CN1500809A

CN1500809A - Fibroblast growth factor-2 analogue, producing process and application thereof

Info

Publication number: CN1500809A
Application number: CNA001173936A
Authority: CN
Inventors: 剑林; 林剑; 赵利淦; 刘小青
Original assignee: BIOLOGICAL ENGINEERING INST JINAN UNIV
Current assignee: BIOLOGICAL ENGINEERING INST JINAN UNIV
Priority date: 1996-12-27
Filing date: 1996-12-27
Publication date: 2004-06-02

Abstract

The present invention provides structural analogs of fibroblast growth factor-2 and its production process, medicinal composition containing these structural analogs and pharmaceutically acceptable carrier or excipient, and the application of the composition in treating tissue damage. Compared with natural human FGF-2, the FGF-2 structural analogs of the present invention has higher storage stability and higher temperature and pH tolerance.

Description

The fibroblast growth factor-2 analogue thing, its production method and application

The present invention relates to fibroblast growth factor-2 analogue thing and production method thereof, contain the pharmaceutical composition of these analogues and pharmaceutically acceptable carrier or vehicle, and the application of said composition in the treated tissue damage.

Polypeptide growth factor is the hormonelike conditioning agent of cell proliferation and differentiation.From various tissues and cell, separated and identified many somatomedins, comprising but be not only limited to Urogastron, platelet-derived somatomedin, nerve growth factor, hematopoietic cell growth factor and fibroblast growth factor.

Fibroblast growth factor (FGF) is as BALB/c 3T3 cell being had the factor of growth-promoting activity, isolating from ox pituitary gland tissue (D.Gospodarowicz, Nature 249:123,1974) at first.This molecule is to acid and temperature sensitive, and has high (alkalescence) iso-electric point.Found from brain isolating mitogenic factor afterwards with isolating different from pituitary gland before this, thereby have similar biologic activity based on them and be called acid and basic FGF (being aFGF and bFGF) with different iso-electric points.AFGF and bFGF are the members of relevant at least 8 kinds of structures, as to have heparin affinity molecule family, they can optionally excite the biologically of the many cells that comprise mesoblastema and neuroderm cell, and these cells comprise endotheliocyte, smooth muscle cell, adrenal cortical cell, sarcoplast and scleroblast.Active and identified the member of other 7 FGF families based on the adjusting of on cell proliferation and differentiation with the sequence homology of FGF, comprising hst/k and int oncogene, and be called the preceding proto-oncogene of FGF-5.As original FGF family member, now acidity and basic FGF are called FGF-1 and FGF-2, this specification sheets hereinafter is called FGF-2 with Prostatropin.

Except stimulate cell growth, FGF also can stimulate the cell of many types in non-mitotic division mode different reactions to take place, for example promote cell to injury migration (chemokine activity), new vasculogenesis, adjusting nerve degeneration and viability (neurotrophic activity), endocrine regulation function and stimulation or the (Baird such as inhibition specific cell protein expression, extracellular matrix generation and cell survival of promotion, A.and Bohler, P., Handbook of Exp.Pharmacol., 95 (1): 369-418,1990).These character provide the foundation for using the FGF preparation to be used for the medicine of accelerating wound healing, nervous tissue reparation, prevention and treatment brain and myocardial ischaemia (collateral blood vessels generation).

Ox FGF-2 (bFGF-2) has 154 amino acid whose polypeptide.People FGF-2 (hFGF-2) is different from bFGF-2 and is that its 121st amino acids is Threonine (Thr) rather than Serine (Ser), and the 137th amino acids is Serine (Ser) rather than proline(Pro) (Pro).People or ox FGF-2 molecule can comprise 7-11 amino acid whose N-terminal extension, also can be to lack one or more at N-terminal, about 4-30 amino acid for example, and still keep the molecule of its biologic activity.These facts have embodied the unhomogeneity of FGF molecule N-terminal.

People such as J.A.Abraham (Science 233:545-548,1986; EMBOJ., 5:2523-2528,1986) nucleotide sequence of at first having cloned ox/people FGF-2.Continue after many researchs in, in order further to understand FGF molecular structure and function relationship, the relation of precursor and product, and the receptor-binding characteristic of molecule and three-D space structure are (referring to Eriksson, E.A.et al., Proc.Natl.Acad.Sci.USA 88:3441-3445,1991; Zhu, H.et al., Science251:90-93, and United States Patent (USP) 5,491,220) carried out extensive work.

In order to improve the receptors bind specificity of wild-type FGF molecule, and further therefrom screening be suitable for varient as FGF functional antagonist or agonist, perhaps expectation obtains being suitable for as the anti-polymeric of medicinal application and/or the varient of stabilization, preparation and disclose many FGF mutant or analog on the basis of basic research work (for example referring to United States Patent (USP) 5,175,147,5,288,704 and European patent application EP-A 281,822 and UK Patent Application 8821795.5).Japanese patent application publication No. JP231428/86 (being equivalent to Chinese patent application publication number CN101486A) discloses the use side-directed mutagenesis and respectively sophisticated rh-bFGF (hFGF-2) sequence the 69th and 87 s' halfcystine has been changed into Serine, forms and the multimerization effect in the hope of stoping intermolecular disulfide bond.In addition, document has also been reported with Serine and has been replaced the method (Science224:1431,1984) of specific cysteine residues to help preventing intermolecular polymerization among the human interleukin 2 (IL-2).Yet, Serine is a kind of thricarbon atom amino acid that does not have amino group, so be difficult to use some polysaccharide or Mierocrystalline cellulose or polyoxyethylene glycol to combine, so that prevent the molecule multimerization and improve its stability in the aqueous solution and in recipient's body fluid with the amino reactive group of biologically active polypeptides molecule.For this reason, the someone proposes to comprise that the one or more Methionins in the biologically active polypeptides molecule of G-CSF and erythropoietin change over other amino acid, is beneficial to the Pegylation (United States Patent (USP) 4,904,584) of molecule.

On the other hand, though many bibliographical informations in the method for expression in escherichia coli hFGF-2 mutein, for the required expression product of separation and purification from the intestinal bacteria inclusion body, often cause the product inactivation because of adding strong protein denaturant.Research work in the past shows, no matter FGF-2 is under solution state or under the lyophilize state as many protein that other obtain with recombinant technology, all is easy to lower or loss of activity.Therefore, reduce the formation number of inclusion body in prokaryotic cell prokaryocyte or the yeast host body as much as possible, and the yield of product is this area problem demanding prompt solution in the increase soluble fractions.Though people (Journal of Molecular Biology 189:113-130 such as Studier F.M., 1983) at first find to utilize the T7 promotor can help improving expression level, but expression product lacks enough biologic activity (Paris, N.et al., Biotechology and Applied Biochemistry 12:436-449,1990).In addition, in the early stage research work that carry out in our laboratory, find, the combination order that combines amount of rigidity and employed chromatography column of FGF molecule and heparin sulfate, to separate and purifying host cell soluble fractions in the yield tool of expression product have a significant impact.

The inventor has cloned the dna sequence dna that coding has peptide more than the bFGF-2 activity from the ox pituitary gland, and has successfully expressed said polypeptide in escherichia coli host.This polypeptide product is expressed with partial sequence (about 17 amino acid) " fusion " proteinic form that N end upstream is connected with LacZ α.On this basis, again through the fixed point induced mutations, the 121st Serine and the 137th proline(Pro) codon in the bFGF-2 encoding sequence are changed into Threonine and Serine codon respectively, and the sequence of the non-FGF structure gene in N-terminal upstream of deletion bFGF-2 dna encoding sequence, thereby obtain the hFGF-2 that encodes) dna sequence dna, and in prokaryotic hosts high level expression hFGF-2.In order further to improve hFGF and sulfated polysaccharide bonded ability and stability, improve the ability of its antagonism intermolecular polymerization, and to low pH and hot tolerance, the present invention has carried out the site-specific sex modification on the gene level to the primary structure of hFGF-2, with other amino acid except that halfcystine, better be to replace the halfcystine that is exposed to the FGF-2 molecular surface, obtain the analog (the following FGF-2m that is called for short sometimes) of hFGF-2 with arginine.The result shows through preliminary experiment, and this analogue has preferably sulfated polysaccharide in conjunction with rigidity, and to the tolerance of low pH and heat.

Therefore, an object of the present invention is to provide and a kind ofly form to produce with fused protein, have the active polypeptide of fibroblast growth factor, this polypeptide has as Fig. 1 or aminoacid sequence shown in Figure 2.

This purpose embodiment according to the present invention, wherein said fused protein comprises the aminoacid sequence of complete in fact people or ox FGF-2, and be connected with about 17 amino acid whose non-FGF-2 structural protein sequences at its N end, said nonstructural proteins sequence is to be encoded by the partial sequence of the LacZ α peptide gene that is used for expressing in the prokaryotic hosts startup, it helps the initial of FGF-2 translation, improves the expression efficiency of active FGF-2 in the soluble fractions.

The hFGF-2 of the fused protein form of this purpose according to the present invention, it has the molecular weight of about 18.5KD, and iso-electric point is about 9.3-9.6.

The hFGF-2 of the fused protein form of this purpose according to the present invention, this protein obtain by the dna encoding sequence of corresponding bFGF-2 is carried out site-specific mutagenesis.

A further object of the present invention provides analog or the varient (FGF-2m) of a kind of hFGF-2, and this analogue has aminoacid sequence as shown in Figure 3.Specifically, this analogue is compared with natural hFGF-2, and particularly arginine or Methionin replace by basic aminoacids respectively to be positioned at two halfcystines on the 78th and 96 of its molecule three-D space structure expose portion.

A further object of the present invention provides produces the method with peptide more than the fibroblast growth promoting activity, and this method comprises:

(1) obtain the encoding dna sequence dna of active polypeptide with fibroblast growth factor-2;

(2) said dna sequence dna is suitably modified;

(3) will be connected with suitable expression through the dna sequence dna of modifying;

(4) transform suitable prokaryotic hosts and screen the recombinant cell that is transformed with the recombinant expression vector that obtains;

(5) cultivate saidly under the said condition with peptide more than the fibroblast growth factor activity being suitable for expressing, and from substratum and cellular lysate, separates and the said polypeptide of purifying by cell transformed.

This purpose preferred embodiment according to the present invention, wherein said dna sequence dna is a dna sequence dna shown in Figure 1.

According to an embodiment of this purpose of the present invention, wherein said modification to the dna encoding sequence is the sequence of the non-FGF structure gene in the terminal upstream of dna encoding sequence of N of deletion bFGF-2.

This purpose embodiment according to the present invention, wherein said modification to the dna encoding sequence be will encode respectively the codon of the 121st Serine of ox FGF-2 change into the coding Threonine codon, and the codon of bFGF-2 the 137th proline(Pro) of will encoding changes into the codon of encoding serine, thereby obtains dna sequence dna as shown in Figure 2.

Another embodiment of this purpose according to the present invention, wherein said modification to the dna encoding sequence is a codon of the codon of the 78th and 96 halfcystine of coding human fibroblastic growth factor-2 being changed into the coding basic aminoacids, the codon of particularly encode arginine or Methionin.

According to this preferred embodiment of this purpose of the present invention, the dna sequence dna of wherein said coding FGF-2 analog has dna sequence dna as shown in Figure 3.

The preferred embodiment of this purpose according to the present invention, wherein said clonal expression carrier is pUC18 and pKK123-33.

Another preferred embodiment of this purpose according to the present invention, wherein said prokaryotic hosts is intestinal bacteria.

A further object of the present invention provides and contains the present invention and have the active polypeptide of human fibroblastic growth factor-2 and the pharmaceutically acceptable carrier or the pharmaceutical composition of vehicle.

This purpose preferred embodiment according to the present invention, wherein remove people FGF-2 or its similar beyond the region of objective existence, also can contain and be selected from Urogastron, brain derived nerve growth factor and one or more other somatomedins of nerve growth factor as the primary activity composition.

This purpose preferred embodiment according to the present invention, wherein said pharmaceutical composition also can contain one or more ancillary components that are selected from stablizer, active protein protective material, skin penetrant and free-radical scavengers.

According to this preferred embodiment, wherein said stablizer comprises but is not only limited to the gsh of polyoxyethylene glycol, carboxymethyl cellulose, sulfated polysaccharide, T 500.

According to this preferred embodiment, wherein said active protein protective material comprises but is not only limited to human serum albumin, low molecular weight peptide, amino acid and metallic cation.And wherein preferred amino acids is glycine, Serine or Methionin, and preferred metallic cation is Zn ²⁺, Mn ²⁺, Mg ²⁺And Cu ²⁺

According to this preferred version, wherein said skin penetrant comprises but is not only limited to dimethyl sulfoxide (DMSO) or tall and erect laurocapram, and said free-radical scavengers comprises but is not only limited to superoxide-dismutase and derivative thereof.

A further object of the present invention relates to the polypeptide with human fibroblastic growth stimulating activity for preparing by the inventive method and contains the application of pharmaceutical composition in prevention or treated tissue damage of this polypeptide.

The preferred embodiment of this purpose according to the present invention, wherein the tissue of said damaged can be skin histology, muscle tissue, mucosal tissue, nervous tissue or osseous tissue.

The dna sequence dna of Fig. 1 code displaying bFGF-2 reaches the amino acid sequence corresponding by its coding.Wherein nucleotide position 1 to 51 is the nucleotide sequence of the part of coding intestinal bacteria LacZ α peptide, and underscore indicates not existing together of people and ox FGF-2 sequence; And wherein nucleotide position 52 to 516 districts are the nucleotide sequence of coding ox FGF-2.

The dna sequence dna of Fig. 2 code displaying hFGF-2 reaches the aminoacid sequence by the corresponding hFGF-2 of this dna sequence encoding.

The dna sequence dna of Fig. 3 code displaying hFGF-2 analog reaches the amino acid sequence corresponding by this dna sequence encoding.

Fig. 4 shows the structure of recombinant expression plasmid pUC18-bFGF-2.

Fig. 5 shows the structure of recombinant plasmid M13mp19-bFGF-2.

Fig. 6 shows the structure of recombinant plasmid M13mp19-hFGF-2.

Fig. 7 shows the structure of recombinant expression vector pUC18-hFGF-2.

Fig. 8 shows the structure of recombinant expression vector pUC18-bFGF-2m.

Fig. 9 shows the structure of recombinant expression vector pUC18-hFGF-2m.

Figure 10 shows the structure of recombinant expression plasmid pKK-bFGF-2.

Figure 11 shows the structure of recombinant expression plasmid pKK-hFGF-2.

Figure 12 shows the structure of recombinant expression plasmid pKK-bFGF-2m.

Figure 13 shows the structure of recombinant expression plasmid pKK-hFGF-2m.

Figure 14 is presented under the non-reduced condition, to the result who analyzes according to the FGF-2 and the sodium dodecyl sulfate-polyacrylamide gel electrophoresis that analog is done (SDS-PAGE) thereof of the inventive method preparation.Wherein

swimming lane

1 and 2 shows the expression product that obtains from transformant pUC18-hFGF-2m and pKK-hFGF-2m respectively, swimming lane 4-7 shows that respectively swimming lane 3 shows the protein molecular weight standard product from the rhFGF-2 standard substance of the protein expression product of transformant pKK-hFGF-2, pKK-bFGF-2m, pKK-bFGF-2m purifying and the production of Promega company.

Figure 15 shows that the FGF-2 that uses behind the purifying and mutating molecule (FGF-2m) thereof and mouse-anti people FGF-2 monoclonal antibody make the result of Western engram analysis.Wherein swimming lane 1-4 is respectively from recombinant chou pKK-hFGF-2m, pKK-hFGF-2m, pKK-bFGF-2, pKK-hFGF-2 expressed protein product, swimming lane 5 is rhbFGF standard substance (productions of Promage company), and swimming lane 6 is a recombinant chou PUC18-hFGF-2m expressed protein product.

Figure 16 show with ³The FGF-2 analog of the present invention that the H method of mixing detects is to the tolerance of low pH value.

Figure 17 show with ³The FGF-2 analog of the present invention that the H method of mixing detects is to the tolerance of the temperature of rising.

The invention provides new, have metastable hFGF-2 activity Polypeptide is characterized in that in this polypeptide amino acid primary structure the 78th and Cysteine on 96 is selected from respectively the alkaline ammonia of arginine or lysine Base acid replaces. After so replacing, can prevent in the molecule on the one hand And/or intermolecular disulfide formation, on the other hand can be for to the FGF-2 molecule Carrying out the modification of Pegylation homogeneous provides condition, thereby greatly improves DNA Active retention time and the stability of recombinant expressed protein. Below retouch in detail State the preferred embodiments of the invention.

In order to prepare FGF-2 of the present invention and its analogue, at first use this The method that those skilled in the art know prepares from ox or human brain pituitary tissue always RNA is further purified with the oligo-dT cellulose then and makes mRNA. Close The oligo DNA fragment of one-tenth and the complementation of FGF-2 mRNA 3 ' end parts sequence, Take mRNA as template, under the catalytic action of reverse transcriptase, prepare bFGF-2 Article one cDNA chain. Then take article one cDNA chain as template, logical Cross the double-stranded DNA of conventional pcr amplification technology preparation coding bFGF-2. Select suitable cloning vector, such as DNA (such as pUC18 or pUC19) Or bacteriophage double-stranded DNA (such as M13 bacteriophage series) or phagemid dna (as Bluescript, pGEM, pUC118 or pUC119), flat terminal through producing After restriction enzyme (such as HincII or the SmaI) digestion, connect at T4 DNA Meet the DNA that under the effect of enzyme pcr amplification is obtained and be connected to selected year On the body. Pass through CaCl₂The conventional methods such as mediation or electroporation will connect product Import in the e. coli host cell, containing Amp, IPTG, X-Gal then The LB culture medium (0.1% tryptone, 0.05% yeast extract, 0.1%NaCl, pH7.2) plate on cultivate, obtain corresponding bacterium colony or bite Spot. Resulting white colony or water white transparency plaque are transferred to cellulose nitrate On plain film or the nylon membrane, it is carried out degenerative treatments so that DNA is fixed on film On. Containing then³²(preferred probe sequence is for reaching for the probe of P mark 60bp and with the dna fragmentation of bFGF-2 coded sequence complete complementary) solution Middle this filter membrane of insulation is with the DNA on the formation film and the crossbred between the probe. For example can (1 * SSC be with 8.77g NaCL and 4.41g containing 6 * SSC Natrium citricum is dissolved in 1 premium on currency and makes), 1%SDS, 100 μ g/ml salmon sperm DNAs and 5 * Denhardt ' s reagent (contain 0.1% Bovine serum albumin(BSA), each 0.1% polyvinylpyrrolidone and FicoII) solution In, in 65 ℃ DNA and Probe Hybridization on the film are spent the night. After the hybridization, wash Fall the part of non-specific adsorption, carry out then autoradiograph, with identify with Probe forms the clone of crossbred. Repeat this step until obtain single Form the clone of molecular hyridization body. With Restriction Enzyme Nco I digestion screening by hybridization The recombinant DNA that arrives, and resulting digestion product carried out electrophoretic analysis, Big with the fragment of determining to be inserted with foreign DNA and known bFGF-2 cDNA Little in full accord.

Measure then the base sequence of the gene that so obtains, whether to confirm it To have more than the bFGF-2 activity gene of peptide identical with the coding of expection. Using in the situation of Escherichia coli as host cell, can use conventional method Extraction and resultant with Restriction Enzyme digestion from the recombinant Bacillus coli cells Plasmid, separate wherein Insert Fragment and with its subclone to the M13 phagocytosis In the body carrier (preferred carrier is M13mp19 among the present invention), use then The people's such as Sanger dideoxy chain termination (T.Maniatis et al., Molecular Cloning, A laboratory Manual, 2nd ed., Chapter 13, Cold Spring Harbor Laboratory Press, 1989) measure the sheet that is inserted into The base sequence of section. Can be with the base sequence of the gene that so obtains and required Coding have gene (referring to Fig. 2 and the 3) alkali of peptide more than the bFGF-2 activity Basic sequence is compared, and is identical with both sequences of further confirmation. If The gene that obtains and the sequence of report (J.A.Abraham et al., Science, 233:545-548,1986) variant, such as the disappearance of partial sequence or missense is arranged Sudden change or nonsense mutation can be synthetic corresponding according to the known array of bibliographical information Orientation insert or the direct mutagenesis primer, by containing uracil (U) dna single Chain template (Kunkel et al., Methods Enzymol., 154:367,1987; Kunkel et al., Proc.Natl.Acad.Sci., USA, 82:488,1985) Or PCR sudden change method is correct sequence with the sequence mutagenesis of mistake.

The inventor is on the basis of successfully having cloned the bFGF-2 gene, compared hFGF-2 gene order (J.A.Abraham et al., EMBO J., 5:2523-2528,1986) and the difference between the bFGF-2 gene (seeing Fig. 1) that obtains of clone, according to the described oligonucleotide mediated standby recombinant M13mp19-bFGF-2 that carries the bFGF-2 gene of uracil (U) single-stranded template legal system that contains of the people such as Kunkel, as the single stranded DNA template that contains uracil (U), design and synthesize simultaneously the primer P that the 121st serine of bFGF-2 (TCC) is sported threonine (ACC) with it₁₂₁And the primer P that the 137th proline of bFGF-2 (CCC) is sported serine (TCC)₁₃₇ To make then Contain U template and two mutagenic primer (P₁₂₁And P₁₃₇) together annealing, then At dna polymerase i large fragment (Klenow enzyme) and T4 dna ligase Acting in conjunction under, spend the night in 12 ℃ of lower reactions, and mix with the gained reaction Thing transforms the JM109 competent cell. Detect the mutagenesis Preliminary screening with PCR, And through dna sequence analysis further conclusive evidence selected recombinant be the 121 and the 137th weights that all sported coding hFGF-2 active peptides Group body, i.e. M13mp19-hFGF-2.

The inventor is after successfully having cloned ox/hFGF-2, according to above-mentioned The oligonucleotide mediated U single stranded DNA template that contains is further to FGF-2 ammonia The indivedual amino acid of base in the acid sequence, particularly the 78th sudden and violent with 96 its side chains The cysteine that is exposed at molecule three-D space structure surface has carried out site-specific Sex modification is changed into the alkaline ammonia of coding with the codon of these encoding aminothiopropionic acids Base acid, such as arginine or lysine, rather than similar to cysteine on the structure But not with the codon of the serine of sulfydryl. The preferred basic amino acid of the present invention Be arginine, and preferred codon is the codon that Escherichia coli are had a preference for CGT.

The inventor further also is cloned into required digestion product with strong promoter (lac, tac, trc, T7, P with the T4 dna ligase with suitable digestion with restriction enzyme on the basis of the gene that has successfully prepared ox/hFGF-2 and analogue thereof_R、P _L, lpp etc.) the Escherichia coli height The efficient expression carrier (such as pUC18, pKK223-33, pBV220, pT7-7, pIN-III-OmpA) in. Here answer lay special stress on to be pointed out that, early stage worker of the present invention In the work, the expression product of FGF-2 is that the form that merges prepares, namely Be the ratio of the soluble component that improves expression product and the expression of FGF-2 Amount connects a coding at the upstream of FGF-2 structural gene and is derived from bacterium The sequence of the protein of cell itself. The preferred bacterial cellular protein matter of the present invention Sequence is that the N of LacZ α peptide holds front 17 amino acid sequences. Should be short after the fusion Peptide is little to the biologically active impact of FGF-2. The preferred expression carried for this purpose Body is pUC18.

In addition, in order to simplify purification step, further increase in the soluble part The yield of active peptides product can be at people/bFGF-2 of the present invention or its knot Connect a secretory signal sequence on the N end of structure analogue gene, and at this 5 of burst ' end adds a driving expression product and divides in the cell pericentral siphon The promoter of secreting (for example for example is derived from the Escherichia coli surface membrane protein OmpA), the targeting signal peptide of alkaline phosphatase (pho A) etc.

In addition, the FGF-2 and the knot thereof that for preparation the people are had lower or no antigen The structure analog can be cloned into FGF-2 efficiently with the form of non-fused protein On the expression vector, preferred expression vector be pKK223-3, pBV220, PT7-7 perhaps inserts between fusion sequence and FGF-2 or its analogue Enter corresponding more special protease hydrolytic site, preferred protease hydrolytic position Point is the recognition site of Xa.

What also need point out emphatically is, in order to reduce as much as possible FGF-2 and knot thereof The expression product of structure analog forms the insoluble of no FGF-2 BA The molecule of form can adopt the induced product expression mechanism of non-temperature control. Use suitable inducer or under suitable inductive condition and in lower temperature When inducing down the expression of gene of FGF-2 and analogue thereof, the present invention Preferred inducer is IPTG, and preferred lower temperature is 25-30 ℃. As The promoter that fruit is selected is subjected to responsive to temperature type repressor (such as Clts857) regulation and control, Can adopt λ promoter P_RAnd P_L, improve at a lower temperature the pH value so that resistance Hold back the thing inactivation, transcribe thereby start. In this case, preferred lower temperature Degree is 25-30 ℃, and preferred pH value is 8.5-9.0.

We use the ox of fused protein form of the present invention/hFGF-2 system Become external used medicine, do not find (to contain approximately 17 amino because of the heterologous peptides fragment Acid) cause comprise antigenicity reaction any bad reaction. Cause This expresses ox/people FGF-with the fused protein form or under non-temperature conditions 2 method also will comprise within the scope of the invention.

The hFGF-2 gene or its mutant nucleotide sequence that obtain are inserted into suitable matter Transform suitable host cell in the grain carrier and with resulting recombinant vector. So Afterwards has peptide more than the human fibroblastic growth factor activity being suitable for expressing Under the general conditions, cultivate resulting transformant cell. Ammonia benzyl green grass or young crops can contained The LB culture medium of mycin (0.1% tryptone, 0.05% pure female extract, 0.1%NaCl, pH7.2) in the transformant overnight incubation. Results are thin after cultivating Born of the same parents use the ultrasonic disruption cell, and the soluble part of centrifugal separating cell is also logical Cross cation exchange, heparin is affine and gel permeation chromatography separates with purifying It, the ox/hFGF-2 or its analogue product that so obtain have the sky The BA of right FGF-2, and the purity 95%-99% of product. Ion Exchange Medium of the present invention comprises but is not only limited to CM-Sepharose Fast Flow, SP-Sepharose Fast Flow or Bio-Rex 70 resins, wherein preferably Bio-Rex 70 resins (Bio-Rad life Produce). The affinity chromatography medium that adopts comprises but is not only limited to Heparin-Sepharose CL-6B or Heparin-HyperD (Bio-Rad Co.), but excellent That select is Bio-Rex 70 Resin. The gel filtration medium that adopts comprise but Be not only limited to Sephadex G75, Superdex 75 prep grade, wherein Superdex 75 prep grade (being produced by Pharmacia) preferably.

Can be according to known in the art³The H-thymidine mixes method (Klagsburn et cl., Proc.Natl.Acad.Sci, USA, 82:805-809,1985) or tetrazolium bromide (MTT) decoration method (Armelin HA., Pituitary extracts and steroid hormones in the control of 3T3 cell growth, Proc.Natl.Acad. Sci.USA 70:2702-2706,1973), use the extract of recombination bacillus coli as test specimen, with SI (³The H-TdR infiltration method) or the maximum half propagation of cell concentration (ED₅₀) (MTT decoration method) detect of the present invention The BA of hFGF-2 or its analogue.

Use³H mixes method or tetrazolium bromide (MTT) Determination Staining FGF-2 knot The structure analog under different temperatures and different pH value to BALB/c 3T3 cell Growth stimulating activity, and use as SDS-PAGE, Western Blot, The methods such as HPLC detect its physicochemical property. Found that, FGF-2 is carried out Above-mentioned modification can make the stability of molecule and the ability of antagonism multimerization get With obvious raising, thereby make FGF-2 of the present invention and analogue thereof extensive Be applied to clinical prevention and/or therapeutic purposes become possibility.

In recent years, with regard to FGF-2 molecular structures-functional relationship, particularly three The dimension space structure has carried out grinding in a large number to the impact of FGF-2 Activity and stabill Study carefully. The many FGF-2 molecule primary structure branches that for example carry out from the eighties Analyse and shown the not diversity of terminal amino acid sequence of N. Also have simultaneously many researchs The person is to being in half Guang ammonia on the surperficial exposure position in the FGF three-D space structure Acid lacks some fragment in the impact of the stability of molecule and multimerization, the molecule Mistake is to enhancing or abated effect and the molecular surface ring of its BA One or more amino acid whose replacements are to molecule in (surface loop) zone Many deep researchs have been carried out in the impact of Pegylation effect etc. These grind Study carefully for will finding to many tissues particularly the nerve fiber cell is had life The FGF of long facilitation is used for the clinical treatment purpose provides foundation.

The inventor is after successfully having cloned ox/hFGF-2, and is further right Indivedual propylhomoserin acid in the FGF-2 amino acid order, particularly the 78th and 96 The cysteine that its side chain is exposed to molecule three-D space structure surface has carried out The site-specific sex modification, it is amino that these cysteines are changed into respectively alkalescence Acid such as arginine or lysine, rather than is changed on the structure and cysteine Similar but not with the serine of sulfydryl. The result is surprisingly found out that, to FGF-2 Carrying out such modification gets the stability of molecule and the ability of antagonism multimerization With obvious raising, thus further strengthened we with FGF-2 of the present invention and Its analogue is widely used in the letter of clinical prevention and/or therapeutic purposes The heart.

In addition, the inventor also to the separation of FGF-2 and analogue thereof with Purifying has carried out useful improvement. It is various normal to unite by different way use The rule chromatographic technique from the transformant cell cultivated and/or culture medium purifying this Bright polypeptide or its analogue with FGF-2 activity. For example can be in fragmentation The required polypeptide of dissolving behind the cell, chromatographic purifying is required from molten born of the same parents' thing then The purpose product. Employed chromatography method comprises but is not only limited to ion exchange layer Analyse, hydrophobic interaction chromatography, gel permeation chromatography and affinity chromatography. Wherein Affinity chromatography comprises but is not only limited to for example parent that closes of copper or zinc chrome of metal ion With column chromatography with combine the heparin sulfate that FGF-2 is had high affinity The Sepharose column chromatography.

Being used for hydrophobic chromatography medium of the present invention and being can covalently bound just (different) The agarose resin of butyl, octyl and phenyl etc., for example can be available from The Butyl Sepharose Phenyl Sepharose of Phamacia Co.Sweden CL-4B etc. Can use methods known in the art to pass through 1-chloro-2, the 3-epoxy Propane or 2,3-dibromo-propanol are as spacerarm, with above-mentioned group covalent bond To the Sepharose solid-phase matrix. Separating with hydrophobic interaction chromatography When FGF-2 or its analogue, degree or the gradient elution such as can use, but Better be to use to be selected from phosphate buffer, Tris-HCl buffer solution, nitrate The gradient buffer salting liquid of buffer solution carries out with 50-600cm/ hour flow velocity Wash-out. The concentration gradient of using is generally 3.5-0M, the pH model of eluent Enclose and be 6-9. In addition, hydrophobic interaction chromatography also can use other types Solid-phase matrix, for example Sephadex microcrystalline cellulose or other inorganic rigids Matrix. Employed aglucon also can be polyethylene glycol and with other of polyether key The solid-phase matrix of type.

For carrying out the metal complex affinity chromatography, can use coupling that Zn is arranged²⁺、 Cu ²⁺、Fe ³⁺、Mn ²⁺Deng the solid-phase resin of metal ion, but better be coupling Zn²⁺Sepharose or Sephadex carboxymethyl cellulose resin column (for example available from Pharmacia Co., the Chelating Sepharose of Sweden Fast Flow). Can be under about pH7-9 condition, with about 250-370cm/ Hour flow velocity select and take off. Can use the wash-out that contains the NaCl concentration gradient Liquid carries out wash-out.

Most important chromatography substrate for separating of FGF-2 is to carry covalent cross-linking Sulfated polysaccharide, or agarose, glucan or cellulosic matrix are for example produced Product Sepharose-CL 6B by name or Sepharose 6 Fast Flow, or available from The affinity chromatography resin of Cellulofine. Available NaCl gradient eluent is washed Take off. We use hydrophobic interaction chromatography-metal complex affinity layer successively Analyse-the sulfated polysaccharide affinity chromatography purification is by the FGF-2 of the inventive method preparation Or its analogue, product purity reaches more than 98%.

In some expression system, expressed FGF-2 or its analog are heavy To gather with the formation of insolubility occlusion body in the group body cell. In this feelings Under the condition, after can dissolving in recovery and with gentle denaturant (for example urea), Remove denaturant immediately so that FGF-2 or its analogue fold also again Recover its original activity, and then basically carry out the chromatography branch by preceding method From, to obtain having the polypeptide of required activity.

The invention further relates to the drug regimen that contains FGF-2 or FGF-2m Thing prepares the method for this pharmaceutical composition, and this pharmaceutical composition is in treatment Use in the tissue damage. Can use according to the method for the invention preparation FGF or FGF-2m are as main component, with pharmaceutically acceptable excipient Or diluent, and other auxiliary elements mix mutually, make to be suitable for clinical treatment The pharmaceutical composition of using. Can incite somebody to action according to the known method in medical industry field Pharmaceutical composition of the present invention is mixed with and can supplies intravenous, interior, the abdominal cavity of muscle In, the parenteral solution of myelencephalon intracavitary administration, perhaps be suitable for the sheet of oral administration Agent, solution, and the spray, emulsion, ointment, the suspension that are suitable for external application Agent or suppository.

It is during the solution of administration, employed auxiliary outside preparation is suitable for intestines and stomach The furtherance branch can comprise diluent or excipient, such as can use sterilized water, etc. Ooze NaCl or sucrose solution or low concentration (for example 1-10mM) PBS as rare Release agent and excipient. Can use ascorbic acid as antioxidant, use choosing From human serum albumins, low molecular weight peptide, amino acid for example glycine or the silk ammonia Acid or lysine and metal cation be Zn for example²⁺、Mn ²⁺、Mg ²⁺Or Cu²⁺One or more materials as the reactive protein protective agent. Can be through cold Freeze-drying is dry, and pharmaceutical composition of the present invention is made freeze-dried powder, adds during use Entering diluent again prepares and uses as early as possible it. Particularly of the present invention in use In the situation of FGF analogue as the primary activity composition, can use choosing Rely ammonia from polyethylene glycol, carboxymethyl cellulose, sulfated polysaccharide, heparin, poly The macromolecular compounds such as acid, and can with the FGF molecule in cysteine form The glutathione of disulfide bond is as stabilizing agent, in order to prevent that the FGF molecule is at solution In or degraded rapidly in patient's blood flow, or the molecule poly took place between the storage life Change and reduce or lose its BA. Be suitable for the sheet of oral administration in preparation When agent, powder agent or microcapsule formulations, can use sucrose, galactolipin, corn Starch, gelatin, microcrystalline cellulose etc. are as excipient, and are in addition wherein all right Add protease inhibitors. Can use method known in the pharmaceuticals industry and auxiliary Furtherance divides the preparation microcapsules, or the liposomes enclose agent.

In the situation of local topical, preferably FGF analog of the present invention is added In water-bearing media, with above-mentioned various suitable auxiliary elements and suitable skin Bleeding agent mixes, and makes spray by known method. Preparation during spray Good use can form diaphragm and have stable merit at skin or wound surface The matrix components of energy. In addition, also the present invention can be contained FGF-2 or its knot The pharmaceutical composition of structure analog is added in necessary base known in the cosmetics industry Make Derma-Guard in the matter, for example make emulsion, creme, lotion, facial mask, The Derma-Guard of the forms such as ointment. In addition, can also be at these skin sparings Add for example superoxide dismutase of free radical scavenger in the agent matrix And be selected from dimethyl sulfoxide (DMSO) and Zhuo Yuegui nitrogen (SOD) and its derivative, The skin penetrant of tall and erect ketone etc. Such Derma-Guard is except having conventional the cosmetic Outside the function of product, also have the part of preventing and/or treating, particularly health is sudden and violent The function of revealing position tissue damage and/or infection, and stimulate in the local organization Fibrocyte and epithelial cell proliferation prevent the function of skin aging and shrinkage.

Should be noted also that at last the difference according to application target, of the present invention Remove FGF-2 or the FGF-that contains as main active in the pharmaceutical composition Outside the 2m, also can contain other relevant biologically active proteins matter, for example table The skin factor (EGF), nerve growth factor (NGF), brain derived nerve growth The factor (BDNF), these active factorses can act synergistically with FGF-2, advance one Step is improved the result for the treatment of of pharmaceutical composition of the present invention.

Below by embodiment and with reference to accompanying drawing the present invention is described for example further, these embodiment also limit the await the reply scope of claim of the present invention never in any form.

Embodiment 1: the preparation of the cDNA of coding people FGF-2 active polypeptide

Present embodiment is described the preparation method of the dna sequence dna of coding hFGF-2 active polypeptide.

1. the mRNA that separates coding bFGF-2 active polypeptide.Get the ox pituitary gland and be organized under the liquid nitrogen environment and smash to pieces, and be suspended in RNA and extract damping fluid and (contain 0.14M NaCL, 1.5mM MgCL ₂10mM Tris-HCL (pH8.6), 0.5%NP-40,1mM dithiothreitol (DTT) (DTT) and the 1000 placenta RNA of unit enzyme inhibitorss) in, after in suspension, adding the guanidine thiocyanate homogenate buffer (4.0M guanidine thiocyanate, 01mM Tris-HCL, 1% beta-mercaptoethanol) of 5 times of volumes, use Polytron refiner (production of Brinkmann company) high-speed homogenization 2 minutes.Adding sarcosyl to final concentration in homogenate is 0.5%, 5000g after centrifugal 10 minutes moves into the gained supernatant top of the clean centrifuge tube that 5.7M CsCl, 0.01M EDTA (pH7.5) bed course are housed, and uses the SW60 rotary head to obtain the RNA throw out with 4000rpm after centrifugal 12 hours.Can directly use resulting RNA, perhaps can obtain mRNA (T.Maniatis by Oligo-dT post (Pharmacia) purifying, et al., Molecular Cloning:A LaboratoryManual, 2nd ed., Chapter 7, Cold Spring Harbor LaboratoryPress, 1989).

2.cDNA preparation.Base sequence (AbrahamJ.A.et al., Science 233:545-548,1986) according to 5 of disclosed bFGF-2 mRNA in the document ' end coding region and 3 ' end non-coding region designs and synthesizes the one couple of PCR amplimer, i.e. P ₅: 5 ' CATGGCCGCCGGGAGCATC 3 ' and P ₃: 5 ' CATGGATGTAGTTAATCTG 3 '.

Use the mRNA that makes as stated above as template, with P ₃As primer, under the effect of mouse source ThermoScript II (production of Promega company), by article one cDNA chain of the synthetic bFGF-2 of 4 kinds of Nucleotide.Then with P ₅And P ₃Being primer, is template with article one cDNA chain, takes turns the amplified production that PCR circulation (92 ℃ of sex change 1 minute, 50 ℃ are moved back and lost 1 minute, 72 ℃ were extended 1 minute) makes bFGF cDNA through 35.Use therein PCR reaction mixture is to contain the above-mentioned primer of 20pmol in the 50ul total reaction volume, 2 μ lTaq polysaccharases, 5 μ l, 10 * buffered soln, each 5 μ l (250uM) dNTP, and adding distil water to 50 μ l.

Obtain linearizing flush end carrier with restriction endonuclease Hinc II digestion cloning vector pUC18 (production of Promega company) then, in this digestion product, add above-mentioned amplified production of 0.1ug and 1ul T4 dna ligase, connect down in 14 ℃ and spend the night.After the connection, transform through CaCl with the gained reaction mixture ₂The escherichia coli jm109 competent cell of handling.Then, utilize known α-Hu Bu sieve method to filter out the white colony that carries the gene that is inserted into.Plasmid DNA with EcoRI and AccI cutting gained bacterium colony therefrom identifies and can downcut the clone that forward inserts about 0.67Kb dna fragmentation, and it is named into pUC18-bFGF-2 (referring to Fig. 4).

3.hFGF-2 the preparation of gene.Dna sequence dna (Abraham J.A.et al. according to coding people FGF-2, EMBO J.5:2523-2528,1986), design and synthesize following two sequence synthetic oligonucleotides on the basis of the hFGF-2 gene order that has prepared, one of them is to induce in the hFGF-2 gene order codon (TCC) of the 121st Serine of coding to change into codon (ACC) the primer P of coding Threonine ₁₂₁:

5′TCCTAGGAAATACACCAGTTGGTAT?3’；

Another is to induce in the hFGF-2 gene order codon (CCC) of the 137th proline(Pro) of coding to change into the primer P of the codon (TCC) of encoding serine ₁₃₇: 5 ' TATAAACTTGGATCCAAAACGGGG 3 '.Simultaneously, according to principle and the method described in the people such as Picard (Nucleic Acids Research 22:2587-2591,1989), design and synthesize the 5 ' end that detects the sudden change of the 121st and the 137th amino acids and detect primer P _121s5 ' TCAAAGAAATACA 3 ' and P _137s: 5 ' TATAAACTTCCAT 3 '.

For ox FGF-2 is carried out site-specific mutagenesis, at first from the recombinant chou pUC18-bFGF-2 that comprises the bFGF-2 encoding sequence that makes by preceding method, downcut the EcoRI-Hind III fragment of about 1.0kb, by the T4 dna ligase this fragment is connected on the M13mp19 phage vector (Pharmacia production), use resulting recombinant phage vector M13mp19-bFGF-2 transformed into escherichia coli JM109 then, be used for detecting the double-stranded DNA template and the single stranded DNA that is used for sequential analysis of sudden change with preparation with PCR method.

Then according to people (Methods Enzymol, 154:367,1987 such as Kunkel T.A.; KunkelT.A.et al., Proc.Natl.Acad.Sci.USA, 82:488,1985) described method, the single stranded DNA template that contains uridylic of preparation recombinant chou M13mp19-bFGF-2 adds simultaneously and do not held the primer P of phosphorylation under the effect of T4 phage polynucleotide kinase ₁₂₁And P ₁₃₇And annealing with it.In annealing mixture, add Klenow enzyme, T4 dna ligase and ATP and dNTP (four kinds of Nucleotide), in 16 ℃ of following incubated overnight.Use the competent cell of resulting reaction mixture transformed into escherichia coli JM109 then, obtain containing the transformant cell of rf (two strands) DNA.

Therefrom select several bacterium colonies behind cultivation and the propagation transformant cell, use the alkaline lysis method of extracting replicative DNA, thereby finish the mutagenesis (referring to Fig. 6) to hFGF-2 by bFGF-2.

Then, according to the method for having described in the document (Picard V.et al., Nucleic Acids Research 22:2587-2591; Newton C.R.et al., Nucleic Acids Research 17:2503-2515,1989), whether desired point mutation has taken place with the round pcr check.In this method, use above-mentioned double-stranded DNA to make template, at aforementioned primer to P _121sAnd P ₃, and P _137sAnd P ₃Guiding under carry out pcr amplification.Amplified production is added on carries out electrophoretic separation in 1.5% sepharose, as seen the result has the recombinant chou of increase 600bp and 550bp simultaneously, thereby confirms that the 121st of bFGF-2 and the 137th amino acids have sported the corresponding amino acid of hFGF-2.For above-mentioned correct sudden change has taken place in further confirmation, use fluorescein-labeled universal primer, dideoxy chain termination (Sanger.F.et al. with people such as Sanger, J.Mol.Biol.94:441,1975) dna sequence dna of mensuration mutating molecule, the result shows that the dna sequence dna through mutagenesis that PCR method detects carries required mutant nucleotide sequence (referring to Fig. 2).

4. to the site-directed mutagenesis of people/ox FGF-2 gene order.Basically according to the method described above the dna encoding sequence of people or ox FGF-2 is carried out site-directed mutagenesis and change into coding arginic codon (CGT) with the codon (TGT) of the 78th and the 96th halfcystine of will encoding.For this purpose, design and synthesize two Oligonucleolide primers P that are used for mutagenesis respectively ₇₈:

5 ' ATCAAAGGAGTGCGTGCAAACCGT3 ' and P ₉₆:

5′CTAGCTTCTAAACGTGTTACAGAC3′。

Design and synthesize two the detection primer that detects corresponding sudden change with PCR method: P simultaneously _78s: 5 ' ATCAAAGGAGTGC 3 ' and P _96s:

5′CTAGCTTCTAAAC?3′。

What prepare the M13mp19-hFGF-2 transformant then respectively contains the uridylic single-stranded template, use M13mp19 as carrier, carry the hFGF-2 of coding the 78th and the 96th arginine codon and the e. coli jm109 transformant cell of bFGF-2 analog encoding sequence according to the preparation of the method described in the 3rd part above, and with other M13mp19-hFGF-2m by name and M13mp19-bFGF-2m.Through nucleotide sequence analysis, confirm that the recombinant chou that is screened carries the gene order of required FGF-2m.

Embodiment 2: the structure of the expression vector of wild-type FGF-2 and FGF-2 analog

In order to make up the recombinant expression plasmid that is used for expressing wild-type FGF-2 or FGF-2 analog at prokaryotic host cell, at first from the entrained recombinant plasmid of the transformant that as above obtains, downcut the coding people of about 1.0kb or the dna fragmentation of ox FGF-2 or its analog, use the T4 dna ligase that this dna segment is connected on the expression vector pUC18 that cuts with same enzyme with restriction enzyme EcoR I and Hind III.The gained recombinant plasmid transformed behind the e. coli jm109 recipient cell, is comprised the recombinant cell of FGF-2 and FGF-2m respectively.Each construction of recombinant plasmid is referring to Fig. 4-9.

In order to make up recombinant chou, the synthetic primer P that is used for pcr amplification with non-fusion protein form expression wild-type FGF and analog thereof _E: 5 ' GAATTCCATGGCCGCCGGGAGCATC 3 ' and P _P: 5 ' CCTGCAGTTATCAGCTAGACAT 3 ', the dna encoding sequence of non-FGF-2 or its analog coding region has been deleted as template by coding people FGF-2 that the process that use makes is as stated above suitably modified or the dna sequence encoding district of FGF-2m with PCR method.After cutting out the fragment (about 0.47kb) that has terminal viscosity with restriction enzyme EcoR I and Pst I, this fragment is connected on the expression plasmid pKK223-3 that has strong promoter (tac) and transcription termination sequence (production of Pharmacia company) that cuts with same enzyme, is named recombinant expression plasmid (referring to Figure 10-13) respectively into pKK-bFGF-2, pKK-hFGF-2, pKK-bFGF-2m and pKK-hFGF-2m.The recombinant expression plasmid that so makes is transformed into respectively in the competence e. coli jm109 cell, obtains corresponding transformant cell.

According on the December 27th, 1996 that is specified in that is used for patented procedure microbial preservation budapest treaty e. coli jm109 pUC18-hFGF-2 of the present invention being preserved in China Committee for Culture Collection of Microorganisms common micro-organisms preservation center, its preservation is registered as CGMCC No.0286.

Embodiment 3:FGF-2 and analog protein expression and purifying

In order under the shake-flask culture condition, in e. coli host cell, to express and produce FGF-2 of the present invention and its analog, to carry pUC18-bFGF-2 respectively, pUC18-hFGF-2, pUC18-bFGF-2m, pUC18-hFGF-2m, pKK-bFGF-2, pKK-bFGF-2m, pKK-hFGF-2, the JM109 transformant streak inoculation of pKK-hFGF-2m is in LB solid medium (the 1.0g Tryptones that contains the 100ug/1ml penbritin, 0.5g pure female extract, 1.0g NaCL, 1.5g it is formulated through autoclaving that agarose is dissolved in the 100ml distilled water) on, in 37 ℃ of following overnight incubation.After spending the night, the positive bacterium colony of picking also is inoculated in respectively in the 5ml LB liquid culture medium, and 30 ℃ of following shaking culture 12 hours obtain inoculum., add and contain in 500mlLB liquid nutrient medium 2.5 liters of culturing bottles of (containing 100 μ g/ml penbritins) by behind 1: 100 this inoculum of dilution proportion with 10mMPBS, in 30 ℃ of following shaking culture 5 hours.To wherein adding 300uMIPTG, continue vibration (200rpm) down at 30 ℃ and cultivated 6 hours, then to promote the generation of FGF-2 or its analogue.

Collect the nutrient solution so obtain, under 4 ℃ with centrifugal 10 minutes harvested cells of 8000rpm.(every liter contains 0.1M NaCl, 10mM EDTA and 20mM phosphate buffered saline buffer (PB) to add the cellular lysate damping fluid by the amount of 10ml/g weight in wet base in the cell of results, pH7.0), use high-pressure homogenizer (Shp 60/60), with the original pressure of 20-25MPa and the end pressure lysing cell of 50-60MPa.Under 4 ℃, with 18, centrifugal 30 minutes of 500rpm also collects supernatant liquor.

The chromatography column that the gained supernatant liquor is added on Bio-Rex 70 resins (Bio-Rad production) filling of having crossed with cellular lysate damping fluid balance (carries out ion exchange chromatography on the 3cm * 5cm), at first use above-mentioned column balance buffering liquid wash-out, when the 280nm absorption value is zero, (every liter contains 0.6MNaCl, 20mM PB, and pH7.0) wash-out contains the active crude extract of FGF-2 to use elution buffer instead.This crude extract crossed use level pad (0.6mM NaCl, 20mMPB, pH7.0) Heparin Hyper-D (production of BiO-Rad company) the heparin affinity chromatography post crossed of balance (5cm * 3cm).For wild-type FGF-2, continue the more weak foreign protein of wash-out heparin affinity with 1.0M NaCl+20mM PB (pH7.0) solution, use 2.0M NaCl+20mM PB (pH7.0) eluant solution then instead and contain the active protein of FGF-2.For FGF-2m, then use 1.5-2.5M NaCl gradient to carry out wash-out.At last, (80cm * 1.6cm) go up also collects the peak value part with maximum absorption (280nm), obtains purity and reaches FGF-2 of the present invention and FGF-2m expression product more than 95% will to be added on Superdex 75 gel-filtration columns of using 1.0M NaCl+20mM PB (pH6.5) balance to cross again by the eluate of heparin affinity column wash-out.

For the FGF-2 that confirms purifying like this or the uniformity and the immunocompetence of FGF-2 analog, the active ingredient of wash-out is carried out non-reduced SDS-PAGE electrophoretic analysis (see figure 4) and Western engram analysis.After at first separating 3 hours, with about 8mA/cm with 10mA constant current electrophoresis ²Constant current the sample electrotransfer of electrophoretic separation was handled 30 minutes to nitrocellulose filter and with sealing damping fluid (10mM PBS (pH7.4)+0.5%Tween 20+1%BSA), add the mouse-anti people FGF-2 monoclonal antibody (Promega production) that is dissolved in the rinsing damping fluid then, 37 ℃ vibrated 2 hours down.After washing 3 times (10 minutes/time) with rinsing liquid (10mM PBS (pH7.4)+0.5%Tween 20), add the rabbit anti-mouse igg (Promega productions) that is dissolved in the horseradish peroxidase in the sealing damping fluid again, and be incubated 2 hours down in 37 ℃.After the insulation filter membrane is washed (10 minutes/time) 3 times with rinsing liquid.Add substrate buffer solution (0.1M PBS (pH6.0)+1mg DAB+10ul H then ₂O), add 50mM EDTA termination reaction behind the band up to showing clearly, and record result as shown in figure 15.

The external biological of embodiment 4:FGF-2m (FGF-2 analog) is active to be detected

Use the inoblast of cultivating, with ³The FGF-2m that the H infiltration method detects by the inventive method preparation stimulates DNA synthetic ability in the immobilized BALB/c 3T3 inoblast under test conditions.

Briefly, with about 10 ⁵Individual BALB/c 3T3 inoblast (being provided by institute of Materia Medica,Chinese Academy of Medical Sciences) is inoculated in 3ml and contains in the DMEM substratum of 10% foetal calf serum.In 37 ℃ at 5% CO ₂Cultivate in the insulation can after 24 hours,, make the final concentration of serum become 1% with fresh DMEM substratum dilution culture.Continue to cultivate after 3 days, in culture, add FGF-2 of the present invention or FGF-2m, and contrast (DMEM culture or hydroxyurea) and ³The thymus pyrimidine of H mark ( ³H-TdR) (final concentration is 2 μ C/ml).37 ℃ of insulations were washed cell 3 times with cold saline after 24 hours.Centrifugal back adds 10% trichoroacetic acid(TCA) with precipitating proteins in the cell precipitation thing.Wash 2 times with physiological saline once more, and the adding alcohol-ether is washed once.Be added in the 4ml scintillation vial and measure radioactivity with getting 0.1ml behind the formic acid digestion throw out.Calculate FGF to inoblast DNA synthetic stimulation index by following formula.

Obtain the result shown in the following tabulation 1.

Table 1 people FGF-2 and FGF-2 are to external mouse 3T3 cell ³The influence that H-TdR mixes

Handle cell ³H-TdR mixes (CPM) stimulation index P value

Substratum 15,078 1.00-

Hydroxyl an aromatic plant metioned in ancient books urea ^*15,105 1.00-

FGF-2 25,126 1.68 ＜0.05

FGF-2m 26,328 1.72 ＜0.01

^*Because known hydroxyurea suppresses mixing of thymus pyrimidine fully,, this contrast detects DNA synthetic certainty in the cell so will further confirming the 3H-TdR method of mixing.

From the result shown in the last tabulation 1 as can be seen, can be synthetic by FGF-2 and FGF-2m that the inventive method makes in the external DNA of l cell that stimulates effectively, and then the growth of irritation cell and propagation.

Embodiment 5:FGF-2m is to the repair of rat skin tissue injury

Use following material and method, detect the repair of FGF-2m in the body, and compare with FGF-2 to the tissue injury of rat local skin.Observe the positively effect of the FGF-2 of containing pharmaceutical composition of the present invention in the treated tissue damage is used simultaneously.

1. the preparation of animal model: choose 20 of the healthy male Wistar rats that body weight is about 230-250g (12 age in week), before the experiment the single cage of animal was fed for 1 week.Shave hair under the light anaesthesia state except that the about 4cm of back part of animal * 5cm scope, in the garden shape surface of a wound of the about 1.8cm of the about 0.9cm of back center line two lateral extents each aseptic cutting diameter of place, and broken a little muscle tissue of ring, to cause the typical knife wound surface of a wound.

2. the preparation of test sample: preparation contains the drug composition solution of the present invention of following ingredients according to a conventional method:

People FGF-2m (or FGF-2) 10 ⁵Unit

Poly(oxyethylene glycol) 400 20.0mg

Xitix 1.0mg

Heparin sulfate 0.5mg

Add 0.9%NaCl to 100.0ml

The aseptic vial of packing into behind the mentioned component mixing is preserved standby down for interior 4 ℃.Preparation only contains the same concentration of aqueous solution of FGF-2m (or FGF-2) as positive control sample under similarity condition.The negative control sample of composition that does not contain FGF-2m (or FGF-2) to contain other various compositions.All 4 ℃ of placement uses after 30 days under lyophilised state of FGF-2m in all composition sample (or FGF-2).

3. animal grouping and administering mode: 20 traumatogenic rat animal models are divided into 4 groups at random, 5 every group, totally 10 surface of a wound.Drip about 0.15ml various tests and control sample in each wound site with the 1ml syringe from beginning in the 0th day of wound and in hindering back the 1st, 3,5,7 day.The 1st treated animal is accepted positive control sample (production of Promega company), the FGF-2 that the 2nd winding is prepared by the present invention, and the 3rd winding is subjected to FGF-2m of the present invention, and the 4th winding is subjected to the negative control sample.The dosage of FGF is about each each wound 100 unit, and the next day is administered once.Drip behind the medicine and to bind up a wound with sterile gauze in 5 minutes.

4. result: the local granulation tissue growing state of visual inspection next day wound after the medication, measure also record surface of a wound area, with estimation epithelium growth velocity.In addition, carried out biopsy from surface of a wound centre clip callus before the medication on the 3rd, 5,7 day in hindering the back, and after the 7th day, detect the tension stress intensity (result is not shown) of callus.

Found that 2 experimental group and positive controls all show tangible wound healing promoter action.(the 1st, 2,3 groups) rat wound of the 3rd day FGF-2 that comes into operation has the thin layer granulation tissue to generate, and the edge of wound contraction of skin is obvious.Hinder the surface of a wound of the 7th day each the experimental group animal in back and all filled by granulation, negative control group (the 4th group) only sees that then the thin layer granulation that has seldom generates.Shown in the following tabulation 2 of result.

Table 2 FGF-2 and FGF-2m are to the influence of mouse trauma repair

Laboratory sample wound area (cm ²) (mean value ± DS)

0 day 1 day 3 days 5 days 7 days

Positive control 2.5 2.09 ± 0.28 1.4 ± 0.28 1.30 ± 0.25 0.90 ± 0.20

FGF-2 2.5 1.86±0.33 1.51±0.19 1.43±0.10 0.83±0.14

FGF-2m 2.5 1.80±0.14 1.24±0.29 1.81±0.05 ^*?0.44±0.06 ^*

Negative control 2.5 2.14 ± 0.34 1.85 ± 0.41 1.53 ± 0.24 1.14 ± 0.35

^*Compare significant difference with FGF-2 with positive control sample ratio, P＜0.05, compare otherness with negative control group remarkable especially, P＜0.01.

As can be seen from the above table, under the situation that adds suitable stablizer, FGF-2m of the present invention (freezing the cool-drying goods) is through after 30 days low-temperature storage, compares with the FGF-2 that produces by the inventive method to have kept promotion fibrous tissue regenerated biologic activity preferably.

Embodiment 6:FGF-2m and FGF-2 are to the repair of pig skin tissue damage

Use following material and method, detect the repair of FGF-2m in the body, and observe the positively effect of pharmaceutical composition in treatment is used of the FGF-2m of containing of the present invention the tissue injury of pig local skin.

1. the preparation of animal model: 8 of Beijing miniature pigs (providing) (male 5, female 3) of choosing the about 10-20Kg of body weight by the agricultural academy of sciences of China animal center.Single cage fed for 1 week before the experiment.Shave the hair except that back 35cm * 25cm scope under shallow liquor-saturated state, the garden shape surface of a wound of the about 1.8cm of scalpel cutting diameter is used in backbone both sides, aseptic condition lower edge at a distance of the antimere of about 2.0cm.Every back part of animal causes two each 5 surface of a wound of row altogether.

2. the preparation of test sample: preparation contains the medicinal composition spray of the present invention of following ingredients according to a conventional method:

People FGF-2m (or FGF-2) 10 ⁵Unit

Hydroxypropylcellulose 20.0mg

Collagen protein 40.0mg

1%ZnSo4 solution 0.2ml

Heparin sodium 20.0ug

Add 0.9%NaCl to 100.0ml

The mentioned component mixing is packed in the automiser spray of sterilizing, and puts 4 ℃ and preserves after 30 days down and use.Be used for other also preparation and storages under similarity condition of sample that contain FGF-2 or do not contain FGF-2 of control experiment.

3. animal grouping and administering mode: 8 traumatogenic animals are divided into 4 groups at random, 2 every group, totally 20 surface of a wound.From the 0th day of wound, and spray various tests of about 0.2ml and control sample in each wound site with automiser spray in hindering back the 1st, 5,7,10 and 14 day.The A treated animal is accepted Sulfadiazine Silver (SD-Ag) treatment, and the B winding is subjected to FGF-2 of the present invention, and the C winding is subjected to FGF-2m of the present invention, and the D winding is subjected to the negative control sample, does not promptly contain FGF-2 or FGF-2m and only contains the composition of other ancillary components.The dosage of FGF is about each each about 100 unit of wound product, and the next day is administered once.Bound up a wound with sterile gauze in 5 minutes after the administration.

4. result: the local granulation tissue growing state of visual inspection next day wound after the medication, measure also record surface of a wound area, with estimation epithelium regeneration rate.Respectively at 2 animals of execution in the 3rd, 7,10 and 14 day.On average cut apart each surface of a wound, wherein 1/2 carries out microscopy, histological chemistry's inspection and specific stain inspection after formalin solution is fixing, and other 1/2 carries out tensile strength after formalin fixed measures.

To form face little red for the 3rd day visible B and C after the wound, no secretory product, and the then visible significantly red and swollen and toughness secretory product of D group, hindering the 7th day B in back and C group has 80% surface of a wound to be filled by granulation tissue, and surface of a wound area is by 2.5cm ²Be reduced into 0.54 and 0.50cm respectively ²Hindered the back the 10th day, the B and the C surface of a wound are filled by granulation tissue fully, remove behind the part surface of a wound crust visible whole surface of a wound epithelial metaplasia substantially.The 10th day A and D group still have 10% the surface of a wound not heal, and surface of a wound area is respectively 0.62 and 0.92cm ²(referring to table 3).

Table 3 FGF-2 and FGF-2m are to the influence of pigskin skin injury repairing

Laboratory sample is hindered the different surface of a wound area (CM in back ²) (mean value ± SD)

0 day 5 days 7 days 10 days 14 days

A(SD-Ag) 2.5 1.86±0.45 1.54±0.52 0.62±0.35 0.17±0.09

B(FGF-2) 2.5 0.69±0.41 0.54±0.52 0.08±0.06 0.00

C(FGF-2m) 2.5 0.82±0.29 0.50±0.32 0.32±0.40 0.02±0.02

D (negative control) 2.5 2.25 ± 0.33 1.74 ± 0.14 0.92 ± 0.29 ± 0.03

Callus is observed down in opticmicroscope after HE dyeing, as seen uses the surface of a wound of bFGF-2 (B group) and FGF-2m (C group) treatment to begin to have tangible capillary vessel plumule growth in the 3rd day, and the inoblast number increases and active growth.The difference of these histologic characteristicses and two control groups is very remarkable in the time of the 7th day.As seen 7-14 days B group and C organize all new epithelize and hair follicle growth.In addition, collegen filament and spandex fiber content are significantly higher than control group in the surface of a wound granulation tissue of particular tissues dyeing demonstration FGF-2 treatment group.

Claims

1. produce with the fused protein form, have the polypeptide of the active aminoacid sequence as shown in Figure 2 of fibroblast growth factor.

2. according to the polypeptide of claim 1, it comprises the aminoacid sequence of complete rh-bFGF, and being connected with 17 amino acid whose nonstructural proteins sequences at N end, said nonstructural proteins sequence is by the partial sequence coding that is used for starting at prokaryotic hosts the LacZ gene of expressing.

3. according to the polypeptide with the generation of fused protein form of claim 1, it has molecular weight and the iso-electric point in the 9.3-9.6 scope of 18.5KD.

4. produce the method for polypeptide according to claim 1, this method comprises:

(1) obtain the encoding dna sequence dna of bFGF-2;

(2) said dna sequence dna is suitably modified, dna sequence dna as claimed in claim 1 obtains encoding;

(4) transform suitable prokaryotic hosts and screen the recombinant cell that is transformed with resulting recombinant expression vector;

(5) cultivate above-mentionedly under the said condition with peptide more than the fibroblast growth factor activity being suitable for expressing, and from substratum and product of cell lysis, separates and the said polypeptide of purifying by cell transformed.

5. according to the method for claim 4, wherein said modification is a codon of the codon of the 121st Serine of coding ox FGF-2 being changed into the coding Threonine, and the codon of the 137th proline(Pro) of ox FGF-2 of will encoding is changed into the codon of encoding serine.

6. according to the method for claim 4, the expression vector in wherein said (3) is PUC18 or PKK-123-33.

7. according to the method for claim 4, wherein said prokaryotic hosts is intestinal bacteria.

8. the pharmaceutical composition that comprises polypeptide as claimed in claim 1 and other auxiliary compositions and pharmaceutically acceptable carrier or vehicle.

9. pharmaceutical composition according to Claim 8, wherein except that the polypeptide as claimed in claim 1 that contains as the primary activity composition, also can contain and be selected from Urogastron, brain derived nerve growth factor and one or more other somatomedins of nerve growth factor.

10. pharmaceutical composition according to Claim 8 wherein also can contain one or more ancillary components that choosing has self stabilization agent, active protein protective material, skin penetrant, free-radical scavengers and proteolytic enzyme to suppress.

11. according to the pharmaceutical composition of claim 10, wherein said stablizer is selected from polyoxyethylene glycol, carboxymethyl cellulose, xitix, sulfated polysaccharide, heparin, poly-lysine and gsh, polyvalent alcohol.

12. according to the pharmaceutical composition of claim 10, wherein said active protein protective material is selected from human serum albumin, low molecular weight peptide, amino acid and metallic cation.

13. according to the pharmaceutical composition of claim 10, wherein said skin penetrant is selected from tall and erect laurocapram or derivatives thereof and dimethyl sulfoxide (DMSO).

14. the application of pharmaceutical composition according to Claim 8 in the treated tissue damage.

15. according to the application of claim 14, wherein said tissue injury is the damage of skin histology, muscle tissue, mucosal tissue, nervous tissue or osseous tissue.

16. pharmaceutical composition according to Claim 8 is as the application of Derma-Guard.