CN1160721A - Fibrillating cell growth factor-2 analogue and its production method and use - Google Patents
Fibrillating cell growth factor-2 analogue and its production method and use Download PDFInfo
- Publication number
- CN1160721A CN1160721A CN 96114279 CN96114279A CN1160721A CN 1160721 A CN1160721 A CN 1160721A CN 96114279 CN96114279 CN 96114279 CN 96114279 A CN96114279 A CN 96114279A CN 1160721 A CN1160721 A CN 1160721A
- Authority
- CN
- China
- Prior art keywords
- fgf
- dna
- sequence
- growth factor
- pharmaceutical composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention provides fibroblast growth factor-2(FGF-2) analogue and its production, medicinal composite containing the said analogue and used as medicinal carrier and excipient, and the use of the said composite in treating tissue damage. Compared with natural human FGF-2, the said FGF-2 analogue has superior storage stability and temp and pH tolerance. The FGF-2 analogue in the present invention is produced through the fixed-point mutagenization and the expression in procaryon host to DNA sequence of encoded natural ox and human FGF-2.
Description
The present invention relates to fibroblast growth factor-2 analogue thing and production method thereof, contain the pharmaceutical composition of these analogues and pharmaceutically acceptable carrier or vehicle, and the application of said composition in the treated tissue damage.
Polypeptide growth factor is the hormonelike conditioning agent of cell proliferation and differentiation.From various tissues and cell, separated and identified many somatomedins, comprising but be not only limited to Urogastron, platelet-derived somatomedin, nerve growth factor, hematopoietic cell growth factor and fibroblast growth factor.
Fibroblast growth factor (FGF) is as BALB/c 3T3 cell being had the factor of growth-promoting activity, isolating from ox pituitary gland tissue (D.Gospodarowicz, Nature 249:123,1974) at first.This molecule is to acid and temperature sensitive, and has high (alkalescence) iso-electric point.Found from brain isolating mitogenic factor afterwards with isolating different from pituitary gland before this, thereby have similar biologic activity based on them and be called acid and basic FGF (being aFGF and bFGF) with different iso-electric points.AFGF and bFGF are the members of relevant at least 8 kinds of structures, as to have heparin affinity molecule family, they can optionally excite the biologically of the many cells that comprise mesoblastema and neuroderm cell, and these cells comprise endotheliocyte, smooth muscle cell, adrenal cortical cell, sarcoplast and scleroblast.Active and identified the member of other 7 FGF families based on the adjusting of on cell proliferation and differentiation with the sequence homology of FGF, comprising hst/k and int oncogene, and be called the preceding proto-oncogene of FGF-5.As original FGF family member, now acidity and basic FGF are called FGF-1 and FGF-2, this specification sheets hereinafter is called FGF-2 with Prostatropin.
Except stimulate cell growth, FGF also can stimulate the cell of many types in non-mitotic division mode different reactions to take place, for example promote cell to injury migration (chemokine activity), new vasculogenesis, adjusting nerve degeneration and viability (neurotrophic activity), endocrine regulation function and stimulation or the (Baird such as inhibition specific cell protein expression, extracellular matrix generation and cell survival of promotion, A.and Bohler, P., Handbook of Exp.Pharmacol., 95 (1): 369-418,1990).These character provide the foundation for using the FGF preparation to be used for the medicine of accelerating wound healing, nervous tissue reparation, prevention and treatment brain and myocardial ischaemia (collateral blood vessels generation).
Ox FGF-2 (bFGF-2) has 154 amino acid whose polypeptide.People FGF-2 (hFGF-2) is different from bFGF-2 and is that its 121st amino acids is Threonine (Thr) rather than Serine (Ser), and the 137th amino acids is Serine (Ser) rather than proline(Pro) (Pro).People or ox FGF-2 molecule can comprise 7-11 amino acid whose N-terminal extension, also can be to lack one or more at N-terminal, about 4-30 amino acid for example, and still keep the molecule of its biologic activity.These facts have embodied the unhomogeneity of FGF molecule N-terminal.
People such as J.A.Abraham (Science 233:545-548,1986; EMBOJ., 5:2523-2528,1986) nucleotide sequence of at first having cloned ox/people FGF-2.Continue after many researchs in, in order further to understand FGF molecular structure and function relationship, the relation of precursor and product, and the receptor-binding characteristic of molecule and three-D space structure are (referring to Eriksson, E.A.et al., Proc.Natl.Acad.Sci.USA 88:3441-3445,1991; Zhu, H.et al., Science251:90-93, and United States Patent (USP) 5,491,220) carried out extensive work.
In order to improve the receptors bind specificity of wild-type FGF molecule, and further therefrom screening be suitable for varient as FGF functional antagonist or agonist, perhaps expectation obtains being suitable for as the anti-polymeric of medicinal application and/or the varient of stabilization, preparation and disclose many FGF mutant or analog on the basis of basic research work (for example referring to United States Patent (USP) 5,175,147,5,288,704 and European patent application EP-A281,822 and UK Patent Application 8821795.5).Japanese patent application publication No. JP231428/86 (being equivalent to Chinese patent application publication number CN101486A) discloses the use side-directed mutagenesis and respectively sophisticated rh-bFGF (hFGF-2) sequence the 69th and 87 s' halfcystine has been changed into Serine, forms and the multimerization effect in the hope of stoping intermolecular disulfide bond.In addition, document has also been reported with Serine and has been replaced the method (Science224:1431,1984) of specific cysteine residues to help preventing intermolecular polymerization among the human interleukin 2 (IL-2).Yet, Serine is a kind of thricarbon atom amino acid that does not have amino group, so be difficult to use some polysaccharide or Mierocrystalline cellulose or polyoxyethylene glycol to combine, so that prevent the molecule multimerization and improve its stability in the aqueous solution and in recipient's body fluid with the amino reactive group of biologically active polypeptides molecule.For this reason, the someone proposes to comprise that the one or more Methionins in the biologically active polypeptides molecule of G-CSF and erythropoietin change over other amino acid, is beneficial to the Pegylation (United States Patent (USP) 4,904,584) of molecule.
On the other hand, though many bibliographical informations in the method for expression in escherichia coli hFGF-2 mutein, for the required expression product of separation and purification from the intestinal bacteria inclusion body, often cause the product inactivation because of adding strong protein denaturant.Research work in the past shows, no matter FGF-2 is under solution state or under the lyophilize state as many protein that other obtain with recombinant technology, all is easy to lower or loss of activity.Therefore, reduce the formation number of inclusion body in prokaryotic cell prokaryocyte or the yeast host body as much as possible, and the yield of product is this area problem demanding prompt solution in the increase soluble fractions.Though people (Journal of Molecular Biology 189:113-130 such as Studier F.M., 1983) at first find to utilize the T7 promotor can help improving expression level, but expression product lacks enough biologic activity (Paris, N.et al., Biotechology and Applied Biochemistry 12:436-449,1990).In addition, in the early stage research work that carry out in our laboratory, find, the combination order that combines amount of rigidity and employed chromatography column of FGF molecule and heparin sulfate, to separate and purifying host cell soluble fractions in the yield tool of expression product have a significant impact.
The inventor has cloned the dna sequence dna that coding has peptide more than the bFGF-2 activity from the ox pituitary gland, and has successfully expressed said polypeptide in escherichia coli host.This polypeptide product is expressed with partial sequence (about 17 amino acid) " fusion " proteinic form that N end upstream is connected with LacZ α.On this basis, again through the fixed point induced mutations, the 121st Serine and the 137th proline(Pro) codon in the bFGF-2 encoding sequence are changed into Threonine and Serine codon respectively, and the sequence of the non-FGF structure gene in N-terminal upstream of deletion bFGF-2DNA encoding sequence, thereby obtain the hFGF-2 that encodes) dna sequence dna, and in prokaryotic hosts high level expression hFGF-2.In order further to improve hFGF and sulfated polysaccharide bonded ability and stability, improve the ability of its antagonism intermolecular polymerization, and to low pH and hot tolerance, the present invention has carried out the site-specific sex modification on the gene level to the primary structure of hFGF-2, with other amino acid except that halfcystine, better be to replace the halfcystine that is exposed to the FGF-2 molecular surface, obtain the analog (the following FGF-2m that is called for short sometimes) of hFGF-2 with arginine.The result shows through preliminary experiment, and this analogue has preferably sulfated polysaccharide in conjunction with rigidity, and to the tolerance of low pH and heat.
Therefore, an object of the present invention is to provide and a kind ofly form to produce with fused protein, have the active polypeptide of fibroblast growth factor, this polypeptide has as Fig. 1 or aminoacid sequence shown in Figure 2.
This purpose embodiment according to the present invention, wherein said fused protein comprises the aminoacid sequence of complete in fact people or ox FGF-2, and be connected with about 17 amino acid whose non-FGF-2 structural protein sequences at its N end, said nonstructural proteins sequence is to be encoded by the partial sequence of the LacZ α peptide gene that is used for expressing in the prokaryotic hosts startup, it helps the initial of FGF-2 translation, improves the expression efficiency of active FGF-2 in the soluble fractions.
The hFGF-2 of the fused protein form of this purpose according to the present invention, it has the molecular weight of about 18.5KD, and iso-electric point is about 9.3-9.6.
The hFGF-2 of the fused protein form of this purpose according to the present invention, this protein obtain by the dna encoding sequence of corresponding bFGF-2 is carried out site-specific mutagenesis.
A further object of the present invention provides analog or the varient (FGF-2m) of a kind of hFGF-2, and this analogue has aminoacid sequence as shown in Figure 3.Specifically, this analogue is compared with natural hFGF-2, and particularly arginine or Methionin replace by basic aminoacids respectively to be positioned at two halfcystines on the 78th and 96 of its molecule three-D space structure expose portion.
A further object of the present invention provides produces the method with peptide more than the fibroblast growth promoting activity, and this method comprises:
(1) obtain the encoding dna sequence dna of active polypeptide with fibroblast growth factor-2;
(2) said dna sequence dna is suitably modified;
(3) will be connected with suitable expression through the dna sequence dna of modifying;
(4) transform suitable prokaryotic hosts and screen the recombinant cell that is transformed with the recombinant expression vector that obtains;
(5) cultivate saidly under the said condition with peptide more than the fibroblast growth factor activity being suitable for expressing, and from substratum and cellular lysate, separates and the said polypeptide of purifying by cell transformed.
This purpose preferred embodiment according to the present invention, wherein said dna sequence dna is a dna sequence dna shown in Figure 1.
According to an embodiment of this purpose of the present invention, wherein said modification to the dna encoding sequence is the sequence of the non-FGF structure gene in the terminal upstream of dna encoding sequence of N of deletion bFGF-2.
This purpose embodiment according to the present invention, wherein said modification to the dna encoding sequence be will encode respectively the codon of the 121st Serine of ox FGF-2 change into the coding Threonine codon, and the codon of bFGF-2 the 137th proline(Pro) of will encoding changes into the codon of encoding serine, thereby obtains dna sequence dna as shown in Figure 2.
Another embodiment of this purpose according to the present invention, wherein said modification to the dna encoding sequence is a codon of the codon of the 78th and 96 halfcystine of coding human fibroblastic growth factor-2 being changed into the coding basic aminoacids, the codon of particularly encode arginine or Methionin.
According to this preferred embodiment of this purpose of the present invention, the dna sequence dna of wherein said coding FGF-2 analog has dna sequence dna as shown in Figure 3.
The preferred embodiment of this purpose according to the present invention, wherein said clonal expression carrier is pUC18 and pKK123-33.
Another preferred embodiment of this purpose according to the present invention, wherein said prokaryotic hosts is intestinal bacteria.
A further object of the present invention provides and contains the present invention and have the active polypeptide of human fibroblastic growth factor-2 and the pharmaceutically acceptable carrier or the pharmaceutical composition of vehicle.
This purpose preferred embodiment according to the present invention, wherein remove people FGF-2 or its similar beyond the region of objective existence, also can contain and be selected from Urogastron, brain derived nerve growth factor and one or more other somatomedins of nerve growth factor as the primary activity composition.
This purpose preferred embodiment according to the present invention, wherein said pharmaceutical composition also can contain one or more ancillary components that are selected from stablizer, active protein protective material, skin penetrant and free-radical scavengers.
According to this preferred embodiment, wherein said stablizer comprises but is not only limited to the gsh of polyoxyethylene glycol, carboxymethyl cellulose, sulfated polysaccharide, T 500.
According to this preferred embodiment, wherein said active protein protective material comprises but is not only limited to human serum albumin, low molecular weight peptide, amino acid and metallic cation.And wherein preferred amino acids is glycine, Serine or Methionin, and preferred metallic cation is Zn
2+, Mn
2+, Mg
2+And Cu
2+
According to this preferred version, wherein said skin penetrant comprises but is not only limited to dimethyl sulfoxide (DMSO) or tall and erect laurocapram, and said free-radical scavengers comprises but is not only limited to superoxide-dismutase and derivative thereof.
A further object of the present invention relates to the polypeptide with human fibroblastic growth stimulating activity for preparing by the inventive method and contains the application of pharmaceutical composition in prevention or treated tissue damage of this polypeptide.
The preferred embodiment of this purpose according to the present invention, wherein the tissue of said damaged can be skin histology, muscle tissue, mucosal tissue, nervous tissue or osseous tissue.
The dna sequence dna of Fig. 1 code displaying bFGF-2 reaches the amino acid sequence corresponding by its coding.Wherein nucleotide position 1 to 51 is the nucleotide sequence of the part of coding intestinal bacteria LacZ α peptide, and underscore indicates not existing together of people and ox FGF-2 sequence; And wherein nucleotide position 52 to 516 districts are the nucleotide sequence of coding ox FGF-2.
The dna sequence dna of Fig. 2 code displaying hFGF-2 reaches the aminoacid sequence by the corresponding hFGF-2 of this dna sequence encoding.
The dna sequence dna of Fig. 3 code displaying hFGF-2 analog reaches the amino acid sequence corresponding by this dna sequence encoding.
Fig. 4 shows the structure of recombinant expression plasmid pUC18-bFGF-2.
Fig. 5 shows the structure of recombinant plasmid M13mp19-bFGF-2.
Fig. 6 shows the structure of recombinant plasmid M13mp19-hFGF-2.
Fig. 7 shows the structure of recombinant expression vector pUC18-hFGF-2.
Fig. 8 shows the structure of recombinant expression vector pUC18-bFGF-2m.
Fig. 9 shows the structure of recombinant expression vector pUC18-hFGF-2m.
Figure 10 shows the structure of recombinant expression plasmid pKK-bFGF-2.
Figure 11 shows the structure of recombinant expression plasmid pKK-hFGF-2.
Figure 12 shows the structure of recombinant expression plasmid pKK-bFGF-2m.
Figure 13 shows the structure of recombinant expression plasmid pKK-hFGF-2m.
Figure 14 is presented under the non-reduced condition, to the result who analyzes according to the FGF-2 and the sodium dodecyl sulfate-polyacrylamide gel electrophoresis that analog is done (SDS-PAGE) thereof of the inventive method preparation.Wherein swimming lane 1 and 2 shows the expression product that obtains from transformant pUC18-hFGF-2m and pKK-hFGF-2m respectively, swimming lane 4-7 shows that respectively swimming lane 3 shows the protein molecular weight standard product from the rhFGF-2 standard substance of the protein expression product of transformant pKK-hFGF-2, pKK-bFGF-2m, pKK-bFGF-2m purifying and the production of Promega company.
Figure 15 shows that the FGF-2 that uses behind the purifying and mutating molecule (FGF-2m) thereof and mouse-anti people FGF-2 monoclonal antibody make the result of Western engram analysis.Wherein swimming lane 1-4 is respectively from recombinant chou pKK-hFGF-2m, pKK-hFGF-2m, pKK-bFGF-2, pKK-hFGF-2 expressed protein product, swimming lane 5 is rhbFGF standard substance (productions of Promage company), and swimming lane 6 is a recombinant chou PUC18-hFGF-2m expressed protein product.
Figure 16 show with
3The FGF-2 analog of the present invention that the H method of mixing detects is to the tolerance of low pH value.
Figure 17 show with
3The FGF-2 analog of the present invention that the H method of mixing detects is to the tolerance of the temperature of rising.
The invention provides new, have the active polypeptide of metastable hFGF-2, it is characterized in that the basic aminoacids that the halfcystine on the 78th and the 96th in this polypeptide amino acid primary structure is selected from arginine or Methionin respectively replaces.After so replacing, can prevent intramolecularly and/or intermolecular disulfide formation on the one hand, can provide condition for the FGF-2 molecule being carried out the modification of Pegylation homogeneous on the other hand, thereby improve DNA recombinant expressed activity of proteins retention time and stability greatly.Below describe the preferred embodiments of the invention in detail.
In order to prepare FGF-2 of the present invention and its analog, at first from ox or human brain pituitary tissue, prepare total RNA with method well known to those skilled in the art, be further purified with the oligo-dT Mierocrystalline cellulose then and make mRNA.Synthesizing and FGF-2 mRNA3 ' end parts sequence complementary oligo DNA fragment, is template with mRNA, article one cDNA chain of preparation bFGF-2 under the katalysis of ThermoScript II.Be template with article one cDNA chain then, prepare the double-stranded DNA of coding bFGF-2 by the pcr amplification technology of routine.Select suitable cloning vector, as plasmid DNA (as pUC18 or pUC19) or phage double-stranded DNA (as M13 phage series) or phagemid dna (as Bluescript, pGEM, pUC118 or pUC119), after producing flat terminal restriction enzyme (as Hincll or Smal) digestion, be connected on the selected carrier at the DNA that under the effect of T4DNA ligase enzyme pcr amplification is obtained.Pass through CaCl
2Ordinary methods such as mediation or electroporation will connect product and import in the e. coli host cell, containing the LB substratum of Amp, IPTG, X-Gal (0.1% Tryptones, 0.05% yeast extract, 0.1%NaCl then, pH7.2) cultivate on the plate, obtain corresponding bacterium colony or plaque.Resulting white colony or water white transparency plaque are transferred on nitrocellulose filter or the nylon membrane, it is carried out denaturing treatment so that DNA is fixed on the film.Containing then
32This filter membrane of insulation is with DNA on the formation film and the crossbred between the probe in the solution of the probe of P mark (the preferred probes sequence is for reaching 60bp and and the complete complementary dna fragmentation of bFGF-2 encoding sequence).For example can in the solution that contains 6 * SSC (1 * SSC 8.77g NaCL and 4.4lg Trisodium Citrate are dissolved in 1 premium on currency and make), 1%SDS, 100ug/ml salmon sperm DNA and 5 * Denhardt ' s reagent (containing 0.1% bovine serum albumin, each 0.1% polyvinylpyrrolidone and Ficoll), DNA and probe hybridization on the film be spent the night in 65 ℃.After the hybridization, wash the part of non-specific adsorption off, carry out radioautograph then, to identify the clone who forms crossbred with probe.Repeat this step until obtaining the single clone who has formed the molecular hybridization body.The recombinant DNA that arrives with Restriction Enzyme NcoI digestion screening by hybridization, and resulting digestion product carried out electrophoretic analysis, in full accord with fragment and the known bFGF-2cDNA size of determining to be inserted with foreign DNA.
Measure the base sequence of the gene so obtain then, to have more than the bFGF-2 activity gene of peptide identical with the coding of expection to confirm it.Using under the situation of intestinal bacteria as host cell, can from the recombinant chou Bacillus coli cells, extract and digest resulting plasmid with ordinary method with Restriction Enzyme, separate wherein the insertion fragment and with its subclone in M13 phage vector (among the present invention preferably carrier be M13mp19), then with people's such as Sanger dideoxy chain termination (T.Maniatis et al., MolecularCloning, A laboratory Manual, 2nd ed., Chapter 13, ColdSpring Harbor Laboratory Press, 1989) measure the segmental base sequence that is inserted into.The base sequence of the gene that so obtains and required coding can be had more than the bFGF-2 activity gene (referring to Fig. 2 and the 3) base sequence of peptide and compare, identical with both sequences of further confirmation.If the gene that is obtained and the sequence of report (J.A.Abraham et al., Science, 233:545-548,1986) variant, as the disappearance of partial sequence or missense mutation is arranged or nonsense mutation, can be according to synthetic corresponding directed the insertion or the site-directed mutagenesis primer of the known array of bibliographical information, by containing uridylic (U) dna single chain template (Kunkel et al., Methods Enzymol., 154:367,1987; Kunkel et al., Proc.Natl.Acad.Sci., USA, 82:488,1985) or PCR sudden change method be correct sequence with the sequence mutagenesis of mistake.
The inventor is on the basis of successfully having cloned the bFGF-2 gene, compared hFGF-2 gene order (J.A.Abraham et al., EMBOJ., 5:2523-2528,1986) and the difference between the bFGF-2 gene (see figure 1) that obtains of clone, according to the described oligonucleotide mediated recombinant chou M13mp19-bFGF-2 that the preparation of uridylic (U) single-stranded template method carries the bFGF-2 gene that contains of people such as Kunkel, as the single stranded DNA template that contains uridylic (U), design and synthesize the primer P that the 121st Serine of bFGF-2 (TCC) is sported Threonine (ACC) with it simultaneously
121And the primer P that the 137th proline(Pro) of bFGF-2 (CCC) is sported Serine (TCC)
137What will make then contains U template and two mutagenic primer (P
121And P
137) annealing together, under the acting in conjunction of big fragment of dna polymerase i (Klenow enzyme) and T4DNA ligase enzyme, reaction is spent the night under 12 ℃, and transforms the JM109 competent cell with the gained reaction mixture then.Detect the mutagenesis preliminary screening with PCR, and further prove conclusively the recombinant chou of the selected recombinant chou that gets for all having sported coding hFGF-2 active polypeptide, i.e. M13mp19-hFGF-2 at the 121st and the 137th through dna sequence analysis.
The inventor is after successfully having cloned ox/people FGF-2, according to the above-mentioned oligonucleotide mediated U single stranded DNA template that contains further to the indivedual amino acid in the FGF-2 aminoacid sequence, particularly the 78th and 96 its side chains halfcystine of being exposed to molecule three-D space structure surface has carried out the site-specific sex modification, the codon of these encoding aminothiopropionic acids is changed into the coding basic aminoacids, as arginine or Methionin, rather than similar to halfcystine but on the structure not with the codon of the Serine of sulfydryl.The preferred basic aminoacids of the present invention is an arginine, and preferred codon is the codon CGT that intestinal bacteria are had a preference for.
The inventor is on the basis of the gene that has successfully prepared ox/people FGF-2 and analog thereof, further with suitable digestion with restriction enzyme and with the T4DNA ligase enzyme required digestion product is cloned into and has strong promoter (lac, tac, trc, T7, P
R, P
L, lpp etc.) the escherichia coli high-level expression carrier (as pUC18, pKK223-33, pBV220, pT7-7, plN-111-OmpA) in.Here answer lay special stress on to be pointed out that, in early stage work of the present invention, the expression product of FGF-2 is to prepare with the form that merges, be the ratio of the soluble component that improves expression product and the expression amount of FGF-2, connect a coding at the upstream of FGF-2 structure gene and be derived from the proteinic sequence of bacterial cell own.The preferred bacterial cellular protein matter of the present invention sequence is that the N of LacZ α peptide holds preceding 17 aminoacid sequences.This small peptide is little to the biological activity influence of FGF-2 after the fusion.Preferred for this purpose expression vector is pUC18.
In addition, in order to simplify purification step, further increase the yield of active polypeptide product in the soluble fractions, can not hold at the N of people of the present invention/ox FGF-2 or its analog gene and connect a secretory signal sequence, and, for example be derived from the targeting signal peptide of intestinal bacteria surface membrane protein (for example OmpA), alkaline phosphatase (phoA) etc. in 5 of this signal sequence ' end adding driving expression product excretory promotor in the cell pericentral siphon.
In addition, the FGF-2 and the analog thereof that the people are had lower or no antigen for preparation, FGF-2 can be cloned on the efficient expression vector with the form of non-fused protein, preferred expression vector is pKK223-3, pBV220, pT7-7, perhaps insert corresponding more special protease hydrolysis site between fusion sequence and FGF-2 or its analog, preferred protease hydrolysis site is the recognition site of Xa.
What also need point out emphatically is, for the expression product that reduces FGF-2 and analog thereof as much as possible forms the molecule of the insoluble form of no FGF-2 biologic activity, can adopt the induced product expression mechanism of non-temperature control.Using suitable inductor or under the suitable inductive condition and when inducing the expression of gene of FGF-2 and analog thereof under lesser temps, the preferred inductor of the present invention is IPTG, preferred lesser temps is 25-30 ℃.If the promotor of selecting for use is subjected to responsive to temperature type repressor (as Clts857) regulation and control, can adopt λ promotor P
RAnd P
L, improve the pH value at a lower temperature so that the repressor inactivation is transcribed thereby start.In this case, preferred lesser temps is 25-30 ℃, and preferred pH value is 8.5-9.0.
We use the ox/people FGF-2 of fused protein form of the present invention to make externally applied medicine, do not find because of heterologous peptides fragment (containing 17 amino acid approximately) caused comprise the antigenicity reaction any untoward reaction.Therefore, the method for expressing ox/people FGF-2 with the fused protein form or under non-temperature condition also will comprise within the scope of the invention.
The hFGF-2 gene or its mutant nucleotide sequence that obtain are inserted in the suitable plasmid vector also with resulting recombinant vectors conversion appropriate host cell.Being suitable for expressing under the general conditions with peptide more than the human fibroblastic growth factor activity, cultivate resulting transformant cell then.Can contain the LB substratum of penbritin (0.1% Tryptones, 0.05% pure female extract, 0.1%NaCl, pH7.2) in the transformant overnight incubation.Cultivate the back harvested cell, use the ultrasonic disruption cell, the soluble fractions of centrifugal separating cell and by cationic exchange, heparin is affine and gel permeation chromatography separate with purifying it, so ox/people FGF-2 or its analog product that obtains has the biologic activity of natural FGF-2, and degree of purity of production can reach 95%-99%.Ion Exchange Medium of the present invention comprises but is not only limited to CM-Sepharose Fast Flow, SP-Sepharose Fast Flow or Bio-Rex70 resin, wherein Bio-Rex70 resin (Bio-Rad production) preferably.The affinity chromatography medium that is adopted comprises but is not only limited to Heparin-SepharoseCL-6B or Heparin-HyperD (Bio-Rad Co.), but Bio-Rex70 Resin preferably.The gel filter medium that is adopted comprises but is not only limited to Sephadex G75, Superdex75 prep grade, wherein Superdex75 prep grade (being produced by Pharmacia) preferably.
Can be according to known in the art
3The H-thymus pyrimidine mixes method (Klagsburnet cl., Proc.Natl.Acad.Sci, USA, 82:805-809,1985) or tetrazolium bromide (MTT) staining (Armelin HA., Pituitary extracts and steroidhormones in the control of 3T3 cell growth, Proc.Natl.Acad.Sci.USA 70:2702-2706,1973), the extract that uses recombination bacillus coli is as test sample, with stimulation index (
3The H-TdR infiltration method) or the maximum half propagation of cell concentration (ED
50) (MTT staining) detect the biologic activity of hFGF-2 of the present invention or its analog.
Use
3H mixes method or tetrazolium bromide (MTT) staining is measured FGF-2 analog growth stimulating activity to the BALB/c3T3 cell under differing temps and different pH value, and uses and detect its physico-chemical property as methods such as SDS-PAGE, Western Blot, HPLC.Found that, FGF-2 is carried out above-mentioned modification can make the stability of molecule and the ability of antagonism multimerization be able to obvious raising, thereby make FGF-2 of the present invention and analog thereof be widely used in clinical prevention and/or therapeutic purpose become possibility.
In recent years, with regard to the structure-functional relationship, particularly three-D space structure of FGF-2 molecule FGF-2 activity and stable influence have been carried out big quantity research.For example many FGF-2 molecule Primary Structure Analysis of carrying out from the eighties have shown the not diversity of terminal amino acid sequence of N.Also have many investigators some segmental disappearance in the influence of the stability of molecule and multimerization, the molecule to be carried out many deep researchs to one or more amino acid whose replacements in the enhancing of its biologic activity or abated effect and molecular surface ring (surface loop) zone to influence of molecule Pegylation effect etc. simultaneously to being in the halfcystine on the surperficial exposure position in the FGF three-D space structure.These researchs will be for will find many tissues, and particularly the FGF that the nervous tissue cell is had a growth-promoting effect is used for the clinical treatment purpose provides foundation.
The inventor is after successfully having cloned ox/people FGF-2, further to the indivedual propylhomoserin acid in the FGF-2 amino acid preface, particularly the 78th and 96 its side chains halfcystine of being exposed to molecule three-D space structure surface has carried out the site-specific sex modification, these halfcystines are changed into basic aminoacids respectively, as arginine or Methionin, rather than change on the structure similar to halfcystine but not with the Serine of sulfydryl.The result is surprisingly found out that, FGF-2 is carried out such modification make the stability of molecule and the ability of antagonism multimerization be able to obvious raising, FGF-2 of the present invention and its analog are widely used in the confidence of clinical prevention and/or therapeutic purpose thereby further strengthened us.
In addition, the inventor has also carried out useful improvement to the isolation and purification of FGF-2 and analog thereof.Can unite by different way and use the purifying the present invention from the transformant cell cultivated and/or substratum of various conventional chromatographic techniques to have the active polypeptide of FGF-2 or its analog.For example can behind smudge cells, dissolve required polypeptide, then the required purpose product of chromatography purification from molten born of the same parents' thing.Employed chromatography method comprises but is not only limited to ion exchange chromatography, hydrophobic interaction chromatography, gel permeation chromatography and affinity chromatography.Wherein affinity chromatography comprises but is not only limited to for example affinity column chromatography that closes of copper or zinc chrome and combine the Sepharose column chromatography that FGF-2 is had the heparin sulfate of high affinity of metal ion.
Being used for hydrophobic chromatography medium of the present invention and being can covalently bound just (different) butyl, the agarose resin of octyl and phenyl etc., for example can be Butyl Sepharose Phenyl SepharoseCL-4B available from Phamacia Co.Sweden etc.Can use methods known in the art to pass through 1-chloro-2,3-propylene oxide or 2,3-dibromo-propanol are covalently bound to above-mentioned group on the Sepharose solid-phase matrix as spacerarm.When separating FGF-2 or its analog with hydrophobic interaction chromatography, degree or gradient elution such as can use, be selected from phosphate buffered saline buffer, Tris-HCl damping fluid but better be to use, the gradient buffer salts solution of nitrate damping fluid carries out wash-out with 50-600cm/ hour flow velocity.The concentration gradient of using is generally 3.5-0M, and the pH scope of elutriant is 6-9.In addition, hydrophobic interaction chromatography also can use the solid-phase matrix of other types, for example Sephadex Microcrystalline Cellulose or other inorganic rigid matrix.Employed aglucon also can be the solid-phase matrix of the other types of polyoxyethylene glycol and band polyether key.
For carrying out the metal complex affinity chromatography, can use coupling that Zn is arranged
2+, Cu
2+, Fe
3+, Mn
2+Deng the solid-phase resin of metal ion, but better be coupling Zn
2+Sepharose or Sephadex carboxymethyl cellulose resin column (for example available from Pharmacia Co., the Chelating SepharoseFast Flow of Sweden).Can be under about pH7-9 condition, select with about 250-370cm/ hour flow velocity and to take off.Can use the elutriant that contains the NaCl concentration gradient to carry out wash-out.
The most important chromatography substrate that is used to separate FGF-2 is the sulfated polysaccharide that carries covalent cross-linking, or agarose, dextran or cellulosic matrix, for example product Sepharose-CL 6B by name or Sepharose 6 Fast Flow, or available from the affinity chromatography resin of Cellulofine.Available NaCl gradient eluent carries out wash-out.We use FGF-2 or its analog of hydrophobic interaction chromatography-metal complex affinity chromatography-sulfated polysaccharide affinity chromatography purification by the inventive method preparation successively, and product purity reaches more than 98%.
In some expression system, expressed FGF-2 or its analogue are to gather with the formation of insolubility inclusion body in recombinant cell.In this case, can be in recovery and after with gentle denaturing agent (for example urea) dissolving, remove denaturing agent immediately so that FGF-2 or its analog fold again and recover its original activity, and then carry out chromatographic separation by preceding method basically, to obtain having required active polypeptide.
The invention further relates to the pharmaceutical composition that contains FGF-2 or FGF-2m, prepare the method for this pharmaceutical composition, and this pharmaceutical composition is used in the treated tissue damage.Can use according to the FGF of the method for the invention preparation or FGF-2m as main component, with pharmaceutically acceptable vehicle or thinner, and other ancillary components mix mutually, make to be suitable for the pharmaceutical composition that clinical treatment is used.Can pharmaceutical composition of the present invention be mixed with the injection liquid that can supply intravenously, intramuscular, intraperitoneal, myelencephalon intracavitary administration according to the known method in medicine industry field, perhaps be suitable for tablet, the solution of oral administration, and the sprays, emulsion, ointment, suspension agent or the suppository that are suitable for external application.
During the solution of administration, employed ancillary component can comprise thinner or vehicle outside preparation is suitable for gi tract, for example can use sterilized water, etc. ooze NaCl or sucrose solution or lower concentration (for example 1-10mM) PBS as thinner and vehicle.Can use xitix as antioxidant, use to be selected from for example glycine or Serine or Methionin and metallic cation Zn for example of human serum albumin, low molecular weight peptide, amino acid
2+, Mn
2+, Mg
2+Or Cu
2+One or more materials as the active protein protective material.Can pharmaceutical composition of the present invention be made lyophilized powder through lyophilize, add thinner during use and prepare again and use it as early as possible.Particularly using under the situation of FGF analog of the present invention as the primary activity composition, can use macromolecular compounds such as being selected from polyoxyethylene glycol, carboxymethyl cellulose, sulfated polysaccharide, heparin, poly-lysine, and can form the gsh of disulfide linkage with the halfcystine in the FGF molecule as stablizer, in order to preventing that the FGF molecule from being degraded rapidly in solution or in patient's blood flow, or between the shelf lives molecule multimerization takes place and reduce or lose its biologic activity.When preparation is suitable for the tablet, powder agent of oral administration or microcapsule, can use sucrose, semi-lactosi, W-Gum, gelatin, Microcrystalline Cellulose etc. as vehicle, wherein can also add proteinase inhibitor in addition.Can use that known method and ancillary component prepare microcapsule in the pharmaceutical industry, or the liposomes enclose agent.
Under the situation of local topical, preferably FGF analogue of the present invention is added in the water-bearing media, mix with above-mentioned various suitable ancillary components and suitable skin penetrant, make sprays by currently known methods.Preferably use the matrix components that can form protective membrane and have stabilization function in skin or wound surface during sprays in preparation.In addition, the pharmaceutical composition that also the present invention can be contained FGF-2 or its analog is added in the cosmetic industry makes Derma-Guard in the known necessary matrix, for example makes the Derma-Guard of forms such as emulsion, creme, lotion, facial mask, ointment.In addition, can also in these Derma-Guard matrix, add free-radical scavengers for example superoxide-dismutase (SOD) and its derivative, and the skin penetrant that is selected from dimethyl sulfoxide (DMSO) and tall and erect laurocapram etc.Such Derma-Guard is except that the function with conventional makeup; also has the part of preventing and/or treating; the function of tissue injury of health exposure portion and/or infection particularly, and stimulate fibrocyte and epithelial cell proliferation in the local organization, prevent the function of skin aging and shrinkage.
What be also pointed out that at last is, difference according to application target, in the pharmaceutical composition of the present invention except that the FGF-2 or FGF-2m that contain as main active ingredient, also can contain other relevant biologically active proteins matter, for example skin factor (EGF), nerve growth factor (NGF), brain derived nerve growth factor (BDNF), these active factores can act synergistically with FGF-2, further improve the result of treatment of pharmaceutical composition of the present invention.
Below by embodiment and with reference to accompanying drawing the present invention is described for example further, these embodiment also limit the await the reply scope of claim of the present invention never in any form.Embodiment 1: the preparation of the cDNA of coding people FGF-2 active polypeptide
Present embodiment is described the preparation method of the dna sequence dna of coding hFGF-2 active polypeptide.
1. the mRNA that separates coding bFGF-2 active polypeptide.Get the ox pituitary gland and be organized under the liquid nitrogen environment and smash to pieces, and be suspended in RNA and extract damping fluid and (contain 0.14M NaCL, 1.5mM MgCL
210mM Tris-HCL (pH8.6), 0.5%NP-40,1mM dithiothreitol (DTT) (DTT) and the 1000 placenta RNA of unit enzyme inhibitorss) in, after in suspension, adding the guanidine thiocyanate homogenate buffer (4.0M guanidine thiocyanate, 01mM Tris-HCL, 1% beta-mercaptoethanol) of 5 times of volumes, use Polytron refiner (production of Brinkmann company) high-speed homogenization 2 minutes.Adding sarcosyl to final concentration in homogenate is 0.5%, with the top that 5000g is equipped with the clean centrifuge tube of 5.7M CsCl, 0.01M EDTA (pH7.5) bed course with the immigration of gained supernatant after centrifugal 10 minutes, use the SW60 rotary head to obtain the RNA throw out after centrifugal 12 hours with 4000rpm.Can directly use resulting RNA, perhaps can obtain mRNA (T.Maniatis by Oligo-dT post (Pharmacia) purifying, et al., Molecular Cloning:A LaboratoryManual, 2nd ed., Chapter 7, Cold Spring arbor LaboratoryPress, 1989).
2.cDNA preparation.Base sequence (AbrahamJ.A.et al., Science 233:545-548,1986) according to 5 of disclosed bFGF-2 mRNA in the document ' end coding region and 3 ' end non-coding region designs and synthesizes the one couple of PCR amplimer, i.e. P
5: 5 ' CATGGCCGCCGGGAGCATC 3, and P
3: 5 ' CATGGATGTAGTTAATCTG 3 '.
Use the mRNA that makes as stated above as template, with P
3As primer, under the effect of mouse source ThermoScript II (production of Promega company), by article one cDNA chain of the synthetic bFGF-2 of 4 kinds of Nucleotide.Then with P
5And P
3Being primer, is template with article one cDNA chain, takes turns the amplified production that PCR circulation (92 ℃ of sex change 1 minute, 50 ℃ are moved back and lost 1 minute, 72 ℃ were extended 1 minute) makes bFGF cDNA through 35.Use therein PCR reaction mixture is to contain the above-mentioned primer of 20pmol in the 50ul total reaction volume, 2 μ lTaq polysaccharases, 5 μ, 1 10 * buffered soln, each 5 μ l (250 uM) dNTP, and adding distil water to 50 μ l.
Obtain linearizing flush end carrier with restriction endonuclease HincII digestion cloning vector pUC18 (production of Promega company) then, in this digestion product, add above-mentioned amplified production of 0.1ug and 1ul T4 dna ligase, connect down in 14 ℃ and spend the night.After the connection, transform through CaCl with the gained reaction mixture
2The escherichia coli jm109 competent cell of handling.Then, utilize known α-Hu Bu sieve method to filter out the white colony that carries the gene that is inserted into.Plasmid DNA with EcoRI and Accl cutting gained bacterium colony therefrom identifies and can downcut the clone that forward inserts about 0.67Kb dna fragmentation, and it is named into pUC18-bFGF-2 (referring to Fig. 4).
3.hFGF-2 the preparation of gene.Dna sequence dna (Abraham J.A.et al. according to coding people FGF-2, EMBO J.5:2523-2528,1986), design and synthesize following two sequence synthetic oligonucleotides on the basis of the hFGF-2 gene order that has prepared, one of them is to induce in the hFGF-2 gene order codon (TCC) of the 121st Serine of coding to change into codon (ACC) the primer P of coding Threonine
121: 5 ' TCCTAGGAAATACACCAGTTGGTAT 3 '; Another is to induce in the hFGF-2 gene order codon (CCC) of the 137th proline(Pro) of coding to change into the primer P of the codon (TCC) of encoding serine
137: 5 ' TATAAACTTGGATCCAAAACGGGG 3 '.Simultaneously, according to principle and the method described in the people such as Picard (Nucleic Acids Research 22:2:2587-2591,1989), design and synthesize the 5 ' end that detects the sudden change of the 121st and the 137th amino acids and detect primer P
121S: 5 ' TCAAAGAAATACA 3 ' and P
137S: 5 ' TATAAACTTCCAT 3 '.
For ox FGF-2 is carried out site-specific mutagenesis, at first from the recombinant chou pUC18-bFGF-2 that comprises the bFGF-2 encoding sequence that makes by preceding method, downcut the EcoRI-HindIII fragment of about 1.0kb, by the T4DNA ligase enzyme this fragment is connected on the M13mp19 phage vector (Pharmacia production), use resulting recombinant phage vector M13mp19-bFGF-2 transformed into escherichia coli JM109 then, be used for detecting the double-stranded DNA template and the single stranded DNA that is used for sequential analysis of sudden change with preparation with PCR method.
Then according to people (Methods Enzymol, 154:367,1987 such as Kunkel T.A.; KunkelT.A.et al., Proc.Natl.Acad.Sci.USA, 82:488,1985) described method, the single stranded DNA template that contains uridylic of preparation recombinant chou M13mp19-bFGF-2 adds simultaneously and do not held the primer P of phosphorylation under the effect of T4 phage polynucleotide kinase
121And P
137And annealing with it.In annealing mixture, add Klenow enzyme, T4DNA ligase enzyme and ATP and dNTP (four kinds of Nucleotide), in 16 ℃ of following incubated overnight.Use the competent cell of resulting reaction mixture transformed into escherichia coli JM109 then, obtain containing the transformant cell of rf (two strands) DNA.
Therefrom select several bacterium colonies behind cultivation and the propagation transformant cell, use the alkaline lysis method of extracting replicative DNA, thereby finish the mutagenesis (referring to Fig. 6) to hFGF-2 by bFGF-2.
Then, according to the method for having described in the document (Picard V.et al., Nucleic Acids Research 22:2587-2591; Newton C.R.et al., Nucleic Acids Research 17:2503-2515,1989), whether desired point mutation has taken place with the round pcr check.In this method, use above-mentioned double-stranded DNA to make template, at aforementioned primer to P
121SAnd P
3, and P
137SAnd P
3Guiding under carry out pcr amplification.Amplified production is added on carries out electrophoretic separation in 1.5% sepharose, as seen the result has the recombinant chou of increase 600bp and 550bp simultaneously, thereby confirms that the 121st of bFGF-2 and the 137th amino acids have sported the corresponding amino acid of hFGF-2.For above-mentioned correct sudden change has taken place in further confirmation, use fluorescein-labeled universal primer, dideoxy chain termination (Sanger.F.et al. with people such as Sanger, J.Mol.Biol.94:441,1975) dna sequence dna of mensuration mutating molecule, the result shows that the dna sequence dna through mutagenesis that PCR method detects carries required mutant nucleotide sequence (referring to Fig. 2).
4. to the site-directed mutagenesis of people/ox FGF-2 gene order.Basically according to the method described above the dna encoding sequence of people or ox FGF-2 is carried out site-directed mutagenesis and change into coding arginic codon (CGT) with the codon (TGT) of the 78th and the 96th halfcystine of will encoding.For this purpose, design and synthesize two Oligonucleolide primers P that are used for mutagenesis respectively
78: 5 ' ATCAAAGGAGTGCGTGCAAACCGT3 ' and P
96: 5 ' CTAGCTTCTAAACGTGTTACAGAC3 '.
Design and synthesize two the detection primer that detects corresponding sudden change with PCR method: P simultaneously
78S: 5 ' ATCAAAGGAGTGC 3 ' and P
96S: 5 ' CTAGCTTCTAAAC 3 '.
What prepare the M13mp19-hFGF-2 transformant then respectively contains the uridylic single-stranded template, use M13mp19 as carrier, carry the hFGF-2 of coding the 78th and the 96th arginine codon and the e. coli jm109 transformant cell of bFGF-2 analog encoding sequence according to the preparation of the method described in the 3rd part above, and with other M13mp19-hFGF-2m by name and M13mp19-bFGF-2m.Through nucleotide sequence analysis, confirm that the recombinant chou that is screened carries the gene order of required FGF-2m.Embodiment 2: the structure of the expression vector of wild-type FGF-2 and FGF-2 analog
In order to make up the recombinant expression plasmid that is used for expressing wild-type FGF-2 or FGF-2 analog at prokaryotic host cell, at first from the entrained recombinant plasmid of the transformant that as above obtains, downcut the coding people of about 1.0kb or the dna fragmentation of ox FGF-2 or its analog, use the T4DNA ligase enzyme that this dna segment is connected on the expression vector pUC18 that cuts with same enzyme with restriction enzyme EcoRI and HindIII.The gained recombinant plasmid transformed behind the e. coli jm109 recipient cell, is comprised the recombinant cell of FGF-2 and FGF-2m respectively.Each construction of recombinant plasmid is referring to Fig. 4-9.
In order to make up recombinant chou, the synthetic primer P that is used for pcr amplification with non-fusion protein form expression wild-type FGF and analog thereof
E: 5 ' GAATTCCATGGCCGCCGGGAGCATC 3 ' and P
P: 5 ' CCTGCAGTTATCAGCTAGACAT 3 ', the dna encoding sequence of non-FGF-2 or its analog coding region has been deleted as template by coding people FGF-2 that the process that use makes is as stated above suitably modified or the dna sequence encoding district of FGF-2m with PCR method.After cutting out the fragment (about 0.47kb) that has terminal viscosity with restriction enzyme EcoRI and PstI, this fragment is connected on the expression plasmid pKK223-3 that has strong promoter (tac) and transcription termination sequence (production of Pharmacia company) that cuts with same enzyme, is named recombinant expression plasmid (referring to Figure 10-13) respectively into pKK-bFGF-2, pKK-hFGF-2, pKK-bFGF-2m and pKK-hFGF-2m.The recombinant expression plasmid that so makes is transformed into respectively in the competence e. coli jm109 cell, obtains corresponding transformant cell.
According on the December 27th, 1996 that is specified in that is used for patented procedure microbial preservation budapest treaty e. coli jm109 pUC18-hFGF-2 of the present invention being preserved in China Committee for Culture Collection of Microorganisms common micro-organisms preservation center, its preservation is registered as CGMCC No.0286.Embodiment 3:FGF-2 and analog protein expression and purifying
In order under the shake-flask culture condition, in e. coli host cell, to express and produce FGF-2 of the present invention and its analog, to carry pUC18-bFGF-2 respectively, pUC18-hFGF-2, pUC18-bFGF-2m, pUC18-hFGF-2m, pKK-bFGF-2, pKK-bFGF-2m, pKK-hFGF-2, the JM109 transformant streak inoculation of pKK-hFGF-2m is in LB solid medium (the 1.0g Tryptones that contains the 100ug/1ml penbritin, 0.5g pure female extract, 1.0g NaCL, 1.5g it is formulated through autoclaving that agarose is dissolved in the 100ml distilled water) on, in 37 ℃ of following overnight incubation.After spending the night, the positive bacterium colony of picking also is inoculated in respectively in the 5ml LB liquid culture medium, and 30 ℃ of following shaking culture 12 hours obtain inoculum., add and contain in 500mlLB liquid nutrient medium 2.5 liters of culturing bottles of (containing 100 μ g/ml penbritins) by behind 1: 100 this inoculum of dilution proportion with 10mMPBS, in 30 ℃ of following shaking culture 5 hours.To wherein adding 300 μ MIPTG, continue vibration (200rpm) down at 30 ℃ and cultivated 6 hours, then to promote the generation of FGF-2 or its analogue.
Collect the nutrient solution so obtain, under 4 ℃ with centrifugal 10 minutes harvested cells of 8000rpm.(every liter contains 0.1MNaCl, 10mMEDTA and 20mM phosphate buffered saline buffer (PB) to add the cellular lysate damping fluid by the amount of 10ml/g weight in wet base in the cell of results, pH7.0), use high-pressure homogenizer (Shp 60/60), with the original pressure of 20-25 MPa and the end pressure lysing cell of 50-60MPa.Under 4 ℃, with 18, centrifugal 30 minutes of 500rpm also collects supernatant liquor.
The chromatography column that the gained supernatant liquor is added on Bio-Rex70 resin (Bio-Rad production) filling of having crossed with cellular lysate damping fluid balance (carries out ion exchange chromatography on the 3cm * 5cm), at first use above-mentioned column balance buffering liquid wash-out, when the 280nm absorption value is zero, (every liter contains 0.6MNaCl, 20mM PB, and pH7.0) wash-out contains the active crude extract of FGF-2 to use elution buffer instead.This crude extract crossed use level pad (0.6mM NaCl, 20mMPB, pH7.0) Heparin Hyper-D (production of BiO-Rad company) the heparin affinity chromatography post crossed of balance (5cm * 3cm).For wild-type FGF-2, continue the more weak foreign protein of wash-out heparin affinity with 1.0M NaCl+20mM PB (pH7.0) solution, use 2.0M NaCl+20mM PB (pH7.0) eluant solution then instead and contain the active protein of FGF-2.For FGF-2m, then use 1.5-2.5M NaCl gradient to carry out wash-out.At last, (80cm * 1.6cm) go up also collects the peak value part with maximum absorption (280nm), obtains purity and reaches FGF-2 of the present invention and FGF-2m expression product more than 95% will to be added on the Superdex75 gel-filtration column of using 1.0M NaCl+20mMPB (pH6.5) balance to cross again by the eluate of heparin affinity column wash-out.
For the FGF-2 that confirms purifying like this or the uniformity and the immunocompetence of FGF-2 analog, the active ingredient of wash-out is carried out non-reduced SDS-PAGE electrophoretic analysis (see figure 4) and Western engram analysis.After at first separating 3 hours, with about 8mA/cm with 10mA constant current electrophoresis
2Constant current with the sample electrotransfer of electrophoretic separation to nitrocellulose filter and with sealing slow in liquid (10mMPBS (pH7.4)+0.5%Tween20+1%BSA) handled 30 minutes, add the mouse-anti people FGF-2 monoclonal antibody (Promega production) that is dissolved in the rinsing damping fluid then, 37 ℃ vibrated 2 hours down.(after 10mM PBS (pH7.4)+0.5%Tween20) washes 3 times (10 minutes/time), add the rabbit anti-mouse igg (Promega productions) that is dissolved in the horseradish peroxidase in the sealing damping fluid again, and be incubated 2 hours down with rinsing liquid in 37 ℃.After the insulation filter membrane is washed (10 minutes/time) 3 times with rinsing liquid.Add substrate buffer solution (0.1M PBS (pH6.0)+1mgDAB+10ulH then
20), add 50mM EDTA termination reaction behind the band up to showing clearly, and record result as shown in figure 15.The external biological of embodiment 4:FGF-2m (FGF-2 analog) is active to be detected
Use the inoblast of cultivating, with
3The FGF-2m that the H infiltration method detects by the inventive method preparation stimulates DNA synthetic ability in the immobilized BALB/c3T3 inoblast under test conditions.
Briefly, with about 10
5Individual BALB/c3T3 inoblast (being provided by institute of Materia Medica,Chinese Academy of Medical Sciences) is inoculated in 3ml and contains in the DMEM substratum of 10% foetal calf serum.In 37 ℃ at 5%CO
2Cultivate in the insulation can after 24 hours,, make the final concentration of serum become 1% with fresh DMEM substratum dilution culture.Continue to cultivate after 3 days, in culture, add FGF-2 of the present invention or FGF-2m, and contrast (DMEM culture or hydroxyurea) and
3The thymus pyrimidine of H mark (
3H-TdR) (final concentration is 2 μ Ci/ml).37 ℃ of insulations were washed cell 3 times with cold saline after 24 hours.Centrifugal back adds 10% trichoroacetic acid(TCA) with precipitating proteins in the cell precipitation thing.Wash 2 times with physiological saline once more, and the adding alcohol-ether is washed once.Be added in the 4ml scintillation vial and measure radioactivity with getting 0.1ml behind the formic acid digestion throw out.Calculate FGF to inoblast DNA synthetic stimulation index by following formula.
Obtain the result shown in the following tabulation 1.Table 1 people FGF-2 and FGF-2 are to external mouse 3T3 cell
3Cell is handled in the influence that H-TdR mixes
3H-TdR mixes (CPM) stimulation index P value substratum 15,078 1.00-hydroxyl an aromatic plant metioned in ancient books ureas
*15,105 1.00-FGF-2,25,126 1.68＜0.05 FGF-2m 26.328 1.72＜0.01
*Because known hydroxyurea suppresses mixing of thymus pyrimidine fully,, this contrast detects DNA synthetic certainty in the cell so will further confirming the 3H-TdR method of mixing.
From the result shown in the last tabulation 1 as can be seen, can be synthetic by FGF-2 and FGF-2m that the inventive method makes in the external DNA of l cell that stimulates effectively, and then the growth of irritation cell and propagation.Embodiment 5:FGF-2m is to the repair of rat skin tissue injury
Use following material and method, detect the repair of FGF-2m in the body, and compare with FGF-2 to the tissue injury of rat local skin.Observe the positively effect of the FGF-2 of containing pharmaceutical composition of the present invention in the treated tissue damage is used simultaneously.
1. the preparation of animal model: choose 20 of the healthy male Wistar rats that body weight is about 230-250g (12 age in week), before the experiment the single cage of animal was fed for 1 week.Shave hair under the light anaesthesia state except that the about 4cm of back part of animal * 5cm scope, in the garden shape surface of a wound of the about 1.8cm of the about 0.9cm of back center line two lateral extents each aseptic cutting diameter of place, and broken a little muscle tissue of ring, to cause the typical knife wound surface of a wound.
2. the preparation of test sample: preparation contains the drug composition solution of the present invention of following ingredients according to a conventional method:
People FGF-2m (or FGF-2) 10
5Unit
Poly(oxyethylene glycol) 400 20.0mg
Xitix 1.0mg
Heparin sulfate 0.5mg
Add 0.9%NaCl to 100.0ml
The aseptic vial of packing into behind the mentioned component mixing is preserved standby down for interior 4 ℃.Preparation only contains the same concentration of aqueous solution of FGF-2m (or FGF-2) as positive control sample under similarity condition.The negative control sample of composition that does not contain FGF-2m (or FGF-2) to contain other various compositions.All 4 ℃ of placement uses after 30 days under lyophilised state of FGF-2m in all composition sample (or FGF-2).
3. animal grouping and administering mode: 20 traumatogenic rat animal models are divided into 4 groups at random, 5 every group, totally 10 surface of a wound.Drip about 0.15ml various tests and control sample in each wound site with the 1ml syringe from beginning in the 0th day of wound and in hindering back the 1st, 3,5,7 day.The 1st treated animal is accepted positive control sample (production of Promega company), the FGF-2 that the 2nd winding is prepared by the present invention, and the 3rd winding is subjected to FGF-2m of the present invention, and the 4th winding is subjected to the negative control sample.The dosage of FGF is about each each wound 100 unit, and the next day is administered once.Drip behind the medicine and to bind up a wound with sterile gauze in 5 minutes.
4. result: the local granulation tissue growing state of visual inspection next day wound after the medication, measure also record surface of a wound area, with estimation epithelium growth velocity.In addition, carried out biopsy from surface of a wound centre clip callus before the medication on the 3rd, 5,7 day in hindering the back, and after the 7th day, detect the tension stress intensity (result is not shown) of callus.
Found that 2 experimental group and positive controls all show tangible wound healing promoter action.(the 1st, 2,3 groups) rat wound of the 3rd day FGF-2 that comes into operation has the thin layer granulation tissue to generate, and the edge of wound contraction of skin is obvious.Hinder the surface of a wound of the 7th day each the experimental group animal in back and all filled by granulation, negative control group (the 4th group) only sees that then the thin layer granulation that has seldom generates.Shown in the following tabulation 2 of result.
Table 2 FGF-2 and FGF-2m influence laboratory sample wound area (cm to the mouse trauma repair
2) (mean value ± DS)
0 day 1 day 3 days 5 days 7 days positive control 2.5 2.09 ± 0.28 1.4 ± 0.28 1.30 ± 0.25 0.90 ± 0.20FGF-2 2.5 1.86 ± 0.33 1.51 ± 0.19 1.43 ± 0.10 0.83 ± 0.14FGF-2m 2.5 1.80 ± 0.14 1.24 ± 0.29 1.81 ± 0.05
*0.44 ± 0.06
*Negative control 2.5 2.14 ± 0.34 1.85 ± 0.41 1.53 ± 0.24 1.14 ± 0.35
*Compare significant difference with FGF-2 with positive control sample ratio, P＜0.05, compare otherness with negative control group remarkable especially, P＜0.01.
As can be seen from the above table, under the situation that adds suitable stablizer, FGF-2m of the present invention (freezing the cool-drying goods) is through after 30 days low-temperature storage, compares with the FGF-2 that produces by the inventive method to have kept promotion fibrous tissue regenerated biologic activity preferably.Embodiment 6:FGF-2m and FGF-2 are to the repair of pig skin tissue damage
Use following material and method, detect the repair of FGF-2m in the body, and observe the positively effect of pharmaceutical composition in treatment is used of the FGF-2m of containing of the present invention the tissue injury of pig local skin.
1. the preparation of animal model: 8 of Beijing miniature pigs (providing) (male 5, female 3) of choosing the about 10-20Kg of body weight by the agricultural academy of sciences of China animal center.Single cage fed for 1 week before the experiment.Shave the hair except that back 35cm * 25cm scope under shallow liquor-saturated state, the garden shape surface of a wound of the about 1.8cm of scalpel cutting diameter is used in backbone both sides, aseptic condition lower edge at a distance of the antimere of about 2.0cm.Every back part of animal causes two each 5 surface of a wound of row altogether.
2. the preparation of test sample: preparation contains the medicinal composition spray of the present invention of following ingredients according to a conventional method:
People FGF-2m (or FGF-2) 10
5Unit
Hydroxypropylcellulose 20.0mg
Collagen protein 40.0mg
1%ZnSo4 solution 0.2ml
Heparin sodium 20.0ug
Add 0.9%NaCl to 100.0ml
The mentioned component mixing is packed in the automiser spray of sterilizing, and puts 4 ℃ and preserves after 30 days down and use.Be used for other also preparation and storages under similarity condition of sample that contain FGF-2 or do not conform to FGF-2 of control experiment.
3. animal grouping and administering mode: 8 traumatogenic animals are divided into 4 groups at random, 2 every group, totally 20 surface of a wound.From the 0th day of wound, and spray various tests of about 0.2ml and control sample in each wound site with automiser spray in hindering back the 1st, 5,7,10 and 14 day.The A treated animal is accepted Sulfadiazine Silver (SD-Ag) treatment, and the B winding is subjected to FGF-2 of the present invention, and the C winding is subjected to FGF-2m of the present invention, and the D winding is subjected to the negative control sample, does not promptly contain FGF-2 or FGF-2m and only contains the composition of other ancillary components.The dosage of FGF is about each each about 100 unit of wound product, and the next day is administered once.Bound up a wound with sterile gauze in 5 minutes after the administration.
4. result: the local granulation tissue growing state of visual inspection next day wound after the medication, measure also record surface of a wound area, with estimation epithelium regeneration rate.Respectively at 2 animals of execution in the 3rd, 7,10 and 14 day.On average cut apart each surface of a wound, wherein 1/2 carries out microscopy, histological chemistry's inspection and specific stain inspection after formalin solution is fixing, and other 1/2 carries out tensile strength after formalin fixed measures.
To form face little red for the 3rd day visible B and C after the wound, no secretory product, and the then visible significantly red and swollen and toughness secretory product of D group, hindering the 7th day B in back and C group has 80% surface of a wound to be filled by granulation tissue, and surface of a wound area is by 2.5cm
2Be reduced into 0.54 and 0.50cm respectively
2Hindered the back the 10th day, the B and the C surface of a wound are filled by granulation tissue fully, remove behind the part surface of a wound crust visible whole surface of a wound epithelial metaplasia substantially.The 10th day A and D group still have 10% the surface of a wound not heal, and surface of a wound area is respectively 0.62 and 0.92cm
2(referring to table 3).
Table 3 FGF-2 hinders the different surface of a wound area (CM in back with FGF-2m to the laboratory sample that influences of pigskin skin injury repairing
2) (mean value ± SD)
0 day 5 days 7 days 10 days 14 days A, (SD-Ag) 2.5 1.86 ± 0.45 1.54 ± 0.52 0.62 ± 0.35 0.17 ± 0.09B, (FGF-2) 2.5 0.69 ± 0.41 0.54 ± 0.52 0.08 ± 0.06 0.00C, (FGF-2m) 2.5 0.82 ± 0.29 0.50 ± 0.32 0.32 ± 0.40 0.02 ± 0.02D, (negative control) 2.5 2.25 ± 0.33 1.74 ± 0.14 0.92 ± 0.29 ± 0.03
Callus is observed down in opticmicroscope after HE dyeing, as seen uses the surface of a wound of bFGF-2 (B group) and FGF-2m (C group) treatment to begin to have tangible capillary vessel plumule growth in the 3rd day, and the inoblast number increases and active growth.The difference of these histologic characteristicses and two control groups is very remarkable in the time of the 7th day.As seen 7-14 days B group and C organize all new epithelize and hair follicle growth.In addition, collegen filament and spandex fiber content are significantly higher than control group in the surface of a wound granulation tissue of particular tissues dyeing demonstration FGF-2 treatment group.
Claims (22)
1. produce with the fused protein form, have the active polypeptide of fibroblast growth factor or its function equivalent.
2. according to the polypeptide of claim 1, it has aminoacid sequence as shown in Figure 1.
3. according to the polypeptide of claim 1, it comprises the aminoacid sequence of complete people or ox bFGF-2 in fact, and being connected with about 17 amino acid whose nonstructural proteins sequences at N end, said nonstructural proteins sequence is by the partial sequence coding that is used for starting at prokaryotic hosts the LacZ gene of expressing.
4. according to the polypeptide with the generation of fused protein form of claim 1, it has the iso-electric point of molecular weight and the about 9.3-9.6 of about 18.5KD.
5. the analog that has the people bFGF-2 of aminoacid sequence as shown in Figure 3.
6. according to the analog of the people FGF-2 of claim 5, this analog is to obtain by the dna encoding sequence of wild-type FGF-2 is carried out site-directed mutagenesis.
7. produce the method with peptide more than the fibroblast growth factor activity, this method comprises:
(1) obtains being encoded into the dna sequence dna of fibroblast growth factor-2;
(2) said dna sequence dna is suitably modified;
(3) will be connected with suitable expression through the dna sequence dna of modifying;
(4) transform suitable prokaryotic hosts and screen the recombinant cell that is transformed with resulting recombinant expression vector;
(5) cultivate saidly under the said condition with peptide more than the fibroblast growth factor activity being suitable for expressing, and from substratum and product of cell lysis, separates and the said polypeptide of purifying by cell transformed.
8. according to the method for claim 7, wherein said dna sequence dna is as Fig. 1 or Fig. 2 or dna sequence dna shown in Figure 3.
9. according to the method for claim 7, wherein said modification is a codon of the codon of the 121st Serine of coding ox FGF-2 being changed into the coding Threonine, and the codon of the 137th proline(Pro) of ox FGF-2 of will encoding is changed into the codon of encoding serine.
10. according to the method for claim 7, wherein said modification is a codon of the codon of coding people FGF-2 the 78th and 96 halfcystines being changed into the coding basic aminoacids.
11. according to the method for claim 10, wherein said basic aminoacids is arginine or Methionin.
12. according to the method for claim 7, wherein said clonal expression carrier is PUC18 or PKK-123-33.
13. according to the method for claim 7, wherein said prokaryotic hosts is intestinal bacteria.
14. contain the pharmaceutical composition of people FGF-2 or its analog and other ancillary components and pharmaceutically acceptable carrier or vehicle.
15. pharmaceutical composition according to claim 14, wherein remove people FGF-2 or its similar beyond the region of objective existence contain as the primary activity composition, also can contain and be selected from Urogastron, brain derived nerve growth factor and one or more other somatomedins of nerve growth factor.
16., wherein also can contain one or more ancillary components that choosing has self stabilization agent, active protein protective material, skin penetrant, free-radical scavengers and proteinase inhibitor according to the pharmaceutical composition of claim 14.
17. according to the pharmaceutical composition of claim 14, wherein said stablizer selects polyoxyethylene glycol, carboxymethyl cellulose, xitix, sulfated polysaccharide, heparin, poly-lysine and gsh, polyvalent alcohol.
18. according to the pharmaceutical composition of claim 16, wherein said active protein protective material is selected from human serum albumin, low molecular weight peptide, amino acid and metallic cation.
19. according to the pharmaceutical composition of claim 16, wherein said skin penetrant is selected from tall and erect laurocapram or derivatives thereof and dimethyl sulfoxide (DMSO).
20. the application of pharmaceutical composition in the treated tissue damage according to claim 14.
21. according to the application of claim 20, wherein said tissue injury is the damage of skin histology, muscle tissue, mucosal tissue, nervous tissue or osseous tissue.
22. according to the application of the pharmaceutical composition of claim 14 as Derma-Guard.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN96114279A CN1065875C (en) | 1996-12-27 | 1996-12-27 | Fibrillating cell growth factor-2 analogue and its production method and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN96114279A CN1065875C (en) | 1996-12-27 | 1996-12-27 | Fibrillating cell growth factor-2 analogue and its production method and use |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 00117394 Division CN1232532C (en) | 1996-12-27 | 1996-12-27 | Fibroblast growth factor-2 analogue, producing process and application thereof |
| CNA001173936A Division CN1500809A (en) | 1996-12-27 | 1996-12-27 | Fibroblast growth factor-2 analogue, producing process and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1160721A true CN1160721A (en) | 1997-10-01 |
| CN1065875C CN1065875C (en) | 2001-05-16 |
Family
ID=5122046
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN96114279A Expired - Fee Related CN1065875C (en) | 1996-12-27 | 1996-12-27 | Fibrillating cell growth factor-2 analogue and its production method and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1065875C (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1295332C (en) * | 2003-04-03 | 2007-01-17 | 暨南大学 | Recombination human alkaline fiber forming cell growth factor gene and its nonfusion expression product, production method and application |
| US7759309B2 (en) * | 2006-05-19 | 2010-07-20 | Yanming Wang | Use of polypeptides in treating tissue injury |
| CN105294851A (en) * | 2015-12-07 | 2016-02-03 | 中国科学院长春应用化学研究所 | Basic fibroblast growth factor (bFGF) specifically bound with chitin as well as coding gene, preparation method and application thereof |
| CN106361405A (en) * | 2016-10-09 | 2017-02-01 | 上海岐华医疗科技有限公司 | Improved ultrasonic surgical operation system |
| CN112266483A (en) * | 2020-12-22 | 2021-01-26 | 天津力博生物科技有限公司 | Side chain modified polyamino acid and preparation method and application thereof |
| CN114965839A (en) * | 2022-05-11 | 2022-08-30 | 朗肽生物制药股份有限公司 | Peptide map analysis method of human basic fibroblast growth factor |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5491220A (en) * | 1993-09-24 | 1996-02-13 | Yeda Research And Development Co., Ltd. | Surface loop structural analogues of fibroblast growth factors |
-
1996
- 1996-12-27 CN CN96114279A patent/CN1065875C/en not_active Expired - Fee Related
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1295332C (en) * | 2003-04-03 | 2007-01-17 | 暨南大学 | Recombination human alkaline fiber forming cell growth factor gene and its nonfusion expression product, production method and application |
| US7759309B2 (en) * | 2006-05-19 | 2010-07-20 | Yanming Wang | Use of polypeptides in treating tissue injury |
| CN105294851A (en) * | 2015-12-07 | 2016-02-03 | 中国科学院长春应用化学研究所 | Basic fibroblast growth factor (bFGF) specifically bound with chitin as well as coding gene, preparation method and application thereof |
| CN105294851B (en) * | 2015-12-07 | 2019-02-12 | 中国科学院长春应用化学研究所 | With the basic fibroblast growth factor and its encoding gene of chitin specific bond, preparation method and application |
| CN106361405A (en) * | 2016-10-09 | 2017-02-01 | 上海岐华医疗科技有限公司 | Improved ultrasonic surgical operation system |
| CN112266483A (en) * | 2020-12-22 | 2021-01-26 | 天津力博生物科技有限公司 | Side chain modified polyamino acid and preparation method and application thereof |
| CN114965839A (en) * | 2022-05-11 | 2022-08-30 | 朗肽生物制药股份有限公司 | Peptide map analysis method of human basic fibroblast growth factor |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1065875C (en) | 2001-05-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111944057B (en) | Recombinant human collagen peptide and application thereof | |
| AU704515B2 (en) | Novel protein and process for producing the same | |
| CA2005502C (en) | Somatotropin analogs | |
| CN1191491A (en) | Connective tissue growth factor | |
| JPH04505151A (en) | bone morphogenetic factors | |
| CN86106915A (en) | Nucleic acid encoding inhibin alpha or beta chain and method for synthesizing polypeptide using the same | |
| CN101062952B (en) | Fusion protein comprised of human serum and interferon and its coding gene and application | |
| KR20020047208A (en) | Fibrinolytically active polypeptide | |
| JPH01501361A (en) | Production of new T cell suppressor factors and their uses | |
| JPH06253850A (en) | Heparin-binding neurotrophic factor gene sequence | |
| CN1065875C (en) | Fibrillating cell growth factor-2 analogue and its production method and use | |
| CN1232532C (en) | Fibroblast growth factor-2 analogue, producing process and application thereof | |
| CN1323167C (en) | Muteins of placental growth factor type 1, preparation method and application thereof | |
| CN1865286A (en) | Double function epidermal growth factor and its preparation method and uses | |
| CN108840950A (en) | A kind of fusion protein and preparation method thereof being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha | |
| CN1500809A (en) | Fibroblast growth factor-2 analogue, producing process and application thereof | |
| US5444157A (en) | Chondromodulin-I protein | |
| EP0473080B1 (en) | Chondromodulin-I protein | |
| CN1323715C (en) | Application of c-ski gene and polypeptide thereof in preparation of medicine for promoting tissue repair and relieving scar formation | |
| CN1966529A (en) | Recombinant toxin agent containing gonadorelin and pyocyanin functional frament | |
| JPS62501071A (en) | Novel polypeptides with growth factor activity and nucleic acid sequences encoding the polypeptides | |
| CN117510619B (en) | Recombinant III-type humanized collagen microsphere with innovative spatial structure and design, preparation process and application thereof | |
| CN1310949C (en) | Bifunctional chimeric profein possessing inhibiting leucocyte function and thrombin activity | |
| CN109689079A (en) | Ketoacidosis in bovine fibroblasts growth factor-2 1 and milk animal | |
| CN1769299A (en) | Novel fusion protein production and uses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20010516 Termination date: 20100127 |