RU2775696C2 - Modified l-asparaginase - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology and is a modified protein for the treatment of a disease treatable by asparagine depletion, where the specified modified protein is a tetramer, and each monomer of the specified tetramer contains: (i) L-asparaginase having at least 95% identity of the amino acid sequence SEQ ID NO: 1, and (ii) one or more (poly)peptides, where the (poly)peptide consists of 20-600 amino acid residues of proline and alanine.

EFFECT: invention makes it possible to effectively treat diseases that can be treated by asparagine depletion.

18 cl, 9 dwg, 5 tbl, 9 ex

Description

[0001] The present invention relates to a modified protein that is a combination of (i) L-asparaginase and (ii) one or more (poly)peptides, where the (poly)peptide consists solely of the amino acid residues of proline and alanine. The modified protein can be generated in a number of ways, including chemical conjugation between L-asparaginase and (poly)peptides, or by expressing the modified protein as a fusion protein. This document also provides nucleic acids encoding the modified protein, vectors and/or host cells containing them, as well as methods for their production. Disclosed are compositions containing a modified protein and their use in medicine, especially in the treatment of cancer. In another aspect of the invention, L-asparaginase may be derived from bacteria of the genus Erwinia and/or it has at least 85% amino acid sequence identity to SEQ ID NO: 1.

[0002] Proteins with L-asparagine aminohydrolase activity, commonly known as L-asparaginases, have been successfully used to treat acute lymphoblastic leukemia (ALL) in children for many years. ALL is the most common malignant cancer in children (Avramis (2005) Clin. Pharmacokinet . 44, 367-393).

[0003] L-asparaginase is also used to treat Hodgkin's disease, acute myeloid leukemia, acute myelomonocytic leukemia, chronic lymphocytic leukemia, lymphosarcoma, reticulosarcoma, and melanosarcoma (Kotzia (2007) J. Biotechnol. 127, 657-669). It is believed that the antitumor activity of L-asparaginase is due to the inability or reduced ability of some malignant cells to synthesize L-asparagine ( Id ). These malignant cells rely on the extracellular supply of L-asparagine. However, the enzyme L-asparaginase catalyzes the hydrolysis of L-asparagine to aspartic acid and ammonia, thereby depleting circulating pools of L-asparagine and killing tumor cells that cannot carry out protein synthesis without L-asparagine ( Id ).

[0004] E. coli L-asparaginase was the first enzyme preparation used in the treatment of ALL and was sold under the trade name Elspar® in the United States or as Kidrolase® and Medac® L-asparaginase in Europe. L-asparaginases have also been isolated from other microorganisms, such as the L-asparaginase protein from Erwinia chrysanthemi , called chrysanthspase, which was sold under the trade name Erwinase® (Wriston (1985) M eth. Enzymol. 113, 608-618; Goward (1992) Bioseparation 2, 335-341). L-asparaginases from other Erwinia species have also been identified, including, for example, Erwinia chrysanthemi 3937 (Genbank accession number AAS67028), Erwinia chrysanthemi NCPPB 1125 (Genbank accession number CAA31239), Erwinia carotovora (Genbank accession number AAP92666) and Erwinia carotovora subsp. artroseptica (Genbank accession number AAS67027). These Erwinia chrysanthemi L-asparaginases share approximately 91-98% amino acid sequence identity with each other, while Erwinia carotovora L-asparaginases have approximately 75-77% amino acid sequence identity with Erwinia chrysanthemi L-asparaginases (Kotzia (2007) J. Biotechnol 127, 657-669).

[0005] L-asparaginases of bacterial origin have high immunogenic and antigenic potential and often provoke adverse reactions ranging from a mild allergic reaction to anaphylactic shock in sensitized patients (Wang (2003) Leukemia 17, 1583-1588). E. coli L-asparaginase is particularly immunogenic in accordance with the reported presence of anti-asparaginase antibodies to E. coli L-asparaginase after intravenous or intramuscular administration, reaching 78% in adults and 70% in children ( Id ).

[0006] Escherichia coli and Erwinia chrysanthemi L-asparaginases differ in their pharmacokinetic properties and, accordingly, have different immunogenic profiles (Klug Albertsen (2001), Brit. J. Haematol . 115, 983-990). In addition, it has been shown that antibodies that are produced after treatment with E. coli L-asparaginase do not cross-react with Erwinia L-asparaginase (Wang (2003) Leukemia 17, 1583-1588). Thus, Erwinia L-asparaginase (crisanthaspase) has been used as a second-line therapy for ALL in patients who have responded to E. coli L-asparaginase (Duval (2002) Blood 15, 2734-2739; Avramis (2005) Clin. Pharmacokinet . 44 , 367-393).

[0007] In another attempt to reduce the immunogenicity associated with the administration of microbial L-asparaginases, methoxypolyethylene glycol (mPEG) modified E. coli L-asparaginase has been developed. This so-called mPEG-L-asparaginase or pegaspargase, sold under the trade name Oncaspar® (Enzon Inc.), was first approved in the United States for second-line ALL in 1994, and since 2006 for first-line ALL in children and adults. .

[0008] Oncaspar® is an E. coli L-asparaginase that has been modified at several lysine residues using mPEG succinimidyl succinate 5 kDa (SS-PEG) (US Patent No. 4,179,337). SS-PEG is a first generation PEG reagent that contains an unstable ester bond that is susceptible to hydrolysis by enzymes or at slightly alkaline pH values (US Pat. No. 4,670,417). These properties reduce in vitro and in vivo stability and may reduce drug safety.

[0009] In addition, it has been demonstrated that antibodies developed against L-asparaginase from E. coli will cross-react with Oncaspar® (Wang (2003) Leukemia 17, 1583-1588). Although these antibodies were not neutralizing, this discovery clearly demonstrated the high potential for cross-hypersensitivity or cross-inactivation in vivo . Indeed, one report presented evidence that 30-41% of children treated with pegaspargasa had an allergic reaction ( Id ).

[00010] In addition to extrinsic allergic reactions, the problem of "latent hypersensitivity" has recently been reported, where patients develop antibodies to asparaginase without showing any clinical signs of a hypersensitivity reaction (Wang (2003) Leukemia 17, 1583-1588). This reaction can lead to the production of neutralizing antibodies to E. coli L-asparaginase and pegaspargase; however, these patients are not switched to Erwinia L-asparaginase due to the absence of outward signs of hypersensitivity and therefore receive a shorter duration of effective treatment (Holcenberg (2004) J. Pediatr. Hematol. Oncol . 26, 273-274).

[00011] Erwinia chrysanthemi L-asparaginase treatment is often used in cases of hypersensitivity to E. coli- derived L-asparaginases. However, up to 30-50% of patients treated with Erwinia L-asparaginase have been noted to be antibody positive (Avramis (2005), Clin. Pharmacokinet . 44, 367-393). Moreover, since Erwinia chrysanthemi L-asparaginase has a shorter half-life than E. coli L-asparaginases, it should be administered more frequently ( Id ). In a study by Avramis et. al , Erwinia asparaginase has been associated with poor pharmacokinetic profiles (Avramis (2007), J. Pediatr. Hematol. Oncol . 29, 239-247). Therefore, L-asparaginase and E. coli pegaspargase are the preferred first-line therapy for ALL over Erwinia L-asparaginase.

[00012] Numerous biopharmaceuticals have been successfully pegylated and marketed over the years. However, in many cases, pegylated biopharmaceuticals exhibit significantly reduced potency compared to the unmodified biopharmaceutical. In the case of Erwinia carotovora L-asparaginase, it was noted that pegylation reduced its in vitro activity to about 57% (Kuchumova (2007) Biochemistry (Moscow) Supplement Series B: Biomedical Chemistry, 1, 230-232). Erwinia carotovora L-asparaginase shares only about 75% homology with Erwinia chrysanthemi L-asparaginase (chrysanthaspase). Oncaspar® is also known to have approximately 50% in vitro activity compared to unmodified E. coli L-asparaginase.

[00013] Thus, the technical problem underlying the present invention is to provide agents and methods for treating cancer, such as leukemia or non-Hodgkin's lymphoma, that avoid the limitations and disadvantages of prior art treatments, especially some pegylated asparaginases.

[00014] The technical problem is solved by providing the embodiments described in the claims.

[00015] In one aspect, the present invention relates to a modified protein containing (i) L-asparaginase and (ii) one or more (poly)peptides, where the (poly)peptide consists solely of the amino acid residues of proline and alanine. In a preferred aspect, the invention provides a modified protein comprising (i) an L-asparaginase having at least 85% amino acid sequence identity to SEQ ID NO: 1 and (ii) one or more (poly)peptides, wherein the (poly)peptides consist solely of from the amino acid residues of proline and alanine.

The present invention relates in particular to the following points:

1. A modified protein containing (i) L-asparaginase and (ii) one or more (poly)peptides, where the (poly)peptide consists solely of the amino acid residues of proline and alanine.

2. The modified protein of claim 1, wherein said L-asparaginase has at least 85% amino acid sequence identity to SEQ ID NO: 1

3. A modified protein according to claim 1 or 2, wherein said L-asparaginase has the amino acid sequence of SEQ ID NO: 1.

4. Modified protein according to any one of paragraphs. 1-3, wherein the modified protein has an asparaginase or glutaminase activity higher than that of the unmodified L-asparaginase.

5. Modified protein according to any one of paragraphs. 1-4, wherein said modified protein has an L-asparagine depleting activity that is at least about 20% greater than that of unmodified L-asparaginase.

6. Modified protein according to any one of paragraphs. 1-5, wherein said L-asparaginase is a tetramer.

7. Modified protein according to any one of paragraphs. 1-6, which is a modified protein of the specified L-asparaginase and a polypeptide, where the polypeptide consists solely of the amino acid residues of proline and alanine.

8. The modified protein according to claim 7, wherein said polypeptide consists of about 100-600 amino acid residues of proline and alanine, in particular about 200-400 amino acid residues of proline and alanine.

9. A modified protein according to claim 7 or 8, wherein said polypeptide consists of a total of about 200 amino acid residues of proline and alanine, or a total of about 400 amino acid residues of proline and alanine.

10. Modified protein according to any one of paragraphs. 7-9, wherein said proline residues comprise more than about 10% and less than about 70% of the polypeptide.

11. Modified protein according to any one of paragraphs. 7-10, where said polypeptide contains multiple amino acid repeats, where said repeat consists of proline and alanine residues, and where no more than 6 consecutive amino acid residues are identical.

12. Modified protein according to any one of paragraphs. 7-11, where the specified polypeptide contains or consists of the amino acid sequence AAPAAPAPAAPAAPAPAAPA (SEQ ID NO: 5) or cyclically permuted versions or (a) multimer(s) of the sequences in general or parts of the sequence.

13. Modified protein according to any one of paragraphs. 7-12,

(a) in which the specified polypeptide contains or consists of the amino acid sequence in accordance with presented in SEQ ID NO: 7 or 9;

(b) wherein said polypeptide comprises or consists of an amino acid sequence encoded by a nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 8 or 10.

14. Modified protein according to any one of paragraphs. 7-13,

(a) in which the specified modified protein contains or consists of the amino acid sequence in accordance with presented in SEQ ID NO: 11 or 13;

(b) wherein said modified protein comprises or consists of an amino acid sequence encoded by a nucleic acid having a nucleotide sequence as shown in SEQ ID NO:12 or 14.

15. Modified protein according to any one of paragraphs. 7-14, wherein said polypeptide is a random coil conformation polypeptide.

16. Modified protein according to any one of paragraphs. 7-15, in which the modified protein is a hybrid protein of L-asparaginase and a polypeptide.

17. A modified protein according to any one of paragraphs 1-6, which is a modified protein of L-asparaginase and one or more peptides, where each is independently a peptide R ^N -(P/A)-R ^C ,

where (P/A) is an amino acid sequence consisting solely of the amino acid residues of proline and alanine, where RN is a protecting group attached to the ^N -terminal amino group of the amino acid sequence, and

where RC is an amino acid residue linked through its amino group to the ^C -terminal carboxy group of the amino acid sequence,

where each peptide is conjugated to L-asparaginase through an amide bond formed from the carboxyl group of the ^C -terminal amino acid residue RC of the peptide and the free amino group of L-asparaginase, and

wherein at least one of the free amino groups to which the peptides are conjugated is not the N-terminal α-amino group of L-asparaginase.

18. The modified protein according to claim 17, wherein said amino acid sequence consists of a total of 15 to 45 proline and alanine amino acid residues.

19. A modified protein according to claim 17 or 18, wherein said amino acid sequence consists of 20 amino acid residues of proline and alanine.

20. A modified protein according to claim 17 or 18, wherein said amino acid sequence consists of 40 amino acid residues of proline and alanine.

21. Modified protein according to any one of paragraphs. 17-20, wherein said proline residues comprise more than about 10% and less than about 70% of the amino acid sequence.

22. Modified protein according to any one of paragraphs. 17-21, wherein said amino acid sequence is

AAPAAPAPAAPAAPAPAAPA (SEQ ID NO: 5) or

AAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPA (SEQ ID NO: 15).

23. Modified protein according to any one of paragraphs. 17-22,

where RN is ^{pyroglutamoyl} or acetyl, and/or

where RC is ε- ^{aminohexanoic} acid.

24. Modified protein according to any one of paragraphs. 17-23, wherein the peptides contained in said modified protein adopt a random coil conformation.

25. Modified protein according to any one of paragraphs. 17-24, in which all peptides contained in said modified protein are the same.

26. Modified protein according to any one of paragraphs. 17-25, wherein at least one of the free amino groups to which the peptides are conjugated is the ε-amino group of the lysine residue of L-asparaginase.

27. Modified protein according to any one of paragraphs. 17-26 wherein the free amino groups to which the peptides are conjugated are selected from the group consisting of the ε-amino group(s) of any L-asparaginase lysine residues and the N-terminal α-amino group(s) of L-asparaginase.

28. Modified protein according to any one of paragraphs. 17-27, in which L-asparaginase consists of four subunits, and where 9-13 peptides in accordance with the definition according to any one of paragraphs. 15-24 are conjugated to each L-asparaginase subunit.

29. Modified protein according to any one of paragraphs. 1-28, wherein said polypeptide or peptide mediates reduced immunogenicity of said modified protein.

30. Nucleic acid encoding a modified protein according to any one of paragraphs. 1-16.

31. Nucleic acid according to claim 30, characterized in that said nucleic acid is selected from the group consisting of:

(a) a nucleic acid containing the nucleotide sequence of SEQ ID NO:12 or 14;

(b) a nucleic acid containing a nucleotide sequence having at least 85% identity to the nucleotide sequence defined in (a); and

(c) a nucleic acid that is degenerate, due to the genetic code, in a nucleotide sequence as defined in (a) or (b).

32. A vector containing a nucleic acid according to claim 30 or 31.

33. A host cell containing a nucleic acid according to claim 30 or 31 or a vector according to claim 32.

34. A host cell according to claim 33, wherein said host cell is selected from the group consisting of Pseudomonas fluorescens and Corynebacterium glutamicum .

35. The method of obtaining a modified protein according to any one of paragraphs. 1-16, 29 or a nucleic acid according to claim 30 or 31.

36. The method of claim 35, comprising culturing the host cell of claim 33 or 34 and isolating said modified protein from the culture or from said cell.

37. The method of obtaining a modified protein in accordance with the definition in any of paragraphs. 17-29, wherein the process includes:

(a) a combination of an activated peptide of the formula R ^N -(P/A)-R ^C-act , where R ^{C -act} is the carboxy-activated form of RC , where ^RC and (P/A) have the meanings defined for the modified protein to be produced, and where RN is a protecting group that is attached to the ^N -terminal amino group (P/A), with L-asparaginase to obtain a modified L-asparaginase protein and peptides, in which ^RN is a protecting group .

38. The method according to claim 37, characterized in that the activated carboxy group of the amino acid residue R ^C-act in the activated peptide is an active ester group.

39. Composition containing a modified protein according to any one of paragraphs. 1-29 or a modified protein obtained by the method according to any one of paragraphs. 35-38.

40. The composition of claim 39, which is a pharmaceutical composition optionally further comprising (a) a pharmaceutically acceptable carrier(s) or excipient(s).

41. Modified protein according to any one of paragraphs. 1-29 or a modified protein obtained by the method according to any one of paragraphs. 35-38, or a composition according to claim 39 or 40 for use as a medicine.

42. Modified protein according to any one of paragraphs 1-29, a modified protein obtained by the method according to any one of paragraphs. 35-38, or a composition according to claim 39 or 40 for use in the treatment of a disease, for example, a disease treatable by depletion of L-asparagine in a patient.

43. A method of treating a disease treatable by L-asparagine depletion in a patient, said method comprising administering to said patient an effective amount of the modified protein according to any one of paragraphs. 1-29, a modified protein obtained by a method in accordance with any one of paragraphs. 35-38, or the composition according to paragraphs. 39 or 40.

44. A modified protein for use according to claim 42 or a composition for use according to claim 42, or a method according to claim 43, wherein said disease treatable by L-asparagine depletion is cancer.

45. Modified protein according to any one of paragraphs. 1-29, a modified protein obtained by the method according to any one of paragraphs. 35-38, or a composition according to claim 39 or 40 for use in the treatment of cancer.

46. A method of treating cancer, comprising administering to a subject a modified protein according to any one of paragraphs. 1-29 or a modified protein obtained by the method according to any one of paragraphs. 35-38, or compositions according to claim 39 or 40.

47. Modified protein for use in accordance with paragraph 44 or 45 or composition for use in accordance with paragraph 44 or 45, where the specified cancer is not a solid cancer; or the method of claim 44 or 46, wherein said cancer is a non-solid cancer.

48. A modified protein for use in accordance with paragraph 47 or a composition for use in accordance with paragraph 47, where the specified non-solid cancer is leukemia or non-Hodgkin's lymphoma; or the method of claim 47, wherein said non-solid cancer is leukemia or non-Hodgkin's lymphoma.

49. A modified protein for use in accordance with paragraph 48 or a composition for use in accordance with paragraph 48, where the specified leukemia is acute lymphoblastic leukemia (ALL) or acute myeloid leukemia (AML); or the method of claim 48, wherein said leukemia is acute lymphoblastic leukemia (ALL) or acute myeloid leukemia (AML).

50. Modified protein for use according to any one of paragraphs. 42, 44, 45 and 47-49 or a composition for use according to any one of paragraphs. 42, 44, 45 and 47-49 or the method according to any one of paragraphs. 43, 44 and 46-49, wherein said modified protein elicits a lower immunogenic response in said patient compared to unmodified L-asparaginase.

51. Modified protein for use according to any one of paragraphs. 42, 44, 45 and 47-50 or a composition for use according to any one of paragraphs. 42, 44, 45, and 47-50, or the method of any 43, 44, and 46-50, wherein said modified protein has a longer in vivo circulating half-life after a single dose compared to unmodified L-asparaginase.

52. Modified protein for use according to any one of paragraphs. 42, 44, 45 and 47-51 or a composition for use according to any one of paragraphs. 42, 44, 45 and 47-51, or the method according to any one of paragraphs. 43, 44 and 46-51, wherein said modified protein has a higher AUC after a single dose compared to unmodified L-asparaginase.

53. Modified protein for use according to any one of paragraphs. 42, 44, 45 and 47-52 or a composition for use according to any one of paragraphs. 42, 44, 45 and 47-52 or the method according to any one of paragraphs. 43, 44 and 46-52, wherein said patient has previously had hypersensitivity to E. coli L-asparaginase or its pegylated form.

54. Modified protein for use according to any one of paragraphs. 42, 44, 45 and 47-53 or a composition for use according to any one of paragraphs. 42, 44, 45 and 47-53 or the method according to any one of paragraphs. 43, 44 and 46-53, in which said patient previously had hypersensitivity to Erwinia L-asparaginase.

55. Modified protein for use according to any one of paragraphs. 42, 44, 45 and 47-54 or a composition for use according to any one of paragraphs. 42, 44, 45 and 47-54 or the method according to any one of paragraphs. 43, 44 and 46-54, wherein the treatment comprises intravenous administration of said modified protein.

[00016] In one aspect, the present invention provides a modified protein comprising (i) a recombinant L-asparaginase having at least 85% amino acid sequence identity to SEQ ID NO:1 and (ii) one or more (poly)peptides, where ( a polypeptide consists solely of the amino acid residues of proline and alanine. The explanations and definitions given in this document regarding the terms "modified protein", "L-asparaginase", "(poly)peptides" and the like, given in this document, apply mutatis mutandis (subject to the necessary changes in interpretation). As used herein, the term "recombinant L-asparaginase" refers to a recombinant form of L-asparaginase having at least 85% amino acid sequence identity with native Erwinia L-asparaginase. The term "recombinant" may refer to a recombinantly produced L-asparaginase, for example, L-asparaginase produced in a host cell containing a nucleic acid encoding L-asparaginase.

[00017] The modified proteins also show an increased plasma half-life and hence a longer duration of action compared to the corresponding unconjugated L-asparaginase. This allows you to reduce the frequency of administration and, consequently, the burden of side effects. The invention also relates to methods for producing modified proteins as described herein.

[00018] In certain aspects, the invention relates to a modified protein containing (i) L-asparaginase having at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% amino acid sequence identity of SEQ ID NO: 1 and (ii) one or more (poly)peptides, where the (poly)peptides consist only of proline and alanine amino acid residues. It is clear that the term "consisting exclusively of the amino acid residues of proline and alanine" means the presence of at least one proline residue and at least one alanine residue, i.e., both at least one proline residue and at least one alanine residue. In a preferred aspect, the invention relates to a modified protein comprising (i) a recombinant L-asparaginase having an amino acid the sequence of SEQ ID NO: 1 and (ii) one or more (poly)peptides, in which the (poly)peptides consist solely of the amino acid residues of proline and alanine. In one aspect, L-asparaginase is a tetramer (i.e., L-asparaginase composed of four subunits or monomers). One exemplary subunit or monomer has an amino acid the sequence of SEQ ID NO: 1.

[00019] In one aspect, the (poly)peptide (i.e., polypeptide or peptide) mediates the reduced immunogenicity of the modified protein described herein, for example, the reduced immunogenicity of the modified protein compared to unconjugated L-asparaginase.

[00020] As shown in the accompanying examples, the PA#1(200)-chrysanthaspase protein had 109% and the PA#1(400)-chrysanthaspase protein had 118% enzymatic activity compared to unmodified chrysanthaspase; see Example 5. This demonstrates that the condensation of asparaginases as described herein with polypeptides does not affect enzymatic activity. Surprisingly, the activity even increased with the length of the PA polypeptide.

[00021] More generally, the modified proteins provided herein have the same or substantially the same (enzymatic) activity as compared to unmodified asparaginase. (Enzymatic) activity can be assessed by Nessler analysis. Details of the Nessler assay are provided in the accompanying examples and/or disclosed in the prior art, eg Mashburn (1963) Biochem. Biophys. Res. commun. 12, 50 (incorporated herein by reference in its entirety). Accordingly, in one aspect, the modified proteins provided herein have the same or substantially the same (enzymatic) activity as compared to unmodified asparaginase, as assessed by Nessler analysis. As used herein, the term "unmodified asparaginase" refers to native asparaginase, that is, asparaginase that is not modified by condensation/conjugation to (poly)peptides as defined herein.

[00022] For example, "unmodified asparaginase" is an L-asparaginase having at least 85% amino acid sequence identity of SEQ ID NO: 1. In a preferred aspect, "unmodified asparaginase" is an L-asparaginase having the amino acid sequence of SEQ ID NO: one.

[00023] In some aspects, the modified proteins provided herein have (enzymatic) activity greater than that of unmodified L-asparaginase. (Enzymatic) activity can be assessed, for example, by Nessler analysis. Details of the Nessler assay are provided in the accompanying examples and/or disclosed in the prior art, eg Mashburn (1963) Biochem. Biophys. Res. commun. 12, 50 (incorporated herein by reference in its entirety). Accordingly, in one aspect, the modified proteins provided herein have an (enzymatic) activity greater than that of unmodified L-asparaginase, as assessed by Nessler analysis. As used herein, the term "unmodified asparaginase" refers to native asparaginase, that is, asparaginase that has not been modified by condensation/conjugation to (poly)peptides as defined herein. For example, "unmodified asparaginase" is an L-asparaginase having at least 85% amino acid sequence identity to SEQ ID NO:1. In a preferred aspect, "unmodified asparaginase" is an L-asparaginase having the amino acid sequence of SEQ ID NO: 1. For example, modified proteins have (enzymatic) activity that can be at least 5% and/or up to 30% (for example, at least 10%, 15%, 20%, 25% or more) higher than that of L-asparaginase, especially higher than unmodified L-asparaginase, especially as assessed by Nessler analysis. The above explanations apply in particular to, but are not limited to, the fusion proteins provided herein (eg, a modified L-asparaginase protein and a polypeptide, where the polypeptide consists solely of the amino acid residues of proline and alanine).

[00024] In some aspects, the modified proteins have asparaginase activity or glutaminase activity higher than unmodified L-asparaginase. For example, modified proteins may have asparaginase activity or glutaminase activity at least 5% and/or up to 30% (e.g., at least 10%, 15%, 20%, 25% (or more) higher than that of L -asparaginase, especially higher than unmodified L-asparaginase, especially as assessed by Nessler analysis.In some embodiments, asparaginase activity or glutaminase activity can be measured by Nessler analysis.The rate of hydrolysis of asparagine can be determined by measuring released ammonia, and the amount of released ammonia using the modified proteins disclosed herein can be compared with the amount obtained using L-asparaginase or unmodified L-asparaginase.In additional aspects, these modified proteins have an L-asparagine depletion activity higher than that of unmodified L-asparaginase.For example, modified proteins have activity depleted L-asparagine levels are at least 5% and/or up to 30% (e.g., at least 10%, 15%, 20%, 25%, or more) higher than L-asparaginase, especially higher than unmodified L-asparaginase, especially as assessed by Nessler analysis. The invention also relates to a pharmaceutical composition containing a modified protein and a modified protein, or a pharmaceutical composition for use in therapy, or for use as a drug, or for use in medicine.

[00025] Usually, the modified protein can be obtained by chemical coupling or genetic condensation (in the case of conjugation with another protein or peptide). As used herein, the term "fusion protein" refers primarily to a modified protein containing (i) L-asparaginase and (ii) one or more polypeptides, where the polypeptide consists solely of the amino acid residues of proline and alanine. In this context, a polypeptide may consist of about 200-400 proline and alanine amino acid residues. An exemplary amino acid sequence of such polypeptides is shown in SEQ ID NO: 7 or 9.

[00026] If the modified protein is obtained by chemical coupling, it includes (i) L-asparaginase and (ii) one or more peptides, where the peptide consists solely of the amino acid residues of proline and alanine. In this context, a peptide may contain a total of 10 to 100 amino acid residues of proline and alanine, from about 15 to about 60 amino acid residues of proline and alanine, from about 15 to 45 amino acid residues of proline and alanine, for example, from about 20 to about 40 , for example, 20 amino acid residues of proline and alanine or 40 amino acid residues of proline and alanine. Typical amino acid sequences of such peptides are AAPAAPAPAAPAAPAPAAPA (SEQ ID NO: 5) or AAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPA (SEQ ID NO: 15).

[00027] As used herein, the term "modified protein" can be used interchangeably with the term "conjugate", in particular, if the term "modified protein" refers to a modified protein obtained by chemical coupling or in the form of a hybrid protein, that is, primarily if it includes (i) L-asparaginase and (ii) one or more (poly)peptides, where the (poly)peptides consist solely of the amino acid residues of proline and alanine. Likewise, the terms "unmodified" and "unconjugated" may be used interchangeably herein.

[00028] The invention also relates to a method for producing a modified protein, comprising (a) the combination of an activated peptide of the formula R ^N -(P/A)-R ^C-act , where R ^C-act is a carboxy-activated form of R ^C , where R ^C and (P/A) have the meanings defined for the modified protein to be produced, and where R ^N is a protecting group that is attached to the N-terminal amino group (P/A), with L-asparaginase to obtain the modified protein L ^{-asparaginase} and peptides, in which RN represents a protective group.

[00029] In the attached examples (see example 1, table 1) it was demonstrated that the modified protein can be obtained using various mass ratios of activated peptide and asparaginase. For example, weight ratios of 10:1 (activated peptide:asparaginase), 7.5:1, 5:1 or 3.5:1 can be used. It was observed that the (enzymatic) activity of the modified protein was highest when using a ratio of 5:1 or lower (see example 1, table 2). Thus, when using the method described above herein, it may be advantageous to use an activated peptide:asparaginase weight ratio of 5:1 or lower, such as 5:1, 4:1, 3.5:1, or 3:1. As used herein, the term "weight ratio" refers to the ratio of the molecular weight of an activated peptide as defined herein and an asparaginase as defined herein (e.g., asparaginase as shown in SEQ ID NO: 1 and proteins of at least least 85% identity with SEQ ID NO: 1). "Molecular weight" is usually reported in this document using the scientific unit "dalton" (Da). It is well known that the molecular weight unit of asparaginase or peptide, referred to herein in daltons (Da), is an alternative name for the uniform atomic mass unit (a.u.m.). A molecular weight of, for example, 500 Da is thus equivalent to 500 g/mol. The term "kDa" (kilodalton) refers to 1000 Da.

[00030] The molecular weight of the asparaginase or peptide can be determined using methods known in the art, such as, for example, mass spectrometry (for example, electrospray ionization mass spectrometry, ESI-MS, or laser desorption mass spectrometry / matrix-assisted ionization, MALDI-MS), gel electrophoresis (e.g., sodium dodecyl sulfate polyacrylamide gel electrophoresis, SDS-PAGE), hydrodynamic methods (e.g., gel filtration/size exclusion chromatography, SEC or gradient sedimentation) or dynamic (DLS) or static light scattering (e.g., multi-angle light scattering, MALS), or the molecular weight of the asparaginase or peptide can be calculated from the known amino acid sequence (and known post-translational modifications, if present) of the asparaginase or peptide. Preferably, the molecular weight of the asparaginase or peptide is determined by mass spectrometry.

[00031] The invention also relates to a method for producing a modified protein or a nucleic acid encoding a modified protein. In some aspects, the method includes the production of L-asparaginase in a host selected from the group including yeasts such as Saccharomyces cerevisiae and Pichia Pistoris , as well as bacteria, actinomycetes, fungi, algae and other microorganisms, including Escherichia coli , Bacillus sp., Pseudomonas fluorescens , Corynebacterium glutamicum , and bacterial hosts in the following genera: Serratia , Proteus , Acinetobacter , and Alcaligenes . Other hosts are known to those skilled in the art, including Nocardiopsis alba , which expresses an asparaginase variant lacking glutaminase activity (Meena et al . (2014) Bioprocess Biosyst. Eng , October 2014 article, which is incorporated herein by reference in its entirety. ) and articles disclosed in Savitri et al . (2003) Indian Journal of Biotechnology , 2, 184-194, which are incorporated herein by reference in their entirety.

[00032] The modified protein may be a fusion protein comprising (i) an L-asparaginase having at least 85% amino acid sequence identity to SEQ ID NO: 1, and (ii) one or more polypeptides, wherein the polypeptide consists solely of amino acid residues proline and alanine.

[00033] Proline residues in a polypeptide consisting solely of proline and alanine amino acid residues may comprise more than about 10% and less than about 70% of the polypeptide. Accordingly, it is preferred that 10% to 70% of the total amino acid residues in the polypeptide are proline residues; more preferably, 20% to 50% of the total amino acid residues contained in the polypeptide are proline residues; and even more preferably 30% to 40% (eg 30%, 35% or 40%) of the total amino acid residues contained in the polypeptide are proline residues.

[00034] The polypeptide may contain multiple amino acid repeats, where said repeat consists of proline and alanine residues, and where no more than 6 consecutive amino acid residues are identical. In particular, the polypeptide may contain or consist of the amino acid sequence AAPAAPAPAAPAAPAPAAPA (SEQ ID NO: 5) or cyclically permuted versions or (a) multimer(s) of sequences in general or parts of the sequence.

[00035] Preferably, the polypeptide comprises or consists of an amino acid sequence as shown in SEQ ID NO: 7 or 9, or the polypeptide contains or consists of an amino acid sequence encoded by a nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 8 or 10. Preferably, the modified protein (a) contains or consists of the amino acid sequence shown in SEQ ID NO: 11 or 13; or (b) contained or consisted of an amino acid sequence encoded by a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 12 or 14. In one aspect, the polypeptide is a polypeptide with a random coil conformation.

[00036] In some aspects, the modified protein, such as a fusion protein, has asparaginase or glutaminase activity that is higher than that of unconjugated L-asparaginase. For example, modified proteins may have an asparaginase or glutaminase activity at least 5% and/or up to 30% (e.g., at least 10%, 15%, 20%, 25% (or more) higher than that of an unmodified protein. L-asparaginases, especially as assessed by Nessler analysis In further aspects, the L-asparaginase in the modified protein, e.g., in the fusion protein, is covalently linked to the terminal residue of the polypeptide directly via an amine bond, and/or the fusion protein is recombinantly produced. in preferred aspects, the modified protein, e.g., the fusion protein, comprises a linker between L-asparaginase and the polypeptide.A typical linker may be an alanine amino acid residue.The invention also relates to a pharmaceutical composition containing the modified protein, e.g., the fusion protein, or its use in therapy, or for use as a medicine, or for use in medicine.

[00037] The invention also relates to a nucleic acid encoding a modified protein, in particular a fusion protein as defined herein. Preferably the nucleic acid is selected from the group consisting of: (a) a nucleic acid molecule containing the nucleotide sequence of SEQ ID NO: 12 or 14; (b) a nucleic acid molecule containing a nucleotide sequence having at least 85% identity to the nucleotide sequence defined in (a); and (c) a nucleic acid molecule that is degenerate, due to the genetic code, in a nucleotide sequence as defined in (a).

[00038] One aspect of the invention further relates to a method for producing a modified protein as defined herein, or a nucleic acid as defined herein. The method may include culturing a host cell as defined herein and isolating said modified protein from the culture or from said cell. A method for producing a modified protein as defined herein, in particular a fusion protein, may include culturing a host cell transformed with or containing a vector containing a nucleic acid encoding a modified protein, in particular a fusion protein, under conditions that cause expression of the modified protein , especially the fusion protein. In some aspects, the host cell is selected from the group above.

[00039] The invention further relates to a method of treating a disease treatable by L-asparagine depletion in a patient, said method comprising administering to said patient an effective amount of a modified protein as defined herein, such as a fusion protein. The disease treatable by L-asparagine depletion may be cancer. A modified protein as defined herein may elicit a lower immunogenic response in a patient compared to unconjugated L-asparaginase, may have a longer in vivo circulating half-life after a single dose compared to unconjugated L-asparaginase, and/or may have a higher AUC after a single dose compared with L-asparaginase (especially unconjugated L-asparaginase).

[00040] the Problem solved by this invention can be considered as obtaining the drug L-asparaginase with high biological activity in vitro ; stable binding of the protein to the modifier; long half-life in vivo ; significantly reduced immunogenicity, as evidenced, for example, by a decrease or elimination of the antibody response to the L-asparaginase preparation after repeated injections; and/or useful as a second line therapy for patients who develop sensitivity to first line therapy using, for example, non-E. coli derived L-asparaginases.

[00041] This problem is solved in accordance with the present invention through the embodiments described in the claims, in particular, by providing a modified protein containing L-asparaginase and a modifier, i.e. (ii) one or more (poly)peptides, where ( poly)peptide consists solely of the amino acid residues of proline and alanine, as well as providing methods for its production and use.

[00042] In one aspect, this document describes a modified L-asparaginase with improved pharmacological properties compared to an unmodified L-asparaginase protein.

[00043] As used herein, the term “modified L-asparaginase” refers to “a modified protein comprising (i) L-asparaginase and (ii) one or more (poly)peptides in which the (poly)peptide consists solely of amino acid residues proline and alanine as defined and described herein. In one aspect of the invention, L-asparaginase is derived from Erwinia having at least 85% amino acid identity of SEQ ID NO: 1.

[00044] The modified L-asparaginase described herein, for example, L-asparaginase conjugated or fused to one or more (poly)peptides, where the (poly)peptide consists solely of the amino acid residues of proline and alanine, serves as a therapeutic agent, especially for use in patients who show hypersensitivity (eg allergic reaction or latent hypersensitivity) to treatment with L-asparaginase or pegylated Erwinia L-asparaginase and/or E. coli or unmodified Erwinia L-asparaginase. The modified L-asparaginase described herein is also useful as a therapeutic agent for use in patients who have experienced a relapse of the disease, such as relapse of ALL, and who have previously received treatment with another form of asparaginase.

[00045] Erwinia chrysanthemi (also known as Pectobacterium chrysanthemi ) has been renamed Dickeya chrysanthemi . Thus, the terms Erwinia chrysanthemi , Pectobacterium chrysanthemi and Dickeya chrysanthemi are used interchangeably herein.

[00046] Unless expressly stated otherwise, the terms used in this document will be understood in accordance with their usual meaning in the art.

[00047] As used herein, the term "including" means "including without limitation", and terms used in the singular should include the plural and vice versa, unless the context requires otherwise.

[00048] As used herein, the terms "comprising", "including", "having" or their grammatical variations should be understood as defining the claimed features, integers, steps or components, but not excluding the addition of one or more additional features, integers, stages, components or groups. The terms "comprising"/"including"/"having" encompass the terms "consisting of" and "consisting essentially of". Thus, whenever the terms "comprising"/"comprising"/"having" are used in this document, they can be replaced by "consisting essentially of" or preferably "consisting of".

[00049] The terms "comprising"/"comprising"/"having" mean that any additional component (or also features, integers, steps, and the like) may be present.

[00050] The term "consisting of" means the absence of any additional components (or similar features, integers, steps, and the like.

[00051] The term "consisting essentially of" or its grammatical variations when used herein should be understood as indicating the claimed features, integers, steps or components, but not excluding the addition of one or more additional features, integers, steps, components or groups thereof, but only if additional features, integers, steps, components or groups thereof do not significantly change the main and new characteristics of the claimed product, composition, device or method, etc.

[00052] Thus, the term "consisting essentially of" means that specific additional components (or similar features, integers, steps, and the like) may be present, namely, those that do not significantly affect the main characteristics of the product, compositions, devices or methods. In other words, the term "essentially consisting of" (which may be used here interchangeably with the term "essentially comprising") allows for the presence of other components in a product, composition, device, or method in addition to the required components (or, similarly, features, entire numbers, stages, etc.), provided that the presence of other components does not significantly affect the essential characteristics of the product, composition, device or method.

[00053] As used herein, the term "about" refers to ± 10%, unless otherwise indicated herein.

[00054] As used herein, the singular may include the plural.

[00055] As used herein, the term "asparagine depletion treatable disease" refers to a pathological condition or disorder in which the cells involved in or responsible for the condition or disorder either lack or have a reduced ability to synthesize L-asparagine. Depletion or deprivation of L-asparagine may be partial or substantially complete (eg, to levels that cannot be detected using methods and devices known in the art).

[00056] As used herein, the term "therapeutically effective amount" refers to the amount of a protein (eg, asparaginase or a modified protein thereof) required to produce the desired therapeutic effect.

[00057] As used herein, the term "L-asparaginase" is an enzyme with L-asparagine aminohydrolase activity. The enzymatic activity of L-asparaginase can include not only the deamidation of asparagine to aspartic acid and ammonia, but also the deamidation of glutamine to glutamic acid and ammonia. Asparaginases are usually composed of four monomers (although some have been reported with five or six). Each monomer may have a mass of from about 32,000 to about 36,000 daltons.

[00058] Many L-asparaginase proteins have been identified in the art and isolated from microorganisms by known methods. (See, for example, Savitri and Azmi, Indian J. Biotechnol 2 (2003) 184-194, incorporated herein by reference in its entirety). The most widely used and commercially available L-asparaginases are derived from E. coli or from Erwinia chrysanthemi , which have a structural homology of 50% or less.

[00059] The following refers to "L-asparaginase" used in accordance with the invention. Within species of Erwinia , 75-77% sequence identity has generally been reported between enzymes derived from Erwinia chrysanthemi and Erwinia carotovora , and approximately 90% sequence identity has been found between different subspecies of Erwinia chrysanthemi (Kotzia (2007), Journal of Biotechnology 127 , 657-669, incorporated herein by reference in its entirety). Some representative Erwinia L-asparaginases include, for example, those shown in Table 1 below, which discloses percent sequence identity with Erwinia Chrysanthemi NCPPB 1066:

Table 1 Kinds Access number % identity Erwinia chrysanthemi 3937 AAS67028 91% Erwinia chrysanthemi NCPPB 1125 CAA31239 98% Erwinia carotovora subsp. atroseptica AAS67027 75% Erwinia carotovora AAP92666 77%

[00060] Erwinia L-asparaginase sequences and GenBank entries of Table 1 are incorporated herein by reference. Examples of L-asparaginases used in therapy are L-asparaginase isolated from E. coli and from Erwinia , in particular Erwinia chrysanthemi .

[00061] L-asparaginases can be native enzymes isolated from microorganisms. They can also be produced using recombinant enzyme technologies in the production of microorganisms such as E. coli . As examples, the protein used in the modified protein of the invention may be a recombinant protein produced in an E. coli strain, preferably a protein from an Erwinia species, in particular Erwinia chrysanthemi , produced in a recombinant E. coli strain.

[00062] Enzymes can be identified by their specific activity. Thus, this definition includes all polypeptides that have a certain specific activity also present in other organisms, more specifically in other microorganisms. Often, enzymes with similar activity can be identified by their grouping into specific families, defined as PFAM or COG. PFAM (Protein Family Alignment and Hidden Markov Model Database; pfam.sanfferac.ukl) is a large collection of protein sequence alignments. Each PFAM allows you to visualize multiple alignments, see protein domains, evaluate distribution among organisms, access other databases, and visualize known protein structures. COGs (Clusters of Orthologous Protein Groups; vv-ww.nebi.nlm.nih.gov/COG/) are obtained by comparing protein sequences from 43 fully sequenced genomes representing 30 major phylogenetic lineages. Each COG is defined based on at least three rows, which allows identification of former conservative domains.

[00063] Means for identifying percent sequence identity are well known to those skilled in the art and include, but are not limited to, BLAST programs that can be used at blast.ncbi.olo.nih.gov/Blast.cgi with the specified default parameters, indicated on this website. The resulting sequences can then be used (eg aligned) using, for example, the CLUSTALW program (ebi.ac.uk/Tools/clustalw2/index.html) with default parameters. By using GenBank references for known genes, those skilled in the art are able to identify equivalent genes in other organisms, bacterial strains, yeasts, fungi, mammals, plants, etc. This routine work is predominantly done using consensus sequences, which can be determined by aligning sequences with genes derived from other organisms and developing degenerate probes for cloning the corresponding gene in another organism.

[00064] One of skill in the art will understand how to select and design proteins that retain their L-asparaginase activity to a significant degree. One approach to measuring L-asparaginase activity is the Nessler assay described by Mashburn (1963) Biochem. Biophys. Res. commun. 12, 50 (incorporated herein by reference in its entirety).

[00065] In a specific aspect of the modified protein of the invention, L-asparaginase has at least about 85% homology or sequence identity with the amino acid sequence of SEQ ID NO: 1, more specifically at least about 85%, 86%, 87%, 88% , 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence homology or identity with the amino acid sequence of SEQ ID NO: 1, as indicated in the attached sequence listing. The terms "homology" and "sequence identity" are used interchangeably herein.

[00066] The term "comprising the sequence of SEQ ID NO: 1" (for example, if L-asparaginase has 100% homology or sequence identity with the amino acid sequence of SEQ ID NO: 1) means that the amino acid sequence of asparaginase cannot be strictly limited to SEQ ID NO :1, but may contain one, two, three, four, five, six, seven, eight, nine, ten or more additional amino acids. In other words, if the L-asparaginase for use herein has 100% homology or sequence identity with the amino acid sequence of SEQ ID NO: 1, the L-asparaginase may comprise or consist of the amino acid sequence of SEQ ID NO: 1. The term "comprising" in this context means that the amino acid sequence of L-asparaginase SEQ ID NO: 1 may contain one, two, three, four, five, six, seven, eight, nine, ten or more additional amino acids.

In a specific aspect, the protein is an Erwinia chrysantherni L-asparaginase comprising or consisting of the sequence of SEQ ID NO: 1. In another aspect, the L-asparaginase is from Erwinia chrysanthemi NCPPB 1066 (Genbank accession number CAA32884, incorporated herein by reference in its entirety) , and it either contains signal peptides and/or leader sequences or not.

Fragments of L-asparaginase, preferably L-asparaginase according to SEQ ID NO:1, are also included in the definition of L-asparaginase used in the modified protein of the invention. The term "asparaginase fragment" (e.g., asparaginase fragment of SEQ ID NO: 1) means that the asparaginase sequence may contain fewer amino acids than the exemplary asparaginases listed herein (e.g., asparaginase of SEQ ID NO: 1) but still sufficient amino acids to confer L-aminohydrolase activity. For example, an "asparaginase fragment" is a fragment that is/consists of at least about 150 or 200 contiguous amino acids of one of the asparaginases exemplified herein (e.g., asparaginase SEQ ID NO: 1) (e.g., about 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 321, 322, 323, 324, 325, 326 contiguous amino acids) and/or where said fragment has up to 50 amino acids removed from the N-terminus of said asparaginase exemplified herein (e.g. asparaginase SEQ ID NO: 1) (e.g. up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50) and/or has up to 75 or 100 amino acids removed from the C-terminus of said asparaginase, exemplified in this document (e.g. asparaginase SEQ ID NO:1) (e.g. up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 , 55, 60, 70, 75, 80, 85, 90, 95 or 100) and/or has a remote amino acids at both the N-terminus and the C-terminus of said asparaginase exemplified herein (e.g. asparaginase SEQ ID NO: 1), where the total number of deleted amino acids can be up to 125 or 150 amino acids.

[00067] It is well known in the art that a polypeptide can be modified by substitution, insertion, deletion and/or addition of one or more amino acids while retaining its enzymatic activity. The term "one or more amino acids" in this context may refer to one, two, three, four, five, six, seven, eight, nine, ten or more amino acids. For example, replacing one amino acid at a given position with a chemically equivalent amino acid that does not affect the functional properties of the protein is common practice. Substitutions may be defined as exchanges in one of the following groups:

Small aliphatic, non-polar or slightly polar residues: Ala, Ser, Thr, Pro, Gly

Polar negatively charged residues and their amides: Asp, Asn, Glu, Gln

Polar positively charged residues: His, Arg, Lys

Large aliphatic, non-polar residues: Met, Leu, Ile, Val, Cys

Large aromatic residues: Phe, Tyr, Trp.

[00068] Thus, changes that result in the replacement of one negatively charged residue with another (such as the replacement of glutamic acid with aspartic acid) or one positively charged residue with another (such as the replacement of lysine with arginine) can be expected to result in functionally equivalent product.

[00069] The positions at which the amino acids are modified and the number of amino acids to be modified in the amino acid sequence are not specifically limited. One skilled in the art is able to recognize modifications that can be introduced without affecting the activity of the protein. For example, modifications to the N- or C-terminus of a protein would not be expected to change the activity of the protein under certain circumstances. In particular, certain asparaginases have been extensively characterized, especially with respect to the sequences, structures and residues forming the active catalytic site. This characterization provides guidance on residues that can be modified without affecting enzyme activity. All known L-asparaginases from bacterial sources have common structural features. They are all homotetramers with four active sites between the N- and C-terminal domains of two adjacent monomers (AghaipouR (2001) Biochemistry 40, 5655-5664, incorporated herein by reference in its entirety). All of them have a high degree of similarity in their tertiary and quaternary structures (Papageorgiou (2008) FEBS J. 275, 4306-4316, incorporated herein by reference in its entirety). The catalytic site sequences of L-asparaginases are highly conserved between Erwinia chrysanthemi , Erwinia carotovora , and E. coli L-asparaginase II ( Id ). The flexible loop of the active site contains amino acid residues 14-33 and structural analysis shows that Thr15, Thr95, Ser62, G1u63, Asp96 and A1a120 bind to the ligand ( Id ). Aghaipour et al. performed a detailed analysis of the four active sites of Erwinia chrysanthemi L-asparaginase by examining high resolution crystal structures of the enzyme complexing with its substrates ( Aghaipour (2001) Biochemistry 40, 5655-5664). Kotzia et al. have provided sequences for L-asparaginases from several species and subspecies of Erwinia and although the proteins share only about 75-77% identity between Erwinia chrysanthemi and Erwinia carotovora , each still has L-asparaginase activity (Kotzia (2007) J. Biotechnol. 127 , 657-669). Moola et al have performed epitope mapping studies on Erwinia chrysanthemi 3937 L-asparaginase and were able to maintain enzyme activity even after mutating various antigenic sequences in an attempt to reduce asparaginase immunogenicity (Moola (1994) Biochem . J. 302, 921-927). Because L-asparaginases have been extensively characterized, one of skill in the art can determine how to make fragments and/or sequence substitutions while maintaining enzyme activity.

[00070] As used herein, the term "about" changes, for example, sizes, volumes, the amount of an ingredient in a composition, concentrations, process temperatures, process times, yields, flow rates, pressures, and the like, and ranges thereof, and refers to a change in numerical the amount that may occur, for example, as a result of typical measurement and processing procedures used to manufacture compounds, compositions, concentrates or formulations for use; due to an unintentional error in these procedures; due to differences in manufacture, source, or purity of starting materials or ingredients used to carry out the methods; as well as other factors to be taken into account. The term "about" also encompasses amounts that differ due to aging, such as a composition, drug, or cell culture at a particular starting concentration or mixture, and amounts that differ due to mixing or processing of a composition or preparation from a particular starting concentration or mixture. . Modified by the term "about" the claims appended to this document include the equivalents of these amounts. The term "about" hereinafter may refer to a range of values that are similar to the stated reference value. In some embodiments, the term "about" refers to a range of values that are within 10, 9, 8.7, 6, 5.4, 3, 2, 1 percent or less of a claimed reference value.

[00071] In the context of the present invention, it has surprisingly been found that the chemical conjugation of one or more peptides consisting solely of the amino acid residues of proline and alanine through a specific ^C -terminal amino acid residue (RC ) with L-asparaginase allows you to get a modified L-asparaginase protein , having a particularly high combination ratio of said peptides per asparaginase molecule and thus significantly reduced immunogenicity and increased plasma half-life. In addition, it was found that this new technique can also be applied to L-asparaginase without compromising its catalytic activity, which significantly increases the therapeutic value of the corresponding modified proteins described in this document.

[00072] In one aspect, this document describes a modified protein containing (i) L-asparaginase having at least 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identity the amino acid sequence of SEQ ID NO:1; and (ii) one or more peptides, wherein the peptide consists solely of the amino acid residues of proline and alanine.

[00073] In a preferred aspect, the modified protein is a modified L-asparaginase protein and one or more peptides, each independently a peptide R ^N -(P/A) ^-RC where (P/A) is an amino acid sequence, consisting solely of the amino acid residues of proline and alanine, where RN is a protecting group attached to the ^N -terminal amino group of the amino acid sequence, and where RC is an amino acid residue linked through its amino group to the ^C -terminal carboxyl group of the amino acid sequence, where each the peptide is conjugated to L-asparaginase through an amide bond formed by the carboxyl group of the ^C -terminal amino acid residue RC of the peptide and the free amino group of L-asparaginase, and where at least one of the free amino groups to which the peptides are conjugated is not an N-terminal α- amino group of L-asparaginase.

[00074] In some aspect, the modified protein monomer is from about 350, 400, 450, 500 amino acids to about 550, 600, 650, 700, or 750 amino acids after modification. In additional aspects, the modified protein contains from about 350 to about 750 amino acids, or from about 500 to about 750 amino acids.

[00075] Each peptide that is contained in a modified protein as described herein is independently an RN -(P/A) ^{-RC peptide} . Accordingly, for each of the peptides contained in the modified protein described herein, each of the ^N -terminal protecting group RN , amino acid sequence (P/A), and ^C -terminal amino acid residue RC is independently selected from their respective values. Thus, two or more peptides contained in a modified protein may be the same or different from each other. In one aspect, all peptides contained in the modified protein are the same.

[00076] In addition, the peptides contained in the modified protein preferably adopt a random coil conformation, especially when the modified protein is present in an aqueous medium (eg, an aqueous solution or an aqueous buffer). The presence of a random coil conformation can be determined using techniques known in the art, in particular spectroscopic techniques such as circular dichroism (CD) spectroscopy.

[00077] The (P/A) fragment in the chemically conjugated modified protein that is contained in the R ^N -(P/A) ^-RC peptide is an amino acid sequence that can consist of a total of 10 to 100 proline amino acid residues and alanine, a total of 15 to 60 proline and alanine amino acid residues, a total of 15 to 45 proline and alanine amino acid residues, e.g. a total of 20 to about 40 proline and alanine amino acid residues, e.g. 15, 16 , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44 or 45 amino acid residues of proline and alanine. In a preferred aspect, said amino acid sequence consists of 20 amino acid residues of proline and alanine. In another preferred aspect, said amino acid sequence consists of 40 amino acid residues of proline and alanine. In the peptide R ^N -(P/A)-R ^C , the ratio of the number of proline residues contained in the fragment (P/A) to the total number of amino acid residues contained in (P/A) is preferably ≥ 10% and ≤70% , more preferably ≥20% and ≤50%, and even more preferably ≥25% and ≤40%. Accordingly, it is preferred that 10% to 70% of the total amino acid residues in (P/A) are proline residues; more preferably, 20% to 50% of the total amino acid residues included in (P/A) are proline residues; and even more preferably, 25% to 40% (eg 25%, 30%, 35% or 40%) of the total amino acid residues contained in (P/A) were proline residues. Moreover, it is preferred that (P/A) does not contain any consecutive proline residues (ie, that it does not contain a partial PP sequence). In a preferred aspect (P/A) is the amino acid sequence AAPAAPAPAAPAAPAPAAPA (SEQ ID NO: 5). In another preferred aspect, (P/A) is the amino acid sequence AAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPA (SEQ ID NO: 15).

[00078] The RN group in the RN -(P/A) ^{-RC peptide} may be a protecting group that is attached to the ^N -terminal amino group, in particular the N-terminal α-amino group of the amino acid sequence (P/A). Preferably RN is ^{pyroglutamoyl} or acetyl.

[ ⁰⁰⁰⁷⁹ ] The RC group in the RN -(P/A) ^-RC peptide is an amino acid residue that is linked via its amino group to a ^C -terminal carboxy group (P/A) and that contains at least two carbon atoms between its amino group and its carboxy group. It will be understood that at least two carbon atoms between the amino group and the carboxy group of ^RC can provide a distance of at least two carbon atoms between the amino group and the carboxy group of RC (which is the case if, for example, ^RC is ω-amino- ^C _{3- 15} alkanoic acid such as ε-aminohexanoic acid). Preferably, RC is ε- ^{aminohexanoic} acid.

[00080] In one embodiment, the peptide is Pga-AAPAAPAPAAPAAPAPAAPA-Ahx-COOH (SEQ ID NO:16) or Pga-AAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPA-Ahx-COOH (SEQ ID NO:17). The term "Pga" is an abbreviation for "pyroglutamoyl" or "pyroglutamic acid". The term "Ahx" is an abbreviation for "ε-aminohexanoic acid".

[00081] As also demonstrated in the accompanying examples, it was unexpectedly found that the use of the ^C -terminal amino acid residue RC as defined herein, including, in particular, ε-aminohexanoic acid, allows you to get modified proteins with a predominantly high combination ratio peptides consisting solely of proline and alanine amino acid residues per asparaginase molecule, and thus advantageously reduces immunogenicity and advantageously increases plasma half-life.

[00082] In the modified proteins described herein, each R ^N -(P/A) ^-RC peptide can be conjugated to L-asparaginase via an amide bond formed from the carboxy group of the ^C -terminal amino acid residue of the RC peptide and the free amino group of L- asparaginase. The free amino group of L-asparaginase may be, for example, the N-terminal α-amino group or the amino group of the side chain of L-asparaginase (for example, the ε-amino group of a lysine residue contained in L-asparaginase). If the L-asparaginase is composed of multiple subunits, for example if the L-asparaginase is a tetramer, multiple N-terminal α-amino groups may be present (i.e., one for each subunit). In one aspect, 9 to 13 peptides as defined herein (eg, 9, 11, 12, or 13 peptides) may be chemically conjugated to L-asparaginase (eg, each subunit/monomer of L-asparaginase).

[00083] As described above, in one aspect, at least one of the free amino groups to which the peptides are chemically conjugated is not (ie, different from) the N-terminal α-amino group of L-asparaginase. Accordingly, it is preferred that at least one of the free amino groups to which the peptides are conjugated is the side chain amino group of L-asparaginase, and it is especially preferred that at least one of the free amino groups to which the peptides are conjugated is an ε-amino group. lysine residue of L-asparaginase.

[00084] In addition, it is preferred that the free amino groups to which the peptides are conjugated are selected from the ε-amino groups of any L-asparaginase lysine residues, the N-terminal α-amino groups of L-asparaginase, or any L-asparaginase subunits, and any combination thereof. It is particularly preferred that one of the free amino groups to which the peptides are conjugated is the N-terminal α-amino group, while the others of the free amino groups to which the peptides are conjugated are the ε-amino groups of the lysine residue of L-asparaginase. Alternatively, it is preferred that each of the free amino groups to which the peptides are conjugated is the ε-amino group of a lysine residue of L-asparaginase.

[00085] Modified proteins as described herein consist of L-asparaginase and one or more peptides as defined herein. The corresponding modified protein may, for example, consist of one L-asparaginase and one, two, three, four, five, six, seven, eight, nine, ten, 15, 20, 25, 30, 35, 40, 45, 50, 55 (or more) peptides, each of which is conjugated to L-asparaginase. L-asparaginase may be, for example, a monomeric protein or a protein consisting of multiple subunits, such as a tetramer. If L-asparaginase is a monomeric protein, the corresponding modified protein may, for example, consist of one monomeric L-asparaginase and nine to thirteen (or more) (e.g., 9, 10, 11, 12, or 13) peptides, each of which is conjugated with monomeric L-asparaginase. An exemplary amino acid sequence of monomeric L-asparaginase is shown in SEQ ID NO. 1. If L-asparaginase is a protein consisting of multiple subunits, for example, four subunits (i.e., if said L-asparaginase is a tetramer), the corresponding modified protein may, for example, consist of four subunits of L-asparaginase and nine to thirteen (or more) (eg, 9, 10, 11, 12, or 13) peptides as defined herein, each conjugated to each L-asparaginase subunit. An exemplary amino acid sequence of the L-asparaginase subunit is shown in SEQ ID NO. 1. Similarly, if L-asparaginase is a protein consisting of multiple subunits, for example, four subunits (i.e., if said L-asparaginase is a tetramer), the corresponding modified protein may, for example, consist of four subunits L -asparaginase and 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53 , 54, 55 (or more) peptides, each of which is conjugated to the L-asparaginase tetramer. In one aspect, the invention provides a modified protein having L-asparaginase and a plurality of chemically linked peptide sequences. In a further aspect, the length of the peptide sequences is from about 10 to about 100, from about 15 to about 60, or from about 20 to about 40.

[00086] A peptide consisting solely of the amino acid residues of proline and alanine can be covalently linked to one or more amino acids of said L-asparaginase, such as lysine residues and/or an N-terminal residue, and/or a peptide consisting solely of proline and alanine, and amino acid residues can be covalently linked to at least about 40%, 50%, 60%, 70%, 80%, or 90% to about 60%, 70%, 80%, 90%, or 100% of the available amino groups, including amino groups of lysine residues and/or N -terminal residue on the surface of L-asparaginase. For example, about 11-12 lysine residues may be available per L-asparaginase, and about 9-12 lysines will be conjugated to a peptide consisting solely of the amino acid residues of proline and alanine. In additional aspects, a peptide consisting solely of the amino acid residues of proline and alanine is covalently linked to from about 20%, 30%, 40%, 50%, or 60% to about 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the total lysine residues. said L-asparaginase. In other embodiments, a peptide consisting solely of the amino acid residues of proline and alanine is covalently linked to L-asparaginase via a linker. Exemplary linkers include those disclosed in US Patent Application Publication No. 2015/0037359, which is incorporated herein by reference in its entirety.

[00087] In addition, said modified protein may have a half-life of at least about 5, 10, 12, 15, 24, 36, 48, 60, 72, 84, or 96 hours at a dose of about 25 μg protein/kg, and/ or longer in vivo half-life compared to unmodified L-asparaginase. In addition, said modified protein may have a larger area under the plasma drug concentration versus time curve (AUC) compared to L-asparaginase.

[00088] The modified protein of the present invention can be obtained using methods known in the art. In particular, it can be made using the method described below and/or in accordance with the procedures described in the examples, or by analogy with them.

[00089] The invention further relates to a method for producing a modified protein as defined herein, the method comprising: (a) combining an activated peptide of the formula R ^N -(P/A)-R ^C-act where R ^{C -act} is a carboxy-activated form of ^RC where ^RC and (P/A) have the meanings defined for the modified protein to be made and where RN is a protecting group that is attached to the ^N -terminal amino group (P /A), with L-asparaginase to obtain a modified L-asparaginase protein and peptides, in which ^RN represents a protective group.

[00090] The carboxy-activated C-terminal amino acid residue R ^{C -act} that is contained in the activated peptide may be any amino acid residue RC as described and defined herein in relation to the peptide, where the carboxy group ^RC is in the form of an activated carboxy groups. Preferably, the activated carboxy group of the amino acid residue R ^C-act in the activated peptide is an active ester group.

[00091] If the activated carboxy group R ^C-act is an active ester group, it is preferably selected from any of the following active ester groups:

[00092]

[00093] A particularly preferred active ester group is the 1-hydroxybenzotriazole (HOBt) active ester group. Accordingly, it is particularly preferred that the activated carboxy group R ^C-act is a group with the following formula:

[00094]

[00095] (active ester group HOBt)

[00096] The method may further comprise before step (a) an additional step of converting a peptide of the formula R ^N -(P/A) ^-RC where ^RC and (P/A) are defined for the modified protein to be prepared, and where RN is a protecting group that is attached to the ^N -terminal amino group (P/A) in the activated P/A peptide.

[00097] For example, to obtain an activated peptide having a 1-hydroxybenzotriazole active ester group as the activated carboxy group R ^C-act , the step of converting the peptide to an activated peptide can be carried out by reacting the peptide with a phosphonium, uronium or immonium ester salt of 1-hydroxybenzotriazole ( HOBt) in the presence of a base. The salt of the phosphonium, uronium or ammonium derivative of HOBt is preferably O-(benzotriazol-1-yl)-1,1,3,3-tetramethyluronium tetrafluoroborate (TBTU).

[00098] The coupling step (a) and the previous optional step of converting the peptide to an activated peptide can be carried out, for example, using any of the peptide coupling or amide bond formation methods described in the literature, for example, in any of: El-Faham et al ., 2011 Chem Rev. 111(11), 6557-6602; Montalbetti et al., 2005 Tetrahedron, 61(46), 10827-10852; Klose et al., 1999 Chem. commun. 18, 1847-1848; Valeur et al., 2007; Carpino et al., 1995 J. Am. Chem. soc. 117(19), 5401-5402);; Valeur et al., 2009 Chem. soc. Rev., 38(2), 606-631; or Hermanson, 2013 Bioconjugate techniques. third edition. academic press. Suitable reagents and reaction conditions for such procedures are further described in the aforementioned literature and in the additional references cited therein. Additional descriptions are given in US patent No. 8,563,521; 9,260,494; and 9,221,882, each of which is incorporated herein by reference in its entirety.

[ ⁰⁰⁰⁹⁹ ] Methods for removing RN protecting groups, as required in optional step (b), are well known in the art and are described, for example, in Wuts et al., 2012 Greene's Protective Groups in Organic Synthesis. Fourth edition. John Wiley & Sons and/or in Isidro-Llobet et al., 2009 Chem. Rev. 109(6), 2455-2504. Thus, the optional step (b) may be carried out, for example, as described for the corresponding protecting group ^RN in any of the above references.

[000100] In some aspects, the invention relates to a modified protein containing (i) L-asparaginase having at least 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% amino acid identity sequence SEQ ID NO:1 and (ii) and a polypeptide, where the polypeptide consists solely of the amino acid residues of proline and alanine. In one aspect, the modified protein is a fusion protein. A polypeptide consisting solely of proline and alanine amino acid residues may be from about 200 to about 400 proline and alanine amino acid residues in length. In other words, a polypeptide may consist of about 200-400 proline and alanine amino acid residues. In a preferred aspect, the polypeptide is composed of about 200 (e.g., 201) amino acid residues of proline and alanine (i.e., has a length of about 200 (e.g., 201) amino acid residues of proline and alanine), or the polypeptide is composed of a total of about 400 (e.g., 401) amino acid residues of proline and alanine (i.e., has a length of approximately 400 (for example, 401) amino acid residues of proline and alanine). In some preferred embodiments, the implementation of the polypeptide contains or consists of the amino acid sequence presented in SEQ ID NO: 7 or 9; or the polypeptide contains or consists of an amino acid sequence encoded by a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 8 or 10. In some aspects, the modified protein, preferably wherein the modified protein is a fusion protein, and each monomer has from about 350, 400, 450, 500 amino acids to about 550, 600, 650, 700, 750, or 1000 amino acids, includes the monomer and amino acid sequence P/A. In additional aspects, the modified protein contains from about 350 to about 800 amino acids, or from about 500 to about 750 amino acids.

[000101] For example, a polypeptide includes peptides obtained in US patent No. 9,221,882.

[000102] In a preferred aspect, the modified protein comprises or consists of the amino acid sequence as shown in SEQ ID NO: 11 or 13; or (b) contains or consists of an amino acid sequence encoded by a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 12 or 14. This document assumes that the modified protein includes (a) a protein having the amino acid sequence shown in SEQ ID NO: 11 or 13; (b) a protein as defined in (a), wherein one to 65 amino acids are removed, inserted, added or substituted in the asparaginase; (c) a protein encoded by a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 12 or 14; (d) a protein having an amino acid sequence encoded by a nucleic acid that hybridizes under stringent conditions to a complementary strand of nucleic acid molecules as defined in (c); (e) a protein having at least 85% identity to a protein according to any one of paragraphs. (a)-(d); and (f) a protein having an amino acid sequence encoded by a nucleic acid that is degenerate, due to the genetic code, in the nucleotide sequence of the nucleic acid as defined in (c) or (d).

[000103] A modified protein as defined herein may be composed of four subunits, where the subunits are selected from the group consisting of (a) a protein having the amino acid sequence shown in SEQ ID NO: 1; (b) a protein as defined in (a), wherein one to 65 amino acids are removed, inserted, added or substituted in the asparaginase; (c) a protein encoded by a nucleic acid molecule having the nucleotide sequence shown in SEQ ID NO: 2; (d) a protein having an amino acid sequence encoded by a nucleic acid that hybridizes under stringent conditions to a complementary strand of nucleic acid molecules as defined in (c); (e) a protein having at least 85% identity to a protein according to any one of paragraphs. (a)-(d); and (f) a protein having an amino acid sequence encoded by a nucleic acid that is degenerate, due to the genetic code, in the nucleotide sequence of the nucleic acid as defined in (c) or (d).

[000104] The invention relates to a nucleic acid encoding a modified protein as defined herein, in particular if the modified protein is a modified protein of L-asparaginase and a polypeptide, where the polypeptide consists solely of the amino acid residues of proline and alanine. In a preferred aspect, the modified protein is a fusion protein. In a preferred aspect, the nucleic acid is selected from the group consisting of: (a) a nucleic acid containing the nucleotide sequence of SEQ ID NO: 12 or 14; (b) a nucleic acid containing a nucleotide sequence having at least 85% identity to the nucleotide sequence defined in (a); and (c) a nucleic acid that is degenerate, due to the genetic code, in a nucleotide sequence as defined in (a).

[000105] In a further aspect, the invention provides a nucleotide sequence encoding a fusion protein, including a nucleotide sequence having at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide identity a sequence selected from the group consisting of SEQ ID NO: 12 or 14. While the encoded polypeptide contains a repetitive amino acid sequence that can form a random coil, the encoding nucleic acid preferably contains sequences with low nucleotide repetition. In other words, the nucleic acid may comprise a nucleotide sequence encoding a PA rich polypeptide, wherein said coding nucleotide sequence contains nucleotide repeats having a maximum length of 14, 15, 16, 17, about 20, about 25, about 30, about 35, about 40, about 45, about 50 or about 55 nucleotides. The low rep nucleic acid disclosed herein may be advantageous over the high rep nucleic acid molecules. In particular, the genetic stability of the low repeat nucleic acid molecules to be used in this disclosure can be improved.

[000106] In some aspects, the nucleotide sequence is a sequence encoding any of the modified proteins, including L-asparaginase and a polypeptide, where the polypeptide consists solely of the amino acid residues of proline and alanine, preferably where the modified protein is a hybrid protein described in this document, except that one or more amino acids are added, deleted, inserted or replaced, provided that the fusion protein having that amino acid sequence has L-asparaginase activity.

[000107] In additional aspects, the invention relates to a (recombinant) vector containing a nucleotide sequence encoding a modified protein containing L-asparaginase and a polypeptide, where the polypeptide consists solely of the amino acid residues of proline and alanine, preferably where the modified protein is a fusion protein according to as described herein, where the vector can express a modified protein (eg, a fusion protein). In additional aspects, the invention also relates to a host containing the (recombinant) vector described in this document. The host can be yeasts such as Saccharomyces cerevisiae and Pichia Pistoris , as well as bacteria, actinomycetes, fungi, algae and other microorganisms, including Escherichia coli , Bacillus sp., Pseudomonas fluorescens, Corynebacterium glutamicum and bacterial hosts of the following genera: Serratia , Proteus , Acinetobacter and Alcaligenes . Other hosts are known to those skilled in the art, including Nocardiopsis alba , which expresses a variant of asparaginase lacking glutaminase activity (Meena et al . (2014) Bioprocess Biosyst. Eng , October 2014 article, which is incorporated herein by reference in its entirety. ) and articles disclosed in Savitri et al . (2003) Indian Journal of Biotechnology , 2, 184-194, which are incorporated herein by reference in their entirety.

[000108] The present invention relates to a vector containing a nucleic acid as described herein above, i.e., a nucleic acid encoding a modified protein as defined herein, in particular a modified L-asparaginase protein and a polypeptide, wherein the polypeptide consists solely of the amino acid residues of proline and alanine, such as a fusion protein. In a preferred aspect, the nucleic acid is selected from the group consisting of: (a) a nucleic acid containing the nucleotide sequence of SEQ ID NO: 12 or 14; (b) a nucleic acid containing a nucleotide sequence having at least 85% identity to the nucleotide sequence defined in (a); and (c) a nucleic acid that is degenerate, due to the genetic code, in a nucleotide sequence as defined in (a).

[000109] The invention relates to a host cell containing a nucleic acid as defined herein, or containing a vector as defined herein. Example hosts are listed above.

[000110] The invention further relates to a method for producing a modified protein as described herein, preferably a fusion protein or nucleic acid encoding it. The method may include culturing a host cell as defined herein and isolating said modified protein from the culture or from said cell. The method may include culturing a host cell (e.g., a host cell transformed with a nucleic acid, or a host cell containing a nucleic acid and/or a vector containing a nucleotide sequence encoding a modified protein (preferably a fusion protein) under conditions that cause expression of the modified protein (preferably a fusion protein) Examples of hosts are listed above.

[000111] Many suitable vectors are known to those skilled in the art of molecular biology. The choice of an appropriate vector depends on the desired function, including plasmids, cosmids, viruses, bacteriophages, and other vectors commonly used in genetic engineering.

[000112] Methods well known to those skilled in the art can be used to construct various plasmids, see, for example, the methods described in Sambrook (2012) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press. Exemplary plasmid vectors include, for example, pQE-12, pUCseries, pBluescript (Stratagene), pET (Novagen) or pCRTOPO (Invitrogen) expression vector series, lambda gt11, pJOE, pBBR1-MCS series, pJB861, pBSMuL, pBC2, pUCPKS , pTACT1. Exemplary vectors compatible with expression in mammalian cells include the Kozak-Sherry E-027 pCAG vector system (L45a), pREP (Invitrogen), pCEP4 (Invitrogen), pMC1neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene) , EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, pIZD35, Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pRc/CMV, pcDNA1, pcDNA3 (Invitrogen), pcDNA3.1, pSPORT1 (GIBCO BRL), pGEMHE (Promega), pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (Edge Biosystems) pTriEx-Hygro (Novagen), and pCINeo (Promega). Non-limiting examples of plasmid vectors suitable for Pichia pastoris include, for example, plasmids pAO815, pPIC9K and pPIC3.5K (all Invitrogen).

[000113] Typically, vectors may contain one or more origins of replication (ori) and inheritance systems for cloning or expression, one or more markers for host selection, such as antibiotic resistance, and one or more expression cassettes. Examples of suitable origins of replication include, for example, full-length ColE1, truncated versions thereof such as those present in pUC plasmids, viral SV40, and the phage M13 origin of replication. Non-limiting examples of selectable markers include ampicillin, chloramphenicol, tetracycline, kanamycin, dhfr, gpt, neomycin, hygromycin, blasticidin or geneticin. In addition, said vector contains a regulatory sequence that is operably linked to said nucleotide sequence or nucleic acid molecule as defined herein.

[000114] Coding sequences, for example, said nucleotide sequences encoding a polypeptide contained in a vector, can be linked to (a) transcriptional regulatory elements and/or other amino acid coding sequences using established methods. Such regulatory sequences are well known to those skilled in the art and include, without limitation, transcriptional initiation regulatory sequences, internal ribosome binding sites (IRES), and optionally transcriptional termination and transcriptional regulatory elements. Non-limiting examples of such transcriptional initiation regulatory sequences include promoters, a translation initiation codon, enhancers, insulators, and/or transcription termination regulatory elements. Additional examples include Kozak sequences and introns flanked by donor and acceptor sites for RNA splicing, nucleic acid sequences encoding secretion signals or, depending on the expression system used, signal sequences capable of directing the expressed protein into a cellular compartment or culture medium.

[000115] Examples of suitable promoters include, without limitation, the cytomegalovirus (CMV) promoter, the SV40 promoter, the RSV (Rous sarcoma virus) promoter, the lacZ promoter, the avian β-actin promoter, the CAG-promoter (a combination of the avian β-actin promoter and the immediate- early enhancer of cytomegalovirus), human elongation factor-1α gene promoter, AOX1 promoter, GAL1 promoter, CaM kinase promoter, lac, trp or tac promoter, lacUV5 promoter, T7 or T5 promoter, Autographa californica nuclear polyhedrosis virus (AcMNPV) polyhedrin gene promoter or globin intron in mammals, as well as other animal cells. One example of an enhancer is, for example, the SV40 enhancer. Non-limiting additional examples of transcription termination regulatory elements/sequences include the SV40 poly A site, the tk poly A site, or the AcMNPV polyhedrin gene polyadenylation signals.

[000116] In addition, depending on the expression system, leader sequences capable of directing the polypeptide into the cellular compartment or secreting it into the environment can be added to the nucleic acid coding sequence presented herein. The leader sequences assemble in frame with the translation, initiation and termination sequences, and preferably the leader sequence is capable of directing the secretion of the translated protein, or portion thereof, into the periplasmic space or into the extracellular environment. Suitable leader sequences are, for example, the BAP (bacterial alkaline phosphatase), CTB (cholera toxin B subunit), DsbA, ENX, OmpA, PhoA, stII, OmpT, PelB, Tat (double arginine translocation) signal sequences in E. coli and signal sequences of bovine growth hormone, human chymotrypsinogen, human factor VIII, human Ig-kappa, human insulin, human interleukin-2, luciferase from Metrida or Vargula , human trypsinogen-2, inulinase from Kluyveromyces marxianus, mating factor alpha-1 from Saccharomyces cerevisiae , mellitin, human azurocidin, and the like in eukaryotic cells.

[000117] The vectors may also contain an additional expressible nucleic acid sequence encoding one or more chaperones to facilitate proper protein folding.

[000118] In some aspects, the vector of the present invention is an expression vector. An expression vector is capable of directing the replication and expression of a nucleic acid molecule of the invention, for example, a nucleic acid comprising a nucleotide sequence encoding a polypeptide and a nucleotide sequence encoding an asparaginase.

[000119] Nucleic acid molecules and/or vectors as described herein above may be designed to be introduced into cells, for example, by non-chemical means (electroporation, sonoporation, optical transfection, gene electrotransfer, hydrodynamic delivery, or natural transformation upon contact of cells with nucleic acid molecule according to the invention), chemical methods (calcium phosphate, DMSO, PEG, liposomes, DEAE-dextran, polyethyleneimine, nucleofection, etc.), particle-based methods (gene gun, magnetofection, impalfection), methods based on a phage or phagemid vector, and viral methods. For example, expression vectors derived from viruses such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses, Semliki forest virus, or bovine papillomavirus can be used to deliver nucleic acid molecules to a target cell population.

[000120] The present invention also relates to a host cell or non-human host transformed with the vector or nucleic acid described herein. It is understood that the term “host cell or non-human host transformed with a vector” refers to a host cell or non-human host that contains a vector or nucleic acid as described herein. Host cells for expression of polypeptides are well known in the art and include prokaryotic cells and eukaryotic cells. Suitable culture media and conditions for the above described host cells are known in the art.

[000121] "Cultivation of a host or host cell" includes expression of a modified protein, including as a fusion protein as defined herein, and/or a polypeptide as defined herein, and/or asparaginase in a host or host cell.

[000122] Methods for isolating a modified protein and/or polypeptide as defined herein and/or asparaginase include, but are not limited to, purification steps such as purification by affinity chromatography (preferably using a fusion label such as Strep- tag II or His ₆ tag), size exclusion chromatography, anion exchange chromatography, cation exchange chromatography, hydrophobic interaction chromatography, high pressure liquid chromatography (HPLC), reverse phase HPLC, ammonium sulfate precipitation, or immunoprecipitation. These methods are well known in the art and are generally described in, for example, Scopes (1994) Protein Purification - Principles and Practice, Springer. Such methods provide substantially purified polypeptides. Said pure polypeptides have a homogeneity of preferably at least about 90% to 95% (at the protein level), more preferably at least about 98% to 99%. Most preferably, such pure polypeptides are suitable for pharmaceutical use.

[000123] This document provides that a modified protein containing L-asparaginase and a polypeptide can be obtained by expressing a nucleic acid molecule containing a nucleotide sequence encoding a polypeptide and a nucleic acid sequence encoding an asparaginase. The expressed modified protein can be isolated. Alternatively, the modified protein can be obtained by culturing/cultivating a host containing a nucleotide sequence or nucleic acid molecule encoding said polypeptide consisting solely of proline and alanine. Thus, the nucleic acid is expressed in the host. The resulting polypeptide may be isolated. The resulting polypeptide can be conjugated to asparaginase, for example via a peptide bond or a non-peptide bond.

[000124] The modified proteins described herein can be used to treat a disease that can be treated by asparagine depletion. The asparagine depletion treatable disease is preferably a cancer, such as a non-solid cancer. Preferably, the non-solid cancer is leukemia or non-Hodgkin's lymphoma. The leukemia is preferably acute lymphoblastic leukemia (ALL) or acute myeloid leukemia (AML). For example, the modified proteins are useful in the treatment or manufacture of a medicament for use in the treatment of acute lymphoblastic leukemia (ALL) in both adults and children, or acute myeloid leukemia (AML) in both adults and children. The use of the modified proteins described herein is contemplated for the treatment of other pathological conditions in which the beneficial effect of asparagine depletion is expected. Such pathological conditions include, but are not limited to, malignant neoplasms or cancers, including, but not limited to, malignant neoplasms in the circulatory system, NK cell lymphoma, pancreatic cancer, Hodgkin's disease, acute myelocytic leukemia, acute myelomonocytic leukemia, chronic lymphocytic leukemia, lymphosarcoma, reticulocellular sarcoma, melanosarcoma, and diffuse B-cell large cell lymphoma (DLBCL). The cancer may be a solid cancer such as lung cancer or breast cancer. Exemplary non-malignant blood diseases responsive to asparagine depletion include immune system-mediated blood diseases, such as infectious diseases such as those caused by HIV infection (ie, AIDS). Diseases other than diseases of the circulatory system associated with aspartic dependence include autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus, autoimmune diseases, vascular collagenoses, and so on. Other autoimmune diseases include osteoarthritis, Issac's syndrome, psoriasis, insulin-dependent diabetes mellitus, multiple sclerosis, sclerosing panencephalitis, systemic lupus erythematosus, rheumatic fever, inflammatory bowel disease (eg, ulcerative colitis and Crohn's disease), primary biliary cirrhosis, chronic active hepatitis, glomerulonephritis , myasthenia gravis, pemphigus vulgaris, and Graves' disease. Cells suspected of causing disease can be tested for asparagine dependence using any suitable in vitro or in vivo assay, for example using an in vitro assay , provided the growth medium is free of asparagine.

[000125] The invention further relates to a method for treating a disease treatable by L-asparagine depletion in a patient, said method comprising administering to said patient an effective amount of the modified protein. In some preferred aspects, said L-asparagine depletion treatable disease is acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), or non-Hodgkin's lymphoma. In some aspects, said disease treatable by L-asparagine depletion is cancer, including, but not limited to, NK cell lymphoma and pancreatic cancer. In additional embodiments, the modified protein described herein elicits a lower immunogenic response in said patient compared to L-asparaginase of said modified protein.

[000126] In some aspects, the modified protein described above has a longer circulating half-life in vivo after a single dose compared to unmodified L-asparaginase of said modified protein. The modified protein described herein can reduce plasma levels of L-asparagine over a period of time of at least about 12, 24, 48, 72, 96, or 120 hours when administered at a dose of 5 U/kg body weight (by weight) or 10 mcg/kg (based on protein content). The modified protein described herein can reduce plasma levels of L-asparagine to undetectable levels over a time period of at least about 12, 24, 48, 72, 96, 120, or 144 hours when administered at a dose of 25 U/kg body weight, or 50 mcg/kg (based on protein content). The modified protein described herein can reduce plasma levels of L-asparagine over a period of time of at least about 12, 24, 48, 72, 96, 120, 144, 168, 192, 216, or 240 hours when administered at a dose of 50 U /kg body weight or 100 mcg/kg (based on protein content). The modified protein described herein can reduce plasma levels of L-asparagine to undetectable levels over a period of at least about 12, 24, 48, 72, 96, 120, 144, 168, 192, 216, or 240 hours when administered in a dose in the range of about 10,000 to about 15,000 IU/m ² (about 20-30 mg protein/m ² ).

[000127] The modified protein described herein can result in a similar level of depletion of L-asparagine over a period of time (eg, 24, 48, or 72 hours) after a single dose.

[000128] The modified protein described herein may have a longer t _1/2 time than unmodified L-asparaginase administered at an equivalent protein dose. The modified protein described above may have a higher AUC value (e.g., at least 1.5, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times) after a single dose compared to L-asparaginase of said unmodified protein. squirrel.

[000129] In some aspects, the modified protein described herein does not elicit any significant antibody response for a certain period of time after a single dose, such as more than about 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, etc. For example, the modified protein does not elicit any significant antibody response for at least 8 weeks. In one example, "does not elicit any significant antibody response" means that the subject receiving the modified protein has been identified, within generally accepted parameters, as antibody negative. Antibody levels can be determined by methods known in the art, for example, ELISA or surface plasmon resonance analysis (Zalewska-Szewczyk (2009) Clin. Exp. Med . 9, 113-116; Avramis (2009) Anticancer Research 29, 299- 302, each of which is incorporated herein by reference in its entirety). The modified protein may have any combination of these properties.

[000130] In some aspects, treatment with the modified protein described herein will be administered as first line therapy. In another aspect, treatment with the modified protein will be given as a second-line therapy in patients, especially those with ALL, who have developed objective evidence of allergy or hypersensitivity, including "latent hypersensitivity", to other asparaginase preparations, in particular native L-asparaginase, derived from Escherichia coli, or its pegylated variant (pegaspargase). Non-limiting examples of objective signs of allergy or hypersensitivity include "antibody positive" testing for the enzyme asparaginase. In a specific aspect, the modified protein is used in second line therapy after treatment with pegapargas. The patient may have had prior hypersensitivity to E. coli L-asparaginase and/or may have had prior hypersensitivity to Erwinia L-asparaginase. Hypersensitivity may be selected from the group consisting of allergic reaction, anaphylactic shock and latent hypersensitivity.

[000131] The recurrence rate in patients with ALL after treatment with L-asparaginase remains high: approximately 10-25% of patients with ALL in children have an early relapse (for example, some during the maintenance phase 30-36 months after induction) (Avramis (2005) Clin Pharmacokinet 44, 367-393). If a patient receiving E. coli -derived L-asparaginase relapses, subsequent treatment with E. coli preparations may result in a "vaccination" effect, resulting in the E. coli preparation being more immunogenic during subsequent doses. The modified protein described herein can be used in a method of treating patients with relapsing ALL previously treated with other asparaginase preparations, in particular those previously treated with E. coli derived asparaginases. Relapse of the disease may occur after treatment with E. coli L-asparaginase or its pegylated form.

[000132] In another aspect, the invention relates to a method of treating acute lymphoblastic leukemia, comprising administering to a patient in need of treatment a therapeutically effective amount of the modified protein described above. In a particular aspect, the treatment will be administered at a dose of from about 1500 IU/m ² to about 15,000 IU/m ² , typically from about 10,000 to about 15,000 IU/m ² (about 20-30 mg protein/m ² ), at schedule from about twice a week to about once a month, usually once a week or once every other week. The modified protein described above can be administered as a single agent (e.g., monotherapy) or as part of a combination of chemotherapy drugs, including, but not limited to, glucocorticoids, corticosteroids, anticancer compounds, or other agents, including, but not limited to, methotrexate, dexamethasone, prednisone, prednisolone, vincristine, cyclophosphamide and anthracycline. As an example, patients with ALL will be administered the modified protein described above as a component of multi-agent chemotherapy during 3 phases of chemotherapy, including induction, consolidation or intensification and maintenance. In a specific example, the modified protein described above is not administered with an asparagine synthetase inhibitor (eg, such as described in WO 2007/103290, which is incorporated herein by reference in its entirety). In another specific example, the modified protein described above is not administered with an asparagine synthetase inhibitor, but is administered with other chemotherapy drugs. The modified protein described above may be administered before, after, or simultaneously with other compounds in a multi-agent chemotherapy regimen.

[000133] In a particular embodiment, the method comprises administering the modified protein described above in an amount of from about 1 U/kg to about 25 U/kg (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 U/kg) or their equivalent 20 (e.g. based on protein content) . The amount of modified protein to be delivered will depend on many factors, eg, IC ₅₀ , EC ₅₀ , biological half-life of the compound, age, size, weight and physical condition of the patient, and the disease or disorder being treated. The importance of these and other factors to be considered is well known to those skilled in the art. In some embodiments, the amount of modified protein to be administered can range from about 10 international units per square meter of patient body surface area (IU/m ² ) to 50,000 IU/m ² . In additional aspects, the modified protein is administered in an amount selected from the group consisting of about 5, about 10, and about 25 units/kg. In another specific aspect, the modified protein is administered at a dose of about 1000 IU/m2 to about 20,000 IU/ ^m2 (eg, 1000 IU/ ^m2 , 2000 IU/ ^m2 , 3000 IU/ ^m2 , 4000 IU/ ^m2 , 5000 IU/ ^m2 , 6000 IU/ ^m2 , 7000 IU/ ^m2 , 8000 IU/ ^m2 , 9000 IU/ ^m2 , 10,000 IU/ ^m2 , 11,000 IU/ ^m2 , 25-12,000 IU/m ² , 13,000 IU/ ^m2 , 14,000 IU/ ^m2 , 15,000 IU/ ^m2 , 16,000 IU/ ^m2 , 17,000 IU/ ^m2 , 18,000 IU/ ^m2 , 19,000 IU/ ^m2 or 20,000 IU/ ^m2 ). In another specific aspect, the modified protein described above is administered at a dose that depletes L-asparagine to undetectable levels using methods and devices known in the art over a period of about 3 days to about 10 days (e.g., 3, 4, 5, 6, 7, 8, 9 or 10 days) for a single dose.

[000134] The modified protein can be administered at a dose that depletes L-asparagine to undetectable levels over a period of 3 days to 10 days, 5 days to 20 days, 1 day to 15 days, or 2 days to 30 days. The modified protein can be administered at a dose that depletes L-asparagine to undetectable levels over a period of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days to 5, 6, 7, 8, 9 , 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days. The modified protein can be administered intravenously or intramuscularly. In further embodiments, said modified protein can be administered once or twice a week, less than once a week, or as monotherapy.

[000135] The present invention relates to a composition containing a modified protein as defined herein, or a modified protein obtained by a method as described herein. The composition may be a pharmaceutical composition optionally further comprising (a) pharmaceutically acceptable carriers or excipients.

[000136] The invention also relates to a pharmaceutical composition containing the modified protein described above. In a particular aspect, the pharmaceutical composition is contained in a vial as a lyophilized powder to be reconstituted with a solvent such as currently available native L-asparaginases, regardless of the bacterial source used to manufacture them (e.g. Kidrolase®, Elspar®, Erwinase® ). In another aspect, the pharmaceutical composition is a "ready to use" solution, such as pegaspargase (Oncaspar®), allowing, in addition to appropriate processing, to be administered, for example, intramuscularly, intravenously (infusion and/or bolus), intracerebroventricular (icv) and subcutaneously.

[000137] The modified protein, including compositions containing it (eg, a pharmaceutical composition), can be administered to a patient using standard techniques. Methods and formulations are generally found in Remington's Pharmaceutical Sciences, 22nd ed., Pharmaceutical Press, (2012). Suitable dosage forms depend in part on the use or route of administration, eg, oral, transdermal, transmucosal, or injection (parenteral). Such dosage forms should allow the therapeutic agent to reach the target cell or otherwise produce the desired therapeutic effect. For example, pharmaceutical compositions administered into the bloodstream are preferably soluble. Pharmaceutical compositions of the invention may be formulated as pharmaceutically acceptable salts and complexes thereof. Pharmaceutically acceptable salts are non-toxic salts present in the amounts and concentrations at which they are administered. The preparation of such salts can facilitate pharmaceutical use by changing the physical characteristics of the compound without interfering with its physiological action. Beneficial changes in physical properties include lowering the melting point to facilitate mucosal administration and increasing solubility to facilitate administration of higher drug concentrations. The pharmaceutically acceptable salt of the modified protein as described herein may be present as a complex, as will be appreciated by those skilled in the art. Pharmaceutically acceptable salts include acid addition salts such as salts containing sulfate, hydrochloride, fumarate, maleate, phosphate, sulfamate, acetate, citrate, lactate, tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, cyclohexylsulfamate and quinate. Pharmaceutically acceptable salts can be derived from acids, including hydrochloric acid, maleic acid, sulfuric acid, phosphoric acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, etc. -toluenesulfonic acid, cyclohexylsulfamic acid, fumaric acid and quinic acid. Pharmaceutically acceptable salts also include base addition salts such as salts containing benzathine, chlorprocaine, choline, diethanolamine, ethylenediamine, meglumine, procaine, aluminum, calcium, lithium, magnesium, potassium, sodium, ammonium, alkylamine and zinc, in the presence of acid functional groups such as carboxylic acid or phenol. For example, see Remington's Pharmaceutical Sciences above. Such salts can be prepared using suitable appropriate bases. Pharmaceutically acceptable carriers and/or excipients may also be included in the pharmaceutical composition of the invention to facilitate the administration of a particular asparaginase. Examples of carriers suitable for use in the practice of the invention include calcium carbonate, calcium phosphate, various sugars such as lactose, glucose or sucrose or types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols, and physiologically compatible solvents. Examples of physiologically compatible solvents include sterile solutions of water for injection (WFI - English: water for injection), saline and dextrose. Pharmaceutical compositions of the invention may be administered by various routes, including intravenous, intraperitoneal, subcutaneous, intramuscular, oral, topical (transdermal), or transmucosal administration. For systemic administration, oral administration is preferred. For example, for oral administration, the compounds may be formulated in conventional oral dosage forms such as capsules, tablets, and liquid preparations such as syrups, elixirs and concentrated drops. Alternatively, injection (parenteral administration) such as intramuscular, intravenous, intraperitoneal and subcutaneous injection may be used. For injection, pharmaceutical compositions are prepared as liquid solutions, preferably in physiologically compatible buffers or solutions such as saline, Hanks' solution or Ringer's solution. In addition, the compounds may be formulated in solid form and re-dissolved or suspended just prior to use. For example, lyophilized forms of the modified protein can be prepared. In a specific aspect, the modified protein is administered intramuscularly. In a preferred specific aspect, the modified protein is administered intravenously.

[000138] Systemic administration can also be via the transmucosal or transdermal route. For transmucosal or transdermal administration, penetration agents suitable for barrier penetration are used in the composition. Such penetration agents are well known in the art and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents may be used to facilitate penetration. For example, transmucosal administration can be done using nasal sprays, inhalers (delivered to the lungs), rectal suppositories, or vaginal suppositories. For topical application, the compounds may be formulated as ointments, gels or creams, as is well known in the art.

[000139] In one aspect, the invention also relates to the use in therapy of a modified protein as described herein. The use may relate to the treatment of the L-asparagine depletion treatable disease described above as a method of treating the L-asparagine depletion treatable disease. In one aspect, the invention relates to a modified protein as described herein, or a modified protein obtained by a process as described herein, or a composition containing a modified protein as described herein, for use as medicinal product / for use in therapy / for use in medicine.

[000140] In one aspect, the invention provides a modified protein as described herein, or a modified protein obtained by a process as described herein, or a composition comprising a modified protein as described herein, for use in the treatment of a disease treatable by depletion of L-asparagine in a patient. The present invention also relates to the use of a modified protein as described herein, or a modified protein obtained by a method as described herein, or a composition comprising a modified protein as described herein, in the preparation of a medicament for the treatment of a disease. curable by L-asparagine depletion in the patient. The present invention also relates to a method for treating a disease treatable by L-asparagine depletion in a patient, said method comprising administering to said patient an effective amount of a modified protein as described herein, a modified protein obtained by a method as described herein, or compositions as described herein. Preferably, the disease treatable by L-asparagine depletion is cancer.

[000141] In a preferred aspect, the invention provides a modified protein as described herein, or a modified protein obtained by a process as described herein, or a composition comprising a modified protein as described herein, for applications in the treatment of cancer. The present invention also relates to the use of a modified protein as described herein, or a modified protein obtained by a method as described herein, or a composition containing a modified protein as described herein, in the preparation of a medicament for the treatment of cancer. The present invention also relates to a method of treating cancer, comprising the introduction of a modified protein described in this document, a modified protein obtained by the method described in this document, or a composition described herein, to a subject.

[000142] In this disclosure, it is preferred that the subject to be treated be a mammal, in particular a human.

[000143] The cancer may be non-solid cancer, such as leukemia or non-Hodgkin's lymphoma. Preferably the leukemia is acute lymphoblastic leukemia (ALL) or acute myeloid leukemia (AML).

[000144] The modified protein may elicit a lower immunogenic response in a patient compared to unconjugated L-asparaginase. The modified protein may have a longer in vivo half-life after a single dose compared to unconjugated L-asparaginase. The modified protein may have a higher AUC after a single dose compared to unconjugated L-asparaginase. The patient may be hypersensitive to E. coli L-asparaginase or its pegylated form.

[000145] The present invention is further illustrated by reference to the following non-limiting figures and examples.

[000146] Description of the figures.

[000147] Figure 1. Chemistry of conjugation of crisanthaspase to N-terminal protected P/A peptides via amino groups

(A) and (B) depict the chemical structures of P/A peptides (SEQ ID NOs: 16 and 17, amino acid sequence shown in SEQ ID NOs: 5 and 15) containing 20 or 40 Pro/Ala residues (respectively), which were obtained by solid phase peptide synthesis. To avoid polymerization of the peptides upon chemical activation of the C-terminus, the N-terminus was protected by a pyroglutamyl (Pga) residue. Aminohexanoic acid (Ahx) was included at the C-terminus of the peptides to serve as a linker. (C) In the presence of the non-nucleophilic base N,N- diisopropylethylamine (DIPEA, Hunig's base) and with DMSO as solvent, the N-terminally protected P/A-peptide is activated at its C-terminus by the benzotriazole derivative O- (benzotriazole- 1-yl) -N, N, N,N',N'- tetramethyluronium tetrafluoroborate (TBTU). The active hydroxybenzotriazole (HOBt) ester of the peptide is subsequently used to derivatize the amino groups (ε-amino group of lysine residues or the N-terminal α-amino group) of crisanthaspase with the P/A peptide via peptide or isopeptide bond formation, thereby releasing free HOBt. This coupling step is performed in an aqueous solution (eg PBS buffer) with an organic solvent content of ≤ 30%. The P/A crisantaspase modified protein can be purified from residual P/A peptide/coupling reagent by dialysis and/or chromatography (eg, ion exchange chromatography).

[000148] Figure 2. Optimization of the crisanthaspase/Pga-P/A(20)-Ahx combination ratio

Recombinant chrysanthaspase produced in E. coli was conjugated to the Pga-P/A#1(20)-Ahx peptide ( FIG. 1A ) (SEQ ID NO: 16, amino acid sequence shown in SEQ ID NO: 5) as described in Example 1 The ratio of peptide to protein varied from 3.5 to 10 mg of P/A peptide per 1 mg of crisanthaspase. The gel was loaded with 7 μg of chrysantaspase from each coupling reaction. In addition, a mixture of coupling reactions with ratios from 0.3 to 10 mg of peptide per mg of protein was used as a size standard ("standard"). The number of bound P/A peptides can be determined by counting the bands on a given assay result, starting with unconjugated crisanthaspase, as noted on the right. “kDa” band: unstained Pierce™ protein molecular weight marker (Thermo Fisher Scientific).

[000149] Figure 3. Purification of the chrysanthaspase/Pga-P/A(40)-Ahx peptide coupling product by anion exchange chromatography

Recombinant chrysantaspase produced in E. coli was conjugated to the Pga-P/A(40)-Ahx peptide ( FIG. 1B ) (SEQ ID NO: 17, amino acid sequence shown in SEQ ID NO: 15) as described in Example 2 After dialysis using AIX working buffer (25 mM boric acid/NaOH, pH 9.0, 1 mM EDTA), anion exchange chromatography was performed on a Source™ 15Q(A) 85 ml column. Using a NaCl concentration gradient, the modified enzyme protein eluted as a single sharp peak as detected by the ultraviolet trace at 280 nm. Separation of the remaining unbound peptide and other non-protein chemical conjugation by-products that do not absorb UV at 280 nm was monitored by UV tracking at 225 nm. (B) SDS-PAGE analysis of modified chrysanthaspase/Pga-P/A(40)-Ahx protein after purification by anion exchange chromatography (lane 1). Lane 2 displays mixed coupling reaction data with ratios of 0.3 to 10 mg peptide per mg protein, which allows the amount of bound P/A peptides per crisanthaspase monomer to be determined. A pre-colored PageRuleR™ Plus marker (Thermo FisheRScientific) was applied to the "M" strip.

[000150] Figure 4. Purification of the chrysanthaspase/Pga-P/A(20)-Ahx peptide coupling product by anion exchange chromatography

Recombinant chrysanthspase produced in E. coli was conjugated to the Pga-P/A(20)-Ahx peptide ( FIG. 1A ) (SEQ ID NO: 16, amino acid sequence shown in SEQ ID NO: 5) as described in Example 3 After dialysis using AIX working buffer (25 mM boric acid/NaOH, pH 9.0, 1 mM EDTA), anion exchange chromatography was performed on a Source™ 15Q(A) 85 ml column. Using a NaCl concentration gradient, the modified enzyme protein eluted as a single sharp peak as detected by the ultraviolet trace at 280 nm. Separation of the remaining unbound peptide and other non-protein chemical conjugation by-products that did not absorb UV at 280 nm was observed by UV tracing at 225 nm. (B) SDS-PAGE analysis of modified chrysanthaspase/Pga-P/A(20)-Ahx protein after purification by anion exchange chromatography (lane 1). Lane 2 displays mixed coupling reaction data with ratios of 0.3 to 10 mg peptide per mg protein, which allows the amount of bound P/A peptides per crisanthaspase monomer to be determined. A pre-colored PageRuleR™ Plus marker (Thermo FisheRScientific) was applied to the "M" strip.

[000151] Figure 5. Cloning of expression vectors for the production of PASylated crisanthaspase in E. coli

(A) Plasmid map of pASK75-SapI-chrysanthspase (SEQ ID NO: 4) and (B) its derivative pASK75-PA400-chrysanthspase (SEQ ID NO: 14) after sutureless introduction of the PA#1c/1b(400) gene cassette (SEQ ID NO: 10) through two reversely oriented Sap I restriction sites. Structural gene for the biologically/pharmacologically active (pre)protein PA#1(400)-chrysanthspase (SEQ ID NO: 13) containing a low-repetition nucleotide sequence encoding the PA# polypeptide 1 with 401 amino acid residues, and the structural gene for crisanthaspase, as well as the coding region for the bacterial signal sequence Enx (SP ^Enx ) are cloned under the transcriptional control of the tet promoter/operator (tet ^p/o ). The plasmid backbone outside the expression cassette, flanked by Xba I and Hin dIII restriction sites, is identical to the backbone of the expression vector pASK75 (Skerra (1994) Gene 151:131-135). The PA#1(200) fused crisanthaspase expression plasmid (SEQ ID NO: 11) was similarly cloned using the PA#1b(200) gene cassette (SEQ ID NO: 12).

[000152] Figure 6. SDS-PGE analysis of recombinant chrysanthaspase genetically fused with PA200 or PA400

(A) Analysis of mature PA#1(400)-crisanthaspase fusion protein (SEQ ID 13) after periplasmic extraction (PPE), ammonium sulfate precipitation (ASP), and anion exchange chromatography (AEX) by 10% SDS-PAGE. (B) Gel shows 5 μg samples of purified mature PA#1(200)-crisanthaspase (lane 1) (SEQ ID NO: 11) or PA#1(400)-chrysanthaspase (lane 2) (SEQ ID NO: 13) . The sizes of marker proteins (M) are indicated on the left. The PA#1(200)-crisanthaspase and PA#1(400)-crisanthaspase fusion protein appears as single homogeneous bands with an apparent molecular size of approximately 105 kDa (lane 1) or 200 kDa (lane 2), respectively. Due to poor SDS binding, PA fusion proteins typically exhibit significantly larger sizes (Schlapschy (2013) Protein Eng Des Sel. 26: 489-501) than, for example, the calculated mass of 51 kDa for the PA#1(200)-crisanthaspase monomer or 67 kDa for the PA#1(400)-crisanthaspase monomer.

[000153] Figure 7. Size exclusion chromatography of PASylated crisanthaspase variants

(A) Overlay of elution profiles for unmodified chrysanthaspase as well as for chrysanthaspase chemically conjugated to Pga-P/A(20)-Ahx or Pga-P/A(40)-Ahx peptides (described in Examples 3 and 2 respectively) and recombinant chrysanthaspase genetically fused to either PA#1(200) (SEQ ID NO: 7) or PA#1(400) (SEQ ID NO: 9) polypeptides (described in Example 5). 150 μl of purified protein at a concentration of 1 mg/ml was loaded onto a Superdex™ S200 10/300 GL column equilibrated with PBS. The absorbance at 280 nm was monitored and the peak of each chromatography cycle was normalized to 100%.

(B) Calibration curve for chromatograms from (A) using a Superdex S200 10/300 GL column. The logarithm of the molecular weight of marker proteins (ovalbumin, 43.0 kDa; bovine serum albumin, 66.3 kDa; alcohol dehydrogenase, 150 kDa, β-amylase, 200 kDa, apoferritin, 440 kDa) was plotted against the volume of elution (black circles ) and aligned in a straight line. From the observed elution volumes of the tetrameric crisantanthaspase, its PA#1 peptide-modified proteins, and recombinant PA#1 fusion proteins (black squares), their apparent molecular sizes were determined as follows. Crisanthaspase, 105 kDa (true mass 140 kDa); modified chrysanthaspase protein/Pga-P/A(20)-Ahx, 531 kDa (true mass 228 kDa); modified chrysanthaspase protein/Pga-P/A(40)-Ahx, 820 kDa (true mass 284 kDa); PA200-crisanthaspase, 595 kDa (true mass 205 kDa); PA400-crisanthaspase, 1087 kDa (true mass 269 kDa). These data show that chemically conjugated P/A peptides and genetic fusion to the PA#1 polypeptide provide a significantly increased hydrodynamic volume.

[000154] Figure 8. ESI-MS analysis of PASylated chrysanthaspase variants

(A) Electrospray ionization mass spectrometry (ESI-MS) raw m/z spectrum of purified modified chrysanthaspase/Pga-P/A(20)-Ahx protein prepared as described in Example 3 was deconvoluted obtaining a mass spectrum (b). The observed massive species can be unambiguously assigned to the 9-14 peptide conjugated crisanthaspase (see Table 3 ). Major peaks, however, were only observed for protein species with 10-13 peptides, consistent with SDS-PAGE peptide coupling ratio determination (see FIG. 4B ). (C) and (E) show the raw m/z spectra of the condensed PA200-chrysanthaspase and PA400-chrysanthspase proteins obtained in Example 5. Deconvoluted mass spectra of (D) and (F) showed masses of 51,164.75 Da and 671 99.17 Da, respectively, which almost completely corresponds to the calculated masses of 51,163.58 Da.

Figure 9. Averages (± s.d.) plasma concentration versus time profiles after a single intravenous bolus dose in male CD-1 mice

The figures show the plasma asparaginase activity of PA-crisanthaspase conjugates after a single intravenous bolus dose in male mice.

[000155] The following examples illustrate the invention.

[000156] Example 1 Coupling ratio optimization for pyroglutamoyl-P/A(20)-aminohexanoyl-crisanthaspase

[000157] 4.38 mg Pga-P/A#1(20)-Ahx peptide ( Figure 1A ; TFA salt, 98% pure; PSL Peptide Specialty Laboratories, Heidelberg, Germany) (SEQ ID NO: 16, amino acid sequence shown in SEQ ID NO: 5) was dissolved in 66.3 μl of DMSO. Chemical activation of the P/A peptide through its terminal carboxylate group was started by adding 23.7 µl of a 500 mM TBTU solution (CAS no. 125700-67-6; Iris Biotech, Marktredwitz, Germany) in DMSO and 2.7 µl of DIPEA to the peptide solution and shaking (see Fig. 1C ). At these amounts, the peptide concentration was 25.8 mM and the molar ratio between DIPEA, TBTU and Pga-P/A#1(20)-Ahx was 5:5:1. After 10 min incubation at 25°C, the mixture was diluted in Eppendorf tubes according to Table 1 .

[000158] A solution of Dickeya chrysanthemi L-asparaginase (chrysanthaspase, SEQ ID NO: 1, recombinant, produced in E. coli (batch RE-LAP-P57D) at a concentration of 2 mg/ml, was prepared in phosphate-buffered saline (PBS: 115 mM NaCl, 4 mM KH ₂ PO ₄ and 16 mM Na ₂ HPO ₄ , pH 7.4) and pipetted into each Eppendorf tube according to the volumes shown in Table 1. After mixing by repeated pipetting and shaking, the coupling reaction was allowed to proceed at 25° C. for 30 minutes The reaction was quenched by adding glycine (pH adjusted to 8.0 with Tris base) to a final concentration of 250 mM.

[000159] Table 1. Dilution Series of Activated P/A Peptide for Coupling with Asparaginase

Mass ratio Peptide stock solution [µl] DMSO [µl] Asparaginase [µl] 10x 21 0 fifty 7.5x 21 7 66.7 5x 21 21 100 3.5x 21 39 143

[000160] SDS-PAGE analysis of the modified proteins is shown in FIG. 2 . Separate bands correspond to proteins modified with proteins that differ from each other by one associated P/A peptide. The additional use of a mixture of coupling reactions with peptide ratios from 0.3 to 10 mg per mg of protein allowed bands to be counted in the sequential analysis starting from the unconjugated protein, and thus the amount of bound P/A peptides could be accurately quantified. Band intensities were quantified densitometrically using Quant v12.2 software (TotalLab, Newcastle upon Tyne, UK) and arithmetic mean values of the number of bound peptides per chrysanthaspase monomer, weighted by the intensities of the respective bands, were calculated (see Table 2 ). 3.5 mg P/A peptide per mg chrysanthaspase resulted in a coupling ratio ranging from 9 to 12 P/A peptides per chrysanthaspase monomer (mean: 10.4). Increasing the applied weight ratio to 10 mg P/A peptide per mg crisantaspase resulted in only a slight increase in the resulting coupling ratio from 10 to 13 P/A peptides per crisantaspase (mean 12.0), indicating saturation of the available amino groups.

[000161] Modified proteins were purified by anion exchange chromatography (AEX) on a MonoQ HR5/5 column (GE Healthcare) using 25 mM Na-borate pH 9.0, 1 mM EDTA as running buffer with a NaCl concentration gradient from 0 to 1 M to elute proteins. The activity of L-asparaginase aminohydrolase of each modified chrysanthaspase protein was determined by the reaction of ammonia, which is released due to the enzymatic activity of L-asparagine, with Nessler's reagent. Briefly, 50 µl of enzyme solution was mixed with 20 mM L-asparagine in 100 mM sodium borate buffer pH 8.6 containing 0.015% (w/v) BSA and incubated for 15 min at 37°C . The reaction was stopped by adding 200 μl of Nessler's reagent (Sigma-Aldrich). The absorbance of this solution was measured at 450 nm. Activity was calculated from a calibration curve that was generated using ammonium sulfate as a reference. The results are shown in table 2 .

[000162] Table 2 Enzymatic activities of chrysanthspase conjugated to Pga-P/A(20)-Ahx peptide at different amounts

mg PA peptide/ mg crisanthaspase mol peptide PA/mol monomer Specific activity [U/mg] Rel. activity [%] 0 - 540 ± 32 100 3.5 10.4 508±20 94.1 5 11.2 436 ± 22 80.7 7.5 11.7 401 ± 21 74.3 ten 12.0 256 ± 20 47.4

[000163] Example 2 Preparation of pyroglutamoyl-P/A(40)-aminohexanoyl-crisanthaspase

[000164] 28 mg of pyroglutamoyl-P/A#1(40)-Ahx peptide (SEQ ID NO. 17, amino acid sequence shown in SEQ ID NO: 15), FIG. 1B , TFA salt, 98% pure; Almac Group, Craigavon, UK) was dissolved in 1324 μl of anhydrous DMSO (99.9%; Sigma-Aldrich, Taufkirchen, Germany). To achieve chemical activation of the P/A peptide through its terminal carboxylate group, 162 µl of a solution of 500 mM TBTU (CAS # 125700-67-6; Iris Biotech, Marktredwitz, Germany) in DMSO and, after mixing, 14 µl of DIPEA (99, 5%, biotech grade, Sigma-Aldrich). The whole mixture was briefly shaken and incubated for 20 min at 25°C (see Fig. 1C ). At these amounts, the peptide concentration was 5.41 mM and the molar ratio between DIPEA, TBTU and Pga-P/A#1(40)-Ahx was 10:10:1.

[000165] 3.5 ml of an ice-cold solution of chrysanthaspase (SEQ ID NO: 1) (2 mg/ml in PBS) was mixed with the activated peptide solution (1.5 ml) to give a weight ratio between Pga-P/A#1(40 )-Ahx and crisanthaspase 5:1, and incubated at room temperature for 30 minutes to ensure binding. Using a regenerated cellulose membrane dialysis tubing (Nominal Molecular Weight Cutoff (MWCO) 50 kDa, Spectrum Laboratories, Los Angeles, CA), the solution was dialyzed using 5 L of AEX working buffer (25 mM Na-borate pH 9.0, 1 mM EDTA) and subjected to anion exchange chromatography on a HiScale™ 16/40 column packed with Source™ 15Q resin (GE Healthcare). The column was equilibrated with AEX running buffer and the protein-modified protein was eluted using a segmented NaCl concentration gradient from 0 to 150 mM in 1 column volume and from 150 to 1000 mM in 0.25 column volumes ( Figure 3A ).

[000166] Plotting the eluate on SDS-PAGE along with the analysis results obtained by combining coupling reactions with ratios of 0.3-10 mg of peptide per mg of protein allowed the determination of the coefficient of binding of 9-11 PA peptides per crisanthaspase monomer (mean value: 10, 0) ( Fig. 3B ). The enzymatic activity of the modified chrysanthaspase/PA(40) protein, determined using the Nessler assay described in Example 1, was 78.2% of the activity of the similarly assayed unmodified chrysanthaspase.

[000167] Example 3 Preparation of pyroglutamoyl-P/A(20)-aminohexanoyl-crisanthaspase

[000168] 21 mg of pyroglutamoyl-P/A#1(20)-Ahx peptide (SEQ ID NO. 5, Fig. 1A ; TFA salt, 98% purity; PSL Peptide Specialty Laboratories, Heidelberg, Germany) was dissolved in 1376 μl of anhydrous DMSO (99.9%; Sigma-Aldrich, Taufkirchen, Germany). To achieve chemical activation of the P/A peptide via its terminal carboxylate group, 114 µl of a solution of 500 mM TBTU (CAS no. 125700-67-6; purchased from Iris Biotech, Marktredwitz, Germany) in DMSO and, after mixing, 10 µl of DIPEA (99.5%, biotech grade, Sigma-Aldrich). The whole mixture was briefly shaken and incubated for 20 min at 25°C ( Fig. 1C ). At these amounts, the peptide concentration was 7.58 mM and the molar ratio between DIPEA, TBTU and Pga-P/A#1(20)-Ahx was 5:5:1.

[000169] 3.5 ml of an ice-cold solution of chrysanthaspase (SEQ ID NO: 1) (2 mg/ml in PBS) was mixed with an activated peptide solution (1.5 ml) to obtain a weight ratio between Pga-P/A#1(40 )-Ahx and crisanthaspase 5:1, and incubated at room temperature for 30 minutes to ensure coupling. Using a regenerated cellulose membrane dialysis tubing (MWCO 50 kDa, Spectrum Laboratories, Los Angeles, CA), the solution was dialyzed with 5 L of AEX running buffer (25 mM Na-borate pH 9.0, 1 mM EDTA) and subjected to anion exchange chromatography on HiScale™ 16/40 column packed with Source™ 15Q resin (GE Healthcare). The column was equilibrated with AEX running buffer and the protein modified protein was eluted using a segmented NaCl concentration gradient from 0 to 150 mM in 1 column volume and from 150 to 1000 mM in 0.25 column volumes ( Figure 4A ).

[000170] Plotting the eluate on SDS-PAGE, together with the analysis results obtained by combining coupling reactions with ratios of 0.3-10 mg peptide per mg protein, determined the coupling ratio of 10-13 PA peptides per crisanthaspase monomer (mean: 11. 9) ( Fig. 4B ). The enzymatic activity of the modified chrysanthaspase/PA(20) protein, determined using the Nessler assay described in Example 1, was 91.2% of the activity of similarly assayed unmodified chrysanthaspase.

[000171] Example 4 Cloning of Expression Plasmids for Periplasmic Production of N-Terminally Condensed Crisanthaspase with P/A Sequences of Various Lengths

[000172] A synthetic DNA fragment encoding the mature amino acid sequence of Dickeya chrysanthemi L-asparaginase (UniProt ID P06608) was obtained from a gene synthesis supplier (Thermo FisheRScientific, Regensburg, Germany). This gene fragment (SEQ ID NO: 4) contains an Xba I restriction site followed by a ribosome binding site, a nucleotide sequence encoding the Enx signal peptide followed by an alanine codon GCC, the first Sap I recognition sequence of GCTCTTC on the non-coding strand, 11- a nucleotide spacer and a second Sap I restriction sequence in reverse complementary orientation with the recognition sequence GCTCTTC on the coding strand, followed by the alanine codon GCC directly linked to the mature L-asparaginase coding sequence, and finally followed by the Hin dIII restriction site.

[000173] This gene fragment was cloned into pASk75 through Xba I and HindIII flanking restriction sites according to standard procedures (Sambrook (2012) MoleculaRCloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press). The resulting plasmid ( Fig. 5A ) was digested with Sap I, which resulted in the release of a small (30 bp) DNA insert containing the Sap I recognition sites and a cleaved vector scaffold with compatible 5'-GCC/5'-GGC sticky ends in position just before the encoded mature N-terminus of L-asparaginase, which is ideal for inserting a low repetitive nucleic acid molecule encoding a proline/alanine-rich repetitive amino acid sequence. After isolation of the vector fragment using the Promega Wizard gel extraction kit (Promega, Mannheim, Germany) and dephosphorylation using FastAP thermosensitive alkaline phosphatase (Thermo FisheRScientific, Waltham, MA) according to the manufacturer's instructions, it was ligated to the PA#1b gene cassette (200) cut from pXL2-PA#1b(200) (SEQ ID NO: 8) or PA#1c/1b(400) gene cassette cut from pXL2-PA#1c/1b(400) (SEQ ID NO: 10) through the restriction fragment Ear I. The resulting plasmids (SEQ ID NO: 12 and SEQ ID NO: 14) ( Fig. 5b ) provide bacterial expression of fusion proteins (SEQ ID NO: 11 and SEQ ID NO: 13) consisting of rich proline/alanine amino acid repeat sequence fused to the biologically active protein chrysantaspase (after in vivo processing of the signal peptide Enx during periplasmic secretion in E. coli ).

[000174] Example 5 Bacterial Production and Purification of Fusion Proteins Between PA#1(200) or PA#1(400) Sequence and Crisantaspase

[000175] Both PA#1(200)-crisanthaspase and PA#1(400)-crisanthaspase fusion proteins (calculated mass: 51 kDa and 67 kDa, respectively) were generated at 25° C. in E. coli W3110 containing expression plasmid pASK75 -PA200-chrysanthaspase or pASK75-PA400-chrysanthaspase ( FIG. 5B ) from Example 4 using an 8 L benchtop fermenter with synthetic mineral glucose medium supplemented with 100 mg/L ampicillin according to a published method (Schiweck (1995) Proteins 23 : 561-565). Expression of the recombinant gene was induced by the addition of 500 μg/l anhydrotetracycline (Skerra (1994) loc. cit.) once the culture had reached an OD ₅₅₀ =40. After an induction period of 2.5 h, cells were harvested by centrifugation and resuspended for 10 min in ice-cold periplasmic fractionation buffer (500 mM sucrose, 1 mM EDTA, 200 mM boric acid/NaOH, pH 8.0; 2 ml per L and OD ₅₅₀ ). After addition of 15 mM EDTA and 250 μg/ml lysozyme, the cell suspension was incubated for 20 minutes on ice, centrifuged several times, and the purified supernatant containing the recombinant protein was recovered.

[000176] Periplasmic extracts were dialyzed twice at 4°C using 15 L of PBS containing 1 mM EDTA for at least 6 hours, respectively, filtered using a 0.2 μm cellulose nitrate membrane (GE Healthcare) and precipitated by adding ammonium sulfate (EF purity; Applichem, Darmstadt, Germany) to 25% saturation at 25°C. After centrifugation, the supernatant was removed and the pellet was resuspended in AEX running buffer (25 mM Na-borate pH 9.0, 1 mM EDTA) and dialyzed at 4° C. using 5 L of AEX running buffer for at least 6 hours. The dialyzed protein solution was purified from remaining insolubles by centrifugation and subjected to subtractive anion exchange chromatography using an 85 ml HiScale™ column (GE Healthcare, Freibur, Germany) packed with Source15Q resin connected to an Äkta™ purification system (GE Healthcare, Freibur, Germany), balanced in the working AEX buffer. The pure protein flow column (see FIGS. 6A and 6B ) was dialyzed twice with 5 L of PBS.

[000177] Homogeneous protein preparations without signs of aggregation were obtained with a final yield of 128 mg for PA#1(200)-chrysanthspase and 48 mg for PA#1(400)-chrysanthspase from a single 8-liter fermenter, respectively. Protein concentrations were determined by measuring absorbance at 280 nm using a calculated extinction coefficient (Gill (1989) Anal. Biochem. 182: 319-326) of 19370 M ^-1 cm ^-1 . The enzymatic activities of the fusion proteins were determined using the Nessler assay described in Example 1. In this setup, the PA#1(200)-chrysanthaspase fusion protein showed 109% and PA#1(400)-chrysanthaspase showed 118% enzymatic activity compared to the same as analyzed by unmodified crisanthaspase. This demonstrates that fusion of the N-terminus of crisanthaspase to P/A polypeptides up to at least 401 amino acids in length does not affect enzymatic activity.

[000178] Example 6 Measurement of Hydrodynamic Volume of Genetically PASylated and Chemically PASylated Crisanthaspase Using Analytical Gel Filtration

[000179] Size exclusion chromatography (SEC) was performed on a Superdex™ S200 column at 10/300 GL magnification (GE Healthcare Europe, Freiburg, Germany) at a flow rate of 0.5 ml/min using an Äkta™ Purifier 10 system (GE Healthcare) with PBS (115 mM NaCl, 4 mM KH ₂ PO ₄ , 16 mM Na ₂ HPO ₄ ; pH 7.4) as working buffer. Using disposable regenerated cellulose ultrafiltration devices (MWCO 10 kDa; Merck-Millipore, Darmstadt, Germany), recombinant chrysanthaspase genetically fused with PA#1(200) or PA#1(400) polypeptides (described in Example 5) and chrysanthaspase, chemically conjugated with Pga-P/A(40)-Ahx peptide (described in Example 2) or Pga-P/A(20)-Ahx peptide (described in Example 3) was adjusted to a concentration of 1 mg/ml in PBS. 150 µl samples of concentrated PASylated enzymes and non-PASylated chrysanthaspase were loaded onto the column individually and chromatography traces were overlaid ( Figure 7A ). All five proteins elute in single homogeneous peaks.

[000180] To calibrate the column ( Figure 7B ), 150 µl of the appropriate mixture of the following globular proteins (Sigma, Deisenhofen, Germany) was loaded into PBS at protein concentrations from 0.5 mg/mL to 1.0 mg/mL: cytochrome c, 12 .4 kDa; ovalbumin, 43.0 kDa; bovine serum albumin, 66.3 kDa; alcohol dehydrogenase, 150 kDa; β-amylase, 200 kDa; apoferritin, 440 kDa; thyroglobulin, 660 kDa.

[000181] As a result, the recombinant PA fusion proteins and chemically conjugated enzyme preparations were significantly larger than the corresponding globular proteins of the same molecular weight. With an increase in the size of the P/A (poly)peptide fragment, such a disproportion, mol. mass/hydrodynamic volume increased even more. The apparent increase in size of PA(200)-chrysanthaspase was 5.1-fold compared to non-hybrid chrysanthaspase, while the true mass was only 1.5-fold greater. The apparent increase in size of PA(400)-chrysanthaspase compared to non-hybrid chrysanthaspase was 10.4-fold, while the true mass was only 1.9-fold greater. This observation clearly indicates the significantly increased hydrodynamic volume imparted to the biologically active crisanthaspase enzyme by the Pro/Ala polypeptide segment of the present invention.

[000182] Example 7 ESI-MS analysis of chemically or genetically PASylated crisanthaspase

[000183] 250 μl of purified chemically modified chrysanthaspase protein with Pga-P/A(20)-Ahx from Example 3 and recombinant fusion proteins PA200 and PA400 from Example 5, all at 1 mg/ml, were applied to a Resource™ RPC column 1 ml (GE Healthcare, Freiburg, Germany) connected to an Äkta™ purification system using 2% v/v acetonitrile and 1% v/v formic acid as working buffer. Proteins were eluted using an acetonitrile gradient from 2% v/v acetonitrile, 1% v/v formic acid to 80% v/v acetonitrile, 0.1% v/v formic acid in 20 column volumes. The eluted proteins were directly analyzed by ESI mass spectrometry on a maXis™ micrOTOF instrument (BrukeRDaltonik, Bremen, Germany) using positive ion detection mode. The raw m/z spectrum of the chemically modified chrysanthaspase/Pga-P/A(20)-Ahx protein is shown in FIG. 8A . The masses revealed as a result of deconvolution of the mass spectrum ( FIG. 8B ) are shown in Table 3 . The mass distribution corresponds to the coupling ratios determined by the SDS-PAGE analysis described in Example 2.

[000184] The raw m/z spectrum of the recombinant PA#1(200)-crisanthaspase fusion protein (SEQ ID NO: 11) is shown in FIG. 8C . The mass spectrum after deconvolution revealed a mass of 51,164.75 Da ( FIG. 8D ), which is essentially the same as the calculated mass of this protein (51,163.58 Da). The raw m/z spectrum of the recombinant PA#1(400)-crisanthaspase fusion protein (SEQ ID NO: 13) is shown in FIG. 8E . The spectrum after deconvolution ( Fig. 8F ) revealed a mass of 67,199.17 Da, which is essentially the same as the calculated mass of this protein (67,201.99 Da). This clearly demonstrates that an intact crisanthaspase enzyme genetically fused to PA200 or PA400 can be produced in E. coli in a highly homogeneous form.

[000185] Table 3. Comparison of calculated and measured masses found in a chemically modified chrysanthaspase/Pga-P/A(20)-Ahx protein preparation

combination ratio Estimated weight Measured mass 9x 51506.1 51503.9 10x 53334.1 53333.2 11x 55162.1 55161.7 12x 56990.1 56990.1 13x 58818.1 58819.4 14x 60646.1 60645.8

Example 8 Asparaginase Activity

[000186] The enzymatic activity of PASylated L-asparaginase was determined by catalysis of the conversion of L-asparagine to L-aspartic acid. This reaction releases one mole of ammonia per mole of L-asparagine converted. The released ammonia is detected using Nessler's reagent. In the presence of Nessler's reagent, ammonia will form a yellow water-soluble complex which can be quantified by measuring absorbance at 450 nm (Mashburn et al. (1963) Biochem. Biophys. Res. Commun. 12, 50). One unit of L-asparaginase enzymatic activity (international unit or IU) is defined as the amount of enzyme that catalyzes the conversion of one µmol of L-asparagine per minute. The specific activity of the samples (IU/mg) is determined by dividing the L-asparaginase activity value, expressed in IU/ml, by the protein concentration, expressed in mg/ml. The mass of the protein monomer with the PASylated sequence was measured.

[000187] The measurement of L-asparaginase activity is based on an endpoint assay in which the sample is diluted to a series of final enzyme concentrations, which are then incubated at 37°C with a saturated concentration of L-asparagine for 15 minutes. The reaction is stopped by adding Nessler's reagent and the amount of ammonia produced from the reaction is extrapolated from a calibration curve based on known amounts of ammonium sulfate used as a standard. Enzyme concentration versus ammonia is then plotted for each sample, and the slope of the curve is divided by the reaction time to obtain the specific activity in IU/mg. Specific activity is reported in IU/mg and rounded to the nearest whole number.

[000188] Initial test results are shown in the table below for each of the modified proteins or fusion proteins.

Crisanthaspase expression system Type of modified protein Nessler plate 1 (IU/mg) Nessler plate 2 (IU/mg) Nessler plate 3 (IU/mg) Nessler analysis (medium) E. coli PA200-crisanthaspaz 626 666 556 616 E. coli Crisanthaspaza-P/A(20)n 694 732 602 676 E. coli PA400-crisanthaspaz 790 748 699 746 E. coli Crisanthaspaza-P/A(40)n 567 528 490 528

Example 9 Pharmacokinetics

[000189] The pharmacokinetic profile of E. coli expressing recombinant crisazaspase as a PASylated fusion protein (PA-200) or chemically conjugated to PA peptides (PA-20) was characterized after administration of a single intravenous bolus dose to CD-1 mice. The CD-1 mice are a healthy mouse model.

[000190]

[000191] All animals received one bolus intravenously (IV) via the lateral tail vein (10 ml/kg) based on pre-dose body weight. Individual doses have been calculated based on the most recent individual body weight measurements to ensure the correct dose. The first day of dosing was based on body weight on study day 0. All animals were monitored for mortality, abnormalities, and signs of pain and abnormalities twice a day, once in the morning and once in the afternoon.

[000192] PASylated asparaginase was administered to mice as a single intravenous dose of 25 IU/kg body weight. Groups of mice were dosed at 25 IU/kg body weight and plasma samples were taken at scheduled times up to 10 days (240 hours) post-dose. Mouse plasma asparaginase activity was measured using a qualified biochemical assay as described in the previous examples. Mean plasma asparaginase activity (n=4) versus time was plotted (FIG. 1) and a pharmacokinetic analysis was performed.

[000193] Blood samples were taken pre-dose and approximately 6, 24 (Day 1), 48 (Day 2), 51 (Day 2), 54 (Day 2), 60 (Day 2), 96 (Day 4), 168 (day 7) and 240 (day 10) hours post-dose. We used the procedure for taking blood from the tail (cut off the end of the tail). For the first blood collection, approximately 1-2 mm of the distal end of the tail was cut off, all successive blood collections were collected from the same site by removing the scab and facilitating blood flow by stroking the tail. Approximately 100 μl of blood at each time point was collected in chilled K ₃ EDTA tubes (Minivette). The blood was transferred into tubes suitable for centrifugation. For plasma isolation, all samples were centrifuged for about 20 minutes after sampling at 3000 g in a refrigerated centrifuge set to maintain about 4° C. for about 10 minutes. After centrifugation, the maximum amount of plasma was removed (targeting 30 μl) and placed in plastic vials. Prior to testing, plastic vials were stored at -65 to -85°C.

[000194] Asparaginase activity was measured as the concentration of asparaginase in plasma samples as previously described (Allas et al. (2009) Blood, 114, 2033). Parameters dependent on sufficient characterization of the end phase of the concentration versus time profile (t½, CL and V _ss ) were only reported if R ² (squared correlation coefficient for linear regression used to estimate the terminal elimination rate constant, λz) was greater than 0.8. Pharmacokinetic data were imported into Phoenix WinNonlin v6.4 (Certara/Pharsight) for analysis. Data on plasma asparaginase activity as a function of time were analyzed using non-compartmental sampling methods in an intravenous bolus model. Activity values below the quantitation limit of the assay (10 U/L) were set to zero when calculating the group means. Nominal dose levels and sampling times were used for calculations. The calculated t½ values were 50.2 h for PA-20 cristantaspase and 17.9 h for PA-200 cristantaspase.

[000195] The present invention relates to the following nucleotide and amino acid sequences:

[000196] Some of the sequences presented herein are available from the NCBI database and can be obtained from www.ncbi.nlm.nih.gov/sites/entrez?db=gene; these sequences also refer to annotated and modified sequences. The present invention also provides techniques and methods that use homologous sequences and short sequence variants provided herein. Preferably, such "variants" are genetic variants.

SEQID No. one:

Amino acid sequence of Dickeya chrysanthemi L-asparaginase.

ADKLPNIVILATGGTIAGSAATGTQTTGYKAGALGVDTLINAVPEVKKLANVKGEQFSNMASENMTGDVVLKLSQRVNELLARDDVDGVVITHGTDTVEESAYFLHLTVKSDKPVVFVAAMRPATAISADGPMNLLEAVRVAGDKQSRGRGVMVVLNDRIGSARYITKTNASTLDTFKANEEGYLGVIIGNRIYYQNRIDKLHTTRSVFDVRGLTSLPKVDILYGYQDDPEYLYDAAIQHGVKGIVYAGMGAGSVSVRGIAGMRKAMEKGVVVIRSTRTGNGIVPPDEELPGLVSDSLNPAHARILLMLALTRTSDPKVIQEYFHTY

SEQID No. 2:

Nucleotide sequence encoding Dickeya chrysanthemi L-asparaginase

GCAGATAAACTGCCGAATATTGTTATTCTGGCAACCGGTGGCACCATTGCAGGTAGCGCAGCAACCGGCACCCAAACCACAGGTTATAAAGCCGGTGCACTGGGTGTTGATACCCTGATTAATGCAGTTCCGGAAGTTAAAAAACTGGCCAATGTGAAAGGTGAACAGTTTAGCAATATGGCCAGCGAAAATATGACCGGTGATGTTGTTCTGAAACTGAGCCAGCGTGTTAATGAACTGCTGGCACGTGATGATGTTGATGGTGTGGTTATTACCCATGGCACCGATACCGTTGAAGAAAGCGCCTATTTTCTGCATCTGACCGTGAAAAGCGATAAACCGGTTGTTTTTGTTGCAGCAATGCGTCCGGCAACCGCAATTAGCGCAGATGGTCCGATGAATCTGCTGGAAGCAGTTCGTGTTGCCGGTGATAAACAGAGCCGTGGTCGTGGTGTTATGGTTGTTCTGAATGATCGTATTGGTAGCGCACGCTATATTACCAAAACCAATGCAAGCACCCTGGATACCTTTAAAGCCAATGAAGAAGGTTATCTGGGCGTTATTATTGGCAATCGCATTTATTATCAGAATCGCATTGATAAACTGCATACCACCCGTAGCGTTTTTGATGTTCGTGGTCTGACCAGCCTGCCGAAAGTTGATATTCTGTATGGCTATCAGGATGATCCGGAATATCTGTATGATGCAGCCATTCAGCATGGTGTTAAAGGTATTGTGTATGCAGGTATGGGTGCAGGTAGCGTTAGCGTTCGTGGTATTGCAGGTATGCGTAAAGCAATGGAAAAAGGCGTTGTTGTTATTCGTAGCACCCGTACCGGTAATGGTATTGTTCCGCCGGATGAAGAACTGCCGGGTCTGGTTAGCGATAGCCTGAATCCGGCACATGCACGTATTCTGCTGATGCTGGCACTGACCCGTACCAGCGATCCGAAAGTGATTCAGGAATATTTTCATACCTAT

SEQID No. 3:

Amino acid sequence of Dickeya chrysanthemi L-asparaginase

Signal peptide: 1-28; removed by cloning: asparaginase, 29-39; 40-366

MFKFKKNFLVGLSAALMSISLFSATASA ARRAIVGRSSA ADKLPNIVILATGGTIAGSAATGTQTTGYKAGALGVDTLINAVPEVKKLANVKGEQFSNMASENMTGDVVLKLSQRVNELLARDDVDGVVITHGTDTVEESAYFLHLTVKSDKPVVFVAAMRPATAISADGPMNLLEAVRVAGDKQSRGRGVMVVLNDRIGSARYITKTNASTLDTFKANEEGYLGVIIGNRIYYQNRIDKLHTTRSVFDVRGLTSLPKVDILYGYQDDPEYLYDAAIQHGVKGIVYAGMGAGSVSVRGIAGMRKAMEKGVVVIRSTRTGNGIVPPDEELPGLVSDSLNPAHARILLMLALTRTSDPKVIQEYFHTY

SEQID No. four

Nucleotide sequence (synthetic) encoding Dickeya chrysanthemi L-asparaginase

mature asparaginase is encoded by bases 160-1140 (bold letters). Thus, the nucleotide sequence encoding L-asparaginase ranges from nucleotides at position 160 to 1140.

TCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTTCAAATTCAAAAAAAACTTCCTGGTGGGTCTGAGCGCAGCACTGATGAGCATTAGCCTGTTTAGCGCAACCGCAAGCGCAGCCAGAAGAGCGATTGTAGGACGCTCTTCTGCC GCAGATAAACTGCCGAATATTGTTATTCTGGCAACCGGTGGCACCATTGCAGGTAGCGCAGCAACCGGCACCCAGACCACCGGTTATAAAGCCGGTGCACTGGGTGTTGATACCCTGATTAATGCAGTTCCGGAAGTTAAAAAACTGGCCAATGTTAAAGGTGAGCAGTTTAGCAATATGGCCAGCGAAAATATGACCGGTGATGTTGTTCTGAAACTGAGCCAGCGTGTTAATGAACTGCTGGCACGTGATGATGTTGATGGTGTTGTTATTACCCATGGCACCGATACCGTTGAAGAAAGCGCATATTTTCTGCATCTGACCGTGAAAAGCGATAAACCGGTTGTTTTTGTTGCAGCAATGCGTCCGGCAACCGCCATTAGCGCAGATGGTCCGATGAATCTGCTGGAAGCAGTTCGTGTTGCCGGTGATAAACAGAGCCGTGGTCGTGGTGTTATGGTTGTGCTGAATGATCGTATTGGTAGCGCACGTTATATTACCAAAACCAATGCAAGCACCCTGGATACCTTTAAAGCAAATGAAGAAGGTTATCTGGGCGTCATTATTGGCAATCGTATCTATTATCAGAACCGCATCGACAAACTGCATACCACCCGTAGCGTTTTTGATGTTCGTGGTCTGACCAGCCTGCCGAAAGTGGATATTCTGTATGGTTATCAGGATGATCCGGAATATCTGTATGATGCAGCAATTCAGCATGGTGTGAAAGGTATTGTTTATGCAGGTATGGGTGCGGGTAGCGTTAGCGTTCGTGGTATTGCCGGTATGCGTAAAGCAATGGAAAAAGGTGTTGTTGTGATTCGTAGCACCCGTACCGGTAATGGTATTGTTCCGCCTGATGAAGAACTGCCTGGTCTGGTTAGCGATAGCCTGAATCCGGCACATGCACGTATTCTGCTGATGCTGGCACTGACCCGTACCAGCGATCCGAAAGTTATTCAAGAATATTTTCATACCTAT TAAGCTT

SEQID No. 5:

Amino acid sequence of the PA(20) peptide

AAPAAPAPAAPAAPAPAAPA

SEQID No. 6:

Nucleotide sequence encoding the peptide PA(20)

GCCGCGCCAGCGGCCCCGGCCCCTGCCGCGCCCGCTGCTCCCGCCCCTGCTGCCCCAGCC

SEQID No. 7:

Amino acid sequence of the PA(200) polypeptide

AAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAAAPAAPAPAAPAAPAPAAPAAAPAAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAPAAPAAPAPAAPAAAPAAPAPAAPAAAPAAAPAA

SEQID No. eight:

Nucleotide sequence encoding a PA(200) polypeptide

GCCGCGCCAGCGGCCCCGGCCCCTGCCGCGCCCGCTGCTCCCGCCCCTGCTGCCCCAGCCGCCGCTCCTGCGGCACCTGCGCCCGCCGCGCCGGCAGCGCCGGCACCGGCAGCTCCGGCGGCCGCGCCTGCAGCTCCTGCACCGGCGGCTCCAGCAGCCCCGGCGCCGGCCGCACCTGCGGCGGCGCCCGCGGCGCCTGCACCCGCAGCGCCTGCGGCACCGGCCCCAGCAGCCCCTGCCGCCGCACCGGCTGCGCCTGCCCCAGCGGCCCCCGCTGCCCCGGCCCCGGCGGCTCCAGCCGCAGCGCCTGCCGCCCCAGCGCCCGCAGCACCGGCGGCACCAGCTCCGGCGGCGCCGGCGGCGGCTCCGGCAGCTCCGGCCCCTGCTGCGCCGGCTGCGCCGGCTCCGGCGGCCCCTGCGGCGGCTCCGGCCGCACCTGCACCTGCCGCGCCGGCTGCTCCGGCCCCGGCTGCCCCAGCAGCGGCACCAGCAGCGCCTGCTCCTGCGGCGCCTGCAGCTCCGGCGCCGGCAGCCCCGGCCGCCGCACCCGCGGCTCCAGCCCCCGCCGCTCCAGCAGCCCCCGCGCCAGCTGCACCTGCTGCC

SEQID No. 9:

Amino acid sequence of the PA(400) polypeptide

AAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAA

SEQID No. ten:

Nucleotide sequence encoding a PA(400) polypeptide

GCCGCGCCAGCGGCCCCGGCCCCTGCCGCGCCCGCTGCTCCCGCCCCTGCTGCCCCAGCCGCCGCTCCTGCGGCACCTGCGCCCGCCGCGCCGGCAGCGCCGGCACCGGCAGCTCCGGCGGCCGCGCCTGCAGCTCCTGCACCGGCGGCTCCAGCAGCCCCGGCGCCGGCCGCACCTGCGGCGGCGCCCGCGGCGCCTGCACCCGCAGCGCCTGCGGCACCGGCCCCAGCAGCCCCTGCCGCCGCACCGGCTGCGCCTGCCCCAGCGGCCCCCGCTGCCCCGGCCCCGGCGGCTCCAGCCGCAGCGCCTGCCGCCCCAGCGCCCGCAGCACCGGCGGCACCAGCTCCGGCGGCGCCGGCGGCGGCTCCGGCAGCTCCGGCCCCTGCTGCGCCGGCTGCGCCGGCTCCGGCGGCCCCTGCGGCGGCTCCGGCCGCACCTGCACCTGCCGCGCCGGCTGCTCCGGCCCCGGCTGCCCCAGCAGCGGCACCAGCAGCGCCTGCTCCTGCGGCGCCTGCAGCTCCGGCGCCGGCAGCCCCGGCCGCCGCACCCGCGGCTCCAGCCCCCGCCGCTCCAGCAGCCCCCGCGCCAGCTGCACCTGCTGCCGCTCCTGCTGCCCCTGCTCCCGCTGCCCCCGCCGCCCCCGCCCCAGCTGCCCCCGCTGCCGCACCTGCTGCCCCAGCTCCCGCTGCCCCAGCCGCGCCGGCCCCCGCAGCTCCAGCCGCGGCACCAGCTGCCCCAGCTCCAGCGGCGCCTGCTGCCCCGGCCCCCGCGGCACCGGCTGCCGCGCCCGCAGCTCCAGCGCCTGCTGCACCGGCTGCTCCGGCACCCGCCGCGCCAGCAGCTGCCCCTGCGGCACCAGCTCCTGCTGCCCCCGCGGCACCTGCACCCGCTGCCCCGGCGGCAGCTCCCGCCGCGCCAGCCCCTGCAGCTCCTGCTGCACCTGCTCCTGCCGCCCCTGCTGCTGCCCCTGCTGCTCCAGCCCCTGCAGCACCGGCCGCTC CAGCTCCTGCCGCTCCTGCCGCTGCGCCCGCTGCTCCAGCCCCAGCTGCGCCAGCAGCTCCTGCACCTGCTGCCCCTGCCGCCGCCCCTGCGGCTCCAGCACCTGCTGCACCGGCCCCCCGGCGCCCGCTGCCCCCGCAGCAGCCCCAGCCGCACCCGCTCCAGCAGCTCCCGCAGCCCCAGCACCCGCAGCACCAGCCGCC

SEQID No. eleven:

Amino acid sequence of the asparaginase-PA(200) fusion protein

AAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAADKLPNIVILATGGTIAGSAATGTQTTGYKAGALGVDTLINAVPEVKKLANVKGEQFSNMASENMTGDVVLKLSQRVNELLARDDVDGVVITHGTDTVEESAYFLHLTVKSDKPVVFVAAMRPATAISADGPMNLLEAVRVAGDKQSRGRGVMVVLNDRIGSARYITKTNASTLDTFKANEEGYLGVIIGNRIYYQNRIDKLHTTRSVFDVRGLTSLPKVDILYGYQDDPEYLYDAAIQHGVKGIVYAGMGAGSVSVRGIAGMRKAMEKGVVVIRSTRTGNGIVPPDEELPGLVSDSLNPAHARILLMLALTRTSDPKVIQEYFHTY

SEQID No. 12:

Nucleotide sequence encoding asparaginase-PA(200) fusion protein (XbaI/HindIII)

Mature fusion protein (SEQ ID NO 11) encoded by bases 127-1710 (bold letters). Thus, the nucleotide sequence encoding the fusion protein can range from nucleotides at position 127 to 1710 of SEQ ID NO: 12. Accordingly, the term "modified protein comprising or consisting of an amino acid sequence encoded by a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 12" as used herein may be more narrowly defined as "a modified protein comprising or consisting of an amino acid sequence encoded by a nucleic acid having the nucleotide sequence represented at positions 127 to 1710 of SEQ ID NO: 12".

TCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTTCAAATTCAAAAAAAACTTCCTGGTGGGTCTGAGCGCAGCACTGATGAGCATTAGCCTGTTTAGCGCAACCGCAAGCGCA GCCGCGCCAGCGGCCCCGGCCCCTGCCGCGCCCGCTGCTCCCGCCCCTGCTGCCCCAGCCGCCGCTCCTGCGGCACCTGCGCCCGCCGCGCCGGCAGCGCCGGCACCGGCAGCTCCGGCGGCCGCGCCTGCAGCTCCTGCACCGGCGGCTCCAGCAGCCCCGGCGCCGGCCGCACCTGCGGCGGCGCCCGCGGCGCCTGCACCCGCAGCGCCTGCGGCACCGGCCCCAGCAGCCCCTGCCGCCGCACCGGCTGCGCCTGCCCCAGCGGCCCCCGCTGCCCCGGCCCCGGCGGCTCCAGCCGCAGCGCCTGCCGCCCCAGCGCCCGCAGCACCGGCGGCACCAGCTCCGGCGGCGCCGGCGGCGGCTCCGGCAGCTCCGGCCCCTGCTGCGCCGGCTGCGCCGGCTCCGGCGGCCCCTGCGGCGGCTCCGGCCGCACCTGCACCTGCCGCGCCGGCTGCTCCGGCCCCGGCTGCCCCAGCAGCGGCACCAGCAGCGCCTGCTCCTGCGGCGCCTGCAGCTCCGGCGCCGGCAGCCCCGGCCGCCGCACCCGCGGCTCCAGCCCCCGCCGCTCCAGCAGCCCCCGCGCCAGCTGCACCTGCTGCCGCAGATAAACTGCCGAATATTGTTATTCTGGCAACCGGTGGCACCATTGCAGGTAGCGCAGCAACCGGCACCCAGACCACCGGTTATAAAGCCGGTGCACTGGGTGTTGATACCCTGATTAATGCAGTTCCGGAAGTTAAAAAACTGGCCAATGTTAAAGGTGAGCAGTTTAGCAATATGGCCAGCGAAAATATGACCGGTGATGTTGTTCTGAAACTGAGCCAGCGTGTTAATGAACTGCTGGCACGTGATGATGTTGATGGTGTTGTTATTACCCATGGCACCGATACCGTTGAAGAAAGCGCATATTTTCTGCATCTGACCGTGAAAAGCGATAAACCGGTTGTTTTTGTTGCAGCAATGCGTCCGGCAACCGCCATTAGCGCAGATGGTCCGATGAATCTGCTGGAAGCAGTTCGTGTTGCCGGTGATAAACAGAGCCGTGGTCGTGGTGTTATGGTTGTGCTGAATGATCGTATTGGTAGCGCACGTTATATTACCAAAACCAATGCAAGCACCCTGGATACCTTTAAAGCAAATGAAGAAGGTTATCTGGGCGTCATTATTGGCAATCGTATCTATTATCAGAACCGCATCGACAAACTGCATACCACCCGTAGCGTTTTTGATGTTCGTGGTCTGACCAGCCTGCCGAAAGTGGATATTCTGTATGGTTATCAGGATGATCCGGAATATCTGTATGATGCAGCAATTCAGCATGGTGTGAAAGGTATTGTTTATGCAGGTATGGGTGCGGGTAGCGTTAGCGTTCGTGGTATTGCCGGTATGCGTAAAGCAATGGAAAAAGGTGTTGTTGTGATTCGTAGCACCCGTACCGGTAATGGTATTGTTCCGCCTGATGAAGAACTGCCTGGTCTGGTTAGCGATAGCCTGAATCCGGCACATGCACGTATTCTGCTGATGCTGGCACTGACCCGTACCAGCGATCCGAAAGTTATTCAAGAATATTTTCATACCTAT TAAGCTT

SEQID No. 13:

Аминокислотная последовательность гибридного белка аспарагиназа-PA(400) AAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPAAADKLPNIVILATGGTIAGSAATGTQTTGYKAGALGVDTLINAVPEVKKLANVKGEQFSNMASENMTGDVVLKLSQRVNELLARDDVDGVVITHGTDTVEESAYFLHLTVKSDKPVVFVAAMRPATAISADGPMNLLEAVRVAGDKQSRGRGVMVVLNDRIGSARYITKTNASTLDTFKANEEGYLGVIIGNRIYYQNRIDKLHTTRSVFDVRGLTSLPKVDILYGYQDDPEYLYDAAIQHGVKGIVYAGMGAGSVSVRGIAGMRKAMEKGVVVIRSTRTGNGIVPPDEELPGLVSDSLNPAHARILLMLALTRTSDPKVIQEYFHTY

SEQID No. fourteen:

Nucleotide sequence encoding asparaginase-PA(400) fusion protein

(XbaI/HindIII)

Mature fusion protein (SEQ ID NO 13) encoded by bases 127-2184 (bold letters). Thus, the nucleotide sequence encoding the fusion protein can range from nucleotides at position 127 to 2184 of SEQ ID NO: 14. Accordingly, the term "modified protein comprising or consisting of an amino acid sequence encoded by a nucleic acid having the nucleotide sequence shown in SEQ ID NO: 14" as used herein may be more narrowly defined as "a modified protein comprising or consisting of an amino acid sequence encoded by a nucleic acid having the nucleotide sequence represented at positions 127 to 2184 of SEQ ID NO: 14".

TCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTTCAAATTCAAAAAAAACTTCCTGGTGGGTCTGAGCGCAGCACTGATGAGCATTAGCCTGTTTAGCGCAACCGCAAGCGCA GCCGCGCCAGCGGCCCCGGCCCCTGCCGCGCCCGCTGCTCCCGCCCCTGCTGCCCCAGCCGCCGCTCCTGCGGCACCTGCGCCCGCCGCGCCGGCAGCGCCGGCACCGGCAGCTCCGGCGGCCGCGCCTGCAGCTCCTGCACCGGCGGCTCCAGCAGCCCCGGCGCCGGCCGCACCTGCGGCGGCGCCCGCGGCGCCTGCACCCGCAGCGCCTGCGGCACCGGCCCCAGCAGCCCCTGCCGCCGCACCGGCTGCGCCTGCCCCAGCGGCCCCCGCTGCCCCGGCCCCGGCGGCTCCAGCCGCAGCGCCTGCCGCCCCAGCGCCCGCAGCACCGGCGGCACCAGCTCCGGCGGCGCCGGCGGCGGCTCCGGCAGCTCCGGCCCCTGCTGCGCCGGCTGCGCCGGCTCCGGCGGCCCCTGCGGCGGCTCCGGCCGCACCTGCACCTGCCGCGCCGGCTGCTCCGGCCCCGGCTGCCCCAGCAGCGGCACCAGCAGCGCCTGCTCCTGCGGCGCCTGCAGCTCCGGCGCCGGCAGCCCCGGCCGCCGCACCCGCGGCTCCAGCCCCCGCCGCTCCAGCAGCCCCCGCGCCAGCTGCACCTGCTGCCGCTCCTGCTGCCCCTGCTCCCGCTGCCCCCGCCGCCCCCGCCCCAGCTGCCCCCGCTGCCGCACCTGCTGCCCCAGCTCCCGCTGCCCCAGCCGCGCCGGCCCCCGCAGCTCCAGCCGCGGCACCAGCTGCCCCAGCTCCAGCGGCGCCTGCTGCCCCGGCCCCCGCGGCACCGGCTGCCGCGCCCGCAGCTCCAGCGCCTGCTGCACCGGCTGCTCCGGCACCCGCCGCGCCAGCAGCTGCCCCTGCGGCACCAGCTCCTGCTGCCCCCGCGGCACCTGCACCCGCTGCCCCGGCGGCAGCTCCCGCCGCGCCAGCCCCTGCAGCTCCTGCTGCACCTGCTCCTGCCGCCCCTGCTGCTGCCCCTGCTGCTCCAGCCCCTGCAGCACCGGCCGCTCCAGCTCCTGCCGCTCCTGCCGCTGCGCCCGCTGCTCCAGCCCCAGCTGCGCCAGCAGCTCCTGCACCTGCTGCCCCTGCCGCCGCCCCTGCGGCTCCAGCACCTGCTGCACCGGCCGCCCCGGCGCCCGCTGCCCCCGCAGCAGCCCCAGCCGCACCCGCTCCAGCAGCTCCCGCAGCCCCAGCACCCGCAGCACCAGCCGCCGCAGATAAACTGCCGAATATTGTTATTCTGGCAACCGGTGGCACCATTGCAGGTAGCGCAGCAACCGGCACCCAGACCACCGGTTATAAAGCCGGTGCACTGGGTGTTGATACCCTGATTAATGCAGTTCCGGAAGTTAAAAAACTGGCCAATGTTAAAGGTGAGCAGTTTAGCAATATGGCCAGCGAAAATATGACCGGTGATGTTGTTCTGAAACTGAGCCAGCGTGTTAATGAACTGCTGGCACGTGATGATGTTGATGGTGTTGTTATTACCCATGGCACCGATACCGTTGAAGAAAGCGCATATTTTCTGCATCTGACCGTGAAAAGCGATAAACCGGTTGTTTTTGTTGCAGCAATGCGTCCGGCAACCGCCATTAGCGCAGATGGTCCGATGAATCTGCTGGAAGCAGTTCGTGTTGCCGGTGATAAACAGAGCCGTGGTCGTGGTGTTATGGTTGTGCTGAATGATCGTATTGGTAGCGCACGTTATATTACCAAAACCAATGCAAGCACCCTGGATACCTTTAAAGCAAATGAAGAAGGTTATCTGGGCGTCATTATTGGCAATCGTATCTATTATCAGAACCGCATCGACAAACTGCATACCACCCGTAGCGTTTTTGATGTTCGTGGTCTGACCAGCCTGCCGAAAGTGGATATTCTGTATGGTTATCAGGATGATCCGGAATATCTGTATGATGCAGCAATTCAGCATGGTGTGAAAGGTATTGTTTATGCAGGTATGGGTGCGGGTAGCGTTAGCGTTCGTGGTATTGCCGGTATGCGTAAAGCAATGGAAAAAGGTGTTGTTGTGATTCGTAGCACCCGTACCGGTAATGGTATTGTTCCGCCTGATGAAGAACTGCCTGGTCTGGTTAGCGATAGCCTGAATCCGGCACATGCACGTATTCTGCTGATGCTGGCACTGACCCGTACCAGCGATCCGAAAGTTATTCAAGAATATTTTCATACCTAT TAAGCTT

SEQ ID NO 15: Amino acid sequence of PA(40) peptide

AAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPA

SEQ ID NO 16: Modified PA(20) peptide

Pga-AAPAAPAPAAPAAPAPAAPA-Ahx-COOH

SEQ ID NO 17: Modified PA(40) peptide

Pga-AAPAAPAPAAPAAPAPAAPAAAPAAPAPAAPAAPAPAAPA-Ahx-COOH

[000197] All references cited in this document are incorporated by reference in their entirety. Having fully described the invention, one skilled in the art will appreciate that the invention may be practiced under a wide and equivalent range of conditions, parameters, and the like, without affecting the spirit or scope of the invention or any embodiment thereof.

Link List

Carpino & El-Faham, 1995

Carpino, LA & El-Faham, A. (1995) Tetramethylfluoroformamidinium hexafluorophosphate: a rapid-acting peptide coupling reagent for solution and solid phase peptide synthesis. J. Am. Chem. Soc . 117 (19), 5401-5402.

El Faham et al., 2011

El-Faham, A. & Albericio, F. (2011) Peptide coupling reagents, more than a letter soup. Chem Rev. 111 (11), 6557-6602.

Hermanson, 2013

Hermanson, G.T. (2013) Bioconjugate techniques. third edition. academic press.

Isidro-Llobet, 2009

Isidro-Llobet, A., Alvarez, M. & Albericio, F. (2009) Amino acid-protecting groups. Chem. Rev. 109 (6), 2455-2504.

Klose et al., 1999

Klose, J., Bienert, M., Mollenkopf, C., Wehle, D., Zhang, C.-W., Carpino, LA & Henklein P. (1999) 2-Propanephosphonic acid anhydride (T3P)-mediated segment coupling and head-to-tail cyclization of sterically hindered peptides. Chem. commun . 18 , 1847-1848.

Montalbetti et al., 2005

Montalbetti, CA & Falque, V. (2005) Amide bond formation and peptide coupling. Tetrahedron , 61 (46), 10827-10852.

Valeur et al., 2007

Valeur, E. & Bradley, M. (2009) Amide bond formation: beyond the myth of coupling reagents. Chem. soc. Rev. , 38 (2), 606-631.

Valeur et al., 2009

Valeur, E. & Bradley, M. (2009) Amide bond formation: beyond the myth of coupling reagents. Chem. soc. Rev. , 38 (2), 606-631.

Wuts, 2012

Wuts, P.G. & Greene, T.W. (2012) Greene's Protective Groups in Organic Synthesis. Fourth Edition. John Wiley & Sons.

--->

SEQUENCE LIST

<110> XL Protein GmbH

Jazz Pharmaceuticals Ireland Limited

<120> Modified L-asparaginase

<130> AA2000 PCT S3

<150>EP 17 17 7237.9

<151> 06/21/2017

<150> US 62/523,061

<151> 06/21/2017

<150> US 15/671,086

<151> 08/07/2017

<160> 17

<170> BiSSAP 1.3

<210> 1

<211> 327

<212> Protein

<213> Dickeya chrysanthemi

<220>

<223> L-asparaginase

<400> 1

Ala Asp Lys Leu Pro Asn Ile Val Ile Leu Ala Thr Gly Gly Thr Ile

1 5 10 15

Ala Gly Ser Ala Ala Thr Gly Thr Gln Thr Thr Gly Tyr Lys Ala Gly

20 25 30

Ala Leu Gly Val Asp Thr Leu Ile Asn Ala Val Pro Glu Val Lys Lys

35 40 45

Leu Ala Asn Val Lys Gly Glu Gln Phe Ser Asn Met Ala Ser Glu Asn

50 55 60

Met Thr Gly Asp Val Val Leu Lys Leu Ser Gln Arg Val Asn Glu Leu

65 70 75 80

Leu Ala Arg Asp Asp Val Asp Gly Val Val Ile Thr His Gly Thr Asp

85 90 95

Thr Val Glu Glu Ser Ala Tyr Phe Leu His Leu Thr Val Lys Ser Asp

100 105 110

Lys Pro Val Val Phe Val Ala Ala Met Arg Pro Ala Thr Ala Ile Ser

115 120 125

Ala Asp Gly Pro Met Asn Leu Leu Glu Ala Val Arg Val Ala Gly Asp

130 135 140

Lys Gln Ser Arg Gly Arg Gly Val Met Val Val Leu Asn Asp Arg Ile

145 150 155 160

Gly Ser Ala Arg Tyr Ile Thr Lys Thr Asn Ala Ser Thr Leu Asp Thr

165 170 175

Phe Lys Ala Asn Glu Glu Gly Tyr Leu Gly Val Ile Ile Gly Asn Arg

180 185 190

Ile Tyr Tyr Gln Asn Arg Ile Asp Lys Leu His Thr Thr Arg Ser Val

195 200 205

Phe Asp Val Arg Gly Leu Thr Ser Leu Pro Lys Val Asp Ile Leu Tyr

210 215 220

Gly Tyr Gln Asp Asp Pro Glu Tyr Leu Tyr Asp Ala Ala Ile Gln His

225 230 235 240

Gly Val Lys Gly Ile Val Tyr Ala Gly Met Gly Ala Gly Ser Val Ser

245 250 255

Val Arg Gly Ile Ala Gly Met Arg Lys Ala Met Glu Lys Gly Val Val

260 265 270

Val Ile Arg Ser Thr Arg Thr Gly Asn Gly Ile Val Pro Pro Asp Glu

275 280 285

Glu Leu Pro Gly Leu Val Ser Asp Ser Leu Asn Pro Ala His Ala Arg

290 295 300

Ile Leu Leu Met Leu Ala Leu Thr Arg Thr Ser Asp Pro Lys Val Ile

305 310 315 320

Gln Glu Tyr Phe His Thr Tyr

325

<210> 2

<211> 981

<212> DNA

<213> Dickeya chrysanthemi

<220>

<223> L-asparaginase

<400> 2

gcagataaac tgccgaatat tgtttattctg gcaaccggtg gcaccattgc aggtagcgca 60

gcaaccggca cccaaaccac aggttataaa gccggtgcac tgggtgttga taccctgatt 120

aatgcagttc cggaagttaa aaaactggcc aatgtgaaag gtgaacagtt tagcaatatg 180

gccagcgaaa atatgaccgg tgatgttgtt ctgaaactga gccagcgtgt taatgaactg 240

ctggcacgtg atgatgttga tggtgtggtt attacccatg gcaccgatac cgttgaagaa 300

agcgcctatt ttctgcatct gaccgtgaaa agcgataaac cggttgtttt tgttgcagca 360

atgcgtccgg caaccgcaat tagcgcagat ggtccgatga atctgctgga agcagttcgt 420

gttgccggtg ataaacagag ccgtggtcgt ggtgttatgg ttgttctgaa tgatcgtatt 480

ggtagcgcac gctatattac caaaaccaat gcaagcaccc tggatacctt taaagccaat 540

gaagaaggtt atctgggcgt tattattggc aatcgcattt attatcagaa tcgcattgat 600

aaactgcata ccacccgtag cgtttttgat gttcgtggtc tgaccagcct gccgaaagtt 660

gatattctgt atggctatca ggatgatccg gaatatctgt atgatgcagc cattcagcat 720

ggtgttaaag gtattgtgta tgcaggtatg ggtgcaggta gcgttagcgt tcgtggtatt 780

gcaggtatgc gtaaagcaat ggaaaaaggc gttgttgtta ttcgtagcac ccgtaccggt 840

aatggtattg ttccgccgga tgaagaactg ccgggtctgg ttagcgatag cctgaatccg 900

gcacatgcac gtattctgct gatgctggca ctgacccgta ccagcgatcc gaaagtgatt 960

caggaatatt ttcataccta t 981

<210> 3

<211> 366

<212> Protein

<213> Dickeya chrysanthemi

<220>

<223> L-asparaginase with signal peptide

<400> 3

Met Phe Lys Phe Lys Lys Asn Phe Leu Val Gly Leu Ser Ala Ala Leu

1 5 10 15

Met Ser Ile Ser Leu Phe Ser Ala Thr Ala Ser Ala Ala Arg Arg Ala

20 25 30

Ile Val Gly Arg Ser Ser Ala Ala Asp Lys Leu Pro Asn Ile Val Ile

35 40 45

Leu Ala Thr Gly Gly Thr Ile Ala Gly Ser Ala Ala Thr Gly Thr Gln

50 55 60

Thr Thr Gly Tyr Lys Ala Gly Ala Leu Gly Val Asp Thr Leu Ile Asn

65 70 75 80

Ala Val Pro Glu Val Lys Lys Leu Ala Asn Val Lys Gly Glu Gln Phe

85 90 95

Ser Asn Met Ala Ser Glu Asn Met Thr Gly Asp Val Val Leu Lys Leu

100 105 110

Ser Gln Arg Val Asn Glu Leu Leu Ala Arg Asp Asp Val Asp Gly Val

115 120 125

Val Ile Thr His Gly Thr Asp Thr Val Glu Glu Ser Ala Tyr Phe Leu

130 135 140

His Leu Thr Val Lys Ser Asp Lys Pro Val Val Phe Val Ala Ala Met

145 150 155 160

Arg Pro Ala Thr Ala Ile Ser Ala Asp Gly Pro Met Asn Leu Leu Glu

165 170 175

Ala Val Arg Val Ala Gly Asp Lys Gln Ser Arg Gly Arg Gly Val Met

180 185 190

Val Val Leu Asn Asp Arg Ile Gly Ser Ala Arg Tyr Ile Thr Lys Thr

195 200 205

Asn Ala Ser Thr Leu Asp Thr Phe Lys Ala Asn Glu Glu Gly Tyr Leu

210 215 220

Gly Val Ile Ile Gly Asn Arg Ile Tyr Tyr Gln Asn Arg Ile Asp Lys

225 230 235 240

Leu His Thr Thr Arg Ser Val Phe Asp Val Arg Gly Leu Thr Ser Leu

245 250 255

Pro Lys Val Asp Ile Leu Tyr Gly Tyr Gln Asp Asp Pro Glu Tyr Leu

260 265 270

Tyr Asp Ala Ala Ile Gln His Gly Val Lys Gly Ile Val Tyr Ala Gly

275 280 285

Met Gly Ala Gly Ser Val Ser Val Arg Gly Ile Ala Gly Met Arg Lys

290 295 300

Ala Met Glu Lys Gly Val Val Val Ile Arg Ser Thr Arg Thr Gly Asn

305 310 315 320

Gly Ile Val Pro Pro Asp Glu Glu Leu Pro Gly Leu Val Ser Asp Ser

325 330 335

Leu Asn Pro Ala His Ala Arg Ile Leu Leu Met Leu Ala Leu Thr Arg

340 345 350

Thr Ser Asp Pro Lys Val Ile Gln Glu Tyr Phe His Thr Tyr

355 360 365

<210> 4

<211> 1147

<212> DNA

<213> Dickeya chrysanthemi

<220>

<223> L-asparaginase

<400> 4

tctagaaata attttgttta actttaagaa ggagatatac atatgttcaa attcaaaaaa 60

aacttcctgg tgggtctgag cgcagcactg atgagcatta gcctgtttag cgcaaccgca 120

agcgcagcca gaagagcgat tgtaggacgc tcttctgccg cagataaact gccgaatatt 180

gttattctgg caaccggtgg caccattgca ggtagcgcag caaccggcac ccagaccacc 240

ggttataaag ccggtgcact gggtgttgat accctgatta atgcagttcc ggaagttaaa 300

360

gatgttgttc tgaaactgag ccagcgtgtt aatgaactgc tggcacgtga tgatgttgat 420

ggtgttgtta ttacccatgg caccgatacc gttgaagaaa gcgcatattt tctgcatctg 480

accgtgaaaa gcgataaacc ggttgttttt gttgcagcaa tgcgtccggc aaccgccatt 540

agcgcagatg gtccgatgaa tctgctggaa gcagttcgtg ttgccggtga taaacagagc 600

cgtggtcgtg gtgttatggt tgtgctgaat gatcgtattg gtagcgcacg ttatattacc 660

aaaaccaatg caagcaccct ggataccttt aaagcaaatg aagaaggtta tctgggcgtc 720

attattggca atcgtatcta ttatcagaac cgcatcgaca aactgcatac cacccgtagc 780

gtttttgatg ttcgtggtct gaccagcctg ccgaaagtgg atattctgta tggttatcag 840

gatgatccgg aatatctgta tgatgcagca attcagcatg gtgtgaaagg tattgtttat 900

gcaggtatgg gtgcgggtag cgttagcgtt cgtggtattg ccggtatgcg taaagcaatg 960

gaaaaaggtg ttgttgtgat tcgtagcacc cgtaccggta atggtattgt tccgcctgat 1020

gaagaactgc ctggtctggt tagcgatagc ctgaatccgg cacatgcacg tattctgctg 1080

atgctggcac tgacccgtac cagcgatccg aaagttattc aagaatattt tcatacctat 1140

taagctt 1147

<210> 5

<211> 20

<212> Protein

<213> Artificial sequence

<220>

<223> Peptide PA(20)

<400> 5

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

1 5 10 15

Ala Ala Pro Ala

twenty

<210> 6

<211> 60

<212> DNA

<213> Artificial sequence

<220>

<223> Peptide PA(20)

<400> 6

gccgcgccag cggccccggc ccctgccgcg cccgctgctc ccgcccctgc tgccccagcc 60

<210> 7

<211> 201

<212> Protein

<213> Artificial sequence

<220>

<223> PA(200) polypeptide.

<400> 7

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

1 5 10 15

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

20 25 30

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

35 40 45

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

50 55 60

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

65 70 75 80

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

85 90 95

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

100 105 110

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

115 120 125

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

130 135 140

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

145 150 155 160

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

165 170 175

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

180 185 190

Ala Pro Ala Pro Ala Ala Pro Ala Ala

195 200

<210> 8

<211> 603

<212> DNA

<213> Artificial sequence

<220>

<223> PA(200) polypeptide.

<400> 8

gccgcgccag cggccccggc ccctgccgcg cccgctgctc ccgcccctgc tgccccagcc 60

gccgctcctg cggcacctgc gccgccgcg ccggcagcgc cggcaccggc agctccggcg 120

gccgcgcctg cagctcctgc accggcggct ccagcagccc cggcgccggc cgcacctgcg 180

gcggcgccg cggcgcctgc acccgcagcg cctgcggcac cggccccagc agcccctgcc 240

gccgcaccgg ctgcgcctgc cccagcggcc cccgctgccc cggccccggc ggctccagcc 300

gcagcgcctg ccgccccagc gcccgcagca ccggcggcac cagctccggc ggcgccggcg 360

gcggctccgg cagctccggc ccctgctgcg ccggctgcgc cggctccggc ggcccctgcg 420

gcggctccgg ccgcacctgc acctgccgcg ccggctgctc cggccccggc tgccccagca 480

gcggcaccag cagcgcctgc tcctgcggcg cctgcagctc cggcgccggc agccccggcc 540

600

gcc 603

<210> 9

<211> 401

<212> Protein

<213> Artificial sequence

<220>

<223> PA(400) polypeptide.

<400> 9

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

1 5 10 15

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

20 25 30

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

35 40 45

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

50 55 60

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

65 70 75 80

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

85 90 95

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

100 105 110

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

115 120 125

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

130 135 140

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

145 150 155 160

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

165 170 175

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

180 185 190

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

195 200 205

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

210 215 220

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

225 230 235 240

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

245 250 255

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

260 265 270

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

275 280 285

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

290 295 300

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

305 310 315 320

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

325 330 335

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

340 345 350

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

355 360 365

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

370 375 380

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

385 390 395 400

Ala

<210> 10

<211> 1203

<212> DNA

<213> Artificial sequence

<220>

<223> PA(400) polypeptide.

<400> 10

gccgcgccag cggccccggc ccctgccgcg cccgctgctc ccgcccctgc tgccccagcc 60

gccgctcctg cggcacctgc gcccgccgcg ccggcagcgc cggcaccggc agctccggcg 120

gccgcgcctg cagctcctgc accggcggct ccagcagccc cggcgccggc cgcacctgcg 180

gcggcgccg cggcgcctgc acccgcagcg cctgcggcac cggccccagc agcccctgcc 240

gccgcaccgg ctgcgcctgc cccagcggcc cccgctgccc cggccccggc ggctccagcc 300

gcagcgcctg ccgccccagc gcccgcagca ccggcggcac cagctccggc ggcgccggcg 360

gcggctccgg cagctccggc ccctgctgcg ccggctgcgc cggctccggc ggcccctgcg 420

gcggctccgg ccgcacctgc acctgccgcg ccggctgctc cggccccggc tgccccagca 480

gcggcaccag cagcgcctgc tcctgcggcg cctgcagctc cggcgccggc agccccggcc 540

600

gccgctcctg ctgcccctgc tcccgctgcc cccgccgccc ccgccccagc tgcccccgct 660

gccgcacctg ctgccccagc tcccgctgcc ccagccgcgc cggcccccgc agctccagcc 720

gcggcaccag ctgccccagc tccagcggcg cctgctgccc cggcccccgc ggcaccggct 780

gccgcgcccg cagctccagc gcctgctgca ccggctgctc cggcacccgc cgcgccagca 840

gctgcccctg cggcaccagc tcctgctgcc cccgcggcac ctgcacccgc tgccccggcg 900

gcagctcccg ccgcgccagc ccctgcagct cctgctgcac ctgctcctgc cgcccctgct 960

gctgcccctg ctgctccagc ccctgcagca ccggccgctc cagctcctgc cgctcctgcc 1020

1080

gccgcccctg cggctccagc acctgctgca ccggccgccc cggcgcccgc tgcccccgca 1140

gcagccccag ccgcacccgc tccagcagct cccgcagccc cagcacccgc agcaccagcc 1200

gcc 1203

<210> 11

<211> 528

<212> Protein

<213> Artificial sequence

<220>

<223> Asparaginase-PA(200) fusion protein

<400> 11

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

1 5 10 15

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

20 25 30

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

35 40 45

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

50 55 60

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

65 70 75 80

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

85 90 95

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

100 105 110

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

115 120 125

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

130 135 140

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

145 150 155 160

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

165 170 175

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

180 185 190

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Asp Lys Leu Pro Asn Ile

195 200 205

Val Ile Leu Ala Thr Gly Gly Thr Ile Ala Gly Ser Ala Ala Thr Gly

210 215 220

Thr Gln Thr Thr Gly Tyr Lys Ala Gly Ala Leu Gly Val Asp Thr Leu

225 230 235 240

Ile Asn Ala Val Pro Glu Val Lys Lys Leu Ala Asn Val Lys Gly Glu

245 250 255

Gln Phe Ser Asn Met Ala Ser Glu Asn Met Thr Gly Asp Val Val Leu

260 265 270

Lys Leu Ser Gln Arg Val Asn Glu Leu Leu Ala Arg Asp Asp Val Asp

275 280 285

Gly Val Val Ile Thr His Gly Thr Asp Thr Val Glu Glu Ser Ala Tyr

290 295 300

Phe Leu His Leu Thr Val Lys Ser Asp Lys Pro Val Val Phe Val Ala

305 310 315 320

Ala Met Arg Pro Ala Thr Ala Ile Ser Ala Asp Gly Pro Met Asn Leu

325 330 335

Leu Glu Ala Val Arg Val Ala Gly Asp Lys Gln Ser Arg Gly Arg Gly

340 345 350

Val Met Val Val Leu Asn Asp Arg Ile Gly Ser Ala Arg Tyr Ile Thr

355 360 365

Lys Thr Asn Ala Ser Thr Leu Asp Thr Phe Lys Ala Asn Glu Glu Gly

370 375 380

Tyr Leu Gly Val Ile Ile Gly Asn Arg Ile Tyr Tyr Gln Asn Arg Ile

385 390 395 400

Asp Lys Leu His Thr Thr Arg Ser Val Phe Asp Val Arg Gly Leu Thr

405 410 415

Ser Leu Pro Lys Val Asp Ile Leu Tyr Gly Tyr Gln Asp Asp Pro Glu

420 425 430

Tyr Leu Tyr Asp Ala Ala Ile Gln His Gly Val Lys Gly Ile Val Tyr

435 440 445

Ala Gly Met Gly Ala Gly Ser Val Ser Val Arg Gly Ile Ala Gly Met

450 455 460

Arg Lys Ala Met Glu Lys Gly Val Val Val Ile Arg Ser Thr Arg Thr

465 470 475 480

Gly Asn Gly Ile Val Pro Pro Asp Glu Glu Leu Pro Gly Leu Val Ser

485 490 495

Asp Ser Leu Asn Pro Ala His Ala Arg Ile Leu Leu Met Leu Ala Leu

500 505 510

Thr Arg Thr Ser Asp Pro Lys Val Ile Gln Glu Tyr Phe His Thr Tyr

515 520 525

<210> 12

<211> 1717

<212> DNA

<213> Artificial sequence

<220>

<223> Asparaginase-PA(200) fusion protein

<400> 12

tctagaaata attttgttta actttaagaa ggagatatac atatgttcaa attcaaaaaa 60

aacttcctgg tgggtctgag cgcagcactg atgagcatta gcctgtttag cgcaaccgca 120

agcgcagccg cgccagcggc cccggcccct gccgcgcccg ctgctcccgc ccctgctgcc 180

ccagccgccg ctcctgcggc acctgcgccc gccgcgccgg cagcgccggc accggcagct 240

ccggcggccg cgcctgcagc tcctgcaccg gcggctccag cagccccggc gccggccgca 300

cctgcggcgg cgcccgcggc gcctgcaccc gcagcgcctg cggcaccggc cccagcagcc 360

cctgccgccg caccggctgc gcctgcccca gcggcccccg ctgccccggc cccggcggct 420

ccagccgcag cgcctgccgc cccagcgccc gcagcaccgg cggcaccagc tccggcggcg 480

ccggcggcgg ctccggcagc tccggcccct gctgcgccgg ctgcgccggc tccggcggcc 540

cctgcggcgg ctccggccgc acctgcacct gccgcgccgg ctgctccggc cccggctgcc 600

ccagcagcgg caccagcagc gcctgctcct gcggcgcctg cagctccggc gccggcagcc 660

ccggccgccg cacccgcggc tccagccccc gccgctccag cagcccccgc gccagctgca 720

cctgctgccg cagataaact gccgaatatt gttattctgg caaccggtgg caccattgca 780

ggtagcgcag caaccggcac ccagaccacc ggttataaag ccggtgcact gggtgttgat 840

accctgatta atgcagttcc ggaagttaaa aaactggcca atgttaaagg tgagcagttt 900

agcaatatgg ccagcgaaaa tatgaccggt gatgttgttc tgaaactgag ccagcgtgtt 960

aatgaactgc tggcacgtga tgatgttgat ggtgttgtta ttacccatgg caccgatacc 1020

gttgaagaaa gcgcatattt tctgcatctg accgtgaaaa gcgataaacc ggttgttttt 1080

gttgcagcaa tgcgtccggc aaccgccatt agcgcagatg gtccgatgaa tctgctggaa 1140

gcagttcgtg ttgccggtga taaacagagc cgtggtcgtg gtgttatggt tgtgctgaat 1200

gatcgtattg gtagcgcacg ttatattacc aaaaccaatg caagcaccct ggataccttt 1260

aaagcaaatg aagaaggtta tctgggcgtc

cgcatcgaca aactgcatac cacccgtagc gtttttgatg ttcgtggtct gaccagcctg 1380

ccgaaagtgg atattctgta tggttatcag gatgatccgg aatatctgta tgatgcagca 1440

1500

1560

cgtaccggta atggtattgt tccgcctgat gaagaactgc ctggtctggt tagcgatagc 1620

ctgaatccgg cacatgcacg tattctgctg atgctggcac tgacccgtac cagcgatccg 1680

aaagttattc aagaatattt tcatacctat taagctt 1717

<210> 13

<211> 728

<212> Protein

<213> Artificial sequence

<220>

<223> Asparaginase-PA-(400) fusion protein

<400> 13

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

1 5 10 15

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

20 25 30

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

35 40 45

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

50 55 60

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

65 70 75 80

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

85 90 95

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

100 105 110

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

115 120 125

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

130 135 140

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

145 150 155 160

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

165 170 175

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

180 185 190

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

195 200 205

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

210 215 220

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

225 230 235 240

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

245 250 255

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

260 265 270

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

275 280 285

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

290 295 300

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

305 310 315 320

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

325 330 335

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

340 345 350

Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro

355 360 365

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Ala Pro Ala

370 375 380

Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

385 390 395 400

Ala Ala Asp Lys Leu Pro Asn Ile Val Ile Leu Ala Thr Gly Gly Thr

405 410 415

Ile Ala Gly Ser Ala Ala Thr Gly Thr Gln Thr Thr Gly Tyr Lys Ala

420 425 430

Gly Ala Leu Gly Val Asp Thr Leu Ile Asn Ala Val Pro Glu Val Lys

435 440 445

Lys Leu Ala Asn Val Lys Gly Glu Gln Phe Ser Asn Met Ala Ser Glu

450 455 460

Asn Met Thr Gly Asp Val Val Leu Lys Leu Ser Gln Arg Val Asn Glu

465 470 475 480

Leu Leu Ala Arg Asp Asp Val Asp Gly Val Val Ile Thr His Gly Thr

485 490 495

Asp Thr Val Glu Glu Ser Ala Tyr Phe Leu His Leu Thr Val Lys Ser

500 505 510

Asp Lys Pro Val Val Phe Val Ala Ala Met Arg Pro Ala Thr Ala Ile

515 520 525

Ser Ala Asp Gly Pro Met Asn Leu Leu Glu Ala Val Arg Val Ala Gly

530 535 540

Asp Lys Gln Ser Arg Gly Arg Gly Val Met Val Val Leu Asn Asp Arg

545 550 555 560

Ile Gly Ser Ala Arg Tyr Ile Thr Lys Thr Asn Ala Ser Thr Leu Asp

565 570 575

Thr Phe Lys Ala Asn Glu Glu Gly Tyr Leu Gly Val Ile Ile Gly Asn

580 585 590

Arg Ile Tyr Tyr Gln Asn Arg Ile Asp Lys Leu His Thr Thr Arg Ser

595 600 605

Val Phe Asp Val Arg Gly Leu Thr Ser Leu Pro Lys Val Asp Ile Leu

610 615 620

Tyr Gly Tyr Gln Asp Asp Pro Glu Tyr Leu Tyr Asp Ala Ala Ile Gln

625 630 635 640

His Gly Val Lys Gly Ile Val Tyr Ala Gly Met Gly Ala Gly Ser Val

645 650 655

Ser Val Arg Gly Ile Ala Gly Met Arg Lys Ala Met Glu Lys Gly Val

660 665 670

Val Val Ile Arg Ser Thr Arg Thr Gly Asn Gly Ile Val Pro Pro Asp

675 680 685

Glu Glu Leu Pro Gly Leu Val Ser Asp Ser Leu Asn Pro Ala His Ala

690 695 700

Arg Ile Leu Leu Met Leu Ala Leu Thr Arg Thr Ser Asp Pro Lys Val

705 710 715 720

Ile Gln Glu Tyr Phe His Thr Tyr

725

<210> 14

<211> 2317

<212> DNA

<213> Artificial sequence

<220>

<223> Asparaginase-PA(400) fusion protein

<400> 14

tctagaaata attttgttta actttaagaa ggagatatac atatgttcaa attcaaaaaa 60

aacttcctgg tgggtctgag cgcagcactg atgagcatta gcctgtttag cgcaaccgca 120

agcgcagccg cgccagcggc cccggcccct gccgcgcccg ctgctcccgc ccctgctgcc 180

ccagccgccg ctcctgcggc acctgcgcc gccgcgccgg cagcgccggc accggcagct 240

ccggcggccg cgcctgcagc tcctgcaccg gcggctccag cagccccggc gccggccgca 300

cctgcggcgg cgcccgcggc gcctgcaccc gcagcgcctg cggcaccggc cccagcagcc 360

cctgccgccg caccggctgc gcctgcccca gcggcccccg ctgccccggc cccggcggct 420

ccagccgcag cgcctgccgc cccagcgccc gcagcaccgg cggcaccagc tccggcggcg 480

ccggcggcgg ctccggcagc tccggcccct gctgcgccgg ctgcgccggc tccggcggcc 540

cctgcggcgg ctccggccgc acctgcacct gccgcgccgg ctgctccggc cccggctgcc 600

ccagcagcgg caccagcagc gcctgctcct gcggcgcctg cagctccggc gccggcagcc 660

ccggccgccg cacccgcggc tccagccccc gccgctccag cagcccccgc gccagctgca 720

cctgctgccg ctcctgctgc ccctgctccc gctgcccccg ccgcccccgc cccagctgcc 780

cccgctgccg cacctgctgc cccagctccc gctgccccag ccgcgccggc ccccgcagct 840

ccagccgcgg caccagctgc cccagctcca gcggcgcctg ctgccccggc ccccgcggca 900

ccggctgccg cgcccgcagc tccagcgcct gctgcaccgg ctgctccggc acccgccgcg 960

cggcagctg cccctgcggc accagctcct gctgcccccg cggcacctgc acccgctgcc 1020

ccggcggcag ctcccgccgc gccagcccct gcagctcctg ctgcacctgc tcctgccgcc 1080

cctgctgctg cccctgctgc tccagcccct gcagcaccgg ccgctccagc tcctgccgct 1140

cctgccgctg cgcccgctgc tccagcccca gctgcgccag cagctcctgc acctgctgcc 1200

cctgccgccg cccctgcggc tccagcacct gctgcaccgg ccgccccggc gcccgctgcc 1260

ccgcagcag ccccagccgc acccgctcca gcagctcccg cagccccagc acccgcagca 1320

ccagccgccg cagataaact gccgaatatt gttattctgg caaccggtgg caccattgca 1380

ggtagcgcag caaccggcac ccagaccacc ggttataaag ccggtgcact gggtgttgat 1440

accctgatta atgcagttcc ggaagttaaa aaactggcca atgttaaagg tgagcagttt 1500

1560

aatgaactgc tggcacgtga tgatgttgat ggtgttgtta ttacccatgg caccgatacc 1620

gttgaagaaa gcgcatattt tctgcatctg accgtgaaaa gcgataaacc ggttgttttt 1680

gttgcagcaa tgcgtccggc aaccgccatt agcgcagatg gtccgatgaa tctgctggaa 1740

gcagttcgtg ttgccggtga taaacagagc cgtggtcgtg gtgttatggt tgtgctgaat 1800

gatcgtattg gtagcgcacg ttatattacc aaaaccaatg caagcaccct ggataccttt 1860

aaagcaaatg aagaaggtta tctgggcgtc attattggca atcgtatcta ttatcagaac 1920

cgcatcgaca aactgcatac cacccgtagc gtttttgatg ttcgtggtct gaccagcctg 1980

ccgaaagtgg atattctgta tggttatcag gatgatccgg aatatctgta tgatgcagca 2040

attcagcatg gtgtgaaagg tattgtttat gcaggtatgg gtgcgggtag cgttagcgtt 2100

2160

cgtaccggta atggtattgt tccgcctgat gaagaactgc ctggtctggt tagcgatagc 2220

ctgaatccgg cacatgcacg tattctgctg atgctggcac tgacccgtac cagcgatccg 2280

aaagttattc aagaatattt tcatacctat taagctt 2317

<210> 15

<211> 40

<212> Protein

<213> Artificial sequence

<220>

<223> Peptide PA(40)

<400> 15

Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala Pro

1 5 10 15

Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala

20 25 30

Ala Pro Ala Pro Ala Ala Pro Ala

35 40

<210> 16

<211> 22

<212> Protein

<213> Artificial sequence

<220>

<223> Modified PA(20) peptide

<220>

<221> OPTION

<222> 1

<223> Xaa = Pga (pyroglutamic acid)

<220>

<221> OPTION

<222> 22

<223> Xaa = Ahx (6-aminohexanoic acid)

<400> 16

Xaa Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala

1 5 10 15

Pro Ala Ala Pro Ala Xaa

twenty

<210> 17

<211> 42

<212> Protein

<213> Artificial sequence

<220>

<223> modified PA(40) peptide

<220>

<221> OPTION

<222> 1

<223> Xaa = Pga (pyroglutamic acid)

<220>

<221> OPTION

<222> 42

<223> Xaa = Ahx (6-aminohexanoic acid)

<400> 17

Xaa Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro Ala Ala Pro Ala

1 5 10 15

Pro Ala Ala Pro Ala Ala Ala Pro Ala Ala Pro Ala Pro Ala Ala Pro

20 25 30

Ala Ala Pro Ala Pro Ala Ala Pro Ala Xaa

35 40

<---

Claims (18)

1. A modified protein for the treatment of a disease treatable by asparagine depletion, wherein said modified protein is a tetramer and each monomer of said tetramer contains: (i) an L-asparaginase having at least 95% amino acid sequence identity to SEQ ID NO: 1, and (ii) one or more (poly)peptides, where the (poly)peptide consists of 20-600 amino acid residues of proline and alanine. 2. The modified protein according to claim 1, wherein the L-asparaginase subunit has an amino acid sequence comprising SEQ ID NO: 1. 3. The modified protein according to claim 1, wherein the L-asparaginase subunit has an amino acid sequence consisting of SEQ ID NO: 1. 4. The modified protein according to claim 3, wherein the polypeptide consists of 100-600 amino acid residues of proline and alanine. 5. The modified protein according to claim 3, wherein the proline amino acid residues comprise more than 10% and less than 70% of the polypeptide. 6. The modified protein according to claim 3, where the polypeptide has an amino acid sequence containing SEQ ID NO: 5. 7. The modified protein according to claim 3, wherein the polypeptide has an amino acid sequence comprising SEQ ID NO: 7. 8. The modified protein according to claim 3, where the polypeptide has an amino acid sequence containing SEQ ID NO: 9. 9. The modified protein according to claim 3, where the monomer has an amino acid sequence containing SEQ ID NO: 11. 10. The modified protein according to claim 3, where the monomer has an amino acid sequence containing SEQ ID NO: 13. 11. The modified protein of claim 1, wherein the disease treatable by asparagine depletion is cancer. 12. The modified protein of claim 11, wherein the cancer is leukemia or non-Hodgkin's lymphoma. 13. The modified protein of claim 1, wherein the polypeptide is fused at the N-terminus of the L-asparaginase subunit. 14. The modified protein of claim 1, wherein the cancer is pancreatic cancer. 15. The modified protein of claim 4, wherein no more than 6 consecutive amino acid residues in the polypeptide are identical. 16. The modified protein of claim 12, wherein the cancer is leukemia. 17. The modified protein of claim 16 wherein the leukemia is acute lymphoblastic leukemia (ALL). 18. The modified protein of claim 16 wherein the leukemia is acute myeloid leukemia (AML).

Images