WO2008145013A1

WO2008145013A1 - Fusion protein comprising targeting peptide of cd13 and lidamycin

Info

Publication number: WO2008145013A1
Application number: PCT/CN2008/001014
Authority: WO
Inventors: Yanbo Zheng; Yongsu Zhen; Boyang Shang; Xiujun Liu; Shuying Wu
Original assignee: Institute Of Medicinal Biotechnology Chinese Academy Of Medical Sciences
Priority date: 2007-05-25
Filing date: 2008-05-26
Publication date: 2008-12-04
Also published as: CN101070350A; WO2008145013A8; CN101070350B

Abstract

Provided is a fusion protein NGR-LDP-AE, which comprises targeting peptide of CD13, lidamycin apoprotein LDP and activated form enediyne chromophore AE combined with the LDP. This fusion protein can be used for targeted cancer therapy.

Description

Technical field:

The present invention relates to anti-tumor targeted drugs. More specifically, the present invention relates to a fortified fusion protein consisting of a CD13 targeting peptide and lidamycin, comprising an activated enediyne chromophore AE bound to LDP, a process for the preparation thereof and an antitumor targeted drug Applications.

Background technique:

In recent years, with the advent of targeted anticancer drugs such as Ri tuxan and Hercept in, targeted therapy has become a new concept and new approach to cancer therapy. Compared with traditional chemotherapeutic drugs, sputum drugs can selectively kill tumor cells, reduce toxic side effects, and improve efficacy. Targeted drugs are generally composed of a targeting molecule that binds to a specific receptor at the tumor site and a "warhead" drug that kills the cell. Miniaturization and high efficiency have become the development trend of targeted drugs.

Tumor targeting peptides are a class of oligopeptides that bind to specific receptors at the tumor site. Compared with the antibody and its fragments, such targeted oligopeptides have a smaller molecular weight and a weaker immunogenicity, and are less likely to cause a response to human antibodies.

Lidamycin (LDM, also known as C-1027) is an actinomycete isolated from the soil of Qianjiang County, Hubei Province, China (Streptomyces globi sporus C-1027, strain accession number: CGMCC No 0704) Large molecule anti-tumor antibiotic produced.

To date, there have been no reports of enhanced fusion proteins composed of targeting peptides and lidamycin and their use as targeted anti-tumor drugs.

It is an object of the present invention to provide improved targeted anti-tumor drugs, methods for their preparation, and use in tumor targeted therapies. Summary of the invention: In one aspect, the invention relates to a protein comprising: (1) a fusion protein comprising a CD13 targeting peptide and a lidamycin prosthetic protein LDP, and (2) an activated enediyne chromophore bound to LDP AE.

CD13 targeting peptide

The NGR (Asn-Gly-Arg) peptide is a tumor targeting peptide obtained by an in vivo phage library selection technique such as Arap, which specifically binds to the CD13 isoform expressed by tumor neovascular endothelial cells. CD13, aminopept idase N (APN; EC 3. 4. 11. 2 ), is a transmembrane glycoprotein with a molecular weight of approximately 150 kDa (the degree of glycosylation is different, the molecular weight is also different, and the difference is formed. Isomer), having metalloproteinase activity, catalyzing the hydrolysis of the amino terminal amino acid of the polypeptide, especially the neutral amino acid. CD13 is expressed on the cell surface of various tissues, and CD13 expressed by tumor neovascular endothelial cells is an isomer of normal tissue CD13. The high expression of CD13 in tumor vascular endothelial cells can promote the formation of new blood vessels. The mechanism may be related to the degradation of extracellular matrix by CD13 aminopeptidase activity, promoting endothelial cell invasion and regulating the activity of certain growth factors and cytokines. Related (Irtt J Cancer, 1993, 54: 137-43). Certain tumor cells, such as breast cancer cells and human melanoma cells, are also highly expressed, and these highly expressed cells may also be targeted sites for NGR peptides. Although the NGR peptide is anisotropic, it has no cytotoxic effect. The NGR peptide is coupled with a highly effective "warhead" drug to truly exert its targeted killing effect. Arap et al. coupled the NGR peptide with doxorubicin, which significantly improved the antitumor effect of doxorubicin and reduced toxicity.

For the present invention, the CD13 targeting peptide preferably comprises NGR, more preferably comprises CNGRC; In a preferred embodiment, the CD13 targeting peptide is the amino acid sequence NGR, and in another preferred embodiment, the CD13 targeting peptide is the amino acid sequence CNGRC. Herein, the CD13 targeting peptide is sometimes referred to as the CD13 targeting peptide NGR.

2. Lida Zunxin (l idaprotein) LDP and active enediyne chromophore AE

Lidamycin (L idamycin, LDM, also known as C-1027) is the Institute from the lake of China A macromolecular antitumor antibiotic produced by an actinomycete (Streptomyces globi sporus C-1027, strain accession number: CGMCC No. 0704) isolated from the soil of Qianjiang County, Northern Province. Lidamycin consists of two parts: one is an active chromophore (ACT enediyne, AE, relative molecular mass 843Da) containing a 9-membered enediyne structure, which has strong cytotoxicity but is unstable; It is a 110 amino acid acidic prosthetic protein (l idaprote in, LDP, relative molecular mass 10 506 Da), which protects the chromophore. The chromophore and the prosthetic protein are combined by non-covalent bonds, which can be resolved and reconstructed. Lidamycin has a strong killing effect on tumor cells. In vivo experiments in animals have shown that lindamycin has significant effects on transplanted mouse colon cancer26 and human liver cancer Bel-7402 and cecal cancer Hce-8693 transplanted into rats. Efficacy (Chinese Journal of Antibiotics, 1994, 19: 164-8). Molecular pharmacology studies have shown that its main mechanism of action is to induce specific DNA breaks, thereby inducing apoptosis. Because lidamycin has a strong cytotoxic effect, it also kills normal cells while killing tumor cells, which limits the tolerance of animals. However, precisely because of its strong cytotoxicity lidamycin targeted drug preparation useful as an efficient "warhead" Drug ₀

The molecular weight of LDM is known to be 11349. 1120 Da. The molecular weight of the basal protein LDP is 10505. 7830 Da, and the molecular weight of the chromophore is 843. 3295 Da.

Chemical name of the LDM chromophore:

(2R, 7S, 9R, 10R) - 7-Amino-7, 8-(2*-chloro-6*-hydroxy-1*, 4*-phenylene)-10-(4, -deoxy-4 , -dimethylamino-5, ,5,-dimethyl-pyranosyl)-4,8-oxa-5-oxo-1, 11, 13-triene-15, 18-diyne- Three rings

[7,7,3,0 ^{1 4} ]-2-nonadecanol-2",3"-dihydro-7"-methoxy-2"-methylene-3"-oxo-1" , 4"-benzoxazine-5'-carboxylate.

(2R, 7S, 9R, 10R) -7-Amino-7, 8- (2*-chloro-6*-hydroxy-l*, *-pheny 1 ene) -10- (4 ' -deoxy-4 ' - Dimethylamino-5 ' ,5, -dimethyl-r ibopyranos ido) -4, 8-dioxa-5-oxo-l, 11, 13-tr ien -15, 18-diyn-tricyclo[7, 7, 3, 0 ¹⁰ ' ¹⁴ ] -2-nondecanyl - 2",3"-dihydro-7" - methoxy-2" -methylene- 3" -oxo- 1",4"-benzoxazine-5" -carboxylate The molecular formula of lidamycin is: C ₄₃ H ₄₂ 0 ₁₃ N ₃ CI

The chemical structure of the active and inactive chromophores of LDM is shown in the following figure:

Active inactivating

Lidamycin has a strong killing effect on tumor cells. In vivo experiments in animals have shown that lidamycin has significant effects on transplanted mouse colon cancer26 and human liver cancer Bel-7402 and cecal cancer Hce-8693 transplanted into rats. Efficacy (Chinese Journal of Antibiotics, 1994, 19: 164-8). Molecular pharmacology studies have shown that its main mechanism of action is to induce specific DNA breaks and induce apoptosis. It is known that the chromophore of LDM. and the prosthetic protein are bound by non-covalent bonds, and the combination of the two is specific and robust. Moreover, LDM can be resolved and molecularly enhanced. This unique molecular structure and its low molecular weight and high activity make LDM an ideal "warhead" drug for the construction of novel monoclonal antibody-directed drugs (Journal of the Chinese Academy of Medical Sciences 2001) , 23<6>: 563-567).

For the purposes of the present invention, the present invention refers to the "Lida zero-prostaglandin LDP" package. A wild-type protein, such as a protein having the sequence of amino acids 7 to 116 of SEQ ID NO: 2, also includes variants that retain at least substantially its function, such as, but not limited to, the lidamycin prosthetic protein LDP wild-type protein. Homologous protein. The term "homologous" as used herein may be the amino acid sequence of a polypeptide having a LD wild-type protein of the lidamycin prosthetic protein, but one or more of them (eg, 1-25, 1-20, 1-15,

1-10, 1-5) amino acid residues have been conservatively altered, in particular by conservative substitutions of different amino acid residues, and the resulting polypeptides are useful in the practice of the invention. Amino acid substitutions are known in the art. The rules that result in such substitutions include the substitution rules described by Dayhof, M. D. (1978, National Biomedical Research Fund, Washington, D. C., Vol. 5, Supplement 3). More specifically, conservative amino acid substitutions occur within a family of amino acids that are associated with their acidity, polarity, or side chain size. Generally, genetically encoded amino acids can be divided into four groups: (1) acidic amino acids - aspartic acid, glutamic acid; (2) basic amino acids = lysine, arginine, histidine; Polar amino acids = alanine, valine, leucine, isoleucine, valine, phenylalanine, methionine, tryptophan; (4) uncharged polar amino acid = glycine , asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan and tyrosine are also collectively classified as aromatic amino acids. One or more substitutions in any particular group, such as substitution of leucine with isoleucine or valine, substitution of aspartic acid with glutamic acid, replacement of threonine with serine, or any other amino acid residue Amino acid residues associated with a base structure, such as amino acid residues having similar acidity, polarity, side chain size, or similarity in some combinations thereof, generally do not have a significant effect on the function of the polypeptide.

Substantially homologous proteins and polypeptides are characterized by having one or more (e.g., 1-25, 1-20, 1-15, 1-10, 1-5) amino acid substitutions, deletions or additions. These changes preferably affect smaller transformations, ie conservative amino acid substitutions and other substitutions that do not significantly affect the folding and activity of the protein or polypeptide; small deletions, usually small deletions of from 1 to about 30 amino acids; and small amino or Carboxyl end Extension, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or a small extension (affinity tag) that facilitates purification, such as a polyhistidine bundle, protein A (Ni ls Son et al, EMBO J. 4: 1075, 1985; Ni l sson et al., Methods in Enzymology, 198: 3, 1991). DNA encoding the affinity tag is available from the product supplier.

In the protein of the present invention, the fusion protein may or may not contain a linker between the CD13 targeting peptide and the lidamycin prosthetic protein LDP. The connector can be 1 - 20 amino acids long, preferably 1 - 10, for example 1 - 5 or 1 - 3. The linker can be any linker known in the art and can be suitably selected by those skilled in the art and should generally not significantly impede or be able to increase the target peptide NGR targeting and/or the strength of the drug.

In addition to the CD13 targeting peptide and the lidamycin prosthetic protein LDP, the fusion protein may also contain other amino acid sequences, which can be suitably selected by those skilled in the art, and generally should not significantly hinder or increase the targeting peptide NGR. Targeted and / or lidamycin toxicity.

In a preferred embodiment, the fusion protein comprises a purification tag such as a histidine hexamer tag.

In a preferred embodiment, the fusion protein comprises a signal peptide, e.g., a signal peptide for directing secretion of the fusion protein outside of its expression host cell. The signal peptide can be any signal peptide known in the art and can be suitably selected by those skilled in the art. The signal peptide can be excised after secretion.

In a preferred embodiment, the protein shield of the present invention consists of a fusion protein NGR-LDP formed by a CD13 targeting peptide and a lignin-based proprotein LDP and an activated enediyne chromophore AE bound to LDP.

In a preferred embodiment, the fusion protein comprises the amino acid sequence set forth in positions 1 to 116 of SEQ ID NO: 2, or the amino acid sequence shown in positions 1 to 124 of SEQ ID NO: 2, or SEQ ID NO: 2 - of the amino acid sequence of positions ²² to I ²⁴ bits. The amino acid number is shown in SEQ ID NO: 2 of the Sequence Listing. In a specific embodiment, the protein of the present invention is a fortified fusion protein NGR-LDP-AE constructed from the following examples, which is a fusion protein NGR-formed by a CD13 targeting peptide and a Lidasin prostaglandin LDP. LDP (molecular weight 12. IkDa) and an activated enediyne chromophore AE (molecular weight 843 Da) combined with LDP. The NGR-LDP gene is 441 bp in length and encodes 146 amino acids. The amino acid sequence thereof is shown in SEQ ID NO: 2 (amino acid sequence shown in positions 22 to 124), and the nucleic acid sequence is shown in SEQ ID NO: 1. Among them, the NGR gene is 15 bp long and encodes 5 amino acids. The signal peptide gene before NGR is 66 bp long and encodes 22 amino acids. It is excised when the protein is secreted into the periplasmic cavity. The LDP gene is 330 bp long and encodes 110 amino acids. NGR gene and The LDP gene is linked by a 3 bp sequence encoding one amino acid; the carboxy-terminal histidine hexamer gene is 18 bp long and encodes 6 amino acids; the Xho I cleavage site between the histidine hexamer tag and the LDP gene is long. 6 bp, encoding 2 amino acids; stop codon 3 bp.

The protein of the present invention is capable of carrying a lidadamycin-targeted tumor, i.e., targeting tumor blood vessel endothelial cells, such that lidamycin exerts a tumor cytotoxic effect.

In another aspect, the invention features an isolated nucleic acid molecule comprising: a nucleotide sequence encoding a fusion protein of the invention.

The invention also relates to expression vectors, such as plasmid vectors or viral vectors, comprising a nucleic acid molecule of the invention.

The invention also relates to host cells comprising the expression vector, such as prokaryotic host cells, E. coli cells or eukaryotic cells such as animal cells.

Methods of producing and manipulating the nucleic acid molecules disclosed herein are known to those skilled in the art and can be used in accordance with the recombinant techniques described (see Maniat is et al, 1989, Molecular Cloning, Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Springs Hong Kong, New York; Ausubel et al., 1989, Current Technology in Molecular Biology, Greene Publ ishing Associates & Wiley Interscience, NY; Sambrook et al., 1989, Molecular Cloning, Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Springs Hong Kong, New York; Inni s et al. (eds.), 1995, PCR Strategy, Academic Press, Inc. San Diego; and Er lich (ed.), 1992, PCR Technology, Oxford University Press, New York).

The invention also relates to a process for the preparation of a protein of the invention, said method comprising:

(1) cultivating the above host cell, for example, Escherichia coli having the accession number CGMCC No. 2010, under conditions suitable for expression of the fusion protein;

(2) optionally isolating and purifying the fusion protein;

(3) The obtained fusion protein and the activated enediyne chromophore AE are contacted under conditions allowing the activated enediyne chromophore AE to bind to LDP.

In a specific embodiment, step (3) may comprise: purifying the purified fusion protein NGR-LDP with, for example, a lidamycin-active chromophore AE prepared by methanol extraction, by molecular ratio 1: 1-1: 50 For example, 1:5, at a temperature of 4 degrees Celsius-room temperature, sufficient to assemble the chromophore, for example 6 - 48 hours, for example 10 - 24 hours, for example 12 hours, the excess chromophore is removed by, for example, PD-10 column chromatography.

The invention further relates to the use of the above-described protein or nucleic acid molecule or expression vector of the invention for the preparation of an anti-tumor targeted drug.

The invention further relates to a pharmaceutical composition comprising (a therapeutically effective amount) a protein or nucleic acid molecule of the invention described above or an expression vector and a pharmaceutically acceptable carrier.

The invention also relates to a protein or nucleic acid molecule or expression vector of the invention for use in the treatment of a tumor.

The invention further relates to a method of treating a tumor comprising administering to a patient, including a human and an animal, a therapeutically effective amount of a protein or nucleic acid molecule or expression vector or pharmaceutical composition of the invention described above. The treatment includes improvement or reduction of symptoms, slowing of tumor development, shrinkage or disappearance of tumor volume, and the like.

The tumor usually refers to a malignant tumor (cancer), especially a cancer with high CD13 expression, and may be a solid cancer such as, but not limited to, fibrosarcoma, liver cancer, breast cancer, lung cancer, bladder cancer, gastric cancer, melanoma, nasal Pharyngeal cancer, esophageal cancer, and intestinal cancer. The cancer can be a metastatic cancer, such as a metastatic breast cancer. Cancer can be thin blood Cellular cancer, such as lymphoma or leukemia.

For the prevention or treatment of a tumor, the dosage and manner of administration can be selected by the clinician according to known criteria. Suitable dosages of the compounds and compositions of the invention may depend on the type of cancer to be treated, the severity and duration of the disease, the size of the tumor, the degree of metastasis, whether the purpose of administering the drug is prophylactic or therapeutic, prior treatment, patient's Clinical history and response to the drug, as well as the judgment of the attending physician. The compounds and compositions of the invention are suitable for administration to a patient, either in a single treatment or by a series of treatments. For example, the compound/composition can be administered by intravenous or subcutaneous injection. The course of the treatment can be monitored by conventional methods and analytical tests based on criteria known to the physician or other skilled artisan.

The invention also provides a preparation method of the enhanced fusion protein. In one embodiment, NGR-LDP-AE is prepared by DNA recombination technology, which is a fusion protein of NGR and LDP, NGR-LDP, and then assembled by chromophore AE. Specific steps can include:

Cloning of CD13 targeting peptide NGR and lidamycin prostaglandin LDP fusion gene; construction of fusion protein E. coli recombinant expression plasmid pET30sngr ldp; expression of fusion protein NGR-LDP in E. coli BL21 StarTM (DE3); fusion Affinity chromatography purification of protein NGR-LDP;

Enhanced preparation of the fusion protein NGR-LDP-AE.

In a specific embodiment, the protein of the invention, NGR-LDP-AE, can be prepared by a process comprising the following steps:

A. Cloning of CD13 targeting peptide NGR and Lida Zunsu prosthetic protein LDP fusion gene sngr ldp;

B. Construction of recombinant protein E. coli recombinant expression plasmid pET30sngr ldp;

C. Induction protein NGR- LDP induced expression in Escherichia coli CAMS/NGRLDP with accession number CGMCC No. 2010;

D. Purification of the fusion protein NGR-LDP; E. Preparation and isolation of the enhanced fusion protein NGR-LDP-AE.

In a specific embodiment, step A can be carried out as follows: The sngr ldp gene is amplified by PCR using a plasmid containing the LDP gene as a template, the primer sequence contains a signal peptide and an NGR peptide coding sequence, and Nde I is introduced on both sides of the sngr ldp. And the Xho I restriction site, the amplified sngr ldp gene was cloned into the T vector to obtain pGMTsngr ldp.

In a specific scheme, the sngr ldp fragment obtained by digesting pGMTsngr ldp with Nde I and Xho I can be cloned into the same double-digested pET-30a (+) vector to construct the recombinant expression plasmid pET30sngr ldp.

In one particular embodiment, pET30sngr ldp may be transferred into Escherichia coli BL21 Star ^TM (DE3), to obtain secretory expression of fusion protein was induced by IPTG NGR-LDP.

In a specific embodiment, the fusion protein NGR-LDP can be isolated and purified by ammonium sulfate precipitation and affinity chromatography, followed by dialysis and concentration to prepare a high-purity fusion protein.

In a specific embodiment, the purified fusion protein NGR-LDP and the lidamycin-active chromophore AE prepared by methanol extraction can be assembled at a molecular ratio of 1: ⁵ for 12 hours at room temperature to assemble a chromophore, PD. The -10 column chromatography was used to remove excess chromophore, and the enhanced fusion protein NGR-LDP-AE was obtained.

The invention also provides the biological activity test of the enhanced fusion protein as follows: fusion protein NGR-LDP binding activity analysis;

Enhancement of the cytotoxic effect of the fusion protein NGR-LDP-AE on tumor cells; enhancement of the animal-based therapeutic regimen of the fusion protein NGR-LDP-AE.

The advantage and positive effect of the present invention is that the enhanced fusion protein NGR-LDP-AE is an anti-tumor targeted drug, and its targeting sequence is composed of only 5 amino acids CNGRC, the molecular weight is small, the immunogenicity is weak, and the receptor is a tumor. The CD13 isomer specifically expressed by vascular endothelial cells has good targeting and the drug is easy to reach the tumor site; While lidamycin has a strong cytotoxic effect, it is a highly effective "warhead" drug. Therefore, the enhanced fusion protein NGR-LDP-AE of the present invention is expected to be a novel miniaturized and highly effective targeted anti-tumor drug with good clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS:

Figure 1: PCR amplification of the sngrldp gene. 1-DNA molecular weight standard (DL 2 000 ); 2-gr amplification of the sngr ldp fragment.

Figure 2: Recombinant T vector digestion and PCR identification. 1-pGMTsngr ldp ;

2-pGMTsngr ldp / Nde I + Xho I; 3-PCR, primer T7/a; 4-PCR, primer T7/b; 5-DNA molecular weight standard (DL 2 000 ).

Figure 3: Recombinant plasmid pET30sngrldp Restriction enzyme analysis. 1-DNA molecular weight standard (DL 2 000 ); 2-pET30sngr ldp / Nde I + Xho I;

3- pET30sngr ldp; 4-DNA molecular weight standard (DL 15 000 ).

Figure 4: SDS-PAGE analysis of NGR-LDP induced expression in E. coli. 1- low molecular weight protein standard; 2-the supernatant of the fermentation broth after the induction of the transformant; 3-the supernatant of the fermentation broth before the induction of the transformant; the supernatant of the fermentation broth after the induction of the bacterium; The liquid supernatant part.

Figure 5: SDS-PAGE analysis of expression product localization. 1-low molecular weight protein standard; 2-fermentation supernatant supernatant protein; 3-periplasmic cavity protein; 4-cytoplasmic soluble fraction; 5-cytoplasmic insoluble fraction.

Figure 6: Wes tern-blot analysis of expression product identification and localization. 1-fermentation supernatant supernatant protein; 2-periplasmic cavity protein; 3-cytoplasmic soluble fraction; 4-cytoplasmic insoluble fraction.

Figure 7: SDS-PAGE analysis of the fusion protein after purification by ammonium sulfate precipitation and metal chelate chromatography. 1-low molecular weight protein standard; 2-Affinity chromatographically purified sample; 3-fermented supernatant supernatant protein; 4-ammonium sulfate precipitated total protein.

Figure 8: ELISA for detection of NGR-LDP on human fibrosarcoma HT-1080 cells and humans Binding activity of breast cancer MCF-7 cells

Figure 9: ELISA assay for the binding activity of NGR-LDP and rLDP to human fibrosarcoma HT-1080 cells

Figure 10: Competitive ELISA detection of the effect of NGR peptide on the binding of NGR-LDP to human fibrosarcoma HT-1080 cells

Figure 11: MTT assay Cytotoxicity of NGR-LDP-AE, LDM and NGR-LDP on human fibrosarcoma HT-1080 cells

Figure 12: MTT assay Cytotoxicity of NGR-LDP-AE, LDM and NGR-LDP on human breast cancer MCF-7 cells

Figure 13: Inhibitory effect of enhanced fusion protein NGR-LDP-AE on the growth of subcutaneously transplanted liver cancer H22 in mice. Cont ro l represents a control group; NGR-LDP (2.0) represents 2. Omg/kg NGR-LDP group; LDM (0.05) represents 0.05 mg/kg LDM group; NGR-LDP-AE (0. 2) 2mg/kg NGR-LDP-AE group; NGR-LDP-AE (0.4) represents 0. 4mg/kg NGR-LDP-AE group; NGR-LDP-AE (0.8) represents 0. 8 mg/kg NGR-LDP-AE group. See Example 7. Preservation of biological materials

Applicant deposited on April 17, 2007 in accordance with the Budapest Treaty at the General Microbiology Center of China Microbial Culture Collection Management Committee (CGMCC, Address: No. 13, North Zhongguancun, Haidian District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences, Zip Code 100080) E. coli strain CAMS/NGRLDP expressing NGR-LDP, accession number: CGMCC No. 2010. detailed description:

The following examples are intended to be illustrative, and not restrictive.

<Examples 1. > Fusion protein NGR-LDP expression shield particle construction

Upstream primer a: 5 ' -GG AATTCCATATG AA AT ACCTGCTGCCG ACCGCTGCTGCTGG Nde I

TCTGCTGCTCCTCGCTGCCCAGCCGGCCATGGCCTGCAACGGCC GTTGCGGCGCGCCCGCCTTCTCCGTCAGT -3,

Downstream primer b: 5' -GTTACTCGAGGCCGAAGGTCAGAGCCACGTG -3,

Xho I

Using a and b as primers (synthesized by Shanghai Shenggong Bioengineering Technology Service Co., Ltd.), the plasmid pEFL containing LDP gene (patent application number: CN03150240. 7, publication number: CN1475506) was used as a template and amplified according to conventional PCR conditions. , a sngr ldp fragment containing a signal peptide, an NGR peptide, and an LDP coding sequence of about 0.4 kb (Fig. 1), a signal peptide and an NGR peptide coding sequence in the primer sequence, and Nde I /Xho introduced on both sides of the sngr ldp I cleavage site. This fragment was ligated into the T vector (TGM-T vector of Tiangen Biochemical Technology Co., Ltd.) to obtain pGMTsngr ldp, transformed into E. coll DH5 α, screened for blue and white spots, positive clones were verified by PCR and double enzyme digestion (Fig. 2), The T7 promoter was primer sequencing (sequence of Beijing Huada Gene Research Center).

pGMTsngr ldp was digested with Nde I /Xho I, and the restriction fragment was ligated into the same digested pET-30a ( + ) (Novagen) vector, and the ligated product was transformed into CO/ / DH5 a, 37 Ό after culture. The monoclonal antibody was picked, and the plasmid was extracted after a small amount of culture, and the Nde I / Xho I double restriction enzyme digestion (Fig. 3) was carried out, and the T7 promoter was used as the primer sequencing (Beijing Huada Gene Research Center was sequenced, and the obtained fusion protein encoded nucleic acid sequence was obtained. See Sequence Listing SEQ ID N0: 1). The recombinant plasmid containing the sngr ldp gene was named pET30sngr ldp. The pET-30a (+) used in the present invention has a sequence encoding a histidine tail of the histidine at the 3' end of the multiple cloning site. After translation, Hi s6-Tag facilitates the expression and identification of the fusion protein. And isolated and purified.

<Example 2.> Expression of fusion protein NGR-LDP in Escherichia coli

The constructed pET30sngr ldp plasmid was transformed into E. coli BL21 StarTM (DE3) (product of Invi trogen), monoclonal was selected, and 0D _{6 was} cultured in small amounts. . To 0. 8, 0.25 mM isopropyl-β-D-thiogalactoside (IPTG) 37 Ό induced for 8 hours. After centrifugation in a small amount of medium, the supernatant was precipitated with trichloroacetic acid, and the expression of the target protein was detected by 15% SDS-PAGE (Fig. 4). Samples were prepared from medium supernatant, perivascular shield, cytosolic soluble and insoluble fractions, analyzed by SDS-PAGE (Fig. 5), and identified by Wes tern-blot (Fig. 6) to confirm the protein of interest. Positioning. The results showed that the target egg was present in the medium supernatant, the periplasmic cavity and the cytosolic soluble fraction, and the cytoplasm insoluble fraction contained the target peptide precursor which was not excised by the signal peptide. Since the extracted periplasmic cavity and cytosolic protein are easily mixed into the precursor protein, only the protein in the fermentation broth is extracted. The strain expressing NGR-LDP was named as CAMS/NGRLDP, and was sent to the General Microbiology Center of China Microbial Culture Collection Management Committee for preservation, preservation number: CGMCC No. 2010.

<Example 3.> Fusion protein Affinity chromatography purification of NGR-LDP

The bacterial fermentation broth was centrifuged at 10 000 g for 10 minutes, and the supernatant was collected. Ammonium sulfate was added at a concentration of 390 g/L at 4 t with gentle agitation. 4 Place at rest for half an hour, centrifuge at 4, 10 000g for 20 minutes, and collect the pellet. The precipitate obtained per 100 ml of the fermentation broth was dissolved with 2 ml of 1 Ni-NTA Bind Buffer (300 mM NaCl, 50 mM NaH ₂ P0 ₄ , 10 mM imidazole, pH 8.0) and dialyzed against the same solution. Ni-NTA Hi s -Bind resin ( Novagen ) was loaded into the column and equilibrated with about 5 volumes of 1 χ Ni-NTA Bind Buffer until A _2S . Return to the baseline and stabilize, the flow rate does not exceed 2 ml / min. The sample was dialyzed against 0. 45 μ πι was slowly added to the membrane after filtration chromatography column, 1 X Ni-NTA Bind Buffer column was washed with 5-10 bed volumes of up to A _28. Stable, collected effluent, flow rate 0. 5-1 ml / min. The column was washed with 5-10 bed volumes of lx Ni-NTA Wash Buffer (300 mM NaCl, 50 mM NaH ₂ P0 ₄ , 20 mM imidazole, pH 8.0) until A _{2 S} . Stable, collect the effluent. The target protein bound to the column was eluted with 5 column volumes of lx Ni-NTA Elution Buffer (300 mM NaCl, 50 mM NaH ₂ P0 ₄ , 250 mM imidazole, pH 8.0), according to A ₂₈ . The eluted fractions were collected and analyzed by SDS-PAGE (Fig. 7). The eluate containing the protein of interest was dialyzed against PBS (ρΗ7.4), and concentrated by ultrafiltration. Concentration of the protein of interest. Protein quantification showed that about 10 mg of the target protein with a purity of more than 95% was obtained per liter of fermentation broth.

<Example 4.> Enhanced fusion protein Preparation and separation of NGR-LDP-AE

Detastatin lyophilized product (prepared from Lidamycin producing bacteria (CGMCC NO.0704, published in Chinese Patent Application No. 00121527.2) according to methods known in the art) 10 mg, shaken for 5 minutes by adding 5 ml of cold methanol , -20 was placed for 1 hour, oscillated once in the middle; centrifuged at 0, 12 000 rpm for 20 minutes, the supernatant contained a chromophore, and the precipitate was a prosthetic protein, which was repeatedly extracted twice. The methanol solution is naturally evaporated and the above operation is carried out at a low temperature and protected from light. A certain volume and concentration of the fusion protein was dissolved in 0.01 mol/L phosphate (pH 7.0) buffer, and the chromophore was added. The molecular ratio of the fusion protein to the chromophore was 1:5, and the volume ratio was 50:1. The shaker was shaken slowly for 12 hours for molecular assembly. The reaction solution was separated by PD-10 (Sephadex G-25 column, Pharmacia product), and the enhanced fusion protein NGR-LDP-AE was collected after UV detection at ² 80 nm. Excess unbound chromophore.

<Example 5, > Fusion protein NGR-LDP binding activity detection

Tumor cells in logarithmic growth phase were inoculated into 96 well plates at a density of 2χ10 ⁴ cells/well, and cultured for 24 hours at 37°C, plus 4 pre-cooled 0.05% glutaraldehyde 50μ 1 / well, at 41C The cells were fixed for 15 minutes. After blocking 1% of BSA, the fusion protein was added to each well. After incubation for 1-2 hours at 37 C, His-tag antibody (product of Novagen) was used as the primary antibody, HRP-labeled sheep. Anti-mouse IgG (product of Santa Cruz) was incubated with secondary antibody, 100 μl of reaction substrate was added to each well, and the absorbance at 492 nm was measured by a microplate reader. 50 μΜ NGR per well was added for competitive ELISA. LDP, and then added 0.2 mM and 1 mM of free NGR peptide to compete with it. The results showed that NGR-LDP is stronger than human fibrosarcoma HT-10 ⁸⁰ cells and human breast cancer MCF-7 cells expressing CD13. The combination (Figure 8), and the recombinant NAD peptide-free Lidamycin prosthetic protein LDP) was essentially unbound (Figure 9). The free NGR peptide significantly inhibited the binding of NGR-LDP to HT-1080 cells. effect, The inhibitory rate of the NGR peptide was about 40.6%, and the inhibition rate of the 1 mM NGR peptide was about 73.7% (Fig. 10). The above results indicated that the binding sequence in the fusion protein NGR-LDP was NGR, and the binding site was identical to the free NGR peptide. The LDP sequence in the fusion protein did not affect the binding of the NGR sequence to the target site.

<Examples 6.> Enhanced fusion protein NGR-LDP-AE assay for cytotoxicity of tumor cells

Take the cell digestive count in logarithmic growth phase, 3,000 cells/well in 96 well plates, and culture in a 37 C 5% C0 ₂ incubator for 24 hours, then add different concentrations of drugs, each drug concentration is set. 3 parallel wells. After 48 hours of incubation, add MTT (5 mg/ml) dissolved in PBS to 20 μl, 37 每 for 4 hours. After aspirate for 4 hours, aspirate the supernatant, add 150 μl of dimercaptosulfoxide, shake at room temperature. The bed was shaken for 15 minutes and the absorbance at 570 nm was measured on a microplate reader. Each well was equipped with 3 wells of drug-free control wells and cell-free blank wells. The cell viability and IC _{5 of the} sample were calculated according to the following formula. value:

A dosing group - A blank group

Cell viability = _A control group - A blank group X 1 0% The results showed that the fusion protein NGR-LDP-AE potentiated human fibrosarcoma HT-1080 cells and human breast cancer MCF-7 cells for 48 hours of IC ₅ . The values are 1·94 χ 1 (Γ ⁹ Μ and 2. 67 X 10 ^_9 M, LDM is 1. 08 x 10 ^_1 ° Μ and 2.44 χ 1 (Τ° Μ, and the unreinforced fusion protein NGR) - LDP has no killing effect on both cells (Fig. 11, Fig. 12). Compared with Lidastatin, the in vitro cytotoxicity of the enhanced fusion protein NGR-LDP-AE was decreased.

<Example 7.> An experimental test for the enhancement of the fusion protein NGR-LDP-AE.

According to the results of the initial screening of the dose, the mode of administration and dosage of the animal test treatment are designed. Sixty Kunming mice weighing 18g-22g were randomly divided into 6 groups, 10 in each group. On the 0th day of the experiment, the mouse liver cancer H22 ascites was taken, and the number of cells diluted with physiological saline was 7. 5 107 ml, and was inoculated subcutaneously into the armpits of Kunming mice according to 0.2 ml/mouse. After inoculation 3 NGR-LDP-AE was administered to saline, lidamycin, NGR-LDP, and three dose groups at 4 and 10 days, respectively, with a tail vein injection of 0.2 ml/mouse. The tumor long diameter a and the short diameter b perpendicular thereto were measured every 3-4 days during the experiment, and the animal body weight was recorded. Tumor volume and inhibition rate were calculated by the formula V = l/2ab ² (control tumor volume - test tumor volume) / control tumor volume X 100%).

The experimental results showed that the enhanced fusion protein NGR-LDP-AE was significantly effective in vivo (Fig. 13), and significantly inhibited the growth of H22 subcutaneous tumors at doses of 0, 8 mg/kg, 0.4 mg/kg and 0.2 mg/kg; On the 16th day, 0.8 mg/kg

The tumor inhibition rate of NGR-LDP-AE was 94.8%, which was significantly higher than 0.05 mg/kg (tolerance dose) of free lidomycin (66.9%) (Table 1). Table 1. Inhibitory effect of enhanced fusion protein on growth of mouse liver cancer H22 (experimental day 16)

Number of mice, body weight, tumor volume

Dosage inhibition rate experimental group (only) (cm ³ )

(mg/kg) (%)

Start / end ( g) ( soil SD)

Control - 10/10 +18.7 10.2 ± 3· 9 -

NGR-LDP 2.0 10/10 +19.5 9.9 ±4.2 3.2

NGR-LDP-AE 0.8 10/10 +6.4 0.5 ±0.5 oo

NGR-LDP-AE 0.4 10/10 +11.6 2.3±1.6 77.8"

NGR-LDP-AE 0.2 10/10 +14.7 4· 1 soil 3.1 59.8"

LDM 0.05 10/10 +12.5 3.4 ±2.1 66.9"

**P<0.01 VS. LDM ^## P<0.01 VS.

Description of microbial deposit

(Rule 13 bis)

A. Description of deposited microorganisms or other biological materials as described on page _12_, pages 18-22- of the specification

B. Deposits More deposits on additional pages □

China Microbial Culture Collection Management Committee General Microbiology Center

China General Microbiological Culture Collection Center (CGMCC)

Depository address:

(including zip code and country name)

No.13, North Section, Zhongguancun, Haidian District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences (100080)

Date of deposit April 2007 17曰 Deposit number CGMCC No.2010

C. Supplementary explanation (if necessary) More information on the additional page □

D. This note is for the following designated countries (if the description is not for all designated countries)

E. Supplementary explanation (if necessary)

The following instructions will then be provided to the International Bureau (write the type of description, for example: "The number of the deposit")

Filled in by the receiving Office Filled in by the International Bureau This page has been received with the international application □ The International Bureau received this page Authorized Officer

PCT/RO/134 months, reprinted in January 2004)

Claims

Rights request

A protein comprising: (1) a fusion protein comprising a CD13 targeting peptide and a lidamycin prosthetic protein LDP, wherein the CD13 targeting peptide preferably comprises an NGR, for example, the CD13 purine peptide preferably comprises an amino acid sequence CNGRC And (2) an activated enediyne chromophore AE that binds to LDP.

2. The protein of claim 1, wherein the fusion protein comprises a linker between the CD13 targeting peptide and the lidamycin prosthetic protein LDP.

3. The protein shield of claim 1 wherein said fusion protein comprises a purification tag such as a histidine hexamer tag.

4. The protein of claim 1, wherein the fusion protein comprises a signal peptide, such as a signal peptide for directing secretion of the fusion protein outside of its expression host cell.

The protein of claim 1, which consists of a fusion protein NGR-LDP formed by a CD13 targeting peptide and a lidamycin prosthetic protein LDP and an activated enediyne chromophore AE bound to LDP.

6. The protein of claim 1, wherein the fusion protein comprises the amino acid sequence set forth in positions 1 to 116 of SEQ ID NO: 2, or the amino acid sequence shown in positions 1 to 124 of SEQ ID NO: 2, or SEQ ID NO: 2 - ² to the amino acid sequence shown in the first position, and the amino acid number is shown in SEQ ID NO: 2 of the Sequence Listing.

7. An isolated nucleic acid molecule comprising: a nucleotide sequence encoding a fusion protein as defined in any one of claims 1 to 6.

8. An expression vector comprising the nucleic acid molecule of claim 7, such as a plasmid vector or a viral vector.

9. A host cell comprising the expression vector of claim 8, such as a prokaryotic host cell, an E. coli cell or a eukaryotic cell such as an animal cell.

10. A method of preparing a protein according to any one of claims 1 to 6, said method comprising: (1) cultivating the host cell of claim 9 in Escherichia coli, for example, under the accession number CGMCC No. 2010, under conditions suitable for expression of the fusion protein;

(2) optionally isolating and purifying the fusion protein;

11. The method of claim 10, wherein the step (3) comprises: the purified fusion protein NGR-LDP is reacted with, for example, a lidamycin-active chromophore AE prepared by methanol extraction at a molecular ratio of 1:1-1: 50, for example, 1: 5, at a temperature of 4 degrees Celsius - room temperature for a time sufficient to assemble the chromophore, for example 6-48 hours, such as 10-24 hours, such as 12 hours, to remove excess chromophore by, for example, PD-10 column chromatography. .

12. Use of the protein of any one of claims 1 to 6 or the nucleic acid molecule of claim 7 or the expression vector of claim 8 for the preparation of an anti-tumor targeted drug.

13. A pharmaceutical composition comprising the protein of any of claims 1-6 or the nucleic acid molecule of claim 7 or the expression vector of claim 8 and a pharmaceutically acceptable carrier.

14. A protein according to any one of claims 1 to 6 or a nucleic acid molecule according to claim 7 or an expression vector according to claim 8 for use in the treatment of a tumor.

A method of treating a tumor, comprising administering to a patient, including a human and an animal, a therapeutically effective amount of the protein of any one of claims 1 to 6 or the nucleic acid molecule of claim 7 or the expression vector of claim 8. Or the pharmaceutical composition of claim 13.