WO2005005627A2 - Applications d'une nouvelle classe d'enzymes : les sulfiredoxines. - Google Patents
Applications d'une nouvelle classe d'enzymes : les sulfiredoxines. Download PDFInfo
- Publication number
- WO2005005627A2 WO2005005627A2 PCT/FR2004/001727 FR2004001727W WO2005005627A2 WO 2005005627 A2 WO2005005627 A2 WO 2005005627A2 FR 2004001727 W FR2004001727 W FR 2004001727W WO 2005005627 A2 WO2005005627 A2 WO 2005005627A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- srx
- protein
- prx
- cysp
- srxl
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0051—Oxidoreductases (1.) acting on a sulfur group of donors (1.8)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention relates to applications of a new class of enzymes, sulfiredoxins (Srx), which catalyzes the reduction of Cys-SO 2 H derivatives (cysteine-sulfinic acid) ) and in particular the reduction of peroxyredoxin (Prx) in its Cys-SO 2 H form as a thiol derivative.
- Srx sulfiredoxins
- Cys-SO 2 H derivatives cysteine-sulfinic acid
- Prx peroxyredoxin
- Cys-SOH compound can be further oxidized to sulfinic acid ( Cys-SO 2 H) stable or cysteic acid (Cys-SO 3 H).
- Peroxyredoxins are antioxidant enzymes comprising such cysteines with redox activity.
- 2-Cys Prxs are reverse homodimers with 2 cysteines with redox activity per subunit. They catalyze the reduction of hydrogen peroxide.
- the catalytic site of these enzymes includes two cysteines with redox activity (peroxidic N-terminal cysteine (Cysp) and resolution C-terminal cysteine (Cys R )). More specifically, the catalytic cycle of these peroxyredoxins includes (Wood ZA et al., Science, 2003, 300, 650-653; Wood et al., Trends in Biochemical Sciences, 2003, 28, 1, 32-40): - the oxidation of Cysp-SH to Cysp-SOH (sulfenic acid) with H 2 O 2 ; - the formation of a disulfide bridge between Cysp and Cys R of the second Prx subunit (Cysp-SS-Cysj (slow process); - reduction of this disulfide bridge by conventional cellular reducers such as glutathione or thioredoxin (Trx), to obtain the starting material Cys-SH.
- Cysp peroxidic N-terminal cysteine
- Prxs can be inactivated, by super-oxidation of Cysp-SOH to sulfinic acid (Cysp-SO 2 H); super-oxidation was considered until now as irreversible, (Wood ZA et al., Science, 2003, 300, 650-653). Recently (Woo HA et al., Science, 2003, 300, 653-656; Georgiou G.
- Peroxyredoxins (Chae et al., PNAS, 1994, 91, 7022-7026) are ubiquitous antioxidants, which control, in many species (microorganisms, plants and higher organisms including mammals), the levels of H 2 O 2 , which regulate the signaling cascades leading to cell proliferation, differentiation and apoptosis (Fujii J. et al., Redox Rep., 2002, 7, 123-130).
- the inventors have now identified the family of enzymes which reduce the Prys Cysp-SO 2 H.
- It is a protein which comprises at least one catalytic site having the following motif: FXGCHR, with X G or S and which has a molecular weight of about 8 to 14 kDa.
- This enzyme is conserved in eukaryotes and is hereinafter called sulfiredoxine (Srx). In yeast and in particular in Saccharomyces cerevisiae, this enzyme is called Srxl and has a molecular weight of 13 kDa. In humans, this enzyme is called hSrxl and has a molecular weight of 13.6 kDa.
- Polypeptide sequences identical to those of sulfiredoxine as well as the corresponding nucleotide sequences can be found in the NCBI or GenBank sequence database, under the following access numbers: S. cerevisiae: YKL086W, Homo sapiens: AAH47707, CAC28314, M. musculus: BAB24939, AAH11325, Arabidopsis thaliana: AAD21682, AAO42977, Oryza sativa: BAA95812, Schizosaccharomyces pombe: SPBC106.02c, Thermosyne- chococcus.
- Sulfiredoxine therefore plays a very important role in the antioxidant function of peroxyredoxins and is involved in the repair or control of proteins modified by the formation of a cysteine-sulfinic acid.
- a protein having an amino acid sequence having at least X% identity with the reference sequence SEQ ID NO: 1 is defined, in the present invention as a protein which can include up to 100-X alterations per 100 amino acids of the sequence SEQ ID NO: 1.
- alteration includes deletions, substitutions or consecutive or dispersed insertions of amino acids in the reference sequence. This definition applies, by analogy, to nucleic acid molecules.
- SEQ ID NO: 1 is assessed according to the percentage of amino acid residues which are identical or which differ by conservative substitutions, when the sequences are aligned so as to obtain the maximum correspondence between them.
- conservative substitution is intended to mean the substitution of one amino acid with another which has similar chemical properties (size, charge or polarity), which generally does not modify the functional properties of the protein.
- a protein having an amino acid sequence having at least X% similarity to the sequence SEQ ID NO: 1 is defined, in the present invention as a protein whose sequence can include up to 100-X non-conservative alterations per 100 amino acids of the reference sequence.
- non-conservative alterations includes deletions, non-conservative substitutions or consecutive or dispersed insertions of amino acids in the sequence SEQ ID NO: 1.
- Said sulfiredoxin is especially selected from the proteins whose the sequences correspond respectively to the sequences SEQ ID NO: 1 to 10, illustrated in FIGS. 2 and 3 or represented in the list of sequences: S. cerevisiae: SEQ ID NO: 1; C. albicans: SEQ ID NO: 2; S. pombe: SEQ ID NO: 3; H. sapiens: SEQ ID NO: 4; M. musculus: SEQ ID NO: 5; D. melanogaster: SEQ ID NO: 6; A.
- Said antibodies are either polyclonal antibodies or monoclonal antibodies.
- the present invention also relates to a medicament, characterized in that it comprises an effective amount of a protein defined by a sequence selected from the group consisting of SEQ ID NO- 1-3 and 5-10 and optionally at least a pharmaceutically acceptable excipient.
- the present invention also relates to the use of a protein as defined above for the preparation of an antioxidant medicament intended for treating cancers, neurodegenerative disorders and neuromuscular diseases, in which a failure is observed of the Prx / Srx antioxidant system.
- the present invention also relates to a method for screening for diseases linked to cancer, aging, neurodegenerative diseases and neuromuscular diseases, which method is characterized in that it comprises, for evaluating the involvement of the antioxidant system Prx / Srx : (1) bringing the cells of a biological sample into vitro with hydrogen peroxide (H 2 O 2 ), (2) detecting the Prx-Cysp-SO 2 H formed, between 1 hour and 4 hours after said contacting according to step (1), and (3) establishing the report of the quantities of Prx-Cysp-SO 2 H and Prx-Cysp-SH, from 4 hours after said contacting in contact according to step (1).
- the biological sample consists in particular of blood cells.
- Prx-Cysp-SO 2 H / Prx-Cysp-SH> 1 ratios are a sign of a pathology of the Prx / Srx antioxidant system, linked to a dysfunction of Srx.
- said screening method comprises: A. the genotyping of sulfiredoxine, from total RNA of a suitable biological sample, in particular blood cells.
- said method comprises: (1) extracting the total RNA from a suitable biological sample, (2) preparing cDNA specific for sulfiredoxin, by amplification of the RNA to using the following two primers: GTCCCGCGGCGGCGGCGACG (SEQ ID NO: 11) AGCAGGTGCCAAGGAGGCTG (SEQ ID NO: 12), these sequences being located respectively upstream and downstream of the human sulfiredoxine ORF (GenBank n ° AAH47707), (3) establishment of its nucleotide sequence and (4) comparison with a DNA sequence coding for a protein Srx, as defined above, originating from the same species as that of the biological sample to analyze.
- GTCCCGCGGCGGCGGCGACG SEQ ID NO: 11
- AGCAGGTGCCAAGGAGGCTG SEQ ID NO: 12
- said method comprises a step of extracting total RNA.
- said quantification comprises: (al) the preparation of cDNA from total RNA by reverse transcription with appropriate primers and in particular random hexa-nucleotide primers; (a2) the amplification of said cDNA in the presence of the primer pair: GTCCCGCGGCGGCGGCGACG (SEQ ID NO: 11) AGCAGGTGCCAAGGAGGCTG (SEQ ID NO: 12), in the presence of a fluorescent reporter and simultaneously or sequentially, (a3 ) detecting the amount of the amplimer (or amplicon) by measuring the fluorescent signal.
- the amplification of the mRNA is carried out by RT-PCR; the reverse transcription and PCR amplification steps are either dissociated and in this case the quantification is carried out by PCR-quantitative, or they are coupled and in this case the quantification is carried out by quantitative RT-PCR.
- said quantification is carried out using an internal standard such as, for example, the 18S subunit of ribosomal RNA.
- the fluorescent reporter is selected from the group consisting of agents binding to double-stranded DNA and fluorescent probes.
- said quantification is carried out in real time, that is to say that the detection and quantification of the fluorescent signal emitted are carried out during the amplification process, insofar as the increase in the signal is directly proportional to the amount of amplimers produced during the reaction.
- fluorescent reporter when said fluorescent reporter is a probe, it is preferably selected from the group constituted by the probes defined by the following sequences: TTAATTGAATTCATGGGGCTGCGTGCAGGAGG (SEQ ID NO: 13) and TTTTCCTTTTGCGGCCGCCTACTACTGCAAGTCTGGTGTGAT ID NO: 14).
- RNA extraction, cDNA preparation and sequence establishment are performed using conventional techniques, according to standard protocols such as those described in Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000 , Wiley and son Inc, Library ofCongress, USA).
- the present invention also relates to the use of the sequence coding for a Srx protein, as defined above or of a vector containing said coding sequence, for obtaining plants whose capacity for resistance to stress (drought , cold, toxic heat oxidants present in the environment) are significantly increased.
- the sequences coding for the protein Srx can be easily obtained from the abovementioned sequence databases.
- the present invention also relates to host cells, characterized in that they are transformed by a recombinant vector containing a sequence coding for a protein Srx, defined by a sequence selected from the group consisting of SEQ ID NO J-3, 5-6 and 8-10.
- said host cell it consists of a strain of S. cerevisiae overexpressing the SRXL gene.
- it consists of a mammalian cell modified by an overexpressing vector. the hSrxl gene.
- the vector is advantageously a shuttle vector E. colils. cerevisiae comprising at a cloning site, the sequence coding for the protein Srx and the promoter of the Srx gene. They are in particular the plasmid pRS316 (n ° ATCC 77145).
- the promoter of the Srx gene is 400 base pairs upstream of the translation initiation site; it can be found on the site http://www.yeastgenome.org/ (access number YKL086W).
- These host cells transformed by such a vector are particularly interesting for the study of the Prx / Srx antioxidant system and the in vitro screening of drugs modulating the activity of the Prx / Srx antioxidant system.
- the subject of the present invention is also a method for screening for medicaments capable of modulating the activity of the antioxidant system Prx / Srx, characterized in that it comprises: (1) bringing the substance to be screened into contact with host cells according to the invention, in the presence of hydrogen peroxide, (2) the detection of the Prx-Cysp-SO 2 H formed, between 1 hour and 4 hours after said contacting according to step (1) , (3) establishing the report of the quantities of Prx-Cysp-SO 2 H and of Prx-Cysp-SH, from 4 hours after said contacting according to step (1).
- the present invention also relates to a method of screening for medicaments useful in the treatment of cancers, neurodegenerative diseases and neuromuscular diseases, linked to a failure of the Prx / Srx antioxidant system, characterized in that it comprises: a) bringing the test substance into contact with an extract of modified host cells as defined above or a biological sample of a non-human transgenic animal, in particular mice, selected from the group consisting of animals in which the Srx protein gene is disabled and animals in which the Srx protein gene is overexpressed in the presence of hydrogen peroxide, b) measurement by any appropriate means of the antioxidant activity of the Prx / Srx system of mixture obtained in a), and c) the selection of substances capable of stimulating or inhibiting said activity.
- the measurement of said activity is in particular carried out by the detection of the Prx-Cysp-SO 2 H formed, between 1 hour and 4 hours after said contacting according to step (a) and the establishment of the report of the quantities of Prx -Cysp-SO 2 H and Prx-Cysp-SH, from 4 hours after said contacting according to step (a).
- the present invention also relates to a method of screening for medicaments useful in the treatment of cancers, neurodegenerative diseases and neuromuscular diseases, linked to a failure of the Prx / Srx antioxidant system, characterized in that it comprises: (1) bringing the substance to be screened into contact with non-human transgenic mammals, in particular mice, selected from the group consisting of animals in which the gene for the protein Srx is disabled and animals in which the gene for the protein Srx is overexpressed, and (2) measuring the animal's survival.
- non-human transgenic mammals is carried out using conventional methods and in particular according to the protocols described in Transgenic animais generation and use (CM. Houdebine Ed., Harwood academy publishers, Amsterdam).
- Srx sulfiredoxine
- the reduction of the product comprising at least two cysteines with redox activity involves its activation by phosphorylation followed by a reduction in sulfur, these two activities being catalyzed by sulfiredoxine.
- the present invention also relates to a process for the synthesis of a product comprising Cys-SH residues from products comprising Cys-SO 2 H residues, characterized in that it comprises a step of reducing the product comprising the residues Cys-SO 2 H in product comprising Cys-SH residues, in the presence of a sulfiredoxine, ATP and magnesium.
- the invention also comprises other provisions, which will emerge from the description which follows, which refers to examples of implementation of the method which is the subject of the present invention as well as to the accompanying drawings, in which: - Figure 1 illustrates the reaction catalyzed by Srxl.
- Figures 2 and 3 show the comparison of Srxl sequences in different species;
- Figure 2 S. cerevisiae, C. albicans, S. pombe, H. sapiens, M. musculus, D. melanogaster and A. thaliana; identical regions are framed; the catalytic site is around the conserved cysteine, indicated by an asterisk;
- Figure 3 S. cerevisiae, H. sapiens, M. musculus, D. melanogaster, A.thaliana, T. elongatus and Nostoc sp ..
- GenBank access numbers are shown in this figure. The alignment of the sequences was carried out using the CLUSTALW software.
- FIGS. 4a and 4b 2D PAGE analysis of the reduced (SH) and oxidized (SO 2 H) forms of Tsal marked with S-Met in wild cells and ⁇ srxl cells exposed to H 2 O 2 (500 ⁇ M) during period indicated;
- FIGS. 4a and 4b 2D PAGE analysis of the reduced (SH) and oxidized (SO 2 H) forms of Tsal marked with S-Met in wild cells and ⁇ srxl cells exposed to H 2 O 2 (500 ⁇ M) during period indicated;
- 4c and 4d correspond to Western blots of reduced (2xAMS) and oxidized (lxAMS) forms of Tsal from WT cells (c) or ⁇ srxl (d) cells treated with H 2 O 2 after alkylation in vitro with AMS. After induction of the expression of Srxl for 15 min with H 2 O 2 (100 ⁇ M), the cells are treated with cycloheximide (CHX) 5 min before treatment with HO 2 (500 ⁇ M).
- CHX cycloheximide
- FIG. 5 illustrates the role played by the protein Srxl in the resistance of cells to stress induced by hydrogen peroxide; sensitivity tests are carried out by growing a wild strain (WT) and an invalidated cell (Asrxl) or a mutant strain srxl C84S in petri dishes containing increasing concentrations (in raM) of hydrogen peroxide (H 2 O 2 ) (FIGS. 5a and 5b): FIG. 5a: resistance to H 2 O 2 of the wild strain (WT), of the invalidated strain (Asrxl) and of the mutant strain srxl C84S ; FIG.
- FIG. 5b Western blot (overlay) and QT-RT PCR of the Srxl protein labeled with HA and of the mRNA in cells treated with hydrogen peroxide (400 ⁇ M).
- - Figure 6 illustrates the role played by the protein Srxl in the resistance of cells to stress induced by t-butyl hydroperoxide; sensitivity tests are performed by growing a wild strain (WT), an invalidated cell (Asrxl), a wild strain overexpressing Tsal or Srxl, an invalidated cell (Asrxl) expressing Tsal, an invalidated cell (Atsal) and an invalidated cell (Atsal) overexpressing Srxl in Petri dishes containing increasing concentrations of t-butyl hydroperoxide (tBOOH); the concentrations are expressed in mM.
- tBOOH t-butyl hydroperoxide
- Srxl labeled HA (lanes 1, 2 and 3) or Srxl labeled HA (lane 4) expressed in a wild strain (WT) (lanes 1, 2, 4) or in Atsal cells (lane 3) treated 15 min with H 2 O 2 (500 ⁇ M) after SDS-PAGE electrophoresis carried out under reducing (R) (lane 2) or non-reducing (NR) (lanes 1, 3, 4) conditions;
- WT wild strain
- NR non-reducing
- FIG. 8 shows that the protein Srxl and ATP are necessary for the reduction of Tsal oxidized in vitro by Srxl;
- Figures 8 a and b Western blot analysis of the reduced (SH) and super-oxidized (SO 2 H) forms of Myc-Tsal in lysates AtsaX cells incubated for 15 min at 30 ° C with purified Srxl and ATP, at the concentrations indicated;
- FIG. 8c Western blot analysis of the reduced (SH) and super-oxidized (SO 2 H) forms of 6His-Tsal incubated for 15 min at 30 ° C. with purified Srxl, ATP (1 mM) and Mg ++ (1 mM), as indicated.
- - Figure 9 illustrates the role of hSrxl in reducing 6His-
- Prxl and 6His-Prx2 in their superoxidized forms. It should be understood, however, that these examples are given only by way of illustration of the subject of the invention, of which they do not in any way constitute a limitation.
- Example 1 Materials and Methods.
- the strains of S. cerevisiae used are the strain YPH98 (Sikorski R. et al., Genetics, 1989, 122, 19-27) (MATa, ura3-52, lys2-801 amber , ade2- 101 ocher trpl- ⁇ l Ieu2- ⁇ l) and its isogenic derivatives.
- the Asrxl, ⁇ trrl and ⁇ tsal strains are produced by replacing the coding region of SRXl (sulfiredoxine) and TRRl (thioredoxin reductase) with KANMX4 and the open reading frame TSA1 with TRP1 (tyrosinase-related protein 1).
- the strains overexpressing Tsal and Srxl are identical to the preceding ones, except that they each carry a deletion of the Tsal or Sr 7 gene and carry the multiple copy plasmid psRS426 (No. ATCC 77107); The cells are cultured at 30 ° C.
- YPD medium 1% yeast extract, 2% bactopeptone and 2% glucose
- CASA medium 0.67% nitrogen yeast base, 0.1 amino casamino acids %, 2% glucose
- Plasmids The following fusion proteins: - Srxl -HA: fusion protein comprising the fusion of two HA epitopes in the C-terminal of Srxl and - 6His-Srxl: fusion protein between Srxl and at its N- terminal six labels histidine, are constructed by PCR in two stages: the nucleotide primers used for the PCR incorporate the sequence of one or the other of the epitopes HA (defined by the commercial antibody recognizing the epitope HA 12CA5, Babco, MMS-101 R) and 6His (6 histidines) and amplify the complete coding sequence of Srxl, flanked by 400 and 200 base pairs upstream and downstream of their sequence and clone at the EcoRI site of the plasmid pRS316 (no.
- Myc-Tsal a fusion protein comprising at the N-terminus of Tsal, a Myc epitope (defined by the anti-Myc antibody, 9E10, Babco, MMS-150R) is constructed and cloned similarly to the EcoRI site of plasmid pRS316.
- the directed mutagenesis for the generation of the Cys> Ser mutants is carried out by a standard PCR amplification protocol using primer oligonucleotides comprising the modified sequence. 1.3. Protein analysis * For 2D PAGE analysis.
- the precipitated proteins are dissolved in buffer A [Tris-Ci, pH 8 (100 mM), SDS (1%), EDTA (1 mM)] containing N-ethylmaleimide (NEM) (50 mM).
- the extracts are separated by SDS-PAGE at 17% under reducing and non-reducing conditions and Srxl -HA is detected by the above-mentioned monoclonal antibody 12CA5.
- the cell extracts are treated under the same conditions as those of the TCA lysis protocol, except that the precipitated proteins are first solubilized in buffer A containing DTT (50 mM) for 1 h at 37 ° C., precipitated by TCA suspended in buffer A containing AMS (15 mM) for 2 h at 37 ° C.
- the cell extracts are separated by SDS-PAGE at 20% under reducing conditions and Myc-Tsal is immunodetected with the anti-Myc 9E10 monoclonal antibody, mentioned above.
- the 6His-Tsal is oxidized to cysteine-sulfinic acid by incubation in the RM buffer containing DTT (10 mM) and H 2 O 2 (1 mM) for 30 min and diluted 16 times with the reaction medium.
- 6His-Tsal is expressed in E. coli BL21 cells from the plasmid pET28a-Tsal after induction with isopropyl-thio- ⁇ -D-galactopyranoside, in accordance with the manufacturer's recommendations (Stratagene).
- the cells are suspended in a lysis buffer [Tris-Cl pH 6.8 (50 mM), KCl (100 mM), DTT (2 mM), imidazole (20 mM)], supplemented with phenylmethane-sulfonyl fluoride (PMSF) (1 mM), lysed by freeze-thaw and sonication cycles.
- a lysis buffer [Tris-Cl pH 6.8 (50 mM), KCl (100 mM), DTT (2 mM), imidazole (20 mM)]
- PMSF phenylmethane-sulfonyl fluoride
- the extracts are centrifuged for 30 min at 30,000 g and the supernatant is passed through a column of Ni-NTA agarose (Qiagen). After washing the column with the lysis buffer, the Tsal is eluted with lysis buffer supplemented with imidazole (150 mM). The purity and the concentration of the purified proteins is determined by staining with Coomassie blue after SDS-PAGE and Bradford test (Biorad). 1.5. Purification of the Srxl reaction partners 6His-Srxl and Srxl are expressed from the plasmid pRS426 in the ⁇ trrl strain, lacking the thioredoxin reductase gene which stabilizes the disulfide bridges. The cells are cultured until the middle of the exponential phase
- RNA analysis Total RNA is extracted as described in Lee et al. (J. Biol. Chem., 1999, 274,4537-4544) and the cDNA is synthesized by reverse transcription with random hexanucleotide primers, from ⁇ g of total RNA.
- Tsal appears as a double spot: an intense corresponding to approximately 85% of the total enzyme at a pi position of 4.8 (+/- 0.05), which corresponds to a reduced Tsal (the theoretical pi of the Tsa is 4.87); the other finer spot located at a more acid pi position of 4.7 (+/- 0.05), which corresponds to oxidized Tsal (the theoretical value of the sulfinic acid form of cysteine from Tsal is 4.75).
- H 2 O 2 500 ⁇ M
- the proportion of oxidized Tsal increases at the expense of reduced Tsal, up to a proportion of approximately 90% of total proteins.
- the reduced Tsal / oxidized ratio returns to that of the untreated cells.
- the reappearance of the reduced Tsal task comes from oxidized Tsal and not from Tsal synthesized de novo, since the labeling of proteins is interrupted before analysis.
- Identical results are observed when the cells are treated with t-butyl hydroperoxide (t-BOOH).
- t-BOOH t-butyl hydroperoxide
- the Tsal migrates like a double band modified by the AMS (FIGS. 4c and 4d); and 15 minutes after treatment with H 2 O 2 , Tsal migrates as singular or double species modified by AMS, presenting a mixture of reduced and oxidized forms in a ratio of approximately 1: 3.
- Tsal After a period of 120 minutes of this treatment, the Tsal is completely returned to its initial state, that is to say in the form of a doublet alkylated by AMS, demonstrating the reduction of the sulfinate to Cys-SH.
- the reduction in Tsal is delayed compared to that observed by 2D- PAGE ( Figure 4a), which is likely due to inhibition of protein synthesis.
- Example 3 Identification of a 13 kDa protein in S. cerevisiae linked to a Prx by disulfide bridge ( Figure 7). 3.1 Materials and Methods (see Example 1) (A) Cells containing a labeled copy (HA) of the protein Srxl are treated with 500 ⁇ M of H 2 O 2 for 15 minutes.
- HA labeled copy
- the proteins are extracted according to a method allowing the conservation of the intracellular redox state of the thiols (see example 1) then separated on SDS-PAGE gel under reducing conditions for the cells of the wild strain (WT) containing a labeled copy (HA) of the protein Srxl (lane 1) and under non-reducing conditions for the wild-type (WT) cells (lane 2), the Atsal mutant strain carrying a labeled copy of the SRN7 gene (lane 3), and the Asrxl strain carrying a labeled copy of the C84S mutated SRX1 gene (lane 4); reference molecular weights (MW) are expressed in kDa.
- WT wild strain
- HA labeled copy
- Srxl a labeled copy of the protein Srxl
- la 2 wild-type cells
- MW reference molecular weights
- the purified proteins are then separated on a reducing or non-reducing SDS-PAGE gel.
- the identification of the various proteins indicated was carried out by mass spectrometry; the purified proteins separated under non-reducing and reducing conditions come from the Atrrl mutant strain containing a copy of the SRXl gene (wells 1 and 3), and the Atrrl mutant strain containing a labeled copy (HA) of the SRXl gene ( wells no. 2 and 4), the reference molecular weights (MW) are expressed in kDa.
- FIG. 7a illustrates the existence of an inter-molecular disulfide bridge between Tsal and Srxl, implying the conserved cysteine (Cys84) of Srxl (see Figures 2 and 3). It also shows that Srxl can be in two forms: a 13 kDa monomer and a 55 kDaparticularlyr linked by disulfide bridge ( Figure 7a, lane 2).
- FIG. 7b illustrates the fact that the copurification of Tsal, Tsa2 and Ahpl shows that Srxl interacts with three of the five peroxyredoxins existing in yeast and that the interaction with Tsal can be redox or non-covalent.
- the purified unreduced material contains several major bands of sizes 80, 55, 40, 35, 20 and 13 kDa ( Figure 7b) which are limited to 2 main bands of 13 and 20 kDa and one minor band 18 kDa after reduction (last well).
- Mass spectrometry of the MALDI-TOF type applied to the reduced material made it possible to identify the proteins Srxl, Tsal and the protein Ahpl which is the second major 2-Cys Prx of yeast, in the bands of 13, 20 and 18 respectively.
- kDa. Tsa2, which is a third 2-Cys Prx, is also present as traces in the 20 kDa band.
- FIG. 6 shows that the overexpression of TSA1 completely corrects the defect in resistance of the ⁇ srxl strain, showing that this sensitivity is due to a defect in peroxidase activity.
- the overexpression of SRX1 in an Atsal yeast has no effect, unlike the same overexpression in a wild strain. This shows that the presence of Tsal is essential to the function of Srxl.
- the function of the SRXl gene is linked to the TSAL gene.
- TSA1 restores the lack of tolerance to H 2 O 2 and to t-BOOH in the Atsal strain, but the overexpression of the SRXl gene does not cause any such effect in the strain. Atsal, although it slightly increases the tolerance of the wild strain to t-BOOH.
- Example 5 ATP is necessary to reduce the Cys-SO 2 H form of Tsal.
- 5.2 Results In order to study in more detail the reduction of the Cys-SO 2 H form of Tsal by Srxl, the recombinant Srxl protein expressed by baculovirus was produced. It shows that the purified Srxl allows the reduction of the SO 2 H form of the purified Tsal, and that this reduction occurs only in the presence of ATP and of lysates originating from wild type cells (FIG. 8). These data show that Srxl catalyzes the reduction of the sulfinate form of Tsal.
- the Srxl protein allows the reduction of the Cys-SO 2 H form of the Tsal protein present in the lysates of the ⁇ Srxl cells treated with HO 2 in a dose-dependent manner, only when ATP is added (FIG. 8a and b).
- GTP and AMP-P ⁇ P which is a non-hydrolyzable ATP homolog, has no effect on catalysis.
- Adding EDTA to the lysate inhibits the reduction in Srxl-dependent Tsal and the reintroduction of Mg ++ or Mn ++ but not Fe ++ , Ca ++ , Cu ++ , or Zn, restores the reduction .
- the activity of the Srxl mutants was tested by the substitution of each of its 3 cysteines.
- the substitution of Cys84 (Srxl Cys84s ), which is conserved among the Srxl homologs in other eukaryotes, completely suppresses the formation of the disulfide bridge between Srxl and Tsal and the reduction of the Cys-SO H form of Tsal, then that the other cysteine mutants show no effect for Srxl Cysl06S or a minor effect for Srxl Cys48S .
- Srxl-Tsal bond comes from Cys84 of Srxl and that it is essential for the reduction of Tsa Cys-SO 2 H mediated by Srxl.
- the reduction of the cysteine sulfinic acid probably requires its initial activation, which can be carried out by formation of a phosphorylated sulfinic ester, as the need for ATP and Mg 44 " indicates.
- This modification allows the attack of the sulphide residue by cysteine at the activated site of Srxl, then the temporary formation of an intermolecular thiolsufinate between Srxl and Tsal. Thiolsulfinate exists during oxidative stress and is accessible to thiol-dependent reduction.
- the thiolsulfinate between Srxl and Tsal is converted into two Cys-SH by successive thiol-redox exchanges initially involving the reductive cleavage of the thiolsulfinate bridge into a sulfenate and into a disulfide bridge thanks to the electrons supplied by the DTT in vitro and probably by the thioredoxin in vivo.
- Example 6 Identification of human sulfiredoxine (hSrxl) and demonstration of its catalytic activity.
- hSrxl human sulfiredoxine
- SEQ ID NO: 4 Materials and methods The hSrx gene (SEQ ID NO: 4) was cloned by PCR from cDNAs prepared by reverse transcription from cells of a human tumor line MCF-7, using the oligonucleotides:
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Neurology (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Neurosurgery (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Physical Education & Sports Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP04767567A EP1641919A2 (fr) | 2003-07-04 | 2004-07-02 | Applications d une nouvelle classe d' enzymes : les sulf iredoxines |
JP2006518281A JP2007528207A (ja) | 2003-07-04 | 2004-07-02 | 酵素の新規なクラス:スルフィレドキシンの適用 |
US10/563,375 US20110189154A1 (en) | 2003-07-04 | 2004-07-02 | Applications For A New Class Of Enzymes: Sulfiredoxins |
CA002531235A CA2531235A1 (fr) | 2003-07-04 | 2004-07-02 | Applications d'une nouvelle classe d'enzymes : les sulfiredoxines. |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0308212A FR2857022B1 (fr) | 2003-07-04 | 2003-07-04 | Applications d'une nouvelle classe d'enzymes: les sulfiredoxines |
FR0308212 | 2003-07-04 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2005005627A2 true WO2005005627A2 (fr) | 2005-01-20 |
WO2005005627A3 WO2005005627A3 (fr) | 2005-12-08 |
Family
ID=33522782
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/FR2004/001727 WO2005005627A2 (fr) | 2003-07-04 | 2004-07-02 | Applications d'une nouvelle classe d'enzymes : les sulfiredoxines. |
Country Status (6)
Country | Link |
---|---|
US (1) | US20110189154A1 (fr) |
EP (1) | EP1641919A2 (fr) |
JP (1) | JP2007528207A (fr) |
CA (1) | CA2531235A1 (fr) |
FR (1) | FR2857022B1 (fr) |
WO (1) | WO2005005627A2 (fr) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP6989428B2 (ja) * | 2018-03-23 | 2022-01-05 | アークレイ株式会社 | 前処理剤、前処理キット、抗原検査キット及び抗原検査方法 |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000040695A2 (fr) * | 1999-01-08 | 2000-07-13 | Ceres, Inc. | Fragments d'adn determines selon leur sequence et polypeptides correspondants codes par lesdits fragments |
FR2798672A1 (fr) * | 1999-09-17 | 2001-03-23 | Commissariat Energie Atomique | Formes acides des peroxyredoxines et leur utilisation comme moyen de diagnostic |
US20020172952A1 (en) * | 1999-06-30 | 2002-11-21 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of lung cancer |
-
2003
- 2003-07-04 FR FR0308212A patent/FR2857022B1/fr not_active Expired - Fee Related
-
2004
- 2004-07-02 WO PCT/FR2004/001727 patent/WO2005005627A2/fr active Application Filing
- 2004-07-02 EP EP04767567A patent/EP1641919A2/fr not_active Withdrawn
- 2004-07-02 US US10/563,375 patent/US20110189154A1/en not_active Abandoned
- 2004-07-02 CA CA002531235A patent/CA2531235A1/fr not_active Abandoned
- 2004-07-02 JP JP2006518281A patent/JP2007528207A/ja active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2000040695A2 (fr) * | 1999-01-08 | 2000-07-13 | Ceres, Inc. | Fragments d'adn determines selon leur sequence et polypeptides correspondants codes par lesdits fragments |
US20020172952A1 (en) * | 1999-06-30 | 2002-11-21 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of lung cancer |
FR2798672A1 (fr) * | 1999-09-17 | 2001-03-23 | Commissariat Energie Atomique | Formes acides des peroxyredoxines et leur utilisation comme moyen de diagnostic |
Non-Patent Citations (3)
Title |
---|
BITEAU BENOIT ET AL: "ATP-dependent reduction of cysteine-sulphinic acid by S. cerevisiae sulphiredoxin." NATURE (LONDON), vol. 425, no. 6961, 30 octobre 2003 (2003-10-30), pages 980-984, XP001189048 ISSN: 0028-0836 (ISSN print) * |
DATABASE UNIPROT [Online] 1 juin 1994 (1994-06-01), POHL,T.M, AND POHL, F.M.: "Hypothetical UPF0238 protein YKL086W" XP002273872 Database accession no. YKI6_YEAST * |
WOO HYUN AE ET AL: "Reversing the inactivation of peroxiredoxins caused by cysteine sulfinic acid formation." SCIENCE (WASHINGTON D C), vol. 300, no. 5619, 25 avril 2003 (2003-04-25), pages 653-656, XP002273871 ISSN: 0036-8075 (ISSN print) * |
Also Published As
Publication number | Publication date |
---|---|
WO2005005627A3 (fr) | 2005-12-08 |
EP1641919A2 (fr) | 2006-04-05 |
CA2531235A1 (fr) | 2005-01-20 |
FR2857022B1 (fr) | 2007-10-05 |
JP2007528207A (ja) | 2007-10-11 |
FR2857022A1 (fr) | 2005-01-07 |
US20110189154A1 (en) | 2011-08-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Moosavi et al. | The assembly of succinate dehydrogenase: a key enzyme in bioenergetics | |
Castro et al. | Complementary antioxidant defense by cytoplasmic and mitochondrial peroxiredoxins in Leishmania infantum | |
Lyon et al. | Proteomic analysis of a sea-ice diatom: salinity acclimation provides new insight into the dimethylsulfoniopropionate production pathway | |
Faust et al. | An inventory of peroxisomal proteins and pathways in Drosophila melanogaster | |
Hedtke et al. | Light‐dependent gene activation in A spergillus nidulans is strictly dependent on phytochrome and involves the interplay of phytochrome and white collar‐regulated histone H 3 acetylation | |
Harren et al. | The Ca2+/calcineurin-dependent signaling pathway in the gray mold Botrytis cinerea: the role of calcipressin in modulating calcineurin activity | |
El‐Azaz et al. | Identification of a small protein domain present in all plant lineages that confers high prephenate dehydratase activity | |
Ernst et al. | Endogenous synthesis of 2-aminoacrylate contributes to cysteine sensitivity in Salmonella enterica | |
Winger et al. | Sensitivity of plant mitochondrial terminal oxidases to the lipid peroxidation product 4-hydroxy-2-nonenal (HNE) | |
Asiimwe et al. | Modulation of ethanol stress tolerance by aldehyde dehydrogenase in the mycorrhizal fungus Tricholoma vaccinum | |
Petersson et al. | The Prx Q protein of Arabidopsis thaliana is a member of the luminal chloroplast proteome | |
Shiraishi et al. | Yeast nitrogen utilization in the phyllosphere during plant lifespan under regulation of autophagy | |
Biyani et al. | Leishmania donovani encodes a functional enzyme involved in vitamin C biosynthesis: arabino-1, 4-lactone oxidase | |
Lu et al. | Characterization and modification of enzymes in the 2-ketoisovalerate biosynthesis pathway of Ralstonia eutropha H16 | |
Katane et al. | Rat D-aspartate oxidase is more similar to the human enzyme than the mouse enzyme | |
CA2912495A1 (fr) | Procede d'inactivation d'une proteine prion | |
Nakatsukasa et al. | Heterologous expression and functional analysis of the F-box protein Ucc1 from other yeast species in Saccharomyces cerevisiae | |
Wang et al. | Purification and characterization of aspartate N-acetyltransferase: A critical enzyme in brain metabolism | |
Carletti et al. | Glutathione transferases from Anguilla anguilla liver: identification, cloning and functional characterization | |
FR2841260A1 (fr) | Polynucleotides et polypeptides codes par lesdits polynucleotides impliques dans la synthese de derives des dicetopiperazines | |
Willett et al. | Characterization of the glutamate dehydrogenase gene and its regulation in a euryhaline copepod | |
WO2005005627A2 (fr) | Applications d'une nouvelle classe d'enzymes : les sulfiredoxines. | |
Katane et al. | Caenorhabditis elegans has two genes encoding functional d‐aspartate oxidases | |
Lee et al. | Identification of two plastid proteins in the dinoflagellate Alexandrium affine that are substantially down-regulated by nitrogen-depletion | |
Lee et al. | High-throughput screening methods for selecting L-threonine aldolases with improved activity |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2006518281 Country of ref document: JP |
|
ENP | Entry into the national phase |
Ref document number: 2531235 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2004767567 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2004767567 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10563375 Country of ref document: US |