WO2004090143A2 - Modulation de l'activite des cytokinines dans les plantes - Google Patents

Modulation de l'activite des cytokinines dans les plantes Download PDF

Info

Publication number
WO2004090143A2
WO2004090143A2 PCT/US2004/010064 US2004010064W WO2004090143A2 WO 2004090143 A2 WO2004090143 A2 WO 2004090143A2 US 2004010064 W US2004010064 W US 2004010064W WO 2004090143 A2 WO2004090143 A2 WO 2004090143A2
Authority
WO
WIPO (PCT)
Prior art keywords
cytokinin
plant
promoter
seed
gene
Prior art date
Application number
PCT/US2004/010064
Other languages
English (en)
Other versions
WO2004090143A3 (fr
Inventor
Jeffrey E. Habben
Chris Zinselmeier
Dwight T. Tomes
Shane E. Abbitt
Timothy G. Helentjaris
Xiaomu Niu
Original Assignee
Pioneer Hi-Bred International, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pioneer Hi-Bred International, Inc. filed Critical Pioneer Hi-Bred International, Inc.
Priority to EP04749636A priority Critical patent/EP1613754A2/fr
Priority to BRPI0409178-7A priority patent/BRPI0409178A/pt
Priority to CA2521497A priority patent/CA2521497C/fr
Priority to AU2004227360A priority patent/AU2004227360B2/en
Priority to NZ543070A priority patent/NZ543070A/en
Publication of WO2004090143A2 publication Critical patent/WO2004090143A2/fr
Publication of WO2004090143A3 publication Critical patent/WO2004090143A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0026—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5)
    • C12N9/0032—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5) with oxygen as acceptor (1.5.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
    • C12N15/823—Reproductive tissue-specific promoters
    • C12N15/8234—Seed-specific, e.g. embryo, endosperm
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • This invention relates generally to the field of plant molecular biology. More specifically, this invention relates to methods and reagents for the temporally- or spatially -regulated expression of genes that affect metabolically effective levels of cytokinins in plants, including seeds and the maternal tissue from which such seeds arise, including female inflorescences, ovaries, female florets, aleurone, pedicel, and pedicel-forming regions.
  • Cytokinins are phytohormones involved in numerous physiological processes in plants. Plants respond to environmental stresses in part by modifying the relative balance of active and inactive cytokinins. For instance, during times of abiotic stress (which include, but are not limited to, conditions of drought, density, cold, salinity, and/or soil compaction), increased cytokinin oxidase activity shifts the balance in favor of inactive cytokinins, leading to decreased plant productivity. (Jones and Setter, In CSSA Special Publication No. 29, pp. 25-42. American Society of Agronomy, Madison, WI.
  • cytokinins The metabolism of cytokinins in plants is complex. Multi-step biochemical pathways are known for the biosynthesis and degradation of cytokinins. At least two major routes of cytokinin biosynthesis are recognized. The first involves transfer RNA (tRNA) as an intermediate. The second involves de novo (direct) biosynthesis. In the first case, tRNAs are known to contain a variety of hypermodified bases (among them are certain cytokinins). These modifications are known to occur at the tRNA polymer level as a post-transcriptional modification.
  • tRNA transfer RNA
  • the branched 5-carbon N 6 substituent is derived from mevalonic acid pyrophosphate, which undergoes decarboxylation, dehydration, and isomerization to yield ⁇ 2 -isopentenyl pyrophosphate (iPP).
  • iPP isopentenyl pyrophosphate
  • the latter condenses with the relevant adenosine residue in the tRNA. Further modifications are then possible.
  • the tRNAs are hydrolyzed to their component bases, thereby forming a pool of available free cytokinins.
  • cytokinins de novo, i. e., without a tRNA intermediate.
  • the ipt gene utilized in the practice of this invention is one such gene.
  • the formation of free cytokinins is presumed to begin with [9R5'P] iP.
  • This compound is rapidly and stereospecifically hydroxylated to give the zeatin derivatives from which any number of further metabolic events may ensue.
  • Such events include but are not limited to (1 ) conjugation, incorporating ribosides, ribotides, glucosides, and amino acids; (2) hydrolysis; (3) reduction; and (4) oxidation. While each enzyme in these pathways is a candidate as an effector of cytokinin levels, enzymes associated with rate- limiting steps have particular utility in the practice of this invention.
  • ipt isopentenyl transferase
  • van Larebeke et al. (Nature 252:169-170(1974); see also Barry et al., Proc. Nat . Acad. S . (USA) 81 :4776-4780 (1984) and Strabala et al., Mol. Gen. Gen. 216(2-3):388-394 (1989)).
  • Isolation of ipt genes in Arabidopsis has also been reported. (Takei et al., J Biol Chem. 276(28):26405- 26410 (2001 ); Kakimoto et al., Plant Cell Physiol.
  • the invention comprises appropriately modulated expression of ipt genes from any source, including other species, such as maize.
  • Schmulling, T. et al. transformed tobacco with the Agrobacterium ipt gene under control of the Drosophila hsp70 promoter, which provides a very low level of expression at normal temperatures and a rapid increase in expression after heat shock.
  • Most heat-shocked transgenic calli were greener, had higher cytokinin concentrations, and grew at a more rapid rate than control calli. Plants regenerated from the heat-shocked transgenic calli were described as "fairly normal" and cytokinin levels in these plants did not differ from those measured in wild-type plants.
  • Plants regenerated from uninduced transgenic calli did not differ from controls in either plant phenotype or cytokinin content.
  • a second experiment created callus tissue transgenic for the ipt gene driven by its native promoter. In shoots regenerated from these calli, high cytokinin levels inhibited root formation. These shoots, grafted onto wild-type tobacco stems, displayed tiny leaves and a stunted, highly-branched growth habit. Thus, transformation either resulted in negative phenotypic changes or had no impact.
  • chalcone synthase genes are complex and regulated by a variety of factors, including light, fungal elicitors, wounding, and microbial pathogens.
  • chs expression may be tissue-preferred, occurring in pigmented flowers and roots, and developmentally specific, occurring during early germination. (Ito et al., Mol. Gen. Gen. 255:28-37 (1997); Shimizu et al., Plant Molecular Biology 39(4)785-95 (1999))
  • Transformation of tobacco with ipt linked to a copper-inducible, root-specific promoter provided, in 28 of 31 cases, a controlled system for evaluating effects of increased cytokinin production. Morphological changes upon induction included release of apical dominance, increases in total plant leaf number, and delay of leaf senescence. (McKenzie et al., Plant Physiol. 116:969-977 (1998))
  • Several transgenic lines exhibited uncontrolled cytokinin expression and a radically different, undesirable phenotype, lacking root development and elongation of stems.
  • nucleic acid constructs and methods useful in controlling and directing temporally- and spatially- regulated expression of cytokinin metabolic genes in plants including plant seed and those maternal tissues in which seed development takes place, or in modulating plant sensing of and/or response to cytokinins, in order to improve plant vigor and yield without such detrimental effects as reduced root development or aberrant shoot morphology.
  • This invention provides several such useful nucleic acid constructs and methods to modulate cytokinin activity in plants, including effective levels of cytokinin in plant seeds, developing plant seeds, and related maternal reproductive tissues. Further, the need exists for constructs and methods which can provide said improvements in plant vigor and yield under favorable or unfavorable growing conditions.
  • This invention provides tools and reagents that allow the skilled artisan, by the application of, inter alia, transgenic methodologies, to so influence the level of cytokinin activity, including the metabolic flux in respect to the cytokinin metabolic pathway in seed.
  • This influence may be either anabolic or catabolic, by which is meant the influence may act to increase the biosynthesis of cytokinin and/or decrease the degradation.
  • a combination of both approaches is also contemplated by this invention. Further combinations may include targeted modulation of expression of isolated polynucleotides encoding polypeptides involved in cytokinin recognition and cellular response to provide enhanced cytokinin activity as defined herein.
  • Certain embodiments of the present invention provide plants, particularly transgenic maize, which have enhanced cytokinin activity, relative to an otherwise isogenic plant, without corresponding detrimental effects.
  • Said enhancement relative to an otherwise isogenic plant may occur under favorable environmental conditions, unfavorable environmental conditions, or both.
  • Enhanced cytokinin activity may encompass levels of cytokinins in the seed, the developing seed, and the maternal tissues associated with seed development.
  • enhanced cytokinin activity may result from improved perception of, and response to, cytokinins by said plant.
  • Enhanced cytokinin activity may act as a metabolic buffer to ameliorate the effects of transient stresses, particularly during the lag phase of seed development, to thus improve corn stress tolerance and yield stability.
  • Enhanced cytokinin activity may also be manifested in improved plant vigor and/or increased seed yield.
  • Such embodiments comprise a nucleic acid construct stably integrated into the genome thereof, said construct capable of the temporally- or spatially-regulated modulation of cytokinin levels.
  • Certain embodiments of the present invention provide transgenic plant lines with heritable phenotypes which are useful in breeding programs designed to produce commercial products with improved performance, which may include plant vigor, improved seed size, decreased tip kernel abortion and/or increased seed set during favorable or unfavorable environmental conditions. Such commercial products are further embodiments of the invention.
  • Some embodiments of the invention provide a fertile transgenic plant comprising a nucleic acid construct stably integrated into the genome thereof, said construct capable of effecting modulation of cytokinin activity in said plant.
  • Certain embodiments of the invention provide an isolated recombinant DNA molecule comprising a promoter directing temporally- or spatially-regulated expression of an operably-linked cytokinin-modulating gene and optionally comprising one or more enhancer elements from a highly-expressed gene.
  • the invention provides a method for improving stress tolerance and yield stability in plants, comprising stably introducing into plant cells a nucleic acid construct capable of effecting modulation of cytokinin activity, and from said cells, regenerating said plants with improved stress tolerance and yield stability.
  • Said construct may result in preferential expression of cytokinin modulating genes during the lag phase of plant seed development.
  • Embodiments also provide a method for producing fertile, transgenic plants capable of the regulated expression of a cytokinin modulating gene in developing seeds, comprising introducing into plant host cells a nucleic acid construct capable of preferential temporal and/or spatial expression of a cytokinin-modulating gene in developing seed and the maternal tissues associated with seed development, under conditions sufficient for the stable integration of the construct into the genome of said cells, and regenerating and recovering said fertile transgenic plants.
  • isolated nucleic acid molecules encoding cytokinin metabolic enzymes, including mRNAs, cDNAs, genomic DNAs and biologically useful variants, analogs or derivatives thereof, including fragments of the variants, analogs and derivatives.
  • Other embodiments of the invention are naturally occurring allelic variants of the nucleic acid molecules in the sequences provided which encode cytokinin metabolic enzymes.
  • polypeptides that comprise cytokinin metabolic enzymes as well as biologically or diagnostically useful fragments thereof, as well as variants, derivatives and analogs of the foregoing and fragments thereof.
  • cytokinin metabolic polypeptides particularly ipt (for example, SEQ ID NOS: 1 and 2) and cytokinin oxidase (for example, SEQ ID NOS: 26-37) , that may be employed for modulation of cytokinin levels in seed and related female reproductive tissues, particularly meristematic regions of female reproductive tissues.
  • Certain embodiments of the invention provide methods for producing the polypeptides of interest, comprising culturing host cells having expressibly incorporated therein a polynucleotide under conditions for the temporal and/or spatial expression of cytokinin metabolic enzymes in seed and related female reproductive tissues, and then optionally recovering the expressed polypeptide.
  • probes that hybridize to cytokinin metabolic enzyme polynucleotide sequences useful as molecular markers in breeding programs.
  • Other embodiments of the invention provide products, compositions, processes and methods that utilize the aforementioned polypeptides and polynucleotides for research, biological and agricultural purposes.
  • Other embodiments of the invention provide inhibitors to such polypeptides, useful for modulating the activity and/or expression of the polypeptides.
  • antibodies against such polypeptides are provided.
  • antibodies against the cytokinin catabolic enzymes may be selective for the entire class of the cytokinin catabolic enzymes, irrespective of species of origin, as well as species-specific antibodies.
  • cytokinin enzyme antagonists and agonists are those which bind to cytokinin catabolic enzymes (e.g., to cytokinin oxidase) so as to inhibit the binding of binding molecules, or to destabilize the complex formed between the cytokinin catabolic enzyme and the binding molecule, to prevent further biological activity arising from the cytokinin catabolic enzyme.
  • preferred agonists are molecules that bind to or interact with cytokinin biosynthetic enzymes so as to stimulate one or more effects of a particular cytokinin biosynthetic enzyme or which enhance expression of the enzyme and which also preferably result in a modulation of cytokinin accumulation.
  • Effective constructs result in cytokinin modulation within meristematic tissues, particularly those within female reproductive tissues, providing the observed improvement in vigor.
  • the invention encompasses the particular constructs described herein, and other such constructs which may provide expression of cytokinin-modulating genes to result in improved plant vigor without significant detrimental effects.
  • the modulation of cytokinin activity in the female reproductive tissues of said plant, to result in enhanced plant vigor without significant detrimental effects is claimed.
  • Expression of isolated DNA sequences in a plant host is dependent upon the presence of operably linked regulatory elements that are functional within the plant host. Choice of the regulatory sequences will determine when and where within the organism the isolated DNA sequence is expressed. Where continuous expression is desired in all or nearly all cells of a plant throughout development, constitutive promoters are utilized. In contrast, where gene expression in response to a stimulus is desired, inducible promoters are the regulatory element of choice. Where expression in particular tissues or organs is desired, sometimes at specific stages of development, tissue-preferred promoters and/or terminators are used. That is, these regulatory elements can drive expression in specific tissues or organs, at specific stages. Additional regulatory sequences upstream and/or downstream from the core sequences can be included in expression cassettes of transformation vectors to bring about varying levels of expression of isolated nucleotide sequences in a transgenic plant.
  • Seed development involves embryogenesis and maturation events as well as physiological adaptation processes that occur within the seed to insure progeny survival. Developing plant seeds accumulate and store carbohydrate, lipid, and protein that are subsequently used during germination. Generally, the expression patterns of seed proteins are highly regulated. This regulation includes spatial and temporal regulation during seed development. A variety of proteins accumulate and decay during embryogenesis and seed development and provide an excellent system for investigating different aspects of gene regulation as well as for providing regulatory sequences for use in genetic manipulation of plants.
  • Another reason diverse regulatory sequences are needed is that undesirable biochemical interactions may result from using the same regulatory sequence to control more than one gene.
  • transformation with multiple copies of a regulatory element may cause homologous recombination between two or more expression systems, formation of hairpin loops resulting from two copies of the same promoter or enhancer in opposite orientation in close proximity, competition between identical expression systems for binding to common promoter-specific regulatory factors, and inappropriate expression levels of an exogenous gene due to trans effects of a second promoter or enhancer.
  • a goal in this field has been the detection and characterization of new regulatory sequences for transgenic control of DNA constructs.
  • Isolation and characterization of seed-preferred promoters and terminators that can serve as regulatory elements for expression of isolated nucleotide sequences of interest in a seed-preferred manner are needed for improving seed traits in plants.
  • early kernel development is a stage critical in drought- induced ear tip abortion. Maintaining an active pool of plant cytokinins has been proven critical in sustaining kernel growth and development under transient drought stress.
  • genes that contribute to stress responses in general such as those involved in ABA responses, and also genes that maintain cell expansion and division, play essential roles in reproductive development under stress.
  • Early stage endosperm has emerged as an important target tissue for transgene expression as it surrounds and nurtures developing embryos.
  • EEP1 and EEP2 promoters address the need for directing transgene expression in the early endosperm tissue.
  • Figure 1A-Embryo This Figure shows that embryo-preferred overexpression of ipt increases embryo cytokinin levels, particularly ZR and Z9G (range of 2 to 8- fold difference). In contrast, Z levels are unchanged and IPAR is not detectable at either developmental stage.
  • Figure 1 B-Endosperm This Figure shows that embryo-preferred ipt overexpression altered endosperm cytokinin levels but less than those in the embryo (range of only 10 to 30% difference). Abbreviations used as in Figure 1A.
  • Figure 2 presents ear growth rate data for D2F1 hemizygous plants under non- stress conditions.
  • Figure 3 presents grain yield, kernel number, kernel dry mass, and ear length data for D3F1 hemizygous plants under non-stress conditions.
  • Figure 4 presents plant height data for D4F3 homozygous plants under non- stress conditions.
  • Figure 5 presents yield data for D4F3 homozygous plants under non-stress conditions.
  • Figure 6 provides yield component data for D4F3 homozygous plants under non-stress conditions.
  • Figure 7 provi des plant height data for drought-stressed D4F3 plants
  • Figure 8 provi des leaf greenness data for drought-stressed D4F3 plants
  • Figure 9 prov des yield data for drought-stressed D4F3 plants.
  • Figure 10 shows increased plant biomass for event TC15850.
  • CYTOKININ ACTIVITY encompasses levels of active cytokinins within a plant, as well as the plant's perception of and response to cytokinins.
  • cytokinin biosynthetic enzymes and cytokinin degrading enzymes are examples of enzymes capable of modulating cytokinin activity.
  • Cytokinin- modulating genes comprises polynucleotides encoding such enzymes as well as polynucleotides encoding proteins involved in cytokinin perception and plant response, including transcription factors associated with the cytokinin response.
  • the "active cytokinin pool” refers to the accumulation of active cytokinins at any one time within a cell or plant part or entire plant, as appropriate. Stabilizing the active cytokinin pool may involve down-regulation of cytokinin degradation or conjugation, or up-regulation of cytokinin biosynthesis.
  • CYTOKININ METABOLIC ENZYME-BINDING MOLECULE refers to molecules or ions which bind or interact specifically with cytokinin metabolic enzyme polypeptides or polynucleotides of the present invention, including, for example enzyme substrates, cell membrane components and classical receptors. Binding between polypeptides of the invention and such molecules, including binding or interaction molecules, may be exclusive to polypeptides of the invention, or it may be highly specific for polypeptides of the invention, or it may be highly specific to a group of proteins that includes polypeptides of the invention, or it may be specific to several groups of proteins at least one of which includes a polypeptide of the invention. Binding molecules also include antibodies and antibody-derived reagents that bind specifically to polypeptides of the invention.
  • CYTOKININ RESPONSIVE COMPONENT generally means a cellular constituent that binds to or otherwise interacts with a cytokinin resulting in the transmission of an intra- or inter- cellular signal and eliciting one or more cellular responses to the presence or absence or fluctuation in the levels of cytokinins.
  • DEVELOPING PLANT SEEDS generally means the maternal plant tissues which after pollination are capable of giving rise to a plant seed.
  • This maternal plant tissue includes such tissue as female florets, ovaries, aleurone, pedicel, and pedicel-forming region.
  • DETRIMENTAL effects are those which are obviously harmful or damaging.
  • Significant detrimental effects in the context of this application, refer to phenotypic changes which would contribute to a net negative effect on plant productivity or vigor.
  • GENE SILENCING refers to posttranscriptional interference with gene expression. Techniques such as antisense, co-suppression, and RNA interference (RNAi), for example, have been shown to be effective in gene silencing. (For reviews, see Arndt and Rank, Genome 40(6):78 ⁇ -797, 1997; Turner and Schuch, Journal of Chemical Technology and Biotechnology 7 ⁇ (10):869-882, 2000; Klink and Wolniak, Journal of Plant Growth Regulation 19(4):371-384, 2000)
  • GENETIC ELEMENT generally means a polynucleotide comprising a region that encodes a polypeptide, or a polynucleotide region that regulates replication, transcription or translation or other processes important to expression of the polypeptide in a host cell, or a polynucleotide comprising both a region that encodes a polypeptide and a region operably linked thereto that regulates expression.
  • Genetic elements may be comprised within a vector that replicates as an episomal element; that is, as a molecule physically independent of the host cell genome. They may be comprised within plasmids. Genetic elements also may be comprised within a host cell genome; not in their natural state but, rather, following manipulation such as isolation, cloning and introduction into a host cell in the form of purified DNA or in a vector, among others.
  • GERMPLASM as used herein, means a set of genetic entities, which may be used in a breeding program to develop new plant varieties.
  • HIGH CYTOKININ TRANSGENIC means an entity, which, as a result of recombinant genetic manipulation, produces seed with a heritable increase in cytokinin and/or decrease in auxin.
  • HOST CELL is a cell which has been transformed or transfected, or is capable of transformation or transfection by an exogenous polynucleotide sequence.
  • Exogenous polynucleotide sequence is defined to mean a sequence not naturally in the cell, or which is naturally present in the cell but at a different genetic locus, in different copy number, or under direction of a different regulatory element.
  • IDENTITY and SIMILARITY are relationships between two polypeptide sequences or two polynucleotide sequences, as determined by comparing the sequences.
  • identity also means the degree of sequence relatedness between two polypeptide or two polynucleotide sequences as determined by the match between two strings of such sequences.
  • Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J. Applied Math., 48:1073 (1988). Preferred methods to determine identity are designed to give the largest match between the two sequences tested. Methods to determine identity and similarity are codified in computer programs. Typical computer program methods to determine identity and similarity between two sequences include: GCG® program package (Accelrys, Inc., San Diego, CA; Devereux, J., et al., Nucleic Acids Research 12(1);387 (1984)), BLASTP, BLASTN, FASTA and TFASTA (Atschul, S.F. et al., J. Mol. Biol. 215/403 (1990)).
  • ISOLATED means altered “by the hand of man” from its natural state; i.e., that, if it occurs in nature, it has been changed or removed from its original environment, or both.
  • a naturally-occurring polynucleotide or a polypeptide naturally present in a living organism in its natural state is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein.
  • isolated means that it is separated from the chromosome and cell in which it naturally occurs.
  • polynucleotides can be joined to other polynucleotides, such as DNAs, for mutagenesis, to form fusion proteins, and for propagation or expression in a host, for instance.
  • the isolated polynucleotides, alone or joined to other polynucleotides such as vectors, can be introduced into host cells, in culture or in whole organisms. Introduced into host cells in culture or in whole organisms, such DNAs still would be isolated, as the term is used herein, because they would not be in their naturally- occurring form or environment.
  • polynucleotides and polypeptides may occur in a composition, such as media formulations or solutions for introduction into cells, or compositions or solutions for chemical or enzymatic reactions, which are not naturally occurring compositions, and, therein such polynucleotides or polypeptides remain isolated within the meaning of that term as it is employed herein.
  • LIGATION refers to the process of forming phosphodiester bonds between two or more polynucleotides, which most often are double stranded DNAs.
  • LOW-LEVEL CONSTITUTIVE EXPRESSION refers to gene expression in essentially all tissues of a plant and at most or all stages of development, at a level less than that of a gene driven by the CaMV35S promoter.
  • Low-level constitutive expression of a polynucleotide may result from operable linkage to a promoter that normally drives such expression, such as F3.7 (SEQ ID NO: 10) or from a combination of a promoter operably linked to a gene the combination of which is further in proximity to an enhancer element, such as the CaMVS ⁇ s enhancer.
  • Promoters driving expression preferentially in meristematic tissues such as zag2.1 (SEQ ID NO: 3), may also provide a low level of constitutive expression.
  • OLIGONUCLEOTIDE(S) refers to short polynucleotides. Often the term refers to single-stranded deoxyribonucleotides, but it can refer as well to single- or double-stranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs, among others. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, often are synthesized by chemical methods, such as those implemented on automated oligonucleotide synthesizers. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA- I
  • oligonucleotide typically is obtained without a ⁇ ' phosphate.
  • the ⁇ ' ends of such oligonucleotides are not substrates for phosphodiester bond formation by ligation reactions that employ DNA ligases typically used to form recombinant DNA molecules.
  • a phosphate can be added by standard techniques, such as those that employ a kinase and ATP.
  • the 3' end of a chemically-synthesized oligonucleotide generally has a free hydroxyl group and, in the presence of a ligase, such as T4 DNA ligase, readily will form a phosphodiester bond with a ⁇ ' phosphate of another polynucleotide, such as another oligonucleotide.
  • a ligase such as T4 DNA ligase
  • OPERABLY LINKED includes reference to a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA corresponding to the second sequence.
  • operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame.
  • PLANT includes reference to whole plants, plant parts or organs (e.g., leaves, stems, roots, etc.), plant cells, seeds and progeny of same.
  • Plant cell as used herein, further includes, without limitation, cells obtained from or found in: seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. Plant cells can also be understood to include modified cells, such as protoplasts, obtained from the aforementioned tissues.
  • the class of plants which can be used in the methods of the invention is generally as broad as the class of higher plants amenable to transformation techniques, including both monocotyledonous and dicotyledonous plants, including, for example, maize, soybean, and canola.
  • PLASMIDS as used herein, generally are designated herein by a lower case p preceded and/or followed by capital letters and/or numbers, in accordance with standard naming conventions that are familiar to those of skill in the art.
  • Starting plasmids disclosed herein are either commercially available, publicly available, or can be constructed from available plasmids by routine application of well-known, published procedures.
  • Many plasmids and other cloning and expression vectors that can be used in accordance with the present invention are well known and readily available to those of skill in the art.
  • those of skill readily may construct any number of other plasmids suitable for use in the invention. The properties, construction and use of such plasmids, as well as other vectors, in the present invention will be readily apparent from the present disclosure to those of skill.
  • POLYNUCLEOTIDE(S), as used herein, generally refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • polynucleotides as used herein refers to, among others, single-and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions or single-, double- and triple-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double- stranded regions, hybrid molecules comprising DNA and RNA that may be single- stranded or, more typically, double-stranded, or triple-stranded, or a mixture of single- and double-stranded regions.
  • polynucleotide as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the strands in such regions may be from the same molecule or from different molecules.
  • the regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules.
  • One of the molecules of a triple-helical region often is an oligonucleotide.
  • polynucleotide includes DNAs or RNAs as described above that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides" as that term is intended herein.
  • DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art.
  • polynucleotide as it is employed herein embraces such chemically-, enzymatically- or metabolically-modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including inter alia, simple and complex cells.
  • POLYPEPTIDES includes all polypeptides as described below.
  • the basic structure of polypeptides is well known and has been described in innumerable textbooks and other publications in the art.
  • the term is used herein to refer to any peptide or protein comprising two or more amino acids joined to each other in a linear chain by peptide bonds.
  • the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
  • polypeptides often contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally-occurring amino acids, and that many amino acids, including the terminal amino acids, may be modified in a given polypeptide, not only by natural processes, such as processing and other post- translational modifications, but also by chemical modification techniques which are well known to the art. Even the common modifications that occur naturally in polypeptides are too numerous to list exhaustively here, but they are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and they are well known to those of skill in the art.
  • polypeptides of the present invention are, to name an illustrative few, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphatidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GP anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation proteolytic processing, phosphorylation, prenylation, racemization, selenoylation sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginy
  • polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of posttranslation events, including natural processing events and events brought about by human manipulation which do not occur naturally.
  • Circular, branched and branched circular polypeptides may be synthesized by non-translation natural process and by entirely synthetic methods, as well. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side- chains and the amino or carboxyl termini.
  • blockage of the amino or carboxyl group in a polypeptide, or both, by a covalent modification is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well.
  • the amino terminal residue of polypeptides made in E. coli or other cells, prior to proteolytic processing almost invariably will be N-formylmethionine.
  • a methionine residue at the NH 2 -terminus may be deleted. Accordingly, this invention contemplates the use of both the methionine-containing and the methionine-less amino terminal variants of the protein of the invention.
  • modifications that occur in a polypeptide often will be a function of how it is made.
  • the nature and extent of the modifications in large part will be determined by the host cell post-translational modification capacity and the modification signals present in the polypeptide amino acid sequence.
  • glycosylation often does not occur in bacterial hosts such as, for example, E. coli. Accordingly, when glycosylation is desired, a polypeptide should be expressed in a glycosylating host, generally a eukaryotic cell. Similar considerations apply to other modifications.
  • polypeptide encompasses all such modifications, particularly those that are present in polypeptides synthesized by expressing a polynucleotide in a host cell.
  • PROMOTER includes reference to a region of DNA upstream from the start of transcription and involved in recognition and binding of RNA polymerase and other proteins to initiate transcription.
  • a "plant promoter” is a promoter capable of initiating transcription in plant cells. Exemplary plant promoters include, but are not limited to, those that are obtained from plants, plant viruses, and bacteria which comprise genes expressed in plant cells, such as Agrobacterium or Rhizobium. Examples of promoters under developmental control include promoters that preferentially initiate transcription in certain tissues, such as leaves, roots, or seeds or spatially in regions such as endosperm, embryo, or meristematic regions. Such promoters are referred to as "tissue-preferred”.
  • tissue-specific Promoters that initiate transcription only in certain tissue are referred to as "tissue-specific".
  • a temporally regulated promoter drives expression at particular times, such as between 0-2 ⁇ days after pollination.
  • a "cell-type-preferred” promoter primarily drives expression in certain cell types in one or more organs, for example, vascular cells in roots or leaves.
  • An "inducible” promoter is a promoter that is under environmental control and may be inducible or de-repressible. Examples of environmental conditions that may effect transcription by inducible promoters include anaerobic conditions or the presence of light.
  • Tissue-specific, tissue- preferred, cell-type-specific, and inducible promoters constitute the class of "non- constitutive" promoters.
  • a "constitutive" promoter is a promoter that is active under most environmental conditions and in all or nearly all tissues, at all or nearly all stages of development.
  • RECOMBINANT EXPRESSION CASSETTE refers to a nucleic acid construct, generated recombinantly or synthetically, with a series of specified genetic elements that permit transcription of a particular nucleic acid in a host cell.
  • the recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment.
  • the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid to be transcribed, and a promoter, and may optionally comprise additional elements, such as an enhancer.
  • RELATED FEMALE REPRODUCTIVE TISSUE includes maternal plant tissues, such as female florets, ovaries, aleurone, pedicel, and pedicel-forming region, either pre-pollination or upon pollination. Pre-pollination seed tissues can also be referred to as "grain initials" or “seed initials”.
  • TRANSFORMATION is the process by which a cell is
  • Exogenous DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.
  • the exogenous DNA may be maintained on an episomal element, such as a plasmid.
  • a stably transformed or transfected cell is one in which the exogenous DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA.
  • VARIANT(S) of polynucleotides or polypeptides are polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide, respectively. Variants in this sense are described below and elsewhere in the present disclosure in greater detail. With reference to polynucleotides, generally, differences are limited such that the nucleotide sequences of the reference and the variant are closely similar overall and, in many regions, identical. As noted below, changes in the nucleotide sequence of the variant may be silent; that is, they may not alter the amino acids encoded by the polynucleotide.
  • a variant will encode a polypeptide with the same amino acid sequence as the reference.
  • changes in the nucleotide sequence of the variant may alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide.
  • Such nucleotide changes may result in one or more amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below.
  • differences are limited so that the sequences of the reference and the variant are closely similar overall and, in many regions, identical.
  • a variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.
  • VIGOR of a plant refers to the relative health, productivity, and rate of growth of the plant and/or of certain plant parts, and may be reflected in various developmental attributes, including, but not limited to, concentration of chlorophyll, photosynthetic rate, total biomass, root biomass, grain quality, and/or grain yield.
  • concentration of chlorophyll concentration of chlorophyll
  • photosynthetic rate total biomass
  • root biomass root biomass
  • grain quality grain quality
  • grain yield grain yield
  • vigor may also be reflected in ear growth rate, ear size, and/or expansiveness of silk exsertion. Vigor may be determined with reference to different genotypes under similar environmental conditions, or with reference to the same or different genotypes under different environmental conditions.
  • YIELD STABILITY refers to consistent yield performance of a given genotype across environments, including environments of stress.
  • This invention relates, in part, lo nucleic acid constructs useful for modulation of cytokinin activity in plants, including the temporal and/or spatial expression of cytokinin genes in seed and related female reproductive tissue, and to associated polynucleotides and polypeptides; variants and derivatives of these polynucleotides and polypeptides; processes for making these polynucleotides and these polypeptides, and their variants and derivatives; agonists and antagonists of the polypeptides; products comprising these polynucleotides and polypeptides, and their variants and derivatives; and uses of these polynucleotides, polypeptides, variants, derivatives, agonists and antagonists, and uses of the products comprising same.
  • the invention relates to polynucleotides and polypeptides of the cytokinin metabolic pathway, including the enzymes ipt and cytokinin oxidase and genes encoding same, and their use singly or in combination with each other and/or in combinations with various other isolated polynucleotides and polypeptides affecting cytokinin activity.
  • Targeted modulation of expression to improve plant vigor and seed yield is described.
  • the invention provides the reagents necessary for the development of transgenic plants characterized by enhanced cytokinin activity.
  • cytokinin activity is a relative one and refers to the cytokinin activity in a control plant without the cytokinin-affecting transgene as compared to a plant with such a functioning transgene.
  • the relative levels may also be measured employing only the transgenic plant but measured in the presence and absence of expression of the subject transgene. Accordingly, any structural gene, the regulated expression of which has the effect of enhancing cytokinin activity in plants, particularly seeds, is useful for the practice of this invention.
  • Genes that direct the expression of proteins that act to increase the biosynthesis of cytokinin may be used in the_practice of this invention. However, the use of other genes is also contemplated by this invention.
  • genes that affect the absolute levels of cytokinin genes that affect the ratio of cytokinin to auxin are also useful.
  • Auxin-lowering genes such as iaa-1 and gene- ⁇ may also be employed in the practice of this invention.
  • targeted modulation of expression of isolated polynucleotides encoding polypeptides involved in cytokinin recognition and cellular reponse may provide enhanced cytokinin activity as defined herein. Combinations of these approaches, comprising changes in expression of one or more cytokinin- modulating genes, are also contemplated.
  • the present invention relates to novel constructions of cytokinin metabolic polypeptides and polynucleotides encoding same, among other things, as described in greater detail below.
  • the polypeptides particularly useful for the practice of this invention include, but are not limited to, ipt and cytokinin oxidase.
  • nucleic acids, and fragments thereof, encoding the above-mentioned enzymes are useful to generate enzyme-producing transgenics.
  • a single gene or gene fragment may be incorporated into an appropriate expression cassette (using for example the globulin-1 [glbl] promoter for embryo-preferred expression, or the 27kd gamma zein promoter for endosperm- preferred expression in seed) and transformed into corn along with an appropriate selectable marker (such as the BAR and PAT genes).
  • Certain embodiments comprise a promoter driving expression in female reproductive meristematic tissue operably linked to a poynucleotide encoding a cytokinin biosynthetic enzyme. Examples of promoters useful in such an embodiment include zag2.1 , Zap (also known as ZmMADS), tb1 , and PCNA2, as shown in SEQ ID NOS: 3, 5, 17, and 25.
  • Certain embodiments may comprise both increased cytokinin biosynthesis and reduced cytokinin degradation to result in improved cytokinin activity.
  • the isolated polynucleotides of SEQ ID NOS: 26, 28, 30, and 32 which encode the cytokinin metabolic enzyme maize cytokinin oxidase, having the deduced amino acid sequences shown herein as SEQ ID NOS: 27, 29, 31 , and 33, as disclosed in co- pending provisional application, Cytokinin Oxidase-Like Sequences and Methods of
  • patent applications 10/310,191 maize led promoter, SEQ ID NO: 9 (U.S. Patent Application 09/718,754); maize F3.7 promoter, SEQ ID NO: 10 (Baszczynski et al., Maydica 42:189-201 (1997); maize tb1 promoter, SEQ ID NO: 17(Hubbarda et al., Genetics 162: 1927-1935, December 2002); maize eep2 promoter, SEQ ID NO: 18; maize thioredoxinH promoter, SEQ ID NO: 19, US provisional Patent Application 60/514,123); maize Zm40 promoter, SEQ ID NO: 20 (U.S.
  • Patent 6,403,862 and WO 01/2178 maize mUP15 promoter, SEQ ID NO: 23 (U.S. patent 6,479,734); maize ESR promoter, SEQ ID NO: 24 (U.S. application 10/786,679, filed February 25, 2004); maize PCNA2 promoter, SEQ ID NO: 25 (U.S. application 10/388,359 filed March 13, 2003); maize cytokinin oxidases and promoters, SEQ ID NOS: 26-37 (co-pending provisional application, Cytokinin Oxidase-Like Sequences and Methods of Use, 60/ , filed April 2, 2004).
  • the maize gene ZAG2 was isolated based on homology to the Arabidopsis
  • ZAG2 is normally expressed primarily in developing female florets.
  • the ZAG2 coding sequence and approximately 2.1 kb of ⁇ ' sequence were deposited in GenBank as accession no. X80206 in September 1995.
  • a portion of the ZAG2 5' region is included herein as SEQ ID NO: 3 and referred to as the ZAG2.1 promoter.
  • a polynucleotide of the present invention encoding cytokinin metabolic enzyme polypeptides may be obtained using standard cloning and screening procedures.
  • oligonucleotide primers can be synthesized that are complementary to the known polynucleotide sequence. These primers can then be used in PCR to amplify the polynucleotide from template derived from mRNA or genomic DNA isolated from the desired source material.
  • the resulting amplified products can then be cloned into commercially available cloning vectors, such as the TA series of vectors from InVitrogen.
  • cloning vectors such as the TA series of vectors from InVitrogen.
  • sequencing primers designed from the original sequence it is then possible to extend the sequence in both directions to determine the full gene sequence.
  • Such sequencing is performed using denatured double stranded DNA prepared from a plasmid clone. Suitable techniques are described by Maniatis, T., Fritsch, E.F. and Sambrook, J. in MOLECULAR CLONING, A Laboratory Manual (2nd edition 1989 Cold Spring Harbor Laboratory. See Sequencing Denatured Double-Stranded DNA Templates 13.70.
  • the isopentenyl transferases (ipts) of the present invention may be obtained from sources including, but not limited to, Zea mays, Agrobacterium, Psuedomonas savastano, Rhodococcus and Erwinia.
  • the complete sequence of an ipt gene is provided in Strabala,T.J., et al., Isolation and characterization of an ipt gene from the Ti plasmid Bo542, Mol. Gen. Genet. 216, 388-94 (1989).
  • a copy of such gene can be prepared synthetically employing DNA synthesis protocols well known to those skilled in the art of gene synthesis.
  • a copy of the gene may be isolated directly from an organism harboring an ipt gene, for example by PCR cloning as described in WO 00/63401 , herein incorporated by reference.
  • Polynucleotides of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced by chemical synthetic techniques or by a combination thereof.
  • the DNA may be double-stranded or single-stranded.
  • Single- stranded DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the antisense strand.
  • the coding sequence that encodes the polypeptide may be identical to the coding sequence of the polynucleotides shown below.
  • polypeptides shown below may be a polynucleotide with a different sequence, which, as a result of the redundancy (degeneracy) of the genetic code, encodes the polypeptides shown below. As discussed more fully below, these alternative coding sequences are an important source of sequences for codon optimization.
  • Polynucleotides of the present invention which encode the polypeptides listed below may include, but are not limited to, the coding sequence for the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional coding sequences, such as those encoding a leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to, non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription (including termination signals, for example), ribosome binding, mRNA stability elements, and additional coding sequences which encode additional amino acids, such as those which provide additional functionalities.
  • the DNA may also comprise promoter regions that function to direct the transcription of the DNA encoding heterologous cytokinin-modulating enzymes of this invention.
  • Heterologous is defined as a sequence that is not naturally occurring with the promoter sequence. While the nucleotide sequence is heterologous to the promoter sequence, it may be homologous (native) or heterologous (foreign) to the plant host.
  • the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide.
  • the marker sequence is a hexa-histidine peptide, such as the tag provided in the pQE vector (Qiagen, Inc.) and the pET series of vectors (Novagen), among others, many of which are commercially available.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • the HA tag may also be used to create fusion proteins and corresponds to an epitope derived of influenza hemagglutinin protein, which has been described by Wilson etal., Cell 37:767 (1984), for instance.
  • polynucleotide encoding a polypeptide encompasses polynucleotides which include a sequence encoding a polypeptide of the present invention, particularly cytokinin modulating enzymes having the amino acid sequences set out below.
  • the term encompasses polynucleotides that include a single continuous region or discontinuous regions encoding the polypeptide (for example, interrupted by integrated phage or insertion sequence or editing) together with additional regions that also may contain coding and/or non-coding-sequences.
  • the present invention further relates to variants of the present polynucleotides that encode for fragments, analogs and derivatives of the polypeptides having the deduced amino acid sequence below.
  • a variant of the polynucleotide may be a naturally occurring variant such as a naturally occurring allelic variant, or it may be a variant that is not known to occur naturally.
  • Such non-naturally-occurring variants of the polynucleotide may be made by mutagenesis techniques, including those applied to polynucleotides, cells or organisms.
  • variants in this regard are variants that differ from the aforementioned polynucleotides by nucleotide substitutions, deletions or additions.
  • the substitutions may involve one or more nucleotides.
  • the variants may be altered in coding or non- coding regions or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions.
  • polypeptides having the amino acid sequences set out below; variants, analogs, derivatives and fragments thereof.
  • polynucleotides encoding cytokinin biosynthetic enzyme variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments which have the amino acid sequences below in which several, a few, 1 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are substituted, deleted or added, in any combination.
  • polynucleotides that are greater than 79%, at least 80%, or at least 85% identical to a polynucleotide encoding a polypeptide having an amino acid sequence set out below, and polynucleotides that are complementary to such polynucleotides.
  • Certain embodiments are polynucleotides which encode polypeptides which retain substantially the same, or even exhibit a increase in, biological function or activity as compared to that of the mature polypeptide encoded by the polynucleotides set out below.
  • the present invention further relates to polynucleotides that hybridize to the herein above-described sequences.
  • the present invention especially relates to polynucleotides which hybridize under stringent conditions to the herein above-described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 80% identity between the sequences.
  • stringent conditions or “stringent hybridization conditions” include reference to conditions under which a probe will hybridize to its target sequence, to a detectably greater degree than to other sequences (e.g., at least 2- fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, often less than 500 nucleotides in length.
  • stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1 % SDS at 37°C, and a wash in 0.5X to 1X SSC at 65 to 60°C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1 X SSC at 60 to 65°C.
  • T m 81.5 °C + 16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
  • the T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T m is reduced by about 1 °C for each 1 % of mismatching; thus, T m , hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10 °C.
  • stringent conditions are selected to be about 5 °C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
  • Hybridization and/or wash conditions can be applied for at least 10, 30, 60, 90, 120, or 240 minutes.
  • polynucleotide assays of the invention may be used as a hybridization probe for RNA, cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encoding cytokinin biosynthetic enzymes and to isolate cDNA and genomic clones of other genes that have a high sequence similarity to the genes.
  • Such probes generally will comprise between about 15 and 50 bases.
  • polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of transgenic plants with modulated cytokinin activity.
  • the polynucleotides of the invention that are oligonucleotides derived from the sequences below may be used as PCR primers in the process herein described to determine whether or not the genes identified herein in whole or in part are transcribed in cytokinin accumulating tissue.
  • the polynucleotides may encode a polypeptide which is the mature protein plus additional amino or carboxyl-terminal amino acids, or amino acids interior to the mature polypeptide (when the mature form has more than one polypeptide chain, for instance).
  • Such sequences may play a role in processing of a protein from precursor to a mature form, may allow protein transport, may lengthen or shorten protein half- life or may facilitate manipulation of a protein for assay or production, among other things.
  • the additional amino acids may be processed away from the mature protein by cellular enzymes.
  • a precursor protein, having the mature form of the polypeptide fused to one or more prosequences, may be an inactive form of the polypeptide.
  • inactive precursors When prosequences are removed, such inactive precursors generally are activated. Some or all of the prosequences may be removed before activation. Generally, such precursors are called proproteins.
  • a polynucleotide of the present invention may encode a mature protein, a mature protein plus a leader sequence (which may be referred to as a preprotein), a precursor of a mature protein having one or more prosequences which are not the leader sequences of a preprotein, or a preproprotein, which is a precursor to a proprotein, having a leader sequence and one or more prosequences, which generally are removed during processing steps that produce active and mature forms of the polypeptide.
  • a leader sequence which may be referred to as a preprotein
  • a precursor of a mature protein having one or more prosequences which are not the leader sequences of a preprotein or a preproprotein, which is a precursor to a proprotein, having a leader sequence and one or more prosequences, which generally are removed during processing steps that produce active and mature forms of the polypeptide.
  • the present invention further relates to polypeptides that have the deduced amino acid sequences below.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide. In certain embodiments it is a recombinant polypeptide.
  • the invention also relates to fragments, analogs and derivatives of these polypeptides.
  • fragment when referring to the polypeptides, mean a polypeptide which retains at least 90% of, at least 95% of, or essentially the same biological function or activity as such polypeptide.
  • an analog includes a proprotein that can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • polypeptides having the amino acid sequence of cytokinin modulating enzymes set out below, variants, analogs, derivatives and fragments thereof, and variants, analogs and derivatives of the fragments.
  • the fragment, derivative or analog of the polypeptides below may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
  • a conserved or non-conserved amino acid residue preferably a conserved amino acid residue
  • substituted amino acid residue may or may not be one encoded by the genetic code
  • substitutions are those that vary from a reference by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and He; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg; and replacements among the aromatic residues Phe, Tyr.
  • variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments having the amino acid sequences below, in which several, a few, 1 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are substituted, deleted or added, in any combination.
  • silent substitutions, additions and deletions which do not alter the properties and activities of the cytokinin biosynthetic enzymes.
  • conservative substitutions are especially preferred.
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and may be purified to homogeneity.
  • the present invention also relates to vectors comprising the polynucleotides of the present invention, host cells that incorporate the vectors of the invention, and the production of polypeptides of the invention by recombinant techniques.
  • Vectors comprising the polynucleotides of the present invention, host cells that incorporate the vectors of the invention, and the production of polypeptides of the invention by recombinant techniques.
  • the vector may be, for example, a plasmid vector, a single or double-stranded phage vector, a single or double- stranded RNA or DNA viral vector.
  • Such vectors may be introduced into cells as polynucleotides, preferably DNA, by well known techniques for introducing DNA and RNA into cells.
  • the vectors in the case of phage and viral vectors, also may be and preferably are introduced into cells as packaged or encapsidated virus by well known techniques for infection and transduction.
  • Viral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
  • vectors are those for expression of polynucleotides and polypeptides of the present invention.
  • such vectors comprise cis-acting control regions effective for expression in a host, operably linked to the polynucleotide to be expressed.
  • Appropriate trans-acting factors are supplied by the host, supplied by a complementing vector or supplied by the vector itself upon introduction into the host.
  • the vectors provide for preferred expression.
  • Such preferred expression may be inducible expression or temporally limited or restricted to predominantly certain types of cells or any combination of the above.
  • Particularly preferred among inducible vectors are vectors that can be induced for expression by environmental factors that are easy to manipulate, such as temperature and nutrient additives.
  • vectors suitable to this aspect of the invention including constitutive and inducible expression vectors for use in prokaryotic and eukaryotic hosts, are well known and employed routinely by those of skill in the art.
  • Such vectors include, among others, chromosomal, episomal and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids and binaries used for ⁇ grot ⁇ cfe ⁇ u -mediated transformations. All may be used for expression in accordance with this aspect of
  • vectors which are commercially available, are provided by way of example.
  • vectors preferred for use in bacteria are pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
  • eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
  • Useful plant binary vectors include BIN19 and its derivatives available from Clontech. These vectors are listed solely by way of illustration of the many commercially available and well-known vectors that are available to those of skill in the art for use in accordance with this aspect of the present invention.
  • any other plasmid or vector suitable for, for example, introduction, maintenance, propagation or expression of a polynucleotide or polypeptide of the invention in a host may be used in this aspect of the invention, several of which are disclosed in more detail below.
  • expression constructs will contain sites for transcription initiation and termination, and, in the transcribed region, a ribosome-binding site for translation.
  • the coding portion of the mature transcripts expressed by the constructs will include a translation-initiating AUG at the beginning and a termination codon appropriately positioned at the end of the polypeptide to be translated.
  • constructs may contain control regions that regulate as well as engender expression.
  • regions will operate by controlling transcription, such as transcription factors, repressor binding sites and termination signals, among others.
  • transcription factors such as transcription factors, repressor binding sites and termination signals, among others.
  • appropriate secretion signals may be incorporated into the expressed polypeptide. These signals may be endogenous to the polypeptide or they may be heterologous signals.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act to increase transcriptional activity of a promoter in a given host cell-type.
  • enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • Additional enhancers useful in the invention to increase transcription of the introduced DNA segment include, inter alia, viral enhancers like those within the 35S promoter, as shown by Odell et al., Plant Mol. Biol. 10:263-72 (1988), and an enhancer from an opine gene as described by Fromm etal., Plant Cell 1 :977 (1989).
  • the enhancer may affect the tissue-specificity and/or temporal specificity of expression of sequences included in the vector.
  • a construct may comprise the CaMV 35s enhancer (SEQ ID NO: 4) in a "head to head” orientation with respect to the zag2.1 promoter (SEQ ID NO: 3) driving ipt (SEQ ID NO: 1).
  • Termination regions also facilitate effective expression by ending transcription at appropriate points.
  • Useful terminators for practicing this invention include, but are not limited to, pinll (See An et al., Plant Cell 1 (1 ):115-122 (1989)), glbl (See Genbank Accession #L22345), gz (See gzw64a terminator, Genbank Accession #S78780), and the nos terminator from Agrobacterium.
  • eukaryotic promoters suitable for generalized expression are the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous sarcoma virus ("RSV"), metallothionein promoters, such as the mouse metallothionein-l promoter and various plant promoters, such as globulin-1.
  • RSV Rous sarcoma virus
  • metallothionein promoters such as the mouse metallothionein-l promoter
  • various plant promoters such as globulin-1.
  • prokaryotic promoters include the phage lambda PL promoter, the E. coli lac, trp and tac promoters to name just a few of the well-known promoters.
  • seed-preferred promoters include promoters of seed storage proteins which express these proteins in seeds in a highly regulated manner (Thompson, et al.; BioEssays;. 10:108 (1989)), such as, for dicotyledonous plants, a bean ⁇ -phaseolin promoter, a napin promoter, a ⁇ - conglycinin promoter, and a soybean lectin promoter.
  • promoters useful in the practice of the invention include, but are not limited to, a maize 15 kD zein promoter, a 22 kD zein promoter, a 27Kd ⁇ -zein promoter (such as gzw64A promoter, see Genbank Accession #S78780), a waxy promoter, a shrunken-1 promoter, a globulin 1 promoter (See Genbank Accession # L22344), an Itp2 promoter (Kalla, et al., Plant Journal 6:849-860 (1994); U.S. Patent 5,525,716), ciml promoter (see U.S.
  • Patent 6,225,529) maize endl and end2 promoters (See U.S. patent 6,528,704 and application 10/310,191 , filed December 4, 2002); nud promoter (U.S. patent 6,407,315); Zm40 promoter (U.S. patent 6,403,862); eepl (SEQ ID NO: 7) and eep2 (SEQ ID NO: 18); led (U.S. patent application 09/718,754); thioredoxinH promoter (U.S. provisional patent application 60/514,123J; mlip15 promoter (U.S. patent 6,479,734); PCNA2 promoter, SEQ ID NO: 25; and the shrunken-2 promoter.
  • nud promoter U.S. patent 6,407,315)
  • Zm40 promoter U.S. patent 6,403,862
  • eepl SEQ ID NO: 7
  • eep2 SEQ ID NO: 18
  • led U.S. patent application
  • nucellain promoter See C. Linnestad, et al., Nucellain, A Barley Homolog of the Dicot Vacuolar - Processing Proteasem Is Localized in Nucellar Cell Walls, Plant Physiol. 118:1169-80 (1998), kn1 promoter (See S. Hake and N.
  • temporally-acting promoters are also contemplated by this invention. Promoters that act from 0-25 days after pollination (DAP) are preferred, as are those acting from 4-21 , 4-12, or 8-12 DAP. In this regard, promoters such as ciml and Itp2 are preferred. Promoters that act from -14 to 0 days after pollination can also be used, such as SAG 12 (See WO 96/29858, Richard M. Amasino, published 3 Oct. 1996) and ZAG1 or ZAG2 (See R.J.
  • Useful promoters include maize zag2.1 (SEQ ID NO: 3), Zap (SEQ ID NO: 5, also known as ZmMADS; US patent application 10/387,937; WO 03/078590); maize tb1 promoter (SEQ ID NO: 17; see also Hubbarda et al., Genetics 162:1927-1935, 2002).
  • promoters for generalized expression in plants are the promoter for the small subunit of ribulose-1 ,5-bis-phosphate carboxylase, promoters from tumor-inducing plasmids of Agrobacterium tumefaciens, such as the nopaline synthase and octopine synthase promoters, and viral promoters such as the cauliflower mosaic virus (CaMV) 19S and 35S promoters or the figwort mosaic virus 3 ⁇ S promoter.
  • CaMV cauliflower mosaic virus
  • Vectors for propagation and expression generally will include selectable markers. Such markers also may be suitable for amplification or the vectors may contain additional markers for this purpose.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells.
  • Preferred markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, and tetracycline or ampicillin resistance genes for culturing E. coli and other prokaryotes. Kanamycin and herbicide resistance genes (PAT and BAR) are generally useful in plant systems.
  • Selectable marker genes in physical proximity to the introduced DNA segment, are used to allow transformed cells to be recovered by either positive genetic selection or screening.
  • the selectable marker genes also allow for maintaining selection pressure on a transgenic plant population, to ensure that the introduced DNA segment, and its controlling promoters and enhancers, are retained by the transgenic plant.
  • positive selectable marker genes for plant transformation have been isolated from bacteria and code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or a herbicide.
  • Other positive selection marker genes encode an altered target which is insensitive to the inhibitor.
  • selection marker gene for plant transformation is the BAR or PAT gene, which is used with the selecting agent bialaphos. Spencer et al., J. Theor. Appl'd Genetics 79:625-631 (1990).
  • Another useful selection marker gene is the neomycin phosphotransferase II (nptll) gene, isolated from Tn5, which confers resistance to kanamycin when placed under the control of plant regulatory signals. Fraley et al., Proc. Nat'l Acad. Sci. (USA) 80:4803 (1983).
  • the hygromycin phosphotransferase gene which confers resistance to the antibiotic hygromycin, is a further example of a useful selectable marker.
  • Additional positive selectable marker genes of bacterial origin that confer resistance to antibiotics include gentamicin acetyl transferase, streptomycin phosphotransferase, aminoglycoside-3'-adenyl transferase and the bleomycin resistance determinant. Hayford et al., Plant Physiol. 86:1216 (1988); Jones et al., Mol. Gen. Genet. 210:86 (1987); Svab et al., Plant Mol. Biol. 14:197 (1990); Hille et al.. Plant Mol. Biol. 7:171 (1986).
  • Other positive selectable marker genes for plant transformation are not of bacterial origin. These genes include mouse dihydrofolate reductase, plant 5-enolpyruvylshikimate-3-phosphate synthase and plant acetolactate synthase. Eichholtz et al., Somatic Cell Mol. Genet. 13:67 (1987); Shah et al., Science 233:478 (1986); Charest et al., Plant Cell Rep. 8:643 (1990).
  • Another class of useful marker genes for plant transformation with the DNA sequence requires screening of presumptively transformed plant cells rather than direct genetic selection of transformed cells for resistance to a toxic substance such as an antibiotic.
  • genes are particularly useful to quantitate or visualize the spatial pattern of expression of the DNA sequence in specific tissues and are frequently referred to as reporter genes because they can be fused to a gene or gene regulatory sequence for the investigation of gene expression.
  • reporter genes Commonly used genes for screening presumptively transformed cells include ⁇ -glucuronidase (GUS), ⁇ - galactosidase, luciferase, and chloramphenicol acetyltransferase. Jefferson, Plant Mol. Biol. Rep. 5:387 (1987); Teeri et al., EMBO J. 8:343 (1989); Koncz et al., Proc. Nat'l Acad. Sci.
  • the appropriate DNA sequence may be inserted into the vector by any of a variety of well-known and routine techniques.
  • a DNA sequence for expression is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction endonucleases and then joining the restriction fragments together using T4 DNA ligase.
  • the sequence may be inserted in a forward or reverse orientation. Procedures for restriction and ligation that can be used to this end are well known and routine to those of skill.
  • a polynucleotide of the invention encoding the heterologous structural sequence of a polypeptide of the invention, generally will be inserted into the vector using standard techniques so that it is operably linked to the promoter for expression.
  • the polynucleotide will be positioned so that the transcription start site is located appropriately 5' to a ribosome binding site.
  • the ribosome-binding site will be ⁇ ' to the AUG that initiates translation of the polypeptide to be expressed.
  • the vector containing the appropriate DNA sequence as described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences, may be introduced into an appropriate host using a variety of well-known techniques suitable to expression therein of a desired polypeptide.
  • the present invention also relates to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a plant cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction, infection or other methods.
  • Such methods are described in many standard laboratory manuals, such as Davis et al., BASIC METHODS IN MOLECULAR BIOLOGY, (1986) and Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
  • Representative examples of appropriate hosts include bacterial cells, such as streptococci, staphylococci, E.
  • the plant cells may be derived from a broad range of plant types, particularly monocots such as the species of the Family Graminiae including Sorghum bicolor and Zea mays, as well as dicots such as soybean (Glycine max) and canola (Brassica napus, Brassica rapa ssp.).
  • plants include maize, soybean, sunflower, safflower, canola, wheat, barley, rye, alfalfa, and sorghum; however, the isolated nucleic acid and proteins of the present invention can be used in species from the genera: Ananas, Antirrhinum, Arabidopsis, Arachis, Asparagus, Atropa, Avena, Brassica, Bromus, Browaalia, Camellia, Capsicum, Ciahorium, Citrus, Cocos, Cofea, Cucumis, Cucurbita, Datura, Daucus, Digitalis, Ficus, Fragaria, Geranium, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Ipomoea, Juglans, Lactuca, Linum, Lolium, Lotus, Lycopersicon, Majorana, Mangifera, Manihot, Medicago, Musa, Ne
  • the promoter regions of the invention may be isolated from any plant, including, but not limited to, maize (corn; Zea mays), canola (Brassica napus, Brassica rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annuus), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma
  • plants include maize, soybean, sunflower, safflower, canola, wheat, barley, rye, alfalfa, and sorghum.
  • Hosts for a great variety of expression constructs are well known, and those of skill will be enabled by the present disclosure readily to select a host for expressing a polypeptide in accordance with this aspect of the present invention.
  • the engineered host cells can be cultured in conventional nutrient media, which may be modified as appropriate for, inter alia, activating promoters, selecting transformants or amplifying genes.
  • Culture conditions such as temperature, pH and the like, previously used with the host cell selected for expression generally will be suitable for expression of polypeptides of the present invention as will be apparent to those of skill in the art.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents; such methods are well know to those skilled in the art. Plant Transformation Methods:
  • Isolated nucleic acid acids of the present invention can be introduced into plants according to techniques known in the art. Generally, recombinant expression cassettes as described above and suitable for transformation of plant cells are prepared. Techniques for transforming a wide variety of higher plant species are well known and described in the technical, scientific, and patent literature. See, for example, Weising et al., Ann. Rev. Genet. 22: 421-477 (1988).
  • the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation, PEG poration, particle bombardment, silicon fiber delivery, or microinjection of plant cell protoplasts or embryogenic callus.
  • the DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector.
  • the virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria. See, U.S. Patent No. 5,691 ,616.
  • the introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski et al., Embo J. 3: 2717-2722 (1984). Electroporation techniques are described in Fromm et al., Proc. Natl. Acad. Sci (USA) 82: 5824 (1985).
  • Agrobacterium tumefaciens-medltated transformation techniques are well described in the scientific literature. See, for example Horsch et al., Science 233: 496-498 (1984), and Fraley et al., Proc. Natl. Acad. Sci(USA) 80: 4803 (1983). Although Agrobacterium is useful primarily in dicots, certain monocots can be transformed by Agrobacterium. For instance, Agrobacterium transformation of maize is described in U.S. Patent No. 5,550,318.
  • tumefaciens vectors pARC ⁇ or pARC16 (2) liposome-mediated DNA uptake (see, e.g., Freeman et al., Plant Cell Physiol. 25: 1353, 1984), (3) the vortexing method (see, e.g., Kindle, Proc. Nat'l. Acad. Sci.(USA) 87: 1228, (1990).
  • DNA can also be introduced into plants by direct DNA transfer into pollen as described by Zhou et al., Methods in Enzymology, 101 :433 (1983); D. Hess, Intern. Rev. CytoL, 107:367 (1987); Luo et al., Plant Mol. Biol. Reporter, 6:165(1988).
  • Expression of polypeptide coding genes can be obtained by injection of the DNA into reproductive organs of a plant as described by Pena et al., Nature 325:274 (1987).
  • DNA can also be injected directly into the cells of immature embryos and the rehydration of desiccated embryos as described by Neuhaus et al., Theor. Appl.
  • CiMV cauliflower mosaic virus
  • geminivirus a variety of plant viruses that can be employed as vectors are known in the art and include cauliflower mosaic virus (CaMV), geminivirus, brome mosaic virus, and tobacco mosaic virus.
  • Transformed plant cells that are derived by any of the above transformation techniques can be cultured to regenerate a whole plant that possesses the transformed genotype.
  • Such regeneration techniques often rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker that has been introduced together with a polynucleotide of the present invention.
  • Plants cells transformed with a plant expression vector can be regenerated, e.g., from single cells, callus tissue or leaf discs according to standard plant tissue culture techniques. It is well known in the art that various cells, tissues, and organs from almost any plant can be successfully cultured to regenerate an entire plant.
  • Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, Macmillilan Publishing Company, New York, pp. 124-176 (1983); and Binding, Regeneration of Plants, Plant Protoplasts, CRC Press, Boca Raton, pp. 21-73 (1985).
  • Transgenic plants of the present invention may be fertile or sterile.
  • Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. Such regeneration techniques are described generally in Klee et al., Ann. Rev, of Plant Phys. 38: 467-486 (1987). The regeneration of plants from either single plant protoplasts or various explants is well known in the art. See, for example, Methods for Plant Molecular Biology, A. Weissbach and H. Weissbach, eds., Academic Press, Inc., San Diego, Calif. (1988). This regeneration and growth process includes the steps of selection of transformant cells and shoots, rooting the transformant shoots and growth of the plantlets in soil.
  • the recombinant expression cassette is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.
  • mature transgenic plants can be propagated by the taking of cuttings or by tissue culture techniques to produce multiple identical plants. Selection of desirable transgenics is made and new varieties are obtained and propagated vegetatively for commercial use.
  • mature transgenic plants can be self-crossed to produce a homozygous inbred plant. The inbred plant produces seed containing the newly introduced heterologous nucleic acid. These seeds can be grown to produce plants that would produce the selected phenotype. Mature transgenic plants can also be crossed with other appropriate plants, generally another inbred or hybrid, including, for example, an isogenic untransformed inbred.
  • Parts obtained from the regenerated plant such as flowers, seeds, leaves, branches, fruit, and the like are included in the invention, provided that these parts comprise cells comprising the isolated nucleic acid of the present invention.
  • Progeny and variants, and mutants of the regenerated plants are also included within the scope of the invention, provided that these plants comprise the introduced nucleic acid sequences.
  • Transgenic plants expressing the selectable marker can be screened for transmission of the nucleic acid of the present invention by, for example, standard immunoblot and DNA detection techniques. Transgenic lines are also typically evaluated on levels of expression of the heterologous nucleic acid. Expression at the RNA level can be determined initially to identify and quantitate expression- positive plants. Standard techniques for RNA analysis can be employed and include PCR amplification assays using oligonucleotide primers designed to amplify only the heterologous RNA templates and solution hybridization assays using heterologous nucleic acid-specific probes. The RNA-positive plants can then be analyzed for protein expression by Western immunoblot analysis using the specifically reactive antibodies of the present invention.
  • in situ hybridization and immunocytochemistry can be done using heterologous nucleic acid specific polynucleotide probes and antibodies, respectively, to localize sites of expression within transgenic tissue.
  • a number of transgenic lines are usually screened for the incorporated nucleic acid to identify and select plants with the most appropriate expression profiles.
  • Some embodiments comprise a transgenic plant that is homozygous for the added heterologous nucleic acid; i.e., a transgenic plant that contains two added nucleic acid sequences, one gene at the same locus on each chromosome of a chromosome pair.
  • a homozygous transgenic plant can be obtained by sexually mating (selfing) a heterozygous (aka hemizygous) transgenic plant that contains a single added heterologous nucleic acid, germinating some of the seed produced and analyzing the resulting plants produced for altered expression of a polynucleotide of the present invention relative to a control plant (i.e., native, non- transgenic).
  • a control plant i.e., native, non- transgenic
  • This invention is also related to the use of the cytokinin biosynthetic enzyme polynucleotides in markers to assist in a breeding program, as described for example in PCT publication US89/00709.
  • the DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al., Nature 324:163-166 (1986)) prior to analysis.
  • RNA or cDNA may also be used in the same ways.
  • PCR primers complementary to the nucleic acid encoding the cytokinin biosynthetic enzymes can be used to identify and analyze cytokinin biosynthetic enzyme presence and expression.
  • characterization of the gene present in a particular tissue or plant variety may be made by an analysis of the genotype of the tissue or variety. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the genotype of a reference sequence.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled cytokinin biosynthetic enzyme RNA or alternatively, radiolabeled cytokinin biosynthetic enzyme antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures. Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing.
  • cloned DNA segments may be employed as probes to detect specific DNA segments.
  • the sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method.
  • a sequencing primer is used with double- stranded PCR product or a single-stranded template molecule generated by a modified PCR.
  • the sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent tags.
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science, 230:1242 (1985)).
  • Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e.g., Cotton et al., Proc. Nat'l. Acad. Sci., (USA), 85:4397-4401 (1985)).
  • nuclease protection assays such as RNase and S1 protection or the chemical cleavage method (e.g., Cotton et al., Proc. Nat'l. Acad. Sci., (USA), 85:4397-4401 (1985)).
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., restriction fragment length polymorphisms ("RFLP")) and Southern blotting of genomic DNA.
  • restriction enzymes e.g., restriction fragment length polymorphisms ("RFLP")
  • RFLP restriction fragment length polymorphisms
  • mutations also can be detected by in situ analysis.
  • a mutation may be ascertained, for example, by a DNA sequencing assay.
  • First strand cDNA is synthesized from the RNA samples by adding an oligonucleotide primer consisting of sequences that hybridize to a region on the mRNA. Reverse transcriptase and deoxynucleotides are added to allow synthesis of the first strand cDNA.
  • Primer sequences are synthesized based on the DNA sequences of the cytokinin modulating enzymes of the invention.
  • the primer sequence is generally comprised of at least 15 consecutive bases, and may contain at least 30 or even 50 consecutive bases.
  • Cells carrying mutations or polymorphisms in the gene of the present invention may also be detected at the DNA level by a variety of techniques.
  • the DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis.
  • RT-PCR can also be used to detect mutations. It is particularly preferred to use RT-PCR in conjunction with automated detection systems, such as, for example, GeneScan.
  • RNA or cDNA may also be used for the same purpose, PCR or RT-PCR.
  • PCR primers complementary to the nucleic acid encoding cytokinin biosynthetic enzymes can be used to identify and analyze mutations.
  • deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA, or alternatively, radiolabeled antisense DNA sequences. While perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures, preferably point mutations are identified by sequence analysis. Primers used for detection of mutations or polymorphisms in the ipt gene: 5'GCGTCCAATGCTGTCCTCAACTA 3' ⁇ 'GCTCTCCTCGTCTGCTAACTCGT3'
  • the above primers may be used for amplifying cytokinin biosynthetic enzyme cDNA or genomic clones isolated from a sample derived from an individual plant.
  • the invention also provides the primers above with 1 , 2, 3 or 4 nucleotides removed from the ⁇ ' and/or the 3' end.
  • the primers may be used to amplify the gene isolated from the individual such that the gene may then be subject to various techniques for elucidation of the DNA sequence. In this way, mutations in the DNA sequence may be identified.
  • the present invention also relates to diagnostic assays such as quantitative and diagnostic assays for detecting levels of cytokinin biosynthetic enzymes in cells and tissues, including determination of normal and abnormal levels.
  • diagnostic assays such as quantitative and diagnostic assays for detecting levels of cytokinin biosynthetic enzymes in cells and tissues, including determination of normal and abnormal levels.
  • a diagnostic assay in accordance with the invention for detecting expression of cytokinin biosynthetic enzymes compared to normal control tissue samples may be used to detect unacceptable levels of expression.
  • Assay techniques that can be used to determine levels of polypeptides of the present invention in a sample derived from a plant source are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays. Among these, ELISAs frequently are preferred.
  • An ELISA assay initially comprises preparing an antibody specific to the polypeptide, preferably a monoclonal antibody.
  • a reporter antibody generally is prepared which binds to the monoclonal antibody.
  • the reporter antibody is attached to a detectable reagent such as a radioactive, fluorescent or enzymatic reagent, in this example horseradish peroxidase enzyme.
  • a sample is removed from a host and incubated on a solid support, e.g., a polystyrene dish, which binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin.
  • a non-specific protein such as bovine serum albumin.
  • the monoclonal antibody is incubated in the dish, during which time the monoclonal antibodies attach to any cytokinin biosynthetic enzymes attached to the polystyrene dish. Unbound monoclonal antibody is washed out with buffer.
  • the reporter antibody linked to horseradish peroxidase is placed in the dish, resulting in binding of the reporter antibody to any monoclonal antibody bound to cytokinin biosynthetic enzyme. Unattached reporter antibody is then washed out. Reagents for peroxidase activity, including a colorimetric substrate, are then added to the dish. Immobilized peroxidase, linked to cytokinin biosynthetic enzyme through the primary and secondary antibodies, produces a colored reaction product. The amount of color developed in a given time period indicates the amount of cytokinin biosynthetic enzyme present in the sample. Quantitative results typically are obtained by reference to a standard curve.
  • a competition assay may be employed wherein antibodies specific to cytokinin biosynthetic enzymes are attached to a solid support, and labeled enzyme derived from the host ispassed over the solid support. The amount of label detected attached to the solid support can be correlated to a quantity of cytokinin biosynthetic enzyme in the sample.
  • polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as immunogens to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal, or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptide can be used to generate antibodies binding the whole native polypeptide. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide. For preparation of monoclonal antibodies, any technique that provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G.
  • Hybridoma cell lines secreting the monoclonal antibody are another aspect of this invention.
  • Patent No. 4,946,778 can be adapted to produce single-chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice, or other organisms such as other mammals, may be used to express humanized antibodies to immunogenic polypeptide products of this invention.
  • polypeptide derivatives include antigenically or immunologically equivalent derivatives that form a particular aspect of this invention.
  • 'antigenically equivalent derivative' encompasses a polypeptide or its equivalent which will be specifically recognized by certain antibodies which, when raised to the protein or polypeptide according to the present invention, interfere with the immediate physical interaction between the antibody and its cognate antigen.
  • immunologically equivalent derivative encompasses a peptide or its equivalent which, when used in a suitable formulation to raise antibodies in a vertebrate, results in antibodies which act to interfere with the immediate physical interaction between the antibody and its cognate antigen.
  • the polypeptide such as an antigenically or immunologically equivalent derivative or a fusion protein thereof, is used as an antigen to immunize a mouse or other animal, such as a rat, guinea pig, goat, rabbit, sheep, bovine or chicken.
  • the fusion protein may provide stability to the polypeptide.
  • the antigen may be associated, for example by conjugation, with an immunogenic carrier protein, for example bovine serum albumin (BSA) or keyhole limpet haemocyanin (KLH).
  • BSA bovine serum albumin
  • KLH keyhole limpet haemocyanin
  • a multiple antigenic peptide comprising multiple copies of the protein or polypeptide, or an antigenically or immunologically equivalent polypeptide thereof, may be sufficiently antigenic to improve immunogenicity so as to obviate the use of a carrier.
  • phage display technology could be utilized to select antibody genes with binding activities towards the polypeptide either from repertoires of PCR amplified v-genes of lymphocytes from humans screened for possessing anti-Fbp or from naive libraries (McCafferty, J. et al., (1990), Nature 348:552-654; Marks, J. et al., (1992) Biotechnology 10:779-783).
  • the affinity of these antibodies can also be improved by chain shuffling (Clackson, T. et al., (1991 ) Nature 352:624-628). The antibody should be screened again for high affinity to the polypeptide and/or fusion protein.
  • a fragment of the final antibody may be prepared.
  • the antibody may be either intact antibody of M r approximately 150,000 or a derivative of it, for example a Fab fragment or a Fv fragment as described in Sierra, A and Pluckthun, A., Science 240:1038-1040 (1988). If two antigen binding domains are present, each domain may be directed against a different epitope - termed 'bispecific' antibodies.
  • the antibody of the invention may be prepared by conventional means, for example by established monoclonal antibody technology (Kohler, G. and Milstein, C, Nature, 256:495-497 (1975)) or using recombinant means e.g. combinatorial libraries, for example as described in Huse, W.D. et al.,
  • the antibody is prepared by expression of a DNA polymer encoding said antibody in an appropriate expression system such as described above for the expression of polypeptides of the invention.
  • the choice of vector for the expression system will be determined in part by the host, which may be a prokaryotic cell, such as E. coli (preferably strain B) or Streptomyces sp. or a eukaryotic cell, such as a mouse C127, mouse myeloma, human HeLa, Chinese hamster ovary, filamentous or unicellular fungi or insect cell.
  • the host may also be a transgenic animal or a transgenic plant for example as described in Hiatt, A. et al., Nature 340:76-78 (1989).
  • Suitable vectors include plasmids, bacteriophages, cosmids and recombinant viruses, derived from, for example, baculoviruses and vaccinia.
  • the Fab fragment may also be prepared from its parent monoclonal antibody by enzyme treatment, for example using papain to cleave the Fab portion from the Fc portion.
  • This invention also provides a method for identification of molecules, such as binding molecules, that bind the cytokinin biosynthetic enzymes.
  • Genes encoding proteins that bind the enzymes, such as binding proteins can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. Such methods are described in many laboratory manuals such as, for instance, Coligan et al., Current Protocols in Immunology 1(2): Chapter 5 (1991 ).
  • polyadenylated RNA is prepared from a cell expressing the cytokinin biosynthetic enzymes, a cDNA library is created from this RNA, the library is divided into pools, and the pools are transfected individually into cells that are not expressing the enzyme. The transfected cells then are exposed to labeled enzyme.
  • the enzyme can be labeled by a variety of well-known techniques, including standard methods of radio-iodination or inclusion of a recognition site for a site-specific protein kinase. Following exposure, the cells are fixed and binding of enzyme is determined. These procedures conveniently are carried out on glass slides.
  • a labeled ligand can be photoaffinity linked to a cell extract, such as a membrane or a membrane extract, prepared from cells that express a molecule that it binds, such as a binding molecule.
  • Cross-linked material is resolved by polyacrylamide gel electrophoresis ("PAGE") and exposed to X-ray film.
  • the labeled complex containing the ligand-binding can be excised, resolved into peptide fragments, and subjected to protein microsequencing.
  • the amino acid sequence obtained from microsequencing can be used to design unique or degenerate oligonucleotide probes to screen cDNA libraries to identify genes encoding the putative binding molecule.
  • Polypeptides of the invention also can be used to assess cytokinin biosynthetic enzyme binding capacity of cytokinin biosynthetic enzyme binding molecules, such as binding molecules, in cells or in cell-free preparations.
  • Polypeptides of the invention may also be used to assess the binding of small molecule substrates and ligands in, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures.
  • substrates and ligands may be natural substrates and ligands or may be structural or functional mimetics.
  • Anti-cytokinin biosynthetic enzyme antibodies represent a useful class of binding molecules contemplated by this invention. Antagonists and Agonists - Assays and Molecules
  • the invention also provides a method of screening compounds to identify those that enhance or block the action of cytokinin biosynthetic enzymes on cells, such as interaction with substrate molecules.
  • An antagonist is a compound that decreases the natural biological functions of the enzymes.
  • a particular enzyme to be targeted in this regard is cytokinin oxidase.
  • Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to cytokinin oxidase and thereby inhibit or extinguish its activity. Potential antagonists also may be small organic molecules, a peptide, a polypeptide such as a closely related protein or antibody, that binds the same sites on a binding molecule, such as a cytokinin oxidase binding molecule, without inducing cytokinin metabolic enzyme-induced activities, thereby preventing the action of the enzyme by excluding the enzyme from binding.
  • Potential antagonists include a small molecule that binds to and occupies the binding site of the polypeptide thereby preventing binding to cellular binding molecules, such as binding molecules, such that normal biological activity is prevented.
  • small molecules include but are not limited to small organic molecules, peptides or peptide-like molecules.
  • cytokinin biosynthetic enzymes e.g. transactivation inhibitors
  • Other potential antagonists include antisense molecules.
  • Antisense technology can be used to control gene expression through antisense DNA or RNA or through double- or triple-helix formation. Antisense techniques are discussed, for example, in - Okano, J. Neurochem. 56: 560 (1991); OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION, CRC Press, Boca Raton, FL (1988).
  • Triple helix formation is discussed in, for instance Lee et al., Nucleic Acids Research 3:173 (1979); Cooney et al., Science 241:456 (1988); and Dervan et al., Science 251 :1360 (1991).
  • the methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription, thereby preventing transcription and the production of cytokinin biosynthetic enzymes.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into cytokinin biosynthetic enzymes.
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of cytokinin biosynthetic enzymes.
  • the DNAs of this invention may also be employed to co-suppress or silence the cytokinin metabolic enzyme genes; for example, as described in PCT Patent Application Publication WO 98/36083.
  • the antagonists may be employed for instance to increase the levels of cytokinin and/or decrease the available auxin in plant cells.
  • this invention provides methods for screening for agonists, those molecules that act to increase the natural biological function of enzymes.
  • Targets in this regard include enzymes such ipt, ⁇ -glucosidase, and iaa-1.
  • Potential agonists include small organic molecules, peptides, polypeptides and antibodies that bind to a biosynthetic enzyme and thereby stimulate or increase its activity. Potential agonists also may be small organic molecules, a peptide, a polypeptide such as a closely related protein or antibody that binds to sites on a binding molecule, such as a ipt binding molecule and promotes cytokinin metabolic enzyme-induced activities, thereby enhancing the action of the enzyme.
  • Potential agonists include small molecules that bind to and occupy the allosteric sites of the enzyme thereby promoting binding to cellular binding molecules, such as substrates, such that normal biological activity is enhanced.
  • small molecules include but are not limited to small organic molecules, peptides or peptide-like molecules.
  • Other potential agonists include molecules that affect the expression of the gene encoding cytokinin biosynthetic enzymes (e.g. transactivatiors).
  • nucleic acid sequences of the present invention can be used in combination ("stacked") with other polynucleotide sequences of interest in order to create plants with a desired phenotype.
  • the polynucleotides of the present invention may be stacked with any gene or combination of genes, and the combinations generated can include multiple copies of any one or more of the polynucleotides of interest.
  • the desired combination may affect one or more traits; that is, certain combinations may be created for modulation of gene expression affecting cytokinin activity. For example, up-regulation of cytokinin synthesis may be combined with down-regulation of cytokinin oxidase expression.
  • Other combinations may be designed to produce plants with a variety of desired traits, including but not limited to traits desirable for animal feed such as high oil genes (e.g., U.S. Patent No. 6,232,529); balanced amino acids (e.g. hordothionins (U.S. Patent Nos. 5,990,389; 5,885,801 ; 5,885,802; and 5,703,409); barley high lysine (Williamson et al. (1987) Eur. J. Biochem. 165:99-106; and WO 98/20122); and high methionine proteins (Pedersen et al. (1986) J. Biol. Chem. 261 :6279; Kirihara et al.
  • traits desirable for animal feed such as high oil genes (e.g., U.S. Patent No. 6,232,529); balanced amino acids (e.g. hordothionins (U.S. Patent Nos. 5,990,389; 5,885,
  • polynucleotides of the present invention can also be stacked with traits desirable for insect, disease or herbicide resistance (e.g., Bacillus thuringiensis toxic proteins (U.S. Patent Nos.
  • acetolactate synthase (ALS) mutants that lead to herbicide resistance such as the S4 and/or Hra mutations
  • inhibitors of glutamine synthase such as phosphinothricin or basta (e.g., bar gene); and glyphosate resistance (EPSPS gene)
  • traits desirable for processing or process products such as high oil (e.g., U.S. Patent No. 6,232,529 ); modified oils (e.g., fatty acid desaturase genes (U.S. Patent No.
  • modified starches e.g., ADPG pyrophosphorylases (AGPase), starch synthases (SS), starch branching enzymes (SBE) and starch debranching enzymes (SDBE)
  • polymers or bioplastics e.g., U.S. patent No. 5.602, 321 ; beta-ketothiolase, polyhydroxybutyrate synthase, and acetoacetyl-CoA reductase (Schubert et al. (1988) J. Bacteriol. 170:5837-6847) facilitate expression of polyhydroxyalkanoates (PHAs)), the disclosures of which are herein incorporated by reference.
  • polynucleotides of the present invention with polynucleotides affecting agronomic traits such as male sterility (e.g., see U.S. Patent No. ⁇ .583,210), stalk strength, flowering time, or transformation technology traits such as cell cycle regulation or gene targeting (e.g. WO 99/61619; WO 00/17364; WO 99/26821), the disclosures of which are herein incorporated by reference.
  • stacked combinations can be created by any method, including but not limited to cross breeding plants by any conventional or TopCross methodology, or genetic transformation. If the traits are stacked by genetically transforming the plants, the polynucleotide sequences of interest can be combined at any time and in any order.
  • a transgenic plant comprising one or more desired traits can be used as the target to introduce further traits by subsequent transformation.
  • the traits can be introduced simultaneously in a co-transformation protocol with the polynucleotides of interest provided by any combination of transformation cassettes.
  • the two sequences can be contained in separate transformation cassettes (trans) or contained on the same transformation cassette (cis).
  • Expression of the sequences of interest can be driven by the same promoter or by different promoters.
  • the transformed plants of the invention may be used in a plant breeding program.
  • the goal of plant breeding is to combine, in a single variety or hybrid, various desirable traits.
  • these traits may include, for example, resistance to diseases and insects, tolerance to heat and drought, reduced time to crop maturity, greater yield, and better agronomic quality.
  • uniformity of plant characteristics such as germination and stand establishment, growth rate, maturity, and plant and ear height, is desirable.
  • Traditional plant breeding is an important tool in developing new and improved commercial crops.
  • This invention encompasses methods for producing a maize plant by crossing a first parent maize plant with a second parent maize plant wherein one or both of the parent maize plants is a transformed plant displaying enhanced vigor, as described herein.
  • Plant breeding techniques known in the art and used in a maize plant breeding program include, but are not limited to, recurrent selection, bulk selection, mass selection, backcrossing, pedigree breeding, open pollination breeding, restriction fragment length polymorphism enhanced selection, genetic marker enhanced selection, doubled haploids, and transformation. Often combinations of these techniques are used.
  • a genetic trait which has been engineered into a particular maize plant using transformation techniques could be moved into another line using traditional breeding techniques that are well known in the plant breeding arts. For example, a backcrossing approach is commonly used to move a transgene from a transformed maize plant to an elite inbred line, and the resulting progeny would then comprise the transgene(s). Also, if an inbred line was used for the transformation then the transgenic plants could be crossed to a different inbred in order to produce a transgenic hybrid maize plant. As used herein, "crossing" can refer to a simple X by Y cross, or the process of backcrossing, depending on the context.
  • the development of a maize hybrid in a maize plant breeding program involves three steps: (1 ) the selection of plants from various germplasm pools for initial breeding crosses; (2) the selfing of the selected plants from the breeding crosses for several generations to produce a series of inbred lines, which, while different from each other, breed true and are highly uniform; and (3) crossing the selected inbred lines with different inbred lines to produce the hybrids.
  • the vigor of the lines decreases. Vigor is restored when two different inbred lines are crossed to produce the hybrid.
  • An important consequence of the homozygosity and homogeneity of the inbred lines is that the hybrid created by crossing a defined pair of inbreds will always be the same.
  • Transgenic plants of the present invention may be used to produce a single cross hybrid, a three-way hybrid or a double cross hybrid.
  • a single cross hybrid is produced when two inbred lines are crossed to produce the F1 progeny.
  • a double cross hybrid is produced from four inbred lines crossed in pairs (A x B and C x D) and then the two F1 hybrids are crossed again (A x B) x (C x D).
  • a three-way cross hybrid is produced from three inbred lines where two of the inbred lines are crossed (A x B) and then the resulting F1 hybrid is crossed with the third inbred (A x B) x C.
  • Much of the hybrid vigor and uniformity exhibited by F1 hybrids is lost in the next generation (F2). Consequently, seed produced by hybrids is consumed rather than planted.
  • nucleotide sequences are provided that allow initiation of transcription in seed.
  • the sequences of the invention comprise transcriptional initiation regions associated with seed formation and seed tissues.
  • the compositions of the present invention comprise novel nucleotide sequences for regulatory sequences.
  • a method for expressing an isolated nucleotide sequence in a plant using the transcriptional initiation sequences disclosed herein is provided. Suitable techniques are described by Maniatis, T., Fritsch, E.F. and Sambrook, J. in MOLECULAR CLONING, A Laboratory Manual (2nd edition 1989 Cold Spring Harbor Laboratory).
  • the method comprises transforming a plant cell with a transformation vector that comprises an isolated nucleotide sequence operably linked to the promoter of the present invention and regenerating a stably transformed plant from the transformed plant cell.
  • the promoter is useful for controlling the expression of endogenous as well as exogenous products in a seed-preferred manner.
  • Under the transcriptional initiation regulation of the seed-preferred promoter region will be a sequence of interest, which will provide for modification of the phenotype of the seed. Such modification includes modulating the production of an endogenous product, as to amount, relative distribution, or the like, or production of an exogenous expression product to provide for a novel function or product in the seed.
  • seed-preferred is intended favored expression in the seed, including at least one of embryo, kernel, pericarp, endosperm, nucellus, aleurone, pedicel, and the like.
  • regulatory element is intended sequences responsible for tissue-preferred and temporally-preferred expression of the associated coding sequence, including promoters, terminators, enhancers, introns, and the like.
  • promoter is intended a regulatory region of DNA usually comprising a
  • a promoter capable of directing RNA polymerase II to initiate RNA synthesis at the appropriate transcription initiation site for a particular coding sequence.
  • a promoter can additionally comprise other recognition sequences generally positioned upstream or ⁇ ' to the TATA box, referred to as upstream promoter elements, which influence the transcription initiation rate. It is recognized that having identified the nucleotide sequences for the promoter region disclosed herein, it is within the state of the art to isolate and identify further regulatory elements in the 5' untranslated region upstream from the particular promoter region identified herein. Thus the promoter region disclosed herein is generally further defined by comprising upstream regulatory elements such as those responsible for tissue-preferred and temporally-preferred expression of the coding sequence, enhancers, and the like.
  • the promoter elements that enable expression in the desired tissue such as the seed can be identified, isolated, and used with other core promoters to confirm seed- preferred expression.
  • the isolated promoter sequences of the present invention can be modified to provide for a range of expression levels of the isolated nucleotide sequence. Less than the entire promoter region can be utilized and the ability to drive seed-preferred expression retained. However, it is recognized that expression levels of mRNA can be decreased with deletions of portions of the promoter sequence. Thus, the promoter can be modified to be a weak or strong promoter. Generally, by "weak promoter" is intended a promoter that drives expression of a coding sequence at a low level.
  • a strong promoter drives expression of a coding sequence at a high level, or at about 1/10 transcripts to about 1/100 transcripts to about 1/1 ,000 transcripts.
  • enhancers can be utilized in combination with the promoter regions of the invention. Enhancers are nucleotide sequences that act to increase the expression of a promoter region. Enhancers are known in the art and include the SV40 enhancer region, the 35S enhancer element, and the like.
  • a promoter of the present invention can be isolated from the ⁇ ' untranslated region flanking the transcription initiation site of its respective coding sequence. Likewise, the terminator can be isolated from the 3' untranslated region flanking the stop codon of its respective coding sequence.
  • isolated refers to material, such as a nucleic acid or protein, which is: (1 ) substantially or essentially free from components which normally accompany or interact with the material as found in its naturally occurring environment or (2) if the material is in its natural environment, the material has been altered by deliberate human intervention to a composition and/or placed at a locus in a cell other than the locus native to the material. Methods for isolation of promoter regions are well known in the art. A sequence for the promoter region eepl is set forth in SEQ ID NO: 7. A sequence for the promoter region eep2 is set forth in SEQ ID NO: 18.
  • the eepl promoter set forth in SEQ ID NO: 7 is 960 nucleotides in length
  • a putative CAAT motif is found 308 bp upstream of the start of translation and a putative TATA motif is found 139 bp upstream form the start of translation.
  • the promoter was isolated from EST sequences found in maize tissue libraries of 4 and 6 DAP embryo sacs, as well as ⁇ and 7 DAP whole kernels.
  • the eepl promoter can address expression problems by providing expression in seed tissues during early stages of seed development.
  • the eep2 promoter set forth in SEQ ID NO: 18 is 1027 nucleotides in length.
  • the promoter was isolated from an EST sequence found in maize tissue libraries of 4 DAP
  • the promoter regions of the invention may be isolated from any plant, including, but not limited to, maize (corn; Zea mays), canola (Brassica napus, Brassica rapa ssp.), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annuus), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma
  • Promoter sequences from other plants may be isolated according to well- known techniques based on their sequence homology to the promoter sequences set forth herein. In these techniques, all or part of the known promoter sequence is used as a probe which selectively hybridizes to other sequences present in a population of cloned genomic DNA fragments (i.e. genomic libraries) from a chosen organism. Methods that are readily available in the art for the hybridization of nucleic acid sequences may be used to obtain sequences which correspond to the promoter of the present invention.
  • the entire promoter sequence or portions thereof can be used as a probe capable of specifically hybridizing to corresponding promoter sequences.
  • probes include sequences that are unique and are preferably at least about 10 nucleotides in length, and most preferably at least about 20 nucleotides in length.
  • Such probes can be used to amplify corresponding promoter sequences from a chosen organism by the well-known process of polymerase chain reaction (PCR). This technique can be used to isolate additional promoter sequences from a desired organism or as a diagnostic assay to determine the presence of the promoter sequence in an organism. Examples include hybridization screening of plated DNA libraries (either plaques or colonies; see e.g. Innis et al. (1990J PCR Protocols, A Guide to Methods and Applications, eds., Academic Press).
  • sequences that correspond to the promoter sequence of the present invention and hybridize to the promoter sequence disclosed herein will be at least 50% homologous, 5 ⁇ % homologous, 60% homologous, 65% homologous, 70% homologous, 75% homologous, 80% homologous, 85% homologous, 90% homologous, 9 ⁇ % homologous and even 98% homologous or more with the disclosed sequence.
  • sequence relationships between two or more nucleic acids or polynucleotides are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) “reference sequence”, (b) “comparison window”, (c) “percentage of sequence identity”, and (d) “substantial identity”.
  • reference sequence is a defined sequence used as a basis for sequence comparison.
  • a reference sequence may be a subset or the entirety of a specified sequence; for example, a segment of a full-length promoter sequence, or the complete promoter sequence.
  • comparison window makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence may be compared to a reference sequence and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the comparison window is at least 20 contiguous nucleotides in length and optionally can be 30, 40, 50, 100, or more contiguous nucleotides in length.
  • a gap penalty is typically introduced and is subtracted from the number of matches.
  • percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
  • polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70% sequence identity, preferably at least 80%, more preferably at least 90% and most preferably at least 95%, compared to a reference sequence using one of the alignment programs described using standard parameters.
  • Identity to the sequence of the present invention would mean a polynucleotide sequence having at least 65% sequence identity, more preferably at least 70% sequence identity, more preferably at least 75% sequence identity, more preferably at least 80% identity, more preferably at least 85% sequence identity, more preferably at least 90% sequence identity and most preferably at least 95% sequence identity wherein the percent sequence identity is based on the entire promoter region.
  • GAP Global Alignment Program
  • GAP uses the algorithm of Needleman and Wunsch (J. Mol. Biol. 48:443-453, 1970) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps.
  • GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases.
  • GAP must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty.
  • gap creation penalty values and gap extension penalty values in Version 10 of the Wisconsin Package® for protein sequences are 8 and 2, respectively.
  • the default gap creation penalty is 50 while the default gap extension penalty is 3.
  • the gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 200.
  • the gap creation and gap extension penalties can be 0, 1 , 2, 3, 4, ⁇ , 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or greater.
  • GAP presents one member of the family of best alignments. There may be many members of this family, but no other member has a better quality. GAP displays four figures of merit for alignments: Quality, Ratio, Identity, and Similarity.
  • the Quality is the metric maximized in order to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment.
  • Percent Identity is the percent of the symbols that actually match.
  • Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold.
  • the scoring matrix used in Version 10 of the Wisconsin Package® is BLOSUM62 (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).
  • Sequence fragments with high percent identity to the sequences of the present invention also refer to those fragments of a particular promoter sequence disclosed herein that operate to promote the seed-preferred expression of an operably-linked isolated nucleotide sequence. These fragments will comprise at least about 20 contiguous nucleotides, preferably at least about 50 contiguous nucleotides, more preferably at least about 75 contiguous nucleotides, even more preferably at least about 100 contiguous nucleotides of the particular promoter nucleotide sequence disclosed herein. The nucleotides of such fragments will usually comprise the TATA recognition sequence of the particular promoter sequence.
  • Such fragments can be obtained by use of restriction enzymes to cleave the naturally occurring promoter sequences disclosed herein; by synthesizing a nucleotide sequence from the naturally-occurring DNA sequence; or through the use of PCR technology. See particularly, Mullis et al. (1987) Methods Enzymol. 155:335-350, and Erlich, ed. (1989) PCR Technology (Stockton Press, New York). Again, variants of these fragments, such as those resulting from site- directed mutagenesis, are encompassed by the compositions of the present invention.
  • Nucleotide sequences comprising at least about 20 contiguous sequences of the sequence set forth in SEQ ID NO:10 are encompassed. These sequences can be isolated by hybridization, PCR, and the like. Such sequences encompass fragments capable of driving seed-preferred expression, fragments useful as probes to identify similar sequences, as well as elements responsible for temporal or tissue specificity.
  • a regulatory "variant" is a modified form of a promoter wherein one or more bases have been modified, removed or added.
  • a routine way to remove part of a DNA sequence is to use an exonuclease in combination with DNA amplification to produce unidirectional nested deletions of double-stranded DNA clones.
  • a commercial kit for this purpose is sold under the trade name Exo-SizeTM (New England Biolabs, Beverly, Mass.).
  • this procedure entails incubating exonuclease III with DNA to progressively remove nucleotides in the 3' to 5' direction at 5' overhangs, blunt ends or nicks in the DNA template.
  • exonuclease III is unable to remove nucleotides at 3', 4-base overhangs.
  • Timed digests of a clone with this enzyme produce unidirectional nested deletions.
  • a regulatory sequence variant is a promoter formed by causing one or more deletions in a larger promoter.
  • Biologically active variants include, for example, the native regulatory sequences of the invention having one or more nucleotide substitutions, deletions or insertions. Activity can be measured by Northern blot analysis, reporter activity measurements when using transcriptional fusions, and the like. See, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.), herein incorporated by reference.
  • nucleotide sequences for the seed-preferred promoter disclosed in the present invention are useful in the genetic manipulation of any plant when operably linked with an isolated nucleotide sequence whose expression is to be controlled to achieve a desired phenotypic response.
  • operably linked is intended that the transcription or translation of the isolated nucleotide sequence is under the influence of the regulatory sequence.
  • a nucleotide sequence for the promoter of the invention may be provided in an expression cassette along with an isolated nucleotide sequence for expression in the plant of interest, more particularly in the seed of the plant.
  • Such an expression cassette is provided with a plurality of restriction sites for insertion of the nucleotide sequence to be under the transcriptional control of the promoter.
  • the genes of interest expressed under the direction of the promoter of the invention can be used for varying the phenotype of seeds. This can be achieved by increasing expression of endogenous or exogenous products in seeds. Alternatively, results can be achieved by providing for a reduction of expression of one or more endogenous products, particularly enzymes or cofactors in the seed. These modifications result in a change in phenotype of the transformed seed. It is recognized that the promoter may be used with its native coding sequence to increase or decrease expression, resulting in a change in phenotype in the transformed seed.
  • genes of interest for the purposes of the present invention include for example, those genes involved in information, such as Zinc fingers; those involved in communication, such as kinases; and those involved in housekeeping, such as heat shock proteins. More specific categories of transgenes include genes encoding important traits for agronomics, insect resistance, disease resistance, herbicide resistance, and grain characteristics. Still other categories of transgenes include genes for inducing expression of exogenous products such as enzymes, cofactors, and hormones from plants and other eukaryotes as well as prokaryotic organisms. It is recognized that any gene of interest, including the native coding sequence, can be operably linked to the regulatory elements of the invention and expressed in the seed.
  • Modifications that affect grain traits include increasing the content of oleic acid, or altering levels of saturated and unsaturated fatty acids. Likewise, increasing the levels of lysine and sulfur-containing amino acids may be desired as well as the modification of starch type and content in the seed. Hordothionin protein modifications are described in WO 9416078 filed April 10, 1997; WO 9638562 filed March 26, 1997; WO 9638563 filed March 26, 1997 and U.S. Pat. No. 5,703,409 issued December 30, 1997; the disclosures of which are incorporated herein by reference.
  • soybean 2S albumin described in WO 9735023 filed March 20, 1996, and the chymotrypsin inhibitor from barley, Williamson et al. (1987) Eur. J. Biochem. 165:99-106, the disclosures of each are incorporated by reference.
  • Derivatives of the following genes can be made by site-directed mutagenesis to increase the level of preselected amino acids in the encoded polypeptide.
  • the gene encoding the barley high lysine polypeptide (BHL) is derived from barley chymotrypsin inhibitor, WO 9820133 filed November 1 , 1996 the disclosure of which is incorporated herein by reference.
  • Other proteins include methionine-rich plant proteins such as from sunflower seed, Lilley et al. (1989) Proceedings of the World Congress on Vegetable Protein Utilization in Human Foods and Animal Feedstuffs; Applewhite, H.
  • Agronomic traits in seeds can be improved by altering expression of genes that: affect the response of seed growth and development during environmental stress, Cheikh-N et al (1994) Plant Physiol. 106(1):45- ⁇ 1) and genes controlling carbohydrate metabolism to reduce kernel abortion in maize, Zinselmeier et al. (1995) Plant Physiol. 107(2):385-391.
  • genes encoding cytokinin biosynthesis enzymes such as isopentenyl transferase
  • genes encoding cytokinin catabolic enzymes such as cytokinin oxidase
  • genes encoding polypeptides involved in regulation of the cell cycle such as CyclinD or cdc25
  • genes encoding cytokinin receptors or sensors such as CRE1 , CKI1 , and CKI2, histidine phospho-transmitters, or cytokinin response regulators.
  • Insect resistance genes may encode resistance to pests that have great yield drag such as rootworm, cutworm, European Corn Borer, and the like.
  • Such genes include, for example: Bacillus thuringiensis endotoxin genes, U.S. Pat. Nos.
  • Genes encoding disease resistance traits include: detoxification genes, such as against fumonosin (WO 9606175 filed June 7, 1995); avirulence (avr) and disease resistance (R) genes, Jones et al. (1994) Science 266:789; Martin et al. (1993) Science 262:1432; Mindrinos et al. (1994) Cell 78:1089; and the like.
  • Exogenous products include plant enzymes and products as well as those from other sources including prokaryotes and other eukaryotes. Such products include enzymes, cofactors, hormones, and the like.
  • the level of seed proteins, particularly modified seed proteins having improved amino acid distribution to improve the nutrient value of the seed can be increased. This is achieved by the expression of such proteins having enhanced amino acid content.
  • the nucleotide sequence operably linked to the regulatory elements disclosed herein can be an antisense sequence for a targeted gene.
  • antisense DNA nucleotide sequence is intended a sequence that is in inverse orientation to the 5'-to-3' normal orientation of that nucleotide sequence.
  • expression of the antisense DNA sequence prevents normal expression of the DNA nucleotide sequence for the targeted gene.
  • the antisense nucleotide sequence encodes an RNA transcript that is complementary to and capable of hybridizing with the endogenous messenger RNA (mRNA) produced by transcription of the DNA nucleotide sequence for the targeted gene. In this case, production of the native protein encoded by the targeted gene is inhibited to achieve a desired phenotypic response.
  • mRNA messenger RNA
  • the regulatory sequences disclosed herein can be operably linked to antisense DNA sequences to reduce or inhibit expression of a native protein in the plant seed.
  • the expression cassette will also include, at the 3' terminus of the isolated nucleotide sequence of interest, a transcriptional and translational termination region functional in plants.
  • the termination region can be native with the promoter nucleotide sequence of the present invention, can be native with the DNA sequence of interest, or can be derived from another source.
  • Termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also: Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991 ) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91 :151- 158; Ballas et al. 1989) Nucleic Acids Res. 17:7891-7903; Joshi et al. (1987) Nucleic Acid Res. 15:9627-9639.
  • the expression cassettes can additionally contain 5' leader sequences.
  • leader sequences can act to enhance translation.
  • Translation leaders are known in the art and include: picornavirus leaders, for example: EMCV leader (Encephalomyocarditis ⁇ ' noncoding region), Elroy-Stein et al. (1989J Proc. Nat. Acad. Sci. USA 86:6126-6130; potyvirus leaders, for example, TEV leader (Tobacco Etch Virus), Allison et al. (1986); MDMV leader (Maize Dwarf Mosaic Virus), Virology 154:9-20; human immunoglobulin heavy-chain binding protein (BiP), Macejak et al.
  • EMCV leader Engelphalomyocarditis ⁇ ' noncoding region
  • potyvirus leaders for example, TEV leader (Tobacco Etch Virus), Allison et
  • the cassette can also contain sequences that enhance translation and/or mRNA stability such as introns.
  • the expression cassette can further comprise a coding sequence for a transit peptide.
  • transit peptides are well known in the art and include, but are not limited to: the transit peptide for the acyl carrier protein, the small subunit of RUBISCO, plant EPSP synthase, and the like.
  • the various DNA fragments can be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame.
  • adapters or linkers can be employed to join the DNA fragments or other manipulations can be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like.
  • in vitro mutagenesis, primer repair, restriction digests, annealing, and resubstitutions such as transitions and transversions, can be involved.
  • the present invention provides vectors capable of expressing genes of interest under the control of the regulatory elements.
  • the vectors should be functional in plant cells.
  • it may be preferable to have vectors that are functional in E. coli e.g., production of protein for raising antibodies, DNA sequence analysis, construction of inserts, obtaining quantities of nucleic acids.
  • Vectors and procedures for cloning and expression in E. coli are discussed in Sambrook eif al. (supra).
  • the transformation vector comprising the promoter of the present invention operably linked to an isolated nucleotide sequence in an expression cassette, can also contain at least one additional nucleotide sequence for a gene to be co- transformed into the organism.
  • the additional sequence(s) can be provided on another transformation vector.
  • Vectors that are functional in plants can be binary plasmids derived from Agrobacterium. Such vectors are capable of transforming plant cells. These vectors contain left and right border sequences that are required for integration into the host (plant) chromosome. At minimum, between these border sequences is the gene to be expressed under control of the regulatory elements of the present invention. In one embodiment, a selectable marker and a reporter gene are also included. For ease of obtaining sufficient quantities of vector, a bacterial origin that allows replication in E. coli can be used.
  • Reporter genes can be included in the transformation vectors. Examples of suitable reporter genes known in the art can be found in, for example: Jefferson et al. (1991 ) in Plant Molecular Biology Manual, ed. Gelvin et al. (Kluwer Academic Publishers), pp. 1-33; DeWet et al. (1987) Mol. Cell. Biol. 7:725-737; Goff et al. (1990) EMBO J. 9:2517-2522; Kain et al. (1995) BioTechniques 19:650-655; and Chiu et al. (1996) Current Biology 6:325-330.
  • Selectable marker genes for selection of transformed cells or tissues can be included in the transformation vectors. These can include genes that confer antibiotic resistance or resistance to herbicides. Examples of suitable selectable marker genes include, but are not limited to: genes encoding resistance to chloramphenicol, Herrera Estrella et al. (1983) EMBO J. 2:987-992; methotrexate, Herrera Estrella et al. (1983) Nature 303:209-213; Meijer et al. (1991 ) Plant Mol. Biol. 16:807-820; hygromycin, Waldron et al. (1985) Plant Mol. Biol. 5:103-108; Zhijian et al.
  • GUS ⁇ -glucoronidase
  • Jefferson (1987) Plant Mol. Biol. Rep. 5:387)
  • GFP green florescence protein
  • luciferase Teeri et al. (1989) EMBO J. 8:343
  • maize genes encoding for anthocyanin production, Ludwig et al. (1990) Science 247:449.
  • the transformation vector comprising the particular regulatory sequences of the present invention, operably linked to an isolated nucleotide sequence of interest in an expression cassette, can be used to transform any plant.
  • Genetically modified plants, plant cells, plant tissue, seed, and the like can be obtained. Transformation protocols can vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of transforming plant cells include microinjection, Crossway et al. (1986) Biotechniques 4:320-334; electroporation, Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-6606; Agrobactehum-med ⁇ ated transformation, see for example, Townsend et al.
  • ligations were accomplished using standard buffers, incubation temperatures and times, approximately equimolar amounts of the DNA fragments to be ligated and approximately 10 units of T4 DNA ligase ("ligase”) per 0.5 microgram of DNA.
  • ligase T4 DNA ligase
  • Example 1 Construction of vectors system for temporal and spatial seed preferred expression of cytokinin biosynthetic enzymes
  • PHP 11466 and PHP 11467 and their cointegrates were employed in particle gun transformation protocols even though they have the right and left border for the tDNA.
  • the versions designated PHP11 ⁇ 1 and PHP11 ⁇ 2 were used in Agro-mediated transformation protocols.
  • the ipt coding sequence was obtained as a 732 bp BamHI/Hpal fragment and inserted into a GLB1 expression cassette (BamHI/Hpal, 4.9 kb) to give PHP11310.
  • the maize GLB1 promoter (Genbank Accession # L22344 L2229 ⁇ ) and terminator (Genbank Accession # L22346 L22295) in PHP3303 comprise the GLB1 expression cassette.
  • the pGLB1 :ipt:GLB1 3' cassette was moved as two pieces (Hindlll/BamHI 1401 bp and BamHI/EcoRI 1618 bp) into a T-DNA vector digested with EcoRI + Hindlll (6.33 kb) to give PHP11363.
  • a selectable marker gene (pUBI:UBIINTRON1 :maize-optimized PAT:3 ⁇ S 3') was added as a 2.84 kb Hindlll fragment into Hind Ill-digested PHP11363 (9.35 kb).
  • PHP11466 the two genes are in opposite orientation relative to each other.
  • PHP11467 the two genes are oriented in the same direction.
  • the cointegrate of PHP11466/PHP10523 was designated PHP11 ⁇ 51.
  • the cointegrate of PHP11467/PHP10523 was designated PHP115 ⁇ 2.
  • PHP 11404 was used with the biolistics-mediated transformation protocol.
  • the plasmid has all the features of the Agro version.
  • the plasmid that was actually used with the Agro-mediated transformation protocols was is PHP11550.
  • PHP9063 pUBI:UBIINTRON1 :ipt:pinll 3'
  • site-directed mutagenesis specifically, the MORPHTM Kit of 5 Prime - 3 Prime, Inc.
  • the resulting plasmid was designated PHP11362.
  • the ipt coding sequence was then moved as a 724 bp Ncol/Hpal fragment into PHP8001 (BamHI-cut, treated with Klenow to fill in the overhang to a blunt then cut with Ncol, 4.9 kb) to give PHP11401.
  • PHP8001 contains the GZ-W64A promoter and terminator from the 27 KD zein gene of Z.
  • PHP11401 was digested with Pa + Kpnl and a 1.3 ⁇ kb fragment inserted into PHP11287 (Pacl/Kpnl-digested, 10.87 kb) to give PHP11404.
  • PHP11287 is a T- DNA vector that already carries the above-described pUBI:UBIINTRON1 :maize- optimized PAT:3 ⁇ S 3' selectable marker. After triparental mating the cointegrate of PHP11404/PHP10623 was designated PHP11550. Construction of PHP12975
  • the CIM1 promoter is described in U.S. Patent Application 09/377,648, filed August 19, 1999. Site-directed mutagenesis was used to create an Ncol site at the CIM1 translational start (PHP12699). The promoter was cut out as a 1.69 kb Sacl/Ncol fragment and ligated to the ipt coding sequence and pinll terminator from PHP11362 to form PHP12800. The CIM1 :ipt:pinll transcriptional unit was then moved as a 2.8 kb BstEII fragment into BstEII-digested PHP12 ⁇ 1 ⁇ (9. ⁇ kb), a binary vector already carrying the UBI:UBIINTRON1:MO-PAT:3 ⁇ S selectable marker between the border sequences. The resulting plasmid was designated PHP12866. Triparental mating into A. tumefaciens LBA4404 (PHP10523) gave the cointegrate plasmid PHP12975.
  • Plasmid PHP11404 (described above) was used as a starting plasmid to replace the
  • the T- DNA region for transformation consists of the T-DNA border sequences flanking a reporter gene and a selectable marker.
  • the reporter is inserted proximal to the right T-DNA border and consists of the 2.0 kb Pstl fragment of the maize ubiquitin promoter Ubi-1 (Christensen et al., 1992) with flanking 5' Hindlll and 3' BamHI restriction sites.
  • the ubiquitin promoter was ligated to the 5' BamHI site of a beta- glucuronidase (GUS) reporter gene (Jefferson et al., 1986), containing the second intron from potato ST-LS1 (Vancanneyt et al., 1990).
  • GUS beta- glucuronidase
  • the potato proteinase II (pinll) terminator (bases 2 to 310 from An et al., Plant Cell 1 (1 ):115-122 (1989)) was blunt-end ligated downstream of the GUS coding sequence. On the 3' end of the terminator is a Notl restriction site.
  • the selectable marker consists of an enhanced cauliflower mosaic virus 35S promoter (bases -421 to -90 and -421 to +2 from Gardner, R.C., et al., Nucl. Acids Res. 9:2871-88 (1981).)) with a flanking 5' Notl site and 3' Pstl site.
  • a Pstl/Sall fragment containing the 79 bp tobacco mosaic virus leader (Gallie, D.R., et al., Nucl. Acids Res. 15:3257-73 (1987).)) is inserted downstream of the promoter followed by a Sall/BamHI fragment containing the first intron of maize alcohol dehydrogenase ADH1-S (Dennis et al., 1984).
  • the BAR coding sequence was cloned into the BamHI site, with the pinll terminator ligated downstream.
  • the pinll signal is flanked by a 3' Sad site.
  • the T-DNA of PHP8904 was integrated into the super binary plasmid pSB1 (Ishida et al. 1996) by homologous recombination between the two plasmids.
  • E. coli strain HB101 containing PHP8904 was mated with Agrobacterium strain LBA4404 harboring pSB1 to create the cointegrate plasmid in Agrobacterium designated LBA4404(PHP10525) (by the method Ditta, G., et al., Proc. Natl. Acad. Sci. USA 77:7347-51 (1980).)
  • LBA4404(PHP10525) was selected for by Agrobacterium resistance to spectinomycin and verified as a recombinant by a Sail restriction digest of the plasmid.
  • the inventive polynucleotides contained within a vector are transformed into embryogenic maize callus by particle bombardment, generally as described by Tomes, D. et al., IN: Plant Cell, Tissue and Organ Culture: Fundamental Methods, Eds. O.L. Gamborg and G.C. Phillips, Chapter 8, pgs. 197-213 (1995) and is briefly outlined below.
  • Transgenic maize plants are produced by bombardment of embryogenically responsive immature embryos with tungsten particles associated with DNA plasmids.
  • the plasmids consist of a selectable and an unselected structural gene. Preparation of Particles:
  • tungsten particles General Electric
  • 0.5 to 1.8 ⁇ , preferably 1 to 1.8 ⁇ , and most preferably 1 ⁇ are added to 2 ml of concentrated nitric acid.
  • This suspension was sonicated at 0°C for 20 minutes (Branson Sonifier Model 450, 40% output, constant duty cycle).
  • Tungsten particles are pelleted by centrifugation at 10000 rpm (Biofuge) for one minute, and the supernatant is removed. Two milliliters of sterile distilled water are added to the pellet, and brief sonication is used to resuspend the particles.
  • the suspension is pelleted, one milliliter of absolute ethanol is added to the pellet, and brief sonication is used to resuspend the particles. Rinsing, pelleting, and resuspending of the particles is performed two more times with sterile distilled water, and finally the particles are resuspended in two milliliters of sterile distilled water. The particles are subdivided into 250-ml aliquots and stored frozen.
  • the stock of tungsten particles are sonicated briefly in a water bath sonicator (Branson Sonifier Model 450, 20% output, constant duty cycle) and 50 ml is transferred to a microfuge tube. All the vectors were cis: that is the selectable marker and the gene of interest were on the same plasmid. These vectors were then transformed either singly or in combination.
  • Plasmid DNA was added to the particles for a final DNA amount of 0.1 to 10 ⁇ g in 10 ⁇ L total volume, and briefly sonicated.
  • 10 ⁇ g (1 ⁇ g/ ⁇ L in TE buffer) total DNA is used to mix DNA and particles for bombardment.
  • 1.0 ⁇ g of PHP 11404, 11466, and/or 11467 (1 ⁇ g/ ⁇ L), where any cytokinin biosynthetic enzyme polynucleotide can replace ipt were used per bombardment.
  • Fifty microliters (50 ⁇ L) of sterile aqueous 2.5 M CaCI 2 are added, and the mixture is briefly sonicated and vortexed.
  • Tissue Immature embryos of maize variety High Type II are the target for particle bombardment-mediated transformation.
  • This genotype is the F-i of two purebred genetic lines, parents A and B, derived from the cross of two know maize inbreds, A188 and B73. Both parents are selected for high competence of somatic embryogenesis, according to Armstrong et al., Maize Genetics Coop. News 65:92 (1991).
  • Ears from F-i plants are selfed or sibbed, and embryos are aseptically dissected from developing caryopses when the scutellum first becomes opaque. This stage occurs about 9-13 days post-pollination, and most generally about 10 days post- pollination, depending on growth conditions. The embryos are about 0.75 to 1.5 millimeters long. Ears are surface sterilized with 20-50% Clorox for 30 minutes, followed by three rinses with sterile distilled water.
  • Immature embryos are cultured with the scutellum oriented upward, on embryogenic induction medium comprised of N6 basal salts, Eriksson vitamins, 0.5 mg/l thiamine HCl, 30 gm/l sucrose, 2.88 gm/l L-proline, 1 mg/l 2,4-dichlorophenoxyacetic acid, 2 gm/l Gelrite, and 8.5 mg/l AgNO 3 .
  • the medium is sterilized by autoclaving at 121°C for 15 minutes and dispensed into 100 X 25 mm Petri dishes.
  • AgNO 3 is filter-sterilized and added to the medium after autoclaving.
  • the tissues are cultured in complete darkness at 28°C. After about 3 to 7 days, most usually about 4 days, the scutellum of the embryo swells to about double its original size and the protuberances at the coleorhizal surface of the scutellum indicate the inception of embryogenic tissue. Up to 100% of the embryos display this response, but most commonly, the embryogenic response frequency is about 80%.
  • the embryos are transferred to a medium comprised of induction medium modified to contain 120 gm/l sucrose.
  • the embryos are oriented with the coleorhizal pole, the embryogenically responsive tissue, upwards from the culture medium.
  • Ten embryos per Petri dish are located in the center of a Petri dish in an area about 2 cm in diameter.
  • the embryos are maintained on this medium for 3-16 hour, preferably 4 hours, in complete darkness at 28°C just prior to bombardment with particles associated with plasmid DNAs containing the selectable and unselectable marker genes.
  • the particle-DNA agglomerates are accelerated using a DuPont PDS-1000 particle acceleration device.
  • the particle- DNA agglomeration is briefly sonicated and 10 ml are deposited on macrocarriers and the ethanol is allowed to evaporate.
  • the macrocarrier is accelerated onto a stainless-steel stopping screen by the rupture of a polymer diaphragm (rupture disk).
  • Rupture is effected by pressurized helium.
  • the velocity of particle-DNA acceleration is determined based on the rupture disk breaking pressure. Rupture disk pressures of 200 to 1800 psi are used, with 650 to 1100 psi being preferred, and about 900 psi being most highly preferred. Multiple disks are used to effect a range of rupture pressures.
  • the shelf containing the plate with embryos is placed 5.1 cm below the bottom of the macrocarrier platform (shelf #3).
  • a rupture disk and a macrocarrier with dried particle-DNA agglomerates are installed in the device.
  • the He pressure delivered to the device is adjusted to 200 psi above the rupture disk breaking pressure.
  • a Petri dish with the target embryos is placed into the vacuum chamber and located in the projected path of accelerated particles.
  • a vacuum is created in the chamber, preferably about 28 in Hg. After operation of the device, the vacuum is released and the Petri dish is removed.
  • Bombarded embryos remain on the osmotically-adjusted medium during bombardment, and 1 to 4 days subsequently.
  • the embryos are transferred to selection medium comprised of N6 basal salts, Eriksson vitamins, 0.5 mg/1 thiamine HCl, 30 gm/l sucrose, 1 mg/l 2,4-dichlorophenoxyacetic acid, 2 gm/l Gelrite, 0.85 mg/l Ag NO 3 and 3 mg/l bialaphos (Herbiace, Meiji). Bialaphos is added filter-sterilized.
  • the embryos are subcultured to fresh selection medium at 10 to 14 day intervals.
  • embryogenic tissue After about 7 weeks, embryogenic tissue, putatively transformed for both selectable and unselected marker genes, proliferates from about 7% of the bombarded embryos. Putative transgenic tissue is rescued, and that tissue derived from individual embryos is considered to be an event and is propagated independently on selection medium. Two cycles of clonal propagation are achieved by visual selection for the smallest contiguous fragments of organized embryogenic tissue.
  • a sample of tissue from each event is processed to recover DNA.
  • the DNA is restricted with a restriction endonuclease and probed with primer sequences designed to amplify DNA sequences overlapping the cytokinin biosynthetic enzymes and non- cytokinin biosynthetic enzyme portion of the plasmid.
  • Embryogenic tissue with amplifiable sequence is advanced to plant regeneration.
  • embryogenic tissue is subcultured to a medium comprising MS salts and vitamins (Murashige & Skoog, Physiol. Plant 15: 473 (1962)), 100 mg/l myo-inositol, 60 gm/l sucrose, 3 gm/l Gelrite, 0.5 mg/l zeatin, 1 mg/l indole-3-acetic acid, 26.4 ng/l cis-trans-abscissic acid, and 3 mg/l bialaphos in 100 X 25 mm Petri dishes, and is incubated in darkness at 28°C until the development of well-formed, matured somatic embryos can be seen. This requires about 14 days.
  • Well-formed somatic embryos are opaque and cream-colored, and are comprised of an identifiable scutellum and coleoptile.
  • the embryos are individually subcultured to a germination medium comprising MS salts and vitamins, 100 mg/l myo-inositol, 40 gm/l sucrose and 1.5 gm/l Gelrite in 100 X 25 mm Petri dishes and incubated under a 16 hour light:8 hour dark photoperiod and 40 meinsteinsm "2 sec "1 from cool-white fluorescent tubes.
  • the somatic embryos After about 7 days, the somatic embryos have germinated and produced a well-defined shoot and root.
  • the individual plants are subcultured to germination medium in 125 X 25 mm glass tubes to allow further plant development.
  • the plants are maintained under a 16 hour light:8 hour dark photoperiod and 40 meinsteinsm "2 sec "1 from cool-white fluorescent tubes. After about 7 days, the plants are well-established and are transplanted to horticultural soil, hardened off, and potted into commercial greenhouse soil mixture and grown to sexual maturity in a greenhouse. An elite inbred line is used as a male to pollinate regenerated transgenic plants.
  • Agrobacterium-mediated transformation When Agrobacterium-mediated transformation is used, the method of
  • immature embryos are isolated from maize and the embryos contacted with a suspension of Agrobacterium (step 1 : the infection step).
  • the immature embryos are preferably immersed in an Agrobacterium suspension for the initiation of inoculation.
  • the embryos are co- cultured for a time with the Agrobacterium (step 2: the co-cultivation step).
  • the immature embryos are cultured on solid medium following the infection step. Following this co-cultivation period an optional "resting" step is contemplated.
  • the embryos are incubated in the presence of at least one antibiotic known to inhibit the growth of Agrobacterium without the addition of a selective agent for plant transformants (step 3: resting step).
  • the immature embryos are cultured on solid medium with antibiotic, but without a selecting agent, for elimination of Agrobacterium and for a resting phase for the infected cells.
  • inoculated embryos are cultured on medium containing a selective agent and growing transformed callus is recovered (step 4: the selection step).
  • the immature embryos are cultured on solid medium with a selective agent resulting in the selective growth of transformed cells.
  • the callus is then regenerated into plants (step 5: the regeneration step) and preferably calli grown on selective medium are cultured on solid medium to regenerate the plants.
  • the resulting transformants are screened for elevated levels of cytokinin using a combination of direct measurements and in vivo correlates.
  • Glb1 ::ipt transformants were initiated using GS3 embryos and either Agrobacterium- (inventive polynucleotides 11551 and 11552) or biolistic-(inventive polynucleotides 11466 and 11467) mediated transformation. Plantlets were regenerated 2-3 months later and these plantlets (TO's) were transferred to the greenhouse after an additional 2-3 months. At anthesis, TO's were crossed with HG11 and vivipary was detected in the developing T1 seed approximately 30 days later. Developing T1 seed that exhibited the viviparous phenotype was rescued by replanting without seed drying.
  • Viable plants were analyzed by PCR and leaf- painting to determine if the ipt gene and the selectable marker (PAT gene) were present. T1 plants flowered and ears were selfed to create T2 seed. Those plants carrying the ipt gene (PCR- and leaf paint-positive) produced seed that were segregating 3:1 for the gene, whereas the plants that were PCR- and leaf paint- negative did not segregate.
  • PAT gene selectable marker
  • glbl ::ipt Seed Propagation n order to propagate the viviparous seed, half of the remaining plants within each event were harvested at 25 DAP. Ears were placed in dryer boxes and ambient air (22 to 25 C) was blown across them for three days to slowly dry the seed. Dryer boxes containing the transgenic ears were then transferred to a growth chamber and seeds were dried to ⁇ 12% moisture by blowing 35C air across them for 3 to 5 days. Individual ears were then shelled and the seeds stored at 10C and 50%RH.
  • Class 1 No apparent swelling of coleoptile.
  • Class 2 Visible swelling of coleoptile, but no elongation.
  • Class 3 Visible swelling of coleoptile with elongation past the scutellum, but no rupture of pericarp.
  • Class 4 Visible swelling of coleoptile with elongation past the scutellum and rupture of pericarp. The results are shown below in Table 1.
  • kernel mass is a function of the number of endosperm cells and amyloplasts, and cytokinins have been implicated in increasing endosperm cell number and in the differentiation of amyloplasts from proplastids, seeds exhibiting an increased level of cytokinin should yield a corresponding increase in seed dry unit mass.
  • Gz::ipt transformants were initiated using GS3 embryos and Agrobacterium-mediated transformation (inventive polynucleotide 11550). Plantlets were regenerated in 2-3 months in 1997 and these plantlets (TO's) were transferred to the greenhouse after an additional 2-3 months. At anthesis, TO's were crossed with HG11 and at maturity the ears were harvested, shelled and the seed used for additional seed propagation (both backcrossing to HG11 and self-pollinating). T2 seed (both BC2 generation and selfs) was then planted. The T2 plants were analyzed by using PCR and leaf painting to determine if the ipt gene and the selectable marker (PAT gene) were present, respectively. Subsets of these plants were self-pollinated for cytokinin determinations, or allowed to open pollinate for phenotype determinations (yield and yield components).
  • PAT gene selectable marker
  • Samples can be collected and analyzed as follows. At 10, 16 and 22 DAP, 50 to 100 seeds can be collected from two replications per event (each replication was composed of two subsamples) and the pedicel removed. For the 10 DAP samples, the remaining seed tissue can be placed directly into liquid nitrogen (tissue defined as "seed,” composed primarily of pericarp, aleurone, endosperm and nucellus). In contrast, at 16 and 22 DAP, the embryo can be first dissected from the remaining seed tissue (tissue defined as "seed minus embryo,” and composed primarily of pericarp, aleurone and endosperm) and then both tissues placed directly into liquid nitrogen.
  • yield is a combination of both frequency of seed set and number of seeds per ear, seeds exhibiting an increased level of cytokinin in the early stages of seed set and formation should have ears with a corresponding increase in seed set and numbers.
  • Ltp2::ipt transformants were initiated using GS3 embryos and Agrobacterium-mediated transformation (12425). Plantlets were regenerated in 2-3 months in 1998 and these plantlets (TO's) were transferred to the greenhouse after an additional 2-3 months. At anthesis, TO's were crossed with HG11 and at maturity the ears were harvested, shelled and the seed used for additional seed propagation (both backcrossing to HG11 and self-pollinating). The number of seeds per TO event, and the number of events which set seed were compared to a number of other transgenic events with promote ⁇ gene combinations other than Itp2:ipt . These are shown in Table 2.
  • seed can be collected from two replications per event (each replication composed of two subsamples) and the pedicel removed. For the 2, 6, and 22 DAP samples, the remaining seed tissue can be placed directly into liquid nitrogen (tissue defined as "seed,” composed primarily of pericarp, aleurone, endosperm and nucellus).
  • PCR primers preferably containing convenient restriction endonuclease sites are constructed. Two useful primers are shown below:
  • SEQ ID NO: 38 (Upper primer with Bam HI site) 5'caucaucaucauggatccaccaatggatctacgtctaattttcggtccaac 3'
  • the Agrobacterium tumefaciens strain carrying the tumor-inducing plasmid pTi Bo542 was obtained (See Guyon, P., et al., Agropine in null-type crown gall tumors: Evidence for generality of the opine concept, Proceedings of the National Academy of Sciences (U.S.) 77(5): 2693-97 (1980); Chilton, W.S., et al.
  • DNA was extracted from putative transformants, cut with BamHI and Hpal, and run on gel to confirm transformation. This insert was then gel purified and transformed into a convenient expression vector, such as 7921 vector DNA containing a Ubi promoter and pinll terminator.
  • a preferred DNA sequence is provided in Molecular and General Genetics 216:388-394 (1989). It contains an open reading frame encoding a protein of 239 amino acid residues, with a deduced molecular weight of about 26.3kDa (Calculated as the number of amino acid residues X 110).
  • SEQ. I.D. NO: 1 Another preferred DNA sequence is set out below as SEQ. I.D. NO: 1. It contains an open reading frame encoding a protein of about 535 amino acid residues, SEQ ID NO.:2, with a deduced molecular weight of about 58.9kDa (Calculated as the number of amino acid residues X 110).
  • a copy of cytokinin oxidase can be prepared synthetically employing DNA synthesis protocols well known to those skilled in the art of gene synthesis. Alternatively, a copy of the gene may be isolated directly from a cytokinin oxidase harboring organism by PCR cloning.
  • cytokinin oxidase gene (ckxl) was cloned by Roy Morris of the University of Missouri and the sequence deposited in Genbank. (Morris et al., 1999. Isolation of a gene encoding a glycosylated cytokinin oxidase from maize. Biochem. Biophys. Res. Commun. 255(2):328-333. See also Houba-Herin et al., 1999. Cytokinin oxidase from Zea mays: purification, cDNA cloning and expression in moss protoplasts. Plant J. (6):615-626.) PCR primers preferably containing convenient restriction endonuclease sites are constructed: Two useful primers are shown below:
  • RT-PCR reverse transcriptase PCR
  • a plasmid vector is constructed comprising the Zag2.1 promoter (SEQ ID NO: 1
  • Zap promoter SEQ ID NO: 5, also known as ZmMADS
  • tbl promoter SEQ ID NO: 17
  • This construct can then be introduced into maize cells by the following procedure.
  • Immature maize embryos are dissected from developing caryopses derived from crosses of maize lines. The embryos are isolated 10 to 11 days after pollination when they are 1.0 to 1.5 mm long. The embryos are then placed with the axis-side facing down and in contact with agarose-solidified N6 medium (Chu et al. (1975) Sci. Sin. Peking 18:659-668). The embryos are kept in the dark at 27°C.
  • Friable embryogenic callus consisting of undifferentiated masses of cells with somatic proembryoids and embryoids borne on suspensor structures, proliferates from the scutellum of these immature embryos.
  • the embryogenic callus isolated from the primary explant can be cultured on N6 medium and sub-cultured on this medium every 2 to 3 weeks.
  • the plasmid p35S/Ac Hoechst Ag, Frankfurt, Germany
  • This plasmid contains the Pat gene (see European Patent Publication 0 242 236) which encodes phosphinothricin acetyl transferase (PAT).
  • the enzyme PAT confers resistance to herbicidal glutamine synthetase inhibitors such as phosphinothricin.
  • the pat gene in p35S/Ac is under the control of the 35S promoter from Cauliflower Mosaic Virus (Odell et al. (1985) Nature 313:810-812) and comprises the 3' region of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens.
  • the particle bombardment method (Klein et al. (1987) Nature 327:70-73) may be used to transfer genes to the callus culture cells. According to this method, gold particles (1 ⁇ m in diameter) are coated with DNA using the following technique.
  • plasmid DNAs are added to 50 ⁇ L of a suspension of gold particles (60 mg per mL).
  • Calcium chloride 50 ⁇ ⁇ L of a 2.5 M solution
  • spermidine free base (20 ⁇ L of a 1.0 M solution) are added to the particles.
  • the suspension is vortexed during the addition of these solutions.
  • the tubes are briefly centrifuged (5 sec at 15,000 rpm) and the supernatant removed.
  • the particles are resuspended in 200 ⁇ L of absolute ethanol, centrifuged again and the supernatant removed.
  • the ethanol rinse is performed again and the particles resuspended in a final volume of 30 ⁇ L of ethanol.
  • An aliquot (5 ⁇ L) of the DNA- coated gold particles can be placed in the center of a Kapton flying disc (Bio-Rad Labs).
  • the particles are then accelerated into the corn tissue with a Biolistic PDS-1000/He (Bio-Rad Instruments, Hercules CA), using a helium pressure of 1000 psi, a gap distance of 0.5 cm and a flying distance of 1.0 cm.
  • the embryogenic tissue is placed on filter paper over agarose-solidified N6 medium.
  • the tissue is arranged as a thin lawn and covers a circular area of about 5 cm in diameter.
  • the petri dish containing the tissue can be placed in the chamber of the PDS-1000/He approximately 8 cm from the stopping screen.
  • the air in the chamber is then evacuated to a vacuum of 28 inches of Hg.
  • the macrocarrier is accelerated with a helium shock wave using a rupture membrane that bursts when the He pressure in the shock tube reaches 1000 psi.
  • tissue can be transferred to N6 medium that contains gluphosinate (2 mg per liter) and lacks casein or proline. The tissue continues to grow slowly on this medium. After an additional 2 weeks the tissue can be transferred to fresh N6 medium containing gluphosinate. After 6 weeks, areas of about 1 cm in diameter of actively growing callus can be identified on some of the plates containing the glufosinate-supplemented medium. These calli may continue to grow when sub-cultured on the selective medium.
  • Plants can be regenerated from the transgenic callus by first transferring clusters of tissue to N6 medium supplemented with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be transferred to regeneration medium (Fromm et al. (1990) Bio/Technology 8:833-839).
  • Soybean embryos are bombarded with a plasmid comprising the Zag2.1 promoter operably linked to a heterologous nucleotide sequence encoding ipt, as follows.
  • a plasmid comprising the Zag2.1 promoter operably linked to a heterologous nucleotide sequence encoding ipt, as follows.
  • cotyledons of 3-5 mm in length are dissected from surface-sterilized, immature seeds of the soybean cultivar A2872, then cultured in the light or dark at 26°C on an appropriate agar medium for six to ten weeks. Somatic embryos producing secondary embryos are then excised and placed into a suitable liquid medium. After repeated selection for clusters of somatic embryos that multiply as early, globular-staged embryos, the suspensions are maintained as described below.
  • Soybean embryogenic suspension cultures can be maintained in 35 ml liquid media on a rotary shaker, 150 rpm, at 26°C with fluorescent lights on a 16:8 hour day/night schedule. Cultures are sub-cultured every two weeks by inoculating approximately 35 mg of tissue into 35 ml of liquid medium. Soybean embryogenic suspension cultures may then be transformed by the method of particle gun bombardment (Klein et al. (1987) Nature (London) 327:70-73, U.S. Patent No. 4,945,050). A DuPont Biolistic PDS1000/HE instrument (helium retrofit) can be used for these transformations.
  • a selectable marker gene that can be used to facilitate soybean transformation is a transgene composed of the 35S promoter from Cauliflower Mosaic Virus (Odell et al. (1985) Nature 373:810-812), the hygromycin phosphotransferase gene from plasmid pJR225 (from E. coli; Gritz et al. (1983) Gene 25:179-188), and the 3' region of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens.
  • the expression cassette of interest comprising the Zag2.1 promoter and a heterologous polynucleotide encoding ipt, can be isolated as a restriction fragment. This fragment can then be inserted into a unique restriction site of the vector carrying the marker gene.
  • To 50 ⁇ l of a 60 mg/ml 1 ⁇ m gold particle suspension is added (in order): 5 ⁇ l
  • DNA (1 ⁇ g/ ⁇ l), 20 ⁇ l spermidine (0.1 M), and 50 ⁇ l CaCl2 (2.5 M).
  • the particle preparation is then agitated for three minutes, spun in a microfuge for 10 seconds and the supernatant removed.
  • the DNA-coated particles are then washed once in 400 ⁇ l 70% ethanol and resuspended in 40 ⁇ l of anhydrous ethanol.
  • the DNA/particle suspension can be sonicated three times for one second each. Five microliters of the DNA-coated gold particles are then loaded on each macro carrier disk.
  • Approximately 300-400 mg of a two-week-old suspension culture is placed in an empty 60x15 mm petri dish and the residual liquid removed from the tissue with a pipette.
  • approximately 5-10 plates of tissue are normally bombarded.
  • Membrane rupture pressure is set at 1100 psi, and the chamber is evacuated to a vacuum of 28 inches mercury.
  • the tissue is placed approximately 3.5 inches away from the retaining screen and bombarded three times. Following bombardment, the tissue can be divided in half and placed back into liquid and cultured as described above.
  • the liquid media may be exchanged with fresh media, and eleven to twelve days post-bombardment with fresh media containing 50 mg/ml hygromycin. This selective media can be refreshed weekly.
  • Green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated green tissue is removed and inoculated into individual flasks to generate new, clonally propagated, transformed embryogenic suspension cultures. Each new line may be treated as an independent transformation event. These suspensions can then be subcultured and maintained as clusters of immature embryos or regenerated into whole plants by maturation and germination of individual somatic embryos.
  • Example 7 Analysis of ear growth rate of T1 (D2F1 hemizygous) plants under non- stress conditions.
  • Transformation of maize with the zag2.1 ::ipt construct was performed as described in Example 5. Regenerated plants were pollinated with one of the parent genotypes to create D2F1 seed (D2 referring to two doses of a parent; also known as T1 seed). Of 17 original transformants, nine were selected for advancement based on favorable genetic complexity (i.e., single- to low-copy number as determined by Southern blot analysis), intactness of the plant transcriptional unit (as determined by Southern blot analysis), and adequate seed numbers.
  • EGR Ear growth rate
  • control plants in this example were grown from a bulked sample of segregating T1 seed. Control plots were thinned to standard density; also, transgene-positive plants, identified via leaf painting with herbicide, were rogued. As a result of the bulking across events and genotypes, and the variation in field conditions for transgenic vs. control plants, the differences in EGR between transgenic and control plants were muted and the results were inconclusive. Therefore, all nine events were carried forward for yield analysis the following year. Ear growth rate differences are expected for the transgenic events and can be properly evaluated with direct comparisons in which genetic background and field growing conditions are held constant.
  • Example 8 Analysis of yield of T2 (D3F1 hemizygous) plants under non-stress conditions.
  • T2 seed representing the nine selected events was planted in an unreplicated, well-watered field trial in Johnston, Iowa. Presence of the ipt transcript in developing ears was confirmed via Northern blot analysis. Transgene-negative sibs of each event were planted as controls and a pair-wise analysis of each event was conducted (a difference analysis) as well as an event average analysis. All subject plants were detasseled and pollinated by a mixed non-transgenic male parent. Yield was determined by collecting primary ears. Grain was bulked by event and by the presence or absence of the transgene; grain was then oven-dried and measured for total dry mass. Results are shown in Figure 3.
  • Grain yield of seven of the nine events was greater than that of controls. Kernel number, ear length, and kernel mass were also measured; results for transgenics exceeded those for non- transgenic sibs in five out of nine events for ear length; and in five out of nine events for both kernel number and dry matter per kernel.
  • Example 9 Analysis of D4F3 homozygous plants for yield and plant height.
  • Plant heights were measured at V10 and V12. (For growth stages, see How a Corn Plant Develops, Iowa State University of Science and Technology Cooperative Extension Service Special Report No. 48, Reprinted June 1993.) Five of the nine events showed a statistically significant increase in plant height, as shown in Figure 4.
  • Yield was determined by collecting all grain-bearing ears. Grain was bulked as appropriate, oven-dried, and measured for total dry mass. As shown in Figure 5, three of the nine events showed a statistically significant increase in yield, including two of the events also showing increased plant height. Ear number, kernel number, and kernel mass were also measured, as shown in Figure 6.
  • Example 10 Analysis of yield, plant height, leaf greenness, biomass, and transgene expression of D4F3 plants under drought stress.
  • Leaf greenness was measured approximately one week prior to flowering with a Minolta SPAD chlorophyll meter. Plant height was measured at the same time. Five of the nine events showed a statistically significant increase in plant height, as shown in Figure 7. Four of these five, and one additional event, showed increased leaf greenness, as shown in Figure 8.
  • Yield was determined by collecting all grain-bearing ears. Grain was bulked as appropriate, oven-dried, and measured for total dry mass. Kernel number, ear number, and kernel mass were also measured. Three of the nine events gave improved yield results, as shown in Figure 9; all three of these events had also displayed increased plant height and leaf greenness. The increase in plant biomass for one of these events is shown in Figure 10. In addition, in all events tested, the transgene positive plants showed an increase in steady-state levels of ipt transcripts in various vegetative and reproductive tissues relative to that in transgene negative plants.
  • Example 11 Analysis of transgene effect on yield of in non-stress conditions Several constructs were tested for their impact upon yield in a preliminary screen at one location with supplemental irrigation as required. All constructs were evaluated as multiple events, dose 2 elite parent, and tested for perse yield with two reps per event. Only transgene-positive plants were harvested and then all events were compared against each other for their yield advantage. The results are shown in Table 2, where the different constructs are ranked by yield, highest at the top and lowest yielding at the bottom. The second column records the raw yield, whereas the third column records the difference between that entry and the mean of all of the constructs.
  • Soybean embryogenic suspension cultures were transformed by the method of particle gun bombardment using procedures known in the art (Klein et al. (1987) Nature (London) 327:70-73; U. S. Patent No. 4,945,050; Hazel, et al. (1998) Plant Cell. Rep. 17:765-772; Samoylov, et al. (1998) In Vitro Cell Dev. Biol.-Plant 34:8-13).
  • the soybean transformation experiments were carried out using two recombinant DNA fragments.
  • the recombinant DNA fragment used to express the IPT gene was on a separate recombinant DNA fragment from the selectable marker gene providing resistance to sulfonylurea herbicides. Both recombinant DNA fragments were co-precipitated onto gold particles.
  • the initiation medium was an agar-solidifed modified MS (Murashige and Skoog (1962) Physiol. Plant. 75:473-497) medium supplemented with vitamins, 2,4-D and glucose. Secondary embryos were placed in flasks in liquid culture maintenance medium and maintained for 7-9 days on a gyratory shaker at 26 +/- 2°C under -80 ⁇ Em-2s-1 light intensity.
  • the culture maintenance medium was a modified MS medium supplemented with vitamins, 2,4-D, sucrose and asparagine.
  • clumps of tissue Prior to bombardment, clumps of tissue were removed from the flasks and moved to an empty 60 X 15 mm petri dish for bombardment. Tissue was dried by blotting on Whatman #2 filter paper. Approximately 100-200 mg of tissue corresponding to 10- 20 clumps (1-5 mm in size each) were used per plate of bombarded tissue.
  • tissue from each bombarded plate was divided and placed into two flasks of liquid culture maintenance medium per plate of bombarded tissue. Seven days post bombardment, the liquid medium in each flask was replaced with fresh culture maintenance medium supplemented with 100 ng/ml selective agent (selection medium).
  • selective agent used was a sulfonylurea (SU) compound with the chemical name, 2-chloro-N-((4-methoxy-6 methy-1 ,3,5-triazine-2-yl)aminocarbonyl) benzenesulfonamide (common names: DPX-W4189 and chlorsulfuron).
  • SU sulfonylurea
  • Chlorsulfuron is the active ingredient n the DuPont sulfonylurea herbicide, GLEAN®.
  • the selection medium containi ng SU was replaced every week for 6-8 weeks. After the 6-8 week selection peri ol d, islands of green, transformed tissue were observed growing from untransformed, necrotic embryogenic clusters. These putative transgenic events were isolated and kept in media with SU at 100 ng/ml for another 2-6 weeks with media changes every 1-2 weeks to generate new, clonally propagated, transformed embryogenic suspension cultures. Embryos spent a total of around 8-12 weeks in SU. Suspension cultures were subcultured and maintained as clusters of immature embryos and also regenerated into whole plants by maturation and germination of individual somatic embryos.
  • 1400 T1 plants derived from 42 zag2:ipt::ALS transgenic events were grown at a high density (1400 plants in a space designed for 480).
  • Eighteen plants of variety 'Jack' grown in the same environment were used as controls. Plants were grown to maturity and visually selected for unusual pod clusters, or increased pod load.
  • Eighty three (83) zag2:ipt::ALS plants, and 18 Jack plants were measured for the number of pods per plant, number of seed per plant, and seed weight (converted to 100-seed weight).
  • Data were subject to ANOVA using the PROC GLM procedure in SAS, and means separation were completed using the PROC MEANS function of SAS.
  • Seed number was counted from all threshed plants of the two events with the highest average pod number (AFS 3579.7.1 and AFS 3586.1.2).
  • Seed of each individual zag2:ipt::ALS plant and individual Jack plants were weighed to determine if seed size was affected by the increased pod load.
  • Genomic DNA was prepared by grinding 10-day-old Zea mays seedling leaves in liquid nitrogen, and the DNA prepared using the DNeasy Plant Kit (Qiagen, Valencia, California). The DNA was then used exactly as described in the Genome Walker User Manual (Clontech PT3042-1 version PR68687). Briefly, the DNA was digested separately with restriction enzymes Dral, EcoRV, Pvull, Seal, and Stul, all blunt-end cutters. In addition to the blunt enzymes suggested by Clontech, three other blunt enzymes, EcolCRI, Xmnl, and Sspl were also used in separate digestions. The DNA was extracted with phenol, then chloroform, then ethanol precipitated. The Genome Walker adapters were ligated onto the ends of the restricted DNA, to create a "Genome Walker Library.”
  • two nonoverlapping gene-specific primers (26-30 bp in length) were designed complementary to the 5' end of the maize genes identified from sequence databases.
  • the primers were designed to amplify the region upstream of the coding sequence, i.e. the 5' untranslated region and promoter of the chosen gene.
  • the sequences of the primers are given below.
  • the first round of PCR was performed on each Genome Walker library with Clontech primer AP1 (SEQ ID NO: 15) and the gene-specific primer (gsp)1 with the sequence shown in SEQ ID NO: 11.
  • PCR was performed in a model iCycler thermal cycler from Bio-Rad (Hercules, California) using reagents supplied with the Genome Walker kit. The following cycle parameters were used: 7 cycles of 94°C for 2 seconds, then 68°C for 3 minutes, followed by 32 cycles of 94°C for 2 seconds and 67°C for 3 minutes. Finally, the samples were held at 67°C for 4 minutes and then at 4°C until further analysis.
  • the DNA from the first round of PCR was then diluted and used as a template in a second round of PCR using the Clontech AP2 primer (SEQ ID NO: 16) and gene-specific primer (gsp)2 with the sequence shown in SEQ ID NO:12.
  • the cycle parameters for the second round were: 5 cycles of 94°C for 4 seconds, then 70°C for 3 minutes, followed by 20 cycles of 94°C for 4 seconds, then 68°C for 3 minutes . Finally, the samples were held at 67°C for 4 minutes and then held at 4°C. Approximately 10 ml of each reaction were run on 0.8% agarose gel, and bands (usually 500bp or larger) were excised, purified with the Qiaquick Gel Extraction Kit (Qiagen, Valencia, California) and cloned into the TA vector pGEMTeasy (Promega, Madison, Wisconsin). Clones were sequenced for verification.
  • the band produced from the Xmnl Genome Walker library contained 1.5kb of sequence upstream of the gene specific primer in SEQ ID NO: 12.
  • the eepl promoter region was obtained using primers SEQ ID NOS: 13 and 14, created from this sequence to amplify 1kb of genomic DNA from maize line A63. These primers added a Hindlll site at the ⁇ ' end, an Ncol at the start of translation, and an EcoRV site just upstream of the Ncol site. These were added to aid in future vector construction.
  • the PCR reaction was performed in a Bio-Rad iCycler (Hercules, CA) thermal cycler using PCR supermix High fidelity (Cat# 10790020, Invitrogen, Carlsbad, California).
  • Genomic DNA was prepared by grinding leaves from Zea mays B73 plants at V6 stage in liquid nitrogen, and the DNA prepared using the PureGene DNA isolation Kit (Gentra Systems, Minneapolis, Minnesota). The DNA was then used exactly as described in the Genome Walker User Manual (Clontech PT3042-1 version PR68687). Briefly, the DNA was digested separately with restriction enzymes Dra I, which generates blunt-ends. The DNA was extracted with phenol, then chloroform, followed by ethanol precipitation.
  • Genome Walker adapters were ligated onto the ends of the restricted DNA, to create a "Genome Walker Library.”
  • two non-overlapping gene-specific primers (27 bp each in length) were designed complementary to the ⁇ ' end of the maize EST identified from sequence databases.
  • the primers were designed to amplify the region upstream of the coding sequence, i.e. the ⁇ ' untranslated region and promoter of the chosen gene. The sequences of the primers are given below.
  • the first round of PCR was performed on the Genome Walker library with Clontech primer AP1 (Sequence ID NO: 1 ⁇ ) and the gene-specific primer 1 (GSP1) with the sequence AAACACCTTCGGATATTGCTCCCTTTT (SEQ ID NO: 21 ).
  • PCR was performed in a PTC-200 DNA Engine thermal cycler from MJ Research Inc. (Waltham, Massachusetts) using reagents supplied with the Genome Walker kit. The following cycle parameters were used: 7 cycles of 94°C for 10 seconds, then 72°C for 3 minutes, followed by 32 cycles of 94°C for 10 seconds and 67°C for 3 minutes. Finally, the samples were held at 67°C for 7 minutes and then at 8°C until further analysis.
  • the DNA from the first round of PCR was then diluted and used as a template in a second round of PCR using the Clontech AP2 primer (SEQ ID NO: 16) and gene-specific primer 2 (GSP2) with the sequence TCTCGCATTTGCAGAAACGAACAACGT (SEQ ID NO: 22).
  • the cycle parameters for the second round were: ⁇ cycles of 94°C for 10 seconds, then 72°C for 3 minutes, followed by 20 cycles of 94°C for 10 seconds, then 67°C for 3 minutes. Finally, the samples were held at 67°C for 7 minutes and then held at 8°C. Approximately 10 ⁇ L of each reaction were run on 1.0% agarose gel, and PCR products ⁇ OObp or larger were excised, purified with the Qiaquick Gel Extraction Kit (Qiagen, Valencia, California). The band produced from the Dra I Genome Walker library contained 1.0 kb of sequence upstream of the GSP2 primer, and it was cloned into the TA cloning vector pCR2.1 (Invitrogen, Carlsbad, California).
  • Clones were sequenced for verification.
  • the eep2 promoter region was obtained by PCR from the plasmid using primers corresponding to a 1027 bp region from downstream of AP2 primer and upstream of the ATG start codon. Clones were sequenced for verification.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Pregnancy & Childbirth (AREA)
  • Reproductive Health (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Cette invention porte, en général, sur la biologie moléculaire des plantes, et plus spécifiquement sur des procédés et sur des réactifs de l'expression à régulation temporelle et/ou spatiale des gènes qui affectent des taux métaboliquement effectifs des cytokinines dans les plantes, notamment dans les graines et les tissus reproducteurs connexes des plantes femelles. Cette invention porte également sur des plantes transgéniques ayant des taux accrus de l'expression des cytokinines, la plante transgénique présentant des caractéristiques utiles telles que l'augmentation de la grosseur des graines, la diminution de l'avortement de l'amande d'extrémité, l'augmentation de la grenaison sous des conditions environnementales défavorables ou la stabilité de la production. La présente invention porte également sur des compositions et sur des procédés de régulation de l'expression des séquences nucléotidiques hétérologues dans une plante. Les compositions comprennent de nouvelles séquences nucléotidiques pour les promoteurs préférés connus de graines tels que eep1 et eep2. L'invention porte aussi sur un procédé d'expression d'une séquence nucléotidique hétérologue dans une plante utilisant les séquences du promoteur. Le procédé consiste à transformer une cellule de plante de sorte qu'elle comprenne une séquence nucléotidique hétérologue liée de manière fonctionnelle à l'un des promoteurs de l'invention et à régénérer une plante à transformation stable à partir de la cellule transformée.
PCT/US2004/010064 2003-04-04 2004-04-02 Modulation de l'activite des cytokinines dans les plantes WO2004090143A2 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP04749636A EP1613754A2 (fr) 2003-04-04 2004-04-02 Modulation de l'activite des cytokinines dans les plantes
BRPI0409178-7A BRPI0409178A (pt) 2003-04-04 2004-04-02 método para produzir plantas transgênicas e para modular a atividade de citocina em plantas, plantas transgênicas, dna recombinate, promotor e cassete de expressão
CA2521497A CA2521497C (fr) 2003-04-04 2004-04-02 Modulation de l'activite des cytokinines dans les plantes
AU2004227360A AU2004227360B2 (en) 2003-04-04 2004-04-02 Modulation of cytokinin activity in plants
NZ543070A NZ543070A (en) 2003-04-04 2004-04-02 Modulation of cytokinin activity in plants

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US46071803P 2003-04-04 2003-04-04
US60/460,718 2003-04-04

Publications (2)

Publication Number Publication Date
WO2004090143A2 true WO2004090143A2 (fr) 2004-10-21
WO2004090143A3 WO2004090143A3 (fr) 2005-05-12

Family

ID=33159802

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2004/010064 WO2004090143A2 (fr) 2003-04-04 2004-04-02 Modulation de l'activite des cytokinines dans les plantes

Country Status (9)

Country Link
EP (1) EP1613754A2 (fr)
CN (3) CN101220358A (fr)
AR (1) AR045420A1 (fr)
AU (1) AU2004227360B2 (fr)
BR (1) BRPI0409178A (fr)
CA (1) CA2521497C (fr)
NZ (1) NZ543070A (fr)
WO (1) WO2004090143A2 (fr)
ZA (1) ZA200508006B (fr)

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1520028A2 (fr) * 2002-06-19 2005-04-06 BASF Plant Science GmbH Compositions et procedes pour ameliorer les performances des plantes
EP1741788A1 (fr) * 2005-07-06 2007-01-10 Freie Universität Berlin Plante transgénique ayant une activité des récepteurs aux cytokinines réduite de manière sélective dans certains tissus
EP1928227A2 (fr) * 2005-08-30 2008-06-11 Monsanto Technology LLC Plantes transgeniques a traits agronomiques ameliores
WO2010065867A1 (fr) 2008-12-04 2010-06-10 Pioneer Hi-Bred International, Inc. Procédés et compositions pour un rendement amélioré par une expression ciblée de knotted1
WO2010147825A1 (fr) 2009-06-09 2010-12-23 Pioneer Hi-Bred International, Inc. Promoteur d'endosperme précoce et procédés d'utilisation
WO2011036569A2 (fr) 2009-09-22 2011-03-31 The Board Of Trustees Of The University Of Arkansas, N.A. Cultivar de riz cl 142-ar
WO2011047191A1 (fr) 2009-10-15 2011-04-21 The Board Of Trustees Of The University Of Arkansas, N.A. Cultivar de riz cl181-ar
WO2011056544A1 (fr) 2009-10-26 2011-05-12 Pioneer Hi-Bred International, Inc. Promoteur somatique spécifique à un ovule et procédés d'utilisation
US8044263B2 (en) * 2001-03-29 2011-10-25 Pioneer Hi-Bred International, Inc. Cytokinin oxidase promoter from maize
WO2013096810A1 (fr) 2011-12-21 2013-06-27 The Curators Of The University Of Missouri Variété de soja s05-11482
WO2013096818A1 (fr) 2011-12-21 2013-06-27 The Curators Of The University Of Missouri Variété de soja s05-11268
WO2013103371A1 (fr) 2012-01-06 2013-07-11 Pioneer Hi-Bred International, Inc. Promoteur spécifique d'ovule et méthodes d'utilisation
WO2013103365A1 (fr) 2012-01-06 2013-07-11 Pioneer Hi-Bred International, Inc. Promoteurs de pollen préférés et procédés d'utilisation
WO2014059155A1 (fr) 2012-10-11 2014-04-17 Pioneer Hi-Bred International, Inc. Promoteurs de cellules de garde et leur utilisation
WO2014153254A2 (fr) 2013-03-14 2014-09-25 Pioneer Hi-Bred International Inc. Compositions et procédés pour contrôler des insectes ravageurs
WO2014150914A2 (fr) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Polypeptides phi-4 et leurs procédés d'utilisation
WO2014159306A1 (fr) 2013-03-13 2014-10-02 Pioneer Hi-Bred International, Inc. Application de glyphosate pour désherbage d'une brassicée
WO2015023846A2 (fr) 2013-08-16 2015-02-19 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2015038734A2 (fr) 2013-09-13 2015-03-19 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2015120276A1 (fr) 2014-02-07 2015-08-13 Pioneer Hi Bred International Inc Protéines insecticides et leurs procédés d'utilisation
WO2016022516A1 (fr) 2014-08-08 2016-02-11 Pioneer Hi-Bred International, Inc. Promoteurs d'ubiquitine et introns, et procédés d'utilisation
WO2016044092A1 (fr) 2014-09-17 2016-03-24 Pioneer Hi Bred International Inc Compositions et procédés de lutte contre des insectes ravageurs
WO2016061206A1 (fr) 2014-10-16 2016-04-21 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2016099916A1 (fr) 2014-12-19 2016-06-23 E. I. Du Pont De Nemours And Company Compositions d'acide polylactique à vitesse de dégradation supérieure et à stabilité thermique accrue
WO2016186986A1 (fr) 2015-05-19 2016-11-24 Pioneer Hi Bred International Inc Protéines insecticides et leurs procédés d'utilisation
WO2016205445A1 (fr) 2015-06-16 2016-12-22 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
WO2017023486A1 (fr) 2015-08-06 2017-02-09 Pioneer Hi-Bred International, Inc. Protéines insecticides d'origine végétale et leurs méthodes d'utilisation
WO2017040343A1 (fr) 2015-08-28 2017-03-09 Pioneer Hi-Bred International, Inc. Transformation de plantes médiée par ochrobactrum
WO2017105987A1 (fr) 2015-12-18 2017-06-22 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2017112006A1 (fr) 2015-12-22 2017-06-29 Pioneer Hi-Bred International, Inc. Promoteurs préférés par un tissu et procédés d'utilisation
WO2017192560A1 (fr) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Protéines insecticides et procédés pour les utiliser
WO2017218207A1 (fr) 2016-06-16 2017-12-21 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
WO2017222821A2 (fr) 2016-06-24 2017-12-28 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plantes et procédés d'utilisation de ceux-ci
WO2018005411A1 (fr) 2016-07-01 2018-01-04 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et procédés pour leur utilisation
WO2018013333A1 (fr) 2016-07-12 2018-01-18 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
WO2018084936A1 (fr) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2019060383A1 (fr) 2017-09-25 2019-03-28 Pioneer Hi-Bred, International, Inc. Promoteurs ayant une préférence pour des tissus et méthodes d'utilisation
CN109762837A (zh) * 2018-12-24 2019-05-17 中国医学科学院药用植物研究所 利用丹参长链异戊烯基转移酶基因SmPPS2调控辅酶Q合成的方法
WO2019178042A1 (fr) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et procédés pour leur utilisation
WO2019178038A1 (fr) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et leurs procédés d'utilisation
WO2019226508A1 (fr) 2018-05-22 2019-11-28 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plante et leurs procédés d'utilisation
WO2020005933A1 (fr) 2018-06-28 2020-01-02 Pioneer Hi-Bred International, Inc. Procédés de sélection de plantes transformées
WO2020092487A1 (fr) 2018-10-31 2020-05-07 Pioneer Hi-Bred International, Inc. Compositions et procédés de transformation de plante médiée par ochrobactrum
CN113373174A (zh) * 2009-12-17 2021-09-10 先锋国际良种公司 玉米事件dp-004114-3及其检测方法
WO2022015619A2 (fr) 2020-07-14 2022-01-20 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101899442B (zh) * 2010-07-13 2012-02-01 中国科学院遗传与发育生物学研究所 水稻rr17启动子及其应用
WO2013138363A2 (fr) * 2012-03-13 2013-09-19 Pioneer Hi-Bred International, Inc. Réduction génétique de la fertilité mâle dans des plantes
CN102629304B (zh) * 2012-04-05 2015-02-04 天津大学 基于基因组尺度代谢网络模型的代谢工程设计预测方法
CN105624190A (zh) * 2016-03-23 2016-06-01 东北农业大学 一种转异戊烯基酰基转移酶基因玉米育种方法
CN109735538B (zh) * 2018-12-27 2022-06-21 南京农业大学 一种提高森林草莓叶片再生效率的载体及其制备方法和应用
CN111518816B (zh) * 2020-05-12 2021-10-08 广西大学 一种玉米黑暗响应白化/玻璃黄色12基因及其应用
CN114990112B (zh) * 2021-02-26 2024-03-12 华中农业大学 一种皮刺特异启动子
CN114807181A (zh) * 2022-04-30 2022-07-29 浙江师范大学 水稻OsCKX3基因在调控水稻叶夹角中的应用

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0242236A1 (fr) 1986-03-11 1987-10-21 Plant Genetic Systems N.V. Cellules végétales résistantes aux inhibiteurs de la synthétase de glutamine, produites par génie génétique
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US5366892A (en) 1991-01-16 1994-11-22 Mycogen Corporation Gene encoding a coleopteran-active toxin
WO1996006175A2 (fr) 1994-08-12 1996-02-29 Pioneer Hi-Bred International, Inc. Enzymes de detoxication des fumonisines
US5593881A (en) 1994-05-06 1997-01-14 Mycogen Corporation Bacillus thuringiensis delta-endotoxin
US5602321A (en) 1992-11-20 1997-02-11 Monsanto Company Transgenic cotton plants producing heterologous polyhydroxy(e) butyrate bioplastic
US5723756A (en) 1990-04-26 1998-03-03 Plant Genetic Systems, N.V. Bacillus thuringiensis strains and their genes encoding insecticidal toxins
US5736369A (en) 1994-07-29 1998-04-07 Pioneer Hi-Bred International, Inc. Method for producing transgenic cereal plants
US5737514A (en) 1995-11-29 1998-04-07 Texas Micro, Inc. Remote checkpoint memory system and protocol for fault-tolerant computer system
US5747450A (en) 1991-08-02 1998-05-05 Kubota Corporation Microorganism and insecticide
US5759829A (en) 1986-03-28 1998-06-02 Calgene, Inc. Antisense regulation of gene expression in plant cells
US5942657A (en) 1992-05-13 1999-08-24 Zeneca Limited Co-ordinated inhibition of plant gene expression
US7531723B2 (en) 1999-04-16 2009-05-12 Pioneer Hi-Bred International, Inc. Modulation of cytokinin activity in plants

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6329570B1 (en) * 1989-07-19 2001-12-11 Calgene, Llc Cotton modification using ovary-tissue transcriptional factors
US6329520B1 (en) * 1990-08-09 2001-12-11 Research Triangle Institute Cocaine receptor binding ligands
US5689042A (en) * 1995-03-29 1997-11-18 Wisconsin Alumni Research Foundation Transgenic plants with altered senescence characteristics
ATE278788T1 (de) * 1995-07-26 2004-10-15 Pioneer Hi Bred Int Expressionskontrollesequenz zur allgemeinen und effektiven genexpression in pflanzen
ATE309362T1 (de) * 1998-08-20 2005-11-15 Pioneer Hi Bred Int Samen-bevorzugende promotoren
MXPA01010439A (es) * 1999-04-16 2003-09-10 Pioneer Hi Bred Int Expresion regulada de genes en semillas.
US6407315B1 (en) * 1999-11-02 2002-06-18 Pioneer Hi-Bred International, Inc. Seed-preferred promoter from barley
WO2002078438A2 (fr) * 2001-03-29 2002-10-10 Pioneer Hi-Bred International, Inc. Promoteur du mais prefere des tissus

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4945050A (en) 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
EP0242236A1 (fr) 1986-03-11 1987-10-21 Plant Genetic Systems N.V. Cellules végétales résistantes aux inhibiteurs de la synthétase de glutamine, produites par génie génétique
US5759829A (en) 1986-03-28 1998-06-02 Calgene, Inc. Antisense regulation of gene expression in plant cells
US5723756A (en) 1990-04-26 1998-03-03 Plant Genetic Systems, N.V. Bacillus thuringiensis strains and their genes encoding insecticidal toxins
US5366892A (en) 1991-01-16 1994-11-22 Mycogen Corporation Gene encoding a coleopteran-active toxin
US5747450A (en) 1991-08-02 1998-05-05 Kubota Corporation Microorganism and insecticide
US5942657A (en) 1992-05-13 1999-08-24 Zeneca Limited Co-ordinated inhibition of plant gene expression
US5602321A (en) 1992-11-20 1997-02-11 Monsanto Company Transgenic cotton plants producing heterologous polyhydroxy(e) butyrate bioplastic
US5593881A (en) 1994-05-06 1997-01-14 Mycogen Corporation Bacillus thuringiensis delta-endotoxin
US5736369A (en) 1994-07-29 1998-04-07 Pioneer Hi-Bred International, Inc. Method for producing transgenic cereal plants
WO1996006175A2 (fr) 1994-08-12 1996-02-29 Pioneer Hi-Bred International, Inc. Enzymes de detoxication des fumonisines
US5737514A (en) 1995-11-29 1998-04-07 Texas Micro, Inc. Remote checkpoint memory system and protocol for fault-tolerant computer system
US7531723B2 (en) 1999-04-16 2009-05-12 Pioneer Hi-Bred International, Inc. Modulation of cytokinin activity in plants

Non-Patent Citations (71)

* Cited by examiner, † Cited by third party
Title
ALLISON ET AL.: "MDMV leader (Maize Dwarf Mosaic Virus)", VIROLOGY, vol. 154, 1986, pages 9 - 20
ALTSCHUL, S. F., J. MOL. BIOL., vol. 215, 1993, pages 403 - 410
AN ET AL., PLANT CELL, vol. 1, no. 1, 1989, pages 115 - 122
ARMSTRONG ET AL., MAIZE GENETICS COOP. NEWS, vol. 65, 1991, pages 92
BALLAS ET AL., NUCLEIC ACIDS RES., vol. 17, 1989, pages 7891 - 7903
BLEOMYCIN; HILLE ET AL., PLANT MOL. BIOL., vol. 7, 1990, pages 171 - 176
BRETAGNE-SAGNARD ET AL., TRANSGENIC RES., vol. 5, 1996, pages 131 - 137
CHALFIE, SCIENCE, vol. 263, 1994, pages 802
CHEIKH; JONES, PLANT PHYSIOL., vol. 106, 1994, pages 45 - 51
CHILTON, W.S. ET AL.: "Absolute stereochemistry of leucinopine, a crown gall opine", PHYTOCHEMISTRY (OXFORD), vol. 24, no. 2, 1985, pages 221 - 24
CHIU, CURRENT BIOLOGY, vol. 6, 1996, pages 325 - 330
CHU ET AL., SCI. SIN., vol. 18, 1975, pages 659
DEBLOCK ET AL., EMBO J, vol. 6, 1987, pages 2513 - 2518
DELLA-CIOPPA ET AL., PLANT PHYSIOLOGY, vol. 84, 1987, pages 965 - 968
DEWET ET AL., MOL. CELL. BIOL., vol. 7, 1987, pages 725 - 737
DIETRICH ET AL., PLANT PHYSIOL BIOCHEM, vol. 33, 1995, pages 327 - 336
DITTA, G. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 77, 1980, pages 7347 - 51
ELROY-STEIN ET AL., PROC. NAT. ACAD. SCI. USA, vol. 86, 1989, pages 6126 - 6130
ERIKSSON, PHYSIOL. PLANT, vol. 18, 1965, pages 976
FRALEY ET AL., PROC. NAT'L ACAD. SCI. (USA), vol. 80, 1983, pages 4803
FROMM ET AL., BIOLTECHNOLOGY, vol. 8, 1990, pages 833 - 839
GALLIE ET AL., MOLECULAR BIOLOGY OF RNA, 1989, pages 237 - 256
GALLIE, D.R., NUCL. ACIDS RES., vol. 15, 1987, pages 3257 - 73
GARDNER, R.C. ET AL., NUCL. ACIDS RES., vol. 9, 1981, pages 2871 - 88
GEISER ET AL., GENE, vol. 48, 1986, pages 109
GENTZ ET AL., PROC. NAT'L. ACAD. SCI., (USA), vol. 86, 1989, pages 821 - 824
GOFF ET AL., EMBO J., vol. 9, 1990, pages 2517 - 2522
GRITZ ET AL., GENE, vol. 25, 1983, pages 179 - 188
GUERINEAU ET AL., MOL. GEN. GENET., vol. 262, 1991, pages 141 - 144
GUERINEAU ET AL., PLANT MOL. BIOL., vol. 15, 1990, pages 127 - 136
GUYON, P. ET AL.: "Agropine in null-type crown gall tumors: Evidence for generality of the opine concept", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES (U.S.), vol. 77, no. 5, 1980, pages 2693 - 97
HAZEL ET AL., PLANT CELL. REP., vol. 17, 1998, pages 765 - 772
HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915
HERRERA ESTRELLA, EMBO J., vol. 2, 1983, pages 987 - 992
HERRERA ESTRELLA, NATURE, vol. 303, 1983, pages 209 - 213
JEFFERSON, PLANT MOL. BIOL. REP., vol. 5, 1987, pages 387
JOBLING ET AL., NATURE, vol. 325, 1987, pages 622 - 625
JONES ET AL., MOL. GEN. GENET., vol. 210, 1987, pages 86 - 91
JONES ET AL., SCIENCE, vol. 266, 1994, pages 789
JOSHI ET AL., NUCLEIC ACID RES., vol. 15, 1987, pages 9627 - 9639
KAIN ET AL., BIOTECHNIQUES, vol. 19, 1995, pages 650 - 655
KLEE ET AL., ANN. REV. OF PLANT PHYS., vol. 38, 1987, pages 467 - 486
KLEIN ET AL., NATURE (LONDON), vol. 327, 1987, pages 70 - 73
KLEIN ET AL., NATURE, vol. 327, 1987, pages 70 - 73
LOMMEL ET AL., VIROLOGY, vol. 81, 1991, pages 382 - 385
LUDWIG ET AL., SCIENCE, vol. 247, 1990, pages 449
MACEJAK ET AL., NATURE, vol. 353, 1991, pages 90 - 94
MARTIN ET AL., SCIENCE, vol. 262, 1993, pages 1432
MCCORMICK ET AL., PLANT CELL REPORTS, vol. 5, 1986, pages 81 - 84
MEIJER ET AL., PLANT MOL. BIOL., vol. 16, 1991, pages 807 - 820
MINDRINOS ET AL., CELL, vol. 78, 1994, pages 1089
MOGEN ET AL., PLANT CELL, vol. 2, 1990, pages 1261 - 1272
MULLIS ET AL., METHODS ENZYMOL., vol. 155, 1987, pages 335 - 350
MUNROE ET AL., GENE, vol. 91, 1990, pages 151 - 158
MURASHIGE; SKOOG, PHYSIOL. PLANT, vol. 15, 1962, pages 473
MURASHIGE; SKOOG, PHYSIOL. PLANT., vol. 15, 1962, pages 473 - 497
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
ODELL ET AL., NATURE, vol. 313, 1985, pages 810 - 812
PROUDFOOT, CELL, vol. 64, 1991, pages 671 - 674
SAMOYLOV ET AL., IN VITRO CELL DEV. BIOL.-PLANT, vol. 34, 1998, pages 8 - 13
SANFACON ET AL., GENES DEV., vol. 5, 1991, pages 141 - 149
SHAW ET AL., SCIENCE, vol. 233, 1986, pages 478 - 481
SPENCER ET AL., J. THEOR. APPL'D GENETICS, vol. 79, 1990, pages 625 - 631
STALKER, SCIENCE, vol. 242, 1988, pages 419 - 423
STRABALA, T.J ET AL.: "Isolation and characterization of an ipt gene from the Ti plasmid Bo542", MOLECULAR & GENERAL GENETICS, vol. 216, 1989, pages 388 - 94, XP002995594, DOI: doi:10.1007/BF00334380
TEERI ET AL., EMBO J., vol. 8, 1989, pages 343
THOMPSON, C.J, EMBO J., vol. 6, 1987, pages 2519 - 23
VANDEN ELZEN, PLANT MOL. BIOL., vol. 5, 1985, pages 299
WALDRON ET AL., PLANT MOL. BIOL., vol. 5, 1985, pages 103 - 108
ZHIJIAN ET AL., PLANT SCIENCE, vol. 108, 1995, pages 219 - 227
ZHU ET AL., THE PLANT CELL, vol. 7, 1995, pages 1681 - 89

Cited By (61)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8044263B2 (en) * 2001-03-29 2011-10-25 Pioneer Hi-Bred International, Inc. Cytokinin oxidase promoter from maize
EP1520028A2 (fr) * 2002-06-19 2005-04-06 BASF Plant Science GmbH Compositions et procedes pour ameliorer les performances des plantes
EP1520028A4 (fr) * 2002-06-19 2006-08-16 Basf Plant Science Gmbh Compositions et procedes pour ameliorer les performances des plantes
EP1741788A1 (fr) * 2005-07-06 2007-01-10 Freie Universität Berlin Plante transgénique ayant une activité des récepteurs aux cytokinines réduite de manière sélective dans certains tissus
WO2007003317A2 (fr) * 2005-07-06 2007-01-11 Freie Universität Berlin Plante transgenique a activite du recepteur de cytokinine reduite selectivement par rapport a un tissu
WO2007003317A3 (fr) * 2005-07-06 2007-06-14 Univ Berlin Freie Plante transgenique a activite du recepteur de cytokinine reduite selectivement par rapport a un tissu
EP1928227A2 (fr) * 2005-08-30 2008-06-11 Monsanto Technology LLC Plantes transgeniques a traits agronomiques ameliores
EP1928227A4 (fr) * 2005-08-30 2009-05-20 Monsanto Technology Llc Plantes transgeniques a traits agronomiques ameliores
WO2010065867A1 (fr) 2008-12-04 2010-06-10 Pioneer Hi-Bred International, Inc. Procédés et compositions pour un rendement amélioré par une expression ciblée de knotted1
WO2010147825A1 (fr) 2009-06-09 2010-12-23 Pioneer Hi-Bred International, Inc. Promoteur d'endosperme précoce et procédés d'utilisation
WO2011036569A2 (fr) 2009-09-22 2011-03-31 The Board Of Trustees Of The University Of Arkansas, N.A. Cultivar de riz cl 142-ar
WO2011047191A1 (fr) 2009-10-15 2011-04-21 The Board Of Trustees Of The University Of Arkansas, N.A. Cultivar de riz cl181-ar
WO2011056544A1 (fr) 2009-10-26 2011-05-12 Pioneer Hi-Bred International, Inc. Promoteur somatique spécifique à un ovule et procédés d'utilisation
CN113373174A (zh) * 2009-12-17 2021-09-10 先锋国际良种公司 玉米事件dp-004114-3及其检测方法
CN113373174B (zh) * 2009-12-17 2024-06-11 先锋国际良种公司 玉米事件dp-004114-3及其检测方法
WO2013096810A1 (fr) 2011-12-21 2013-06-27 The Curators Of The University Of Missouri Variété de soja s05-11482
WO2013096818A1 (fr) 2011-12-21 2013-06-27 The Curators Of The University Of Missouri Variété de soja s05-11268
WO2013103365A1 (fr) 2012-01-06 2013-07-11 Pioneer Hi-Bred International, Inc. Promoteurs de pollen préférés et procédés d'utilisation
WO2013103371A1 (fr) 2012-01-06 2013-07-11 Pioneer Hi-Bred International, Inc. Promoteur spécifique d'ovule et méthodes d'utilisation
WO2014059155A1 (fr) 2012-10-11 2014-04-17 Pioneer Hi-Bred International, Inc. Promoteurs de cellules de garde et leur utilisation
WO2014159306A1 (fr) 2013-03-13 2014-10-02 Pioneer Hi-Bred International, Inc. Application de glyphosate pour désherbage d'une brassicée
WO2014153254A2 (fr) 2013-03-14 2014-09-25 Pioneer Hi-Bred International Inc. Compositions et procédés pour contrôler des insectes ravageurs
EP3744727A1 (fr) 2013-03-14 2020-12-02 Pioneer Hi-Bred International, Inc. Compositions et procédés permettant de lutter contre les insectes nuisibles
WO2014150914A2 (fr) 2013-03-15 2014-09-25 Pioneer Hi-Bred International, Inc. Polypeptides phi-4 et leurs procédés d'utilisation
WO2015023846A2 (fr) 2013-08-16 2015-02-19 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2015038734A2 (fr) 2013-09-13 2015-03-19 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
EP4159028A1 (fr) 2013-09-13 2023-04-05 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
EP3692786A1 (fr) 2013-09-13 2020-08-12 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
EP3705489A1 (fr) 2014-02-07 2020-09-09 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2015120276A1 (fr) 2014-02-07 2015-08-13 Pioneer Hi Bred International Inc Protéines insecticides et leurs procédés d'utilisation
WO2016022516A1 (fr) 2014-08-08 2016-02-11 Pioneer Hi-Bred International, Inc. Promoteurs d'ubiquitine et introns, et procédés d'utilisation
WO2016044092A1 (fr) 2014-09-17 2016-03-24 Pioneer Hi Bred International Inc Compositions et procédés de lutte contre des insectes ravageurs
WO2016061206A1 (fr) 2014-10-16 2016-04-21 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2016099916A1 (fr) 2014-12-19 2016-06-23 E. I. Du Pont De Nemours And Company Compositions d'acide polylactique à vitesse de dégradation supérieure et à stabilité thermique accrue
WO2016186986A1 (fr) 2015-05-19 2016-11-24 Pioneer Hi Bred International Inc Protéines insecticides et leurs procédés d'utilisation
WO2016205445A1 (fr) 2015-06-16 2016-12-22 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
EP3943602A1 (fr) 2015-08-06 2022-01-26 Pioneer Hi-Bred International, Inc. Protéines insecticides d'origine végétale et leurs méthodes d'utilisation
WO2017023486A1 (fr) 2015-08-06 2017-02-09 Pioneer Hi-Bred International, Inc. Protéines insecticides d'origine végétale et leurs méthodes d'utilisation
WO2017040343A1 (fr) 2015-08-28 2017-03-09 Pioneer Hi-Bred International, Inc. Transformation de plantes médiée par ochrobactrum
WO2017105987A1 (fr) 2015-12-18 2017-06-22 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2017112006A1 (fr) 2015-12-22 2017-06-29 Pioneer Hi-Bred International, Inc. Promoteurs préférés par un tissu et procédés d'utilisation
EP4257694A2 (fr) 2015-12-22 2023-10-11 Pioneer Hi-Bred International, Inc. Promoteurs préférés par un tissu et procédés d'utilisation
EP3960863A1 (fr) 2016-05-04 2022-03-02 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2017192560A1 (fr) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Protéines insecticides et procédés pour les utiliser
WO2017218207A1 (fr) 2016-06-16 2017-12-21 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
WO2017222821A2 (fr) 2016-06-24 2017-12-28 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plantes et procédés d'utilisation de ceux-ci
EP4083215A1 (fr) 2016-06-24 2022-11-02 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plantes et leurs procédés d'utilisation
WO2018005411A1 (fr) 2016-07-01 2018-01-04 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et procédés pour leur utilisation
EP3954202A1 (fr) 2016-07-01 2022-02-16 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et leurs procédés d'utilisation
WO2018013333A1 (fr) 2016-07-12 2018-01-18 Pioneer Hi-Bred International, Inc. Compositions et procédés de lutte contre des insectes nuisibles
WO2018084936A1 (fr) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
EP4050021A1 (fr) 2016-11-01 2022-08-31 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation
WO2019060383A1 (fr) 2017-09-25 2019-03-28 Pioneer Hi-Bred, International, Inc. Promoteurs ayant une préférence pour des tissus et méthodes d'utilisation
WO2019178038A1 (fr) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et leurs procédés d'utilisation
WO2019178042A1 (fr) 2018-03-14 2019-09-19 Pioneer Hi-Bred International, Inc. Protéines insecticides issues de plantes et procédés pour leur utilisation
WO2019226508A1 (fr) 2018-05-22 2019-11-28 Pioneer Hi-Bred International, Inc. Éléments régulateurs de plante et leurs procédés d'utilisation
WO2020005933A1 (fr) 2018-06-28 2020-01-02 Pioneer Hi-Bred International, Inc. Procédés de sélection de plantes transformées
WO2020092487A1 (fr) 2018-10-31 2020-05-07 Pioneer Hi-Bred International, Inc. Compositions et procédés de transformation de plante médiée par ochrobactrum
CN109762837B (zh) * 2018-12-24 2020-12-15 中国医学科学院药用植物研究所 利用丹参长链异戊烯基转移酶基因SmPPS2调控辅酶Q合成的方法
CN109762837A (zh) * 2018-12-24 2019-05-17 中国医学科学院药用植物研究所 利用丹参长链异戊烯基转移酶基因SmPPS2调控辅酶Q合成的方法
WO2022015619A2 (fr) 2020-07-14 2022-01-20 Pioneer Hi-Bred International, Inc. Protéines insecticides et leurs procédés d'utilisation

Also Published As

Publication number Publication date
NZ543070A (en) 2008-10-31
CA2521497A1 (fr) 2004-10-21
BRPI0409178A (pt) 2006-05-02
WO2004090143A3 (fr) 2005-05-12
EP1613754A2 (fr) 2006-01-11
AU2004227360A1 (en) 2004-10-21
CA2521497C (fr) 2012-11-27
CN1798843A (zh) 2006-07-05
CN101220357A (zh) 2008-07-16
AU2004227360B2 (en) 2009-05-28
CN101220358A (zh) 2008-07-16
AR045420A1 (es) 2005-10-26
ZA200508006B (en) 2007-01-31

Similar Documents

Publication Publication Date Title
US7531723B2 (en) Modulation of cytokinin activity in plants
AU2004227360B2 (en) Modulation of cytokinin activity in plants
US6992237B1 (en) Regulated expression of genes in plant seeds
AU2005209595B2 (en) Regulated expression of genes in plant seeds
WO2002042424A2 (fr) Elements regulatoires a expression preferee dans les semences et utilisations de ceux-ci
EP0784425A1 (fr) Regulation genique du developpement floral et de la dominance apicale dans des plantes
US6025483A (en) Maize and cauliflower apetalai gene products and nucleic acid molecules encoding same
US6002069A (en) Seed plants exhibiting inducible early reproductive development and methods of making same
US7052871B2 (en) Methods of improving transformation efficiency of plants with auxin responsive promoter sequences
US6903246B2 (en) Dehydroascorbate reductase (“DHAR”) genes from Triticum aestivum and their use to modulate ascorbic acid levels in plants
US6025543A (en) Seed plants exhibiting early reproductive development and methods of making same
US20040006796A1 (en) Methods of modulating cytokinin related processes in a plant using B3 domain proteins
EP2190997A1 (fr) Gène de résistance au mildiou provenant de la pomme de terre sauvage
US20040006783A1 (en) Compositions and methods for modulating Rop GTPase activity in plants
US7220845B2 (en) Nucleic acid molecules associated with plant cell proliferation and growth and uses thereof
US7109390B2 (en) Alternative splicing factors polynucleotides polypeptides and uses therof
US20030018995A1 (en) Plants with a modified flower and seed development
MXPA05010675A (en) Modulation of cytokinin activity in plants
ZA200601187B (en) Materials and methods for the modulation of cyclin-dependent kinase inhibitor-like polypeptides in maize

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2005/08006

Country of ref document: ZA

Ref document number: 2521497

Country of ref document: CA

Ref document number: PA/a/2005/010675

Country of ref document: MX

Ref document number: 4507/DELNP/2005

Country of ref document: IN

Ref document number: 200508006

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 543070

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2004227360

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2004749636

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2004227360

Country of ref document: AU

Date of ref document: 20040402

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 2004227360

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 20048155350

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2004749636

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0409178

Country of ref document: BR