6 volumes contain urea 1Xwashing buffer (20mM Tris-HCl, 0.5M NaCl, the 60mM imidazoles, 6M Urea, pH 7.9) the washing chromatography column, at last the 1xElute Buffer that contains 6M urea with 6 volumes carries out wash-out, collects the fusion rotein (Fig. 5) after the wash-out component obtains purifying.Then capable dialysis renaturation, protein sample is successively to renaturation buffer I (20mM Tris-HCl, 0.5M NaCl, 3M Urea, 5mM EDTA, pH 8.0), renaturation buffer II (20mM Tris-HCl, 0.5M NaCl, 1M Urea, 5mM EDTA, 0.2mM GSSG, 2mM GSH, 0.4M L-Arg, pH 8.0) and renaturation buffer III (20mM Tris-HCl, 0.5M NaCl, 5mM EDTA, pH 8.0) dialyse, again with PBS (pH 7.4) dialysis, concentrated, through PD-10 (the commercial post of Sephadex G25) desalination, lyophilize, standby in-70 ℃ of preservations.

5. the preparation of energized fusion protein Fv-LDP-AE separates: get the high-load LDM dried frozen aquatic products of AE 10mg, add 5ml cold methanol jolting 5min, place 1h, middle jolting 1 time for-20 ℃; At 0 ℃, the centrifugal 20min of 12000r/min, supernatant liquor is rich in AE, and sediment is a peptide chain, repeats to extract 2 times.Spontaneous evaporation concentrated methanol solution, experiment need low temperature, lucifuge to carry out.The Fv-LDP that gets certain volume and concentration is dissolved in the 0.01mol/L phosphoric acid buffer (pH 7.0), the AE methanol solution (volume ratio is 1: 50) that adds 5 times of molecular weight, mix jolting, room temperature was placed 12 hours, with mixed solution with PD-10 post (business-like Sephadex G-25 post, the Pharmacia product) chromatographic separation is abandoned excessive unreacted AE behind the A280nm ultraviolet monitoring, collect energized fusion protein Fv-LDP-AE (Fig. 6).

6. the immunologic competence of fusion protein F v-LDP: detect with indirect ELISA, by 96 hole enzyme plates, put 4 ℃ and spend the night as antigen with 10 μ g/ml gelatinases (being dissolved among the PBS), 100 μ l/ holes bag; With 10 ⁴The density in/hole is 37 ℃ of overnight incubation in 96 orifice plates with HT-1080 cell or HT-29 cell inoculation; After abandoning supernatant, with 0.25% glutaraldehyde fixed cell, as cell antigen; Seal with 100 μ l, 10% skim-milk, every hole adds the fusion protein F v-LDP of 100 μ l different concns gradients, 37 ℃ hatch the back is one anti-with the anti-LDM monoclonal antibody F9 of 100 μ l, 1 μ g/ml, the sheep anti-mouse igg antibody of HPR mark is two anti-, every hole adds 100 μ l OPD substrate reactions liquid and carries out color reaction, and microplate reader is measured 490nm place light absorption value.The result shows, the immunoreactivity of fusion rotein and gelatinase, HT-29 and HT-1080 tumour cell all positive (Fig. 7).

7. the immunologic competence of fusion protein F v-LDP and body tumor tissue: strepto-avidin-vitamin H-enzyme connection mixture (SABC) dyeing process that adopts doctor's moral immunohistochemical methods test kit to provide drips normal goats serum confining liquid, incubated at room 20 minutes; Draw unnecessary liquid, do not wash, directly drip a suitably anti-fusion protein F v-LDP of dilution, incubated at room; Drip suitably two anti-F9 monoclonal antibody and biotinylated sheep anti-mouse igg antibodies of dilution more successively, drip reagent SABC at last, with DAB test kit color development at room temperature, conventional Hematorylin is slightly redyed, and transparent mounting dewaters.Observe coloration result (Fig. 8) and find, immune response can take place and the dyeing that is positive with the MMP-2/MMP-9 in the human colon adenocarcinoma tissue in Fv-LDP, and its positive staining particle is positioned at the endochylema of adenocarcinoma of colon glandular cell sample tumour cell.

8. fusion protein F v-LDP suppresses the activity of tumor cell secretion gelatinase: the human fibrosarcoma HT-1080 cell in the vegetative period of taking the logarithm, and by 1 * 10 ⁵/ ml/ hole is added on 24 well culture plates, and 37 ℃, 5%CO ₂Cultivated 24 hours; Abandon nutrient solution, add 200 μ l serum-free RPMI RPMI-1640s, continue to cultivate after 2 hours, the fusion protein F v-LDP that adds 100 μ l in 37 ℃ hatch 24 hours after, draw nutrient solution, centrifugal 5 minutes of 500 * g, the cell conditioned medium that takes a morsel is measured protein content with the Bradford method, the concentration of drawing standard curve and working sample is got supernatant with respective volume and is carried out non-sex change PAGE electrophoresis.After electrophoresis finishes gel is put into 100ml 2.5%Triton X-100 solution rinsing 30 minutes, repeat once, distilled water rinsing 2 times adds 100ml gelatinase damping fluid (50mM Tris-HCl, pH7.5,200mM NaCl, 10mMCaCl ₂, 1 μ M ZnCl ₂), hatched 16 hours for 37 ℃; The gelatin hydrolysis band of negative staining is observed in coomassie brilliant blue R250 dyeing decolouring back.The result shows that fusion protein F v-LDP suppresses the activity (Fig. 9) of tumour cell HT-1080 secretion gelatinase significantly.

9. energized fusion protein Fv-LDP-AE suppresses angiogenic action: detect its restraining effect to vasculogenesis with the chick embryo allantois embrane method.With the white skin Leghorn kind egg air chamber end of fresh fertilization up, 37 ℃, hatch the egg shell of sterilizing again after 7 days in the thermostatic chamber of 60% humidity, to be needled into air chamber, the 2ml air is sucked in the air chamber so that chick chorioallantoic membrane separates with the blood vessel egg membrane, carefully peel off shell with emery wheel mill shell simultaneously and form a 2 * 2cm ²Fenestella is sealed with scotch tape immediately, continues at 37 ℃, hatches 24h in the thermostatic chamber of 60% humidity.Drip in preprepared dimethyl cellulose carrier plate to hatching the bFGF that carefully drew 10 μ l on the 9th day, the energized fusion protein Fv-LDP-AE that adds different concns simultaneously places great vessels and blastophore far-end with carrier plate, the envelope window, continue at 37 ℃, 5%CO ₂Observe after hatching 48h in the cell culture incubator, the result shows that Fv-LDP-AE can obviously suppress the generation (Figure 10) that bFGF stimulates the chick chorioallantoic membrane new vessel.

10. energized fusion protein Fv-LDP-AE is to the cytotoxicity of tumour cell: measure with clone forming method, the HT-29 cell in the vegetative period of taking the logarithm adds 96 well culture plates, and 50 the cell/0.2ml in every hole cultivate 24h.10 times are diluted each medicine and assembling conjugate, and every concentration is established 3 parallel holes, every hole 50 μ l, and 37 ℃ of incubation 1h, serum-free PRMI RPMI-1640 is washed 2 times, adds fresh medium, continues cultivation 7 days, the 7th day counting cells colony under mirror.The result shows that Fv-LDP-AE has the intensive lethal effect to tumour cell, half clone inhibition concentration IC ₅₀Be 1.65 * 10 ^-16M (Figure 11).

11. the experimentation on animals treatment plan of energized fusion protein Fv-LDP-AE: according to the administering mode and the dosage of dosage primary dcreening operation consequence devised experimentation on animals treatment.Get body weight and be 60 of the kunming mices of 18-22g, be divided into 6 groups at random, 10 every group.Tested the 0th day, and got rat liver cancer H22 ascites, being diluted to cell count with physiological saline is 1.5 * 10 ⁶/ ml, it is subcutaneous only to be inoculated in the kunming mice armpit by 0.2ml/.Behind the mouse hypodermic inoculation H22 tumour 24h, respectively at testing the Fv-LDP-AE that gave physiological saline, Fv-LDP, free LDM and three dosage on the the 1st and the 10th day, tail vein injection administration 2 times.Measured the tumour size in the every 3-4 of experimental session days, with formula 1/2ab ²(a: tumour major diameter, b: the tumour minor axis) calculate gross tumor volume and tumour inhibiting rate.Test the 21st day result and show in the energized fusion protein Fv-LDP-AE body significant curative effect is arranged, in 0.8,1.6, the dosage of 3.2mg/kg, can obviously suppress the growth of liver cancer H22 subcutaneous tumors, as shown in the table:

Fv-LDP-AE is to the growth-inhibiting effect of mouse bearing liver cancer H22

Group	Dosage (mg/kg)	Mouse quantity experiment beginning/end	Body weight change (g)	Gross tumor volume (cm 3) x±SD	Inhibiting rate (%)
						Blank LDM Fv-LDP Fv-LDP-AE Fv-LDP-AE Fv-LDP-AE	- 0.05 2.4 3.2 1.6 0.8	10/10 10/10 10/10 10/10 10/10 10/10	22 19.5 15.7 4.5 8.7 9.7	14.6±4.3 4.3±2.6 11.9±5.8 0.6±0.3 1.8±1.2 2.1±1.1	70.3 * 18.7 95.9 *▲ 87.8 *▲ 85.7 *▲

^*Compare with the blank group, P＜0.01, ^▲Compare P＜0.05 with the LDM group.

From tumor growth curve (Figure 12) as seen, Fv-LDP-AE curative effect when 3.2mg/kg dosage is especially remarkable, and its inhibiting rate of the 14th, 17,21 day is respectively 92.2%, 95.2%, 95.9%.During the treatment, the body weight of animal does not have considerable change, generally in order, shows that animal can tolerate used dosage.

The invention effect:

Advantage of the present invention and positively effect are, the energized fusion protein Fv-LDP-AE that using gene engineering technique and molecule strengthening phase bonded technological line prepare is a kind of new and effective miniaturization immune guiding medicine, with matrix metalloproteinase MMP-2/MMP-9 is the scFv fragment of target spot and the energized fusion protein Fv-LDP-AE that lidamycin (LDM) constitutes, substantially the antigen-binding activity that has kept complete monoclonal antibody, can suppress the secretion activity of tumour cell to gelatinase, show strong killing activity and inhibition angiogenic action simultaneously to tumour cell, experimental therapy has significant curative effect in animal body, shows that it has a good application prospect.

Description of drawings:

The pcr amplification of Fig. 1: scFv and LDP gene and the restriction endonuclease analysis of recombinant cloning vector

Wherein: the PCR product of 1-DNA molecular weight standard 2-scFv

The PCR product 4-recombinant plasmid pGEM-T-scFv/Nde I+EcoR I of 3-LDP

5-recombinant plasmid pGEM-T-LDP/EcoR I+Xho I

Fig. 2: transform bacterial strain BL21 (DE3) star ^TMThe restriction endonuclease analysis of recombinant expression plasmid pEFL among the/pEFL

Wherein: 1-DNA molecular weight standard 2-plasmid pET-30a (+)

3-recombinant plasmid ppEFL 4-pET-30a (+)/Nde I+EcoR I

5-pEFL/Nde I+EcoR I 6-pET-30a(+)/EcoR I+Xho I

7-pEFL/EcoR I+Xho I 8-pET-30a(+)/Nde I+Xho I

9-pEFL/Nde I+Xho I

Fig. 3: the SDS-PAGE of fusion protein F v-LDP expression product analyzes

Wherein: 1-molecular weight of albumen standard

2-BL21 (DE3) star ^TM/ pET-30a (+) IPTG induces preceding whole bacterial protein

3-BL21 (DE3) star ^TM/ pET-30a (+) IPTG induces the back whole bacterial protein

4-transforms bacterial strain CAMS/FLDFP and induces preceding whole bacterial protein through IPTG

5-transforms bacterial strain CAMS/FLDFP whole bacterial protein after IPTG induces

6-transforms bacterial strain CAMS/FLDFP thalline supernatant after IPTG induces

7-transforms bacterial strain CAMS/FLDFP thalline inclusion body precipitation after IPTG induces

The Western-blot of Fig. 4: fusion protein F v-LDP analyzes

Wherein: A: it is one anti-reaching mycin apoprotein monoclonal antibody F9 with drag

B: with anti-histidine mark tail monoclonal antibody is one anti-

1-BL21 (DE3) star ^TM/ pET-30a (+) IPTG induces preceding whole bacterial protein

2-BL21 (DE3) star ^TM/ pET-30a (+) IPTG induces the back whole bacterial protein

3-recombinant bacterial strain CAMS/FLDFP induces preceding whole bacterial protein through IPTG

4-recombinant bacterial strain CAMS/FLDFP whole bacterial protein after IPTG induces

5-recombinant bacterial strain CAMS/FLDFP is thalline inclusion body precipitation after IPTG induces

6-recombinant bacterial strain CAMS/FLDFP thalline supernatant after IPTG induces

Fig. 5: fusion protein F v-LDP analyzes through the SDS-PAGE of metal chelate chromatography purifying

Wherein: 1-molecular weight of albumen standard

2,3-does not go up the preceding sample of affinity column

4-binding buffer liquid is washed the liquid of collecting behind the post

5-washes the liquid of collecting behind the post with 20mM imidazoles rinsing damping fluid

6-10-washes the protein ingredient of successively collecting behind the post with 1M imidazoles elution buffer

Fig. 6: the separation and purification of energized fusion protein Fv-LDP-AE

Wherein: the energized fusion protein Fv-LDP-AE of peak 1-purifying

The unreacted excessive AE of peak 2-

Fig. 7: the immunoreactivity of elisa assay fusion protein F v-LDP and gelatinase and different tumour cells

Wherein: ▲ gelatinase

■ HT-29 cell

◆ the HT-1080 cell

Fig. 8: the immunologic competence of immunohistochemical staining analysis fusioning protein Fv-LDP and human colon cancerous tissue

Wherein: the immunohistochemical staining of A:FvLDP in the human colon carcinoma tissue

B: it is one anti-that negative control, PBS substitute FvLDP

Magnification is 200 *, scale is 20 μ m among the figure.

Fig. 9: fusion protein F v-LDP is to the gelatinase spectrum analysis of HT-1080 cell

Wherein: 1-PBS

2-BL21 (DE3)/pET-30a (+) IPTG induces the back whole bacterial protein

The complete monoclonal antibody 3G11 of 3-(6 μ M)

4-fusion protein F v-LDP (30 μ M)

Figure 10: energized fusion protein Fv-LDP-AE stimulates the restraining effect of chick chorioallantoic membrane vasculogenesis to bFGF

Wherein: A: the chick chorioallantoic membrane blood vessel after only PBS handles

B: with bFGF is stimulator, the chick chorioallantoic membrane blood vessel after PBS handles

C: with bFGF is stimulator, the chick chorioallantoic membrane blood vessel after LDM (0.1 μ g/ chicken embryo) handles

D: with bFGF is stimulator, the chick chorioallantoic membrane blood vessel after Fv-LDP-AE (0.4 μ g/ chicken embryo) handles

Figure 11: energized fusion protein Fv-LDP-AE is to the killing activity of tumour cell HT-29

Wherein: ◆ Fv-LDP-AE

■LDM

Figure 12: energized fusion protein Fv-LDP-AE is to the restraining effect of liver cancer H22 growth in the mouse body

Wherein: ◆ contrast ▲ FvLDP group

■ LDM group △ Fv-LDP-AE3.2 group

◇ Fv-LDP-AE1.6 group Fv-LDP-AE0.8 group

Sequence table

＜110〉Inst. of Medicinal Biological Technology, Chinese Academy of Medical Sciences

＜120〉has the energized fusion protein Fv-LDP-AE that suppresses vasculogenesis and antitumor action

<140>

<141>

<160>1

<170>

<210>1

<211>1119

<212>DNA

＜213〉artificial sequence

<220>

<221>misc feature

<222>

<223>

<400>1

atgcaggtga agctgcagca gtctggaact gaagtggtaa agcctggggc ttcagtgaag 60

ttgtcctgca aggcttctgg ctacatcttc acaagttatg atatagactg ggtgaggcag 120

acgcctgaac agggacttga gtggattgga tggatttttc ctggagaggg gagtactgaa 180

tacaatgaga agttcaaggg cagggccaca ctgagtgtag acaagtcctc cagcacagcc 240

tatatggagc tcactaggct gacatctgag gactctgctg tctatttctg tgctagaggg 300

gactactata ggcgctactt tgacttgtgg ggccaaggga ccacggtcac cgtctcctca 360

ggtggaggcg gttcaggcgg aggtggctct ggcggtggcg gatcggacat cgagctcact 420

cagtctccag cttctttggc tgtgtctcta gggcagaggg ccaccatatc ctgcagagcc 480

agtgaaagtg ttgatactta tggcgatact tttatgtact ggtaccagca gaaaccagga 540

cagccaccca aactcctcat ctatcttgca accaacctag gatctggggt ccctgccagg 600

ttcagtggca gtgggtctag gacaaacttc accctcacca ttgatcctgt ggaggctgat 660

gatgctgcaa cctattactg tcagcaaaat aatgaggatc cgtacacgtt cggagggggc 720

accaagctgg aaatcaaacg tggtggaggc ggttcaccat gggcgcccgc cttctccgtc 780

agtcccgcct cgggtctgag tgacggacag agcgtgtcgg tgtcggtcag cggtgccgcc 840

gccggcgaga cctactacat cgcccagtgc gctccggtcg gtggccagga cgcgtgcaac 900

ccggcgaccg cgacgtcctt caccacggac gcgtccggag cggcgtcgtt cagcttcgtc 960

gtgcgcaagt cgtacacggg ctccacgccc gaaggcacgc cggtcggcag cgtcgactgc 1020

gccacggccg cctgtaacct cggcgccggc aactccgggc tcgacctcgg ccacgtggct 1080

ctgaccttcg gcctcgagca ccaccaccac caccactga* 1119

Claims (1)

1. the preparation method of a high expression level energized fusion protein Fv-LDP-AE is characterized in that said method adopts DNA reorganization and molecule to strengthen two technological lines, and concrete steps are as follows:

A. the fusion gene of Lidamycin agon albumen LDP and type 1 V collagenase-resisting single stranded antibody scFv makes up;

B. the structure of fusion rotein intestinal bacteria recombinant expression plasmid pEFL, be to clone respectively with genetic engineering technique to obtain Lidamycin agon albumen LDP gene and IV Collagen Type VI enzyme single-chain antibody scFv gene, the two is linked to each other with dna sequence dna of the one section little peptide of flexibility of encoding be built into the fusion gene of scFv-spacer-LDP form, introduce the specificity restriction enzyme site simultaneously in the spacer district, be cloned into the expression plasmid pET-30a (+) that efficiently expresses, screening obtains recombinant expression plasmid pEFL;

C. (deposit number: the abduction delivering CGMCCNo.0960) is that recombinant expression plasmid pEFL is transformed into e. coli host bacteria BL21 (DE3) star that efficiently expresses to fusion protein F v-LDP at intestinal bacteria CAMS/FLDFP ^TMObtaining the recombinant conversion bacterium, is IPTG inducing culture 4-6 hour of 0.8mmol/L through final concentration, obtains the fusion protein F v-LDP of inclusion body form, and carries out condition optimizing and obtain optimum expression, and its expressing quantity is 30%;

D. the affinitive layer purification of fusion protein F v-LDP with separate, be by the affine column purification fusion protein F of metal-chelating v-LDP, with metaprotein sample upper prop, with 1 * Binding Buffer flushing affinity column, remove most of foreign protein, use 1 * washing buffer washing chromatography column again, remove the small part foreign protein, carry out wash-out with 1 * Elute Buffer at last, collect the fusion rotein after the wash-out component obtains purifying, dialyse again, renaturation, desalination, lyophilize, in-70 ℃ of preservations, be used to prepare functional fusion rotein;

E. the preparation of energized fusion protein Fv-LDP-AE separates, be fusion protein F v-LDP and 5 times of lidamycin (LDM) chromophoric group active form enediyne AE that molecular weight prepares through methanol extraction that purifies and separates is obtained, mix jolting, room temperature is placed and was carried out the molecule reinforcement in 12 hours, with mixed solution with the PD-10 column chromatography for separation, behind the A280nm ultraviolet monitoring, abandon excessive unreacted AE, obtain energized fusion protein Fv-LDP-AE.

Images