WO2004089408A2 - Preparations de vaccins - Google Patents

Preparations de vaccins Download PDF

Info

Publication number
WO2004089408A2
WO2004089408A2 PCT/GB2004/001504 GB2004001504W WO2004089408A2 WO 2004089408 A2 WO2004089408 A2 WO 2004089408A2 GB 2004001504 W GB2004001504 W GB 2004001504W WO 2004089408 A2 WO2004089408 A2 WO 2004089408A2
Authority
WO
WIPO (PCT)
Prior art keywords
mutation
mutant
gene
bacterium
reca
Prior art date
Application number
PCT/GB2004/001504
Other languages
English (en)
Other versions
WO2004089408A3 (fr
Inventor
Cornelia Suzanna Mcclean
Simon William Keen
Gillian May Martin
Original Assignee
Xenova Research Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xenova Research Limited filed Critical Xenova Research Limited
Publication of WO2004089408A2 publication Critical patent/WO2004089408A2/fr
Publication of WO2004089408A3 publication Critical patent/WO2004089408A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/095—Neisseria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/521—Bacterial cells; Fungal cells; Protozoal cells inactivated (killed)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated

Definitions

  • This invention relates to attenuated bacteria such as Neisseria , e.g. to live attenuated Neisseria and to their preparation and use e.g. as vaccines against
  • Neisseria e.g. Neisseria meningitidis.
  • the invention also relates to pharmaceutical preparations, such as vaccines, e.g. to live attenuated vaccines comprising these attenuated bacteria.
  • immunogens and vaccines related to bacterial diseases are known or have been proposed, including immunogens and vaccines that can be made from Neisseria.
  • specification WO 98/56901 (Medical Research Council: Baldwin et al) describes attenuated bacteria, e.g. Neisseria meningitidis, for use inter alia as live vaccine material, in which besides an attenuating mutation the native fur (ferric uptake regulation) gene or homologue thereof is modified such that the expression of the fur gene product (or its homologue) is regulated independently of the iron concentration in the environment of the bacterium.
  • a live attenuated Neisseria vaccine has also been proposed by C Tang et al. in Vaccine 17 (1999) pp 114-117.
  • auxotrophic mutations Bacteria attenuated by auxotrophic mutations are also known, as is the application of certain of them as live attenuated vaccines. Examples of auxotrophic mutations are described in certain of the following publications:
  • EP 0 322237 (Wellcome: G Dougan & SN Chatfield) describes bacteria attenuated by a non-reverting mutation in at least two aro genes, and use of the attenuated bacterium as a vaccine.
  • USP 5,210,035 discloses a method of preparing a live attenuated bacterial vaccine, for example a Neisseria vaccine, by blocking at least one biosynthetic pathway, such as the aro pathway, by at least two non-reverting mutations which involve at least 5 nucleotides each.
  • WO 94/05326 (University of Saskatchewan: BJ Allen & AA Potter) describes bacterial vaccines attenuated by, for example, mutations in the pyr pathway or by an iron metabolism mutation.
  • Bacterial endotoxin mutants for example of eisseria, are described in WO 99/10497 (De Craig de Nederlanden: PA Van Der Lay & LJJM Steeghs) which discloses the use as vaccines of live gram-negative mucosal bacteria which retain outer membrane proteins but lack endotoxic LPS, such as Lipid A mutants.
  • EP 0 624 376 (American Cyanamid: GW Zlotnik) describes a method for removing bacterial endotoxin from gram-negative cocci, e.g. Neisseria, and the use of such endotoxin-depleted outer membranes and soluble outer membrane proteins as vaccines.
  • WO 93/10815 (Centre for Innovated Technology: TJ Inzana).
  • WO 97/49416 (Virginia Tech: TJ Inzana & C Ward) also discloses deletion of capsule-encoding genes in bacteria, and use of such mutants, for vaccine purposes.
  • the present invention provides attenuated mutant Neisseria bacteria, e.g. Neisseria meningitidis, e.g. as killed bacteria and bacterial preparations, such as antigenic complexes derived from the mutants; or preferably as live bacteria and bacterial preparations; e.g. for vaccine use: the mutants are immunogenic and can be grown in culture in the presence of a corresponding required accessory substance(s) (e.g. aromatic amino acids when the mutant is an aro mutant).
  • a corresponding required accessory substance(s) e.g. aromatic amino acids when the mutant is an aro mutant.
  • Neisseria e.g. N meningitidis
  • the resulting mutant can be unable to grow adequately in culture, and can be insufficiently immunogenic to elicit an immune response.
  • the Neisseria meningitidis bacterium is not sufficiently attenuated, then the safety of any vaccine comprising the attenuated bacterium can be compromised, and hence it may be unsuitable for use as a vaccine.
  • Neisseria e.g. Neisseria meningitidis
  • bacterium e.g.
  • the present invention provides certain combinations of mutations as described below to satisfy the above criteria, and hence render the Neisseria., e.g. N. meningitidis, bacterium immunogenic, able to be grown in culture medium, while also having certain safety features. This can for example be achieved by the presence of attenuating mutations in two different genes which act through different mechanisms, such that in the event of reversion of one of the genes the resulting revertant would still be attenuated.
  • Such a mutant can be used in the manufacture of ⁇ eiiseria, e.g. Neisseria meningitidis, vaccine compositions which can provide protection from challenge by wild-type Neisseria, e.g. Neisseria meningitidis.
  • ⁇ eiiseria e.g. Neisseria meningitidis
  • vaccine compositions which can provide protection from challenge by wild-type Neisseria, e.g. Neisseria meningitidis.
  • Neisseria e.g. Neisseria meningitidis mutants, e.g. live or killed, having the following mutations:
  • an auxotrophic attenuating mutation e.g. a mutation in the aro pathway, e.g. an aroA or an aroB mutation
  • a capsule mutation e.g. which affects capsule integrity and/or causes the capsule to be of reduced thickness (or to be absent), e.g. a mutation in the synX gene or the galE gene
  • a mutation which reduces bacterial recombination or exogenous DNA uptake e.g. a mutation in any of the bacterial recombinase genes such as recA, or alternatively e.g. a comA mutation.
  • the present invention provides a first attenuated Neisseria meningitidis bacterial construct, e.g. a live bacterial construct, suitable for use in the manufacture of a vaccine against Neisseria meningitidis and in which the mutations consist of the following specific combination of mutations which are made to a wild-type form of the bacteria, e.g. preferably to the B16B6 strain: at least one mutation, in each one of the genes selected from (a) the aroB gene (b) the synXge e, and (c) the recA gene; the mutation can be e.g. a deletion of all or part of each of these genes. This is the aroB, synX, recA mutant.
  • the invention provides a second live attenuated Neisseria meningitidis bacterial construct, e.g. a live construct, suitable for use in the manufacture of a vaccine against Neisseria meningitidis in which the mutations consist of the following specific combination of mutations which are made to a wild- type form of the bacteria, e.g. preferably to the B16B6 strain: at least one mutation in each one of the genes selected from (a) the aroB gene (b) the galE gene, and (c) the recA gene; the mutation can be e.g. a deletion of all or part of each of these genes. This is the aroB, galE, recA mutant.
  • the mutations consist of the following specific combination of mutations which are made to a wild- type form of the bacteria, e.g. preferably to the B16B6 strain: at least one mutation in each one of the genes selected from (a) the aroB gene (b) the galE gene, and (c) the recA gene; the mutation
  • the aroB (GenBank accession number AAF42149.1) gene mutation is an auxotrophic attenuating mutation and it blocks the normal aro biosynthetic pathway so that the bacterium is unable to grow in the absence of the corresponding required accessory substance e.g. aromatic amino acids, e.g. L-phenylalanine, L-tyrosine and L-tryptophan in an amount sufficient to provide for the growth needs of the auxotrophic mutant.
  • Such a mutation(s) can be a single or multiple mutation in the aroB gene, e.g. a single mutation which is a deletion of all or part of the aroB gene or e.g. an insertion or e.g. a frameshift mutation such as at least a one amino acid mutation or insertion, wherein said mutation prevents expression of a functional aroB gene product.
  • the galE (GenBank accession number AAF40532.1) and synXgen.es (GenBank accession number AAF40537.1 ) are involved in bacterial capsule formation.
  • the mutation in the galE or synX gene can be one which reduces capsule thickness and/or reduces capsule integrity, or even one which causes absence of the capsule. Such a reduction in the capsule thickness and/or integrity is advantageous as it results in further attenuation of the bacterium since it means that the mutant bacterium is unable to survive in the bloodsteam of a subject to whom it is given, e.g. a human subject.
  • such a mutation also leads to greater exposure of the bacterial outer membrane proteins, and hence it can increase immunogenicity of the mutant bacterium.
  • Such a mutation can be deletion of all or part of the galE or synX gene, or e.g. an insertion, or e.g. a frameshift mutation such as at least a one amino acid mutation or insertion, wherein said mutation prevents expression of a functional galE or synX gene product.
  • auxotrophic attenuating mutation e.g. a mutation in the aro pathway
  • capsule mutation are attenuating through different mechanisms such that in the event of reversion of one of the genes the second would act as a fail safe. Hence this can also increase the safety of the resultant vaccine.
  • the recA gene (GenBank accession number AAF41805.1) has a role in bacterial recombination.
  • a mutation in the recA gene reduces the rate of genetic recombination in the bacterium.
  • this mutation is not in itself attenuating such a mutant has increased stability and a greatly reduced likelihood of reversion to the wild-type through the process of homologous recombination.
  • this is another safety feature in the resultant vaccine.
  • Such a mutation can be deletion of all or part of the recA gene, or e.g. an insertion, or e.g. a frameshift mutation, such as at least a one amino acid mutation or insertion, wherein said mutation prevents expression of a functional recA gene product.
  • the invention also provides pharmaceutical compositions comprising these attenuated bacteria, e.g. live attenuated bacteria, made as described above in combination with pharmaceutically acceptable excipients, e.g. for use as vaccine compositions to stimulate an immune response against Neisseria meningitidis wild- type bacteria.
  • Also provided by the invention is use of the attenuated bacteria in the manufacture of a vaccine to stimulate an immune response against Neisseria meningitidis wild-type bacteria.
  • the invention provides a method of producing an attenuated bacterium, eg. a live attenuated Neisseria meningitidis bacterium as described herein, e.g. suitable for use in the manufacture of a vaccine against Neisseria meningitidis which, comprises the steps of (a) culturing the Neisseria meningitidis attenuated bacteria in a medium which comprises a catechol-group- containing inducer of bacterial growth, whereby said inducer stimulates growth of said bacteria, (b) harvesting from said culture the live bacteria, and (c) formulating said bacteria with a pharmaceutically acceptable carrier for use as an immunogen.
  • an attenuated bacterium eg. a live attenuated Neisseria meningitidis bacterium as described herein, e.g. suitable for use in the manufacture of a vaccine against Neisseria meningitidis
  • inducing means a growth- inducing and iron-binding compound that contains a catechol group. Examples include those catechol compounds mentioned herein. Further details of such a method can be found in WO 01/44278.
  • bacteria can be grown in a medium containing (a) an iron source and a further iron chelator, e.g. in the form of an iron chelator bound to iron, and also (b) at least one catechol group-containing inducer, e.g. norepinephrine as described in WO 01/44278, the contents and teachings of which are incorporated herein by reference.
  • a further iron chelator e.g. in the form of an iron chelator bound to iron
  • at least one catechol group-containing inducer e.g. norepinephrine as described in WO 01/44278, the contents and teachings of which are incorporated herein by reference.
  • such a further chelator need not be present. All or substantially all of the iron present can be bound to the inducer as mentioned above.
  • the inducer can be added in the form of its iron complex, and the medium can otherwise be iron free.
  • the invention provides methods of culturing, eg. the live attenuated Neisseria meningitidis bacterium as described herein, by growing in a suitable culture medium which contains (a) an iron source and (b) an iron chelator, e.g. EDTA. Growth in such a medium can be particularly useful for increasing the ability of the bacterium to induce cross reactivity and immunogenicity with other bacterial strains and/or groups.
  • the invention also provides bacteria, e.g. Neisseria meningitidis bacteria, obtainable by culturing according the methods described herein.
  • the bacteria described herein can be grown in the standard culture media used for culturing Neisseria meningitidis, e.g. as mentioned further below, and without any added chelator, but containing the required additives to enable growth of the auxotrophic mutant, e.g. the aroB mutant.
  • the choice of culture media for use in connection with this invention can range from defined growth media containing a source of carbon, nitrogen and amino acids to rich complex growth media.
  • Useful commercially available examples of media are Dulbecco's modified Eagle's medium (DMEM; Sigma), and brain heart infusion (BHI: Oxoid).
  • examples of defined media which can usefully be used, or which can be modified if necessary for the purposes of the present invention by adding inducer as mentioned above, include the modified Catlin medium described by J. Fu et al. in Bio/Technology 13, ppl70-174 (1995), and also the Frantz medium described in D. Ivan and J.R. Frantz, J. Bacteriol. 43, pp 757-761 (1942).
  • the corresponding required accessory substance e.g. aromatic amino acids, e.g. L-phenylalanine, L-tyrosine and L-tryptophan in an amount sufficient to provide for the growth needs of the auxotrophic must be present in the growth medium during culture mutant. Hence, it can be necessary to add these to the growth medium during culture.
  • the bacteria described herein e.g. the two specified constructs of Neisseria meningitidis specified above can each be further modified by insertion of a heterologous marker sequence, e.g. a gene encoding mercury resistance (see for example FEMS Microbiol. Lett. 1993, July 15; 111 (1), pp 15-21), or e.g. an allele conferring streptomycin resistance (see for example Gene 1992 Nov 2; 121 (1), pp 25-33), or e.g. a unique nucleotide sequence which is not found in other Neisseria meningitidis species.
  • a heterologous marker sequence e.g. a gene encoding mercury resistance (see for example FEMS Microbiol. Lett. 1993, July 15; 111 (1), pp 15-21), or e.g. an allele conferring streptomycin resistance (see for example Gene 1992 Nov 2; 121 (1), pp 25-33), or e.g. a unique nucleotide sequence which is
  • heterologous marker sequence can be usefully used to aid selection of the vaccine strain, and also to distinguish the vaccine strain of Neisseria meningitidis from other strains, e.g. from non-vaccine strains of Neisseria meningitidis, e.g. from disease causing strains.
  • This sequence can be inserted by using standard recombination techniques as are known in the art.
  • any of the bacteria described herein e.g. the two specified constructs (the aroB, synX, recA mutant and the aroB, galE, recA mutant), by making a mutation, e.g. a deletion of all or part of any one of the genes which encode highly immunogenic proteins, which are not cross-reactive, e.g. in any of the Porin genes such as PorA and/or PorB.
  • a mutant could be particularly useful in manufacture of a vaccine which has enhanced cross-reactivity, e.g. enhanced cross-strain and/or cross-group reactivity.
  • the bacteria described herein can for example be made by modifying vaccine strains, of Neisseria meningitidis, e.g. of Group B or C Neisseria meningitidis, e.g. particularly the Group B strain B16B6 strain of Neisseria meningitidis.
  • the present invention can also optionally be applied to a bacterial strain in which expression of the functional fur ((ferric uptake regulation) gene product is downregulated, e.g. a regulatory fur mutant strain, as described in WO 98/56901
  • the bacterial strain can be other than a regulatory fur mutant in which the expression of the fur gene product (or its homologue) is regulated independently of the iron concentration in the environment of the bacterium.
  • Mutants according to the present invention can also be used for making killed antigenic preparations e.g. as described in US 5,597,572.
  • Figure 1 is a graph showing protection from challenge by the wild-type B 16B6 strain of Neisseria meningitidis by vaccination by either the subcutaneous route (sc) or the intraperitoneal route (ip), with either construct (a) which is the aroBlsynXlrecA attenuated B16B6 mutant, or alternatively with the construct (b) which is the aroBlgalElrecA attenuated B16B6 mutant.
  • Figure 2 shows protection from challenge by the wild-type B16B6 strain of Neisseria meningitidis by vaccination by the intranasal route with construct (a) which is the aroBlsynXlrecA attenuated B16B6 mutant. Bacterial recovery from nasal washes is used as the end point.
  • Figure 3 shows antibody titers after vaccination by either the subcutaneous route (sc) or the intraperitoneal route (ip), with either construct (a) which is the aroBlsynXlrecA attenuated B 16B6 mutant, or alternatively with the construct (b) which is the aroBlgalElrecA attenuated B16B6 mutant.
  • Figure 4 shows levels of serum bactericidal antibodies (SBA) to heterologous strains of Neisseria meningitidis after intraperitoneal immunisation with either 10 8 cfu of construct (a) which is the aroBlsynXlrecA attenuated B16B6 mutant, or alternatively with 10 8 cfu of construct (b) which is the aroBlgalElrecA attenuated B16B6 mutant.
  • SBA serum bactericidal antibodies
  • Figure 5 shows levels of growth in whole blood of construct (a) which is the aroBlsynXlrecA attenuated B16B6 mutant, and construct (b) which is the aroBlgalElrecA attenuated B16B6 mutant, and of the single aroB B16B6 mutant, the single synX B 16B6 mutant, the single galE B 16B6 mutant, and the single B 16B6 mutant recA, and the wild-type B16B6.
  • Figure 6 shows levels of growth in complete culture medium of: construct (a) which is the aroBlsynXlrecA attenuated B16B6 mutant compared to the wild-type B16B6 ( Figure 6a), and construct (b) which is the aroBlgalElrecA attenuated B16B6 mutant, compared to the wild-type B16B6 ( Figure 6b).
  • aroBlsynXlrecA mutant A live attenuated vaccine was constructed based on the clinically isolated strain B16B6 obtained as described above. Both the aroB and synX mutations are attenuating, through different mechanisms so that in the event of reversion of one of the genes the second mutation would act as a fail safe. The recA deletion is not in itself attenuating but should render the reversion of the other two loci highly unlikely by preventing any homologous recombination.
  • streptomycin resistant background strain derived from the clinical N. meningitidis isolate B16B6.
  • the streptomycin resistant parental strain used was selected for by plating out a culture of wild-type B16B6 N meningitidis onto an agar plate with a gradient of streptomycin across it (ranging from 0-250 ⁇ g/ml). In this way a number of distinct colonies were seen to grow on the plate. These were picked and shown to be resistant to streptomycin at levels up to 750 ⁇ g/ml but not at lOOO ⁇ g/ml.
  • One of these isolates was chosen for further work and was designated Sml .3.2.
  • the ermC gene confers resistance to the antibiotic erythromycin.
  • the rpsL gene which occurs naturally in N. meningitidis, codes for the ribosomal protein SI 2.
  • the antibiotic streptomycin works through the bacterial ribosome so that a wild-type allele of the rpsL gene will make bacteria sensitive to streptomycin.
  • the ermC gene was obtained from the plasmid pFLOB4300 (Johnston JM and Cannon JG, Gene 1999 Aug 5; 236 (1), pp 179-84) and cloned into the vector pGEM-T (Promega Corporation, USA) to give the plasmid pMEN2.
  • the N. meningitidis rpsL gene was PCR amplified from B16B6 using genomic D ⁇ A (prepared from a culture of N meningitidis B16B6 using the Qiagen Genomic D ⁇ A kit and following the manufacturers instructions for bacterial cultures) and using the oglinucleotide primers ME ⁇ BRPSLIF (CCGCTCGAGCTTCTTGTCGTTATGCTTGAC) (SEQ ID NO: 1) and
  • MENBRPSL1R (CCGCTCGAGTCAGTCGGGTCTATTCCCATG) (SEQ TD NO: 2) to give a 580bp product.
  • This PCR product was ligated into pMEN2 which had previously been digested with restriction enzymes BamHl (obtainable from New England Biolabs, USA) and EcoRl (Invitrogen Ltd, England). The resulting DNA overhangs were filled in using Klenow and T4 DNA polymerases (obtainable from New England Biolabs, USA) to give blunt ends.
  • the resulting plasmid consists of the ermC gene and the rpsL gene cloned adjacent to one another into the vector pGEM-T.
  • This plasmid was designated pMENl 1.
  • the 1.8kb ermClrpsL cassette can be released from pMENl 1 by digestion with the restriction enzyme Sail (obtainable from New England Biolabs, USA).
  • Flanking regions of the aroB gene were PCR amplified from B16B6 genomic DNA (prepared from a culture of N meningitidis B16B6 using the Qiagen Genomic D ⁇ A kit) The left hand flank, LHF, was amplified using the oligonucleotide primers aroBnewl (CAGATGCCCAACGGTCTTTATAGTGGA) (SEQ TD NO: 3) and AroBdell(TTCCGCGGCCGCTARGGCCGACGTCGACTGTTCCTTAAAGTTTG AACCGCCGGCC) (SEQ ID NO: 4) engineered to incorporate a Sail site.
  • the right hand flank, RHF was amplified using the oligonucleotide primers aroBnew2 (CGCATAAAGGGATGGGTGTTCGCCAGC), (SEQ ID NO: 5) and aroBdel2 (ACGCGTCGACGCGGGTTTGACGCACGATGATGATTTT), (SEQ TD NO: 6) engineered to incorporate a Sail site.
  • aroBnew2 CGCATAAAGGGATGGGTGTTCGCCAGC
  • SEQ ID NO: 5 aroBdel2
  • ACGCGTCGACGCGGGTTTGACGCACGATGATGATTTT SEQ TD NO: 6
  • Both PCR products, LHF and RHF were run into an agarose gel and the correct sized PCR product band (1065bp for LHF and 1234bp for RHF) was purified from the gel using the Qiagen QIAquickgel purification kit (Qiagen, GmbH).
  • the PCR product LHF was ligated into the vector pCRJJ (obtained from Invitrogen Ltd) to give the plasmid pCRUaroBl.
  • the PCR product RHF was ligated into the vector pCRJJ (obtained from Invitrogen Ltd) to give the plasmid pCRTIaroB2.
  • Both plasmids (pCRTJaroB 1 and pCRUaroB2) were digested with the restriction enzymes Notl (obtained from Invitrogen Ltd) and Sail (obtained from New England Biolabs Ltd) and these digests were run into an agarose gel.
  • plasmid pCRUaroB contains the left hand and right hand flanking regions of aroB ligated together on a Sail site and cloned into Notl and Kpnl sites of the vector pCRJI.
  • flanking regions were excised from the plasmid pCRUaroB by digestion with the restriction enzymes Kpnl and Notl.
  • the restriction enzyme generated overhangs were filled in using Klenow and T4 DNA polymerases as described earlier to create blunt ends and the reaction was run into an agarose gel.
  • a 2.3kb fragment was excised from the gel, purified using the QIAquick gel extraction kit and ligated into an EcoRV cut pGIT5.1 vector (a Neisseria uptake vector which can be made as described below) which had been treated with CLAP (Calf intestinal alkaline phosphatase obtained from Roche Diagnostocs, UK) to give the plasmid pMEN12.
  • Plasmid pMEN12 was used as the 'clean' aroB deletion plasmid, containing the left and right hand aroB flanking regions without any marker in between them.
  • the pGIT5.1 vector Neisseria uptake vector can be made as follows: uptake of DNA from the environment by Neisseria spp. is greatly facilitated by the inclusion of Uptake Signal Sequences (USS) in the DNA molecule. The core of these USS has been defined as a lObp sequence GCCGTCTGAA (SEQ JO NO: 7) (Goodman SD and Scocca JJ, Proc Natl. Acad. Sci, USA 1988, Sep; 85 (18), pp 6982-6986).
  • a region of Neisseria DNA containing 6 repeats of the core USS was cloned into the cloning vector pCRJJ (Invitrogen Limited).
  • the ampicillin resistance marker can be removed from this plasmid by digestion with the restriction enzymes Seal (New England Biolabs, USA) and Xmnl (New England Biolabs, USA).
  • the restriction enzyme generated overhangs can be filled in using Klenow and T4 DNA polymerases * to create blunt ends, and the reaction then run into an agarose gel.
  • a 3.85kb fragment can then be excised from the gel, this can be purified using the Qiagen QIAquick gel purification kit.
  • This molecule can then be selfligated in order to give the plasmid pGIT5.1.
  • pMEN12 was digested with the restriction enzyme Sail and into this site, the ermC-rpsL cassette from pMENl 1, was ligated to give the plasmid pMEN13.
  • Plasmid pMEN13 consisted of the left and right hand flanking regions of aroB either side of the two gene, selection/counter selection marker ermC-rpsL, cloned into the Neissseria uptake plasmid pGIT5.1.
  • the synX region was amplified by PCR from the B16B6 genomic DNA (prepared as described earlier) using the primers capFl (TAGCGAATATCCCGACACATTCGCCGCATTAT) (SEQ TD NO: 8) and capRl (ATGCGATATCGCTTTCCTTGTGATTAAGAAT) (SEQ ID NO: 9). This PCR reaction resulted in a 3.1 kb fragment extending from the 5' end of the siaB gene to midway through the ctra gene.
  • telomere sequence (TTCCGCGGCCGCTATGGCCGACGTCGACTATATTCGTCACGCAGTATTA) (SEQ JD NO: 10) were used to amplify the left hand flank, giving a 523bp product.
  • Both PCR products were gel purified using the QIAquick gel extraction kit and digested with the restriction endonucleases Sail and EcoRV before being ligated into EcoRV cut and CLAP treated pGIT5.1 as described above, in order to generate the plasmid pMEN5.
  • This plasmid consists of synX left and right hand flanks, ligated together in the Neisseria meningitidis uptake vector pGIT5.1. Plasmid, pMEN5 was used as the 'clean' synX deletion plasmid, containing the left and right hand synX flanking regions without any marker in between them.
  • pMEN5 was digested with the restriction enzyme Sail and into this site, the ermC-rpsL cassette from pMENl 1, was ligated to give the plasmid pMEN15.
  • Plasmid pMEN15 consists of the left and right hand flanking regions of synX either side of the two gene, selection/counter selection marker ermC-rpsL, cloned into the Neissseria uptake plasmid pGIT5.1.
  • the galE (GenBank accession no AAF40532.1) region was amplified by PCR from B16B6 genomic DNA (prepared from a culture of N meningitidis B16B6 using the Qiagen Genomic D ⁇ A kit, following the manufacturers protocol for bacterial cultures; Qiagen GmbH) using the primers galEl (GTGATTTTGGATAAGCTTTGCAATTCC) (SEQ ID NO: 12) and galE2
  • Plasmid pGIT5.1 - ⁇ galE was used as the 'clean' galE deletion plasmid, containing the left and right hand galE flanking regions without any marker in between them
  • pGIT5.1 - ⁇ galE was digested with the restriction enzyme Sail (New England Biolabs) and into this site, the ermC-rpsL cassette from pMENl 1, was ligated to give the plasmid pMEN17.
  • Plasmid pMEN17 consists of the left and right hand flanking regions of galE either side of the two gene, selection/counter selection marker ermC-rpsL, cloned into the Neisseria uptake plasmid pGIT5.1.
  • the recA gene (Gen Bank accession no AAF41805.1) region was amplified by PCR from B16B6 genomic DNA (prepared from a culture of N meningitidis B16B6 using the Qiagen Genomic D ⁇ A kit, following the manufacturers protocol for bacterial cultures (Qiagen GmbH) using the primers CHI 37 (GATATCATCAGTTTGCAGGATTCGGC) (SEQ ID NO: 16) and CH138 (GATATCGATCAGCGCGTCGAGCAGTTC) (SEQ ID NO: 17). This PCR reaction resulted in a 3.6kb product.
  • the PCR product was digested with the restriction enzymes BspHl(New England Biolabs) and BstXl (New England Biolabs) to release a fragment consisting of the 3' end of the recA gene and it's downstream untranslated region (UTR). Restriction enzyme generated overhangs were filled in to create blunt ends using Klenow and T4 polymerases (New England Biolabs) and the reaction was run into an agarose gel. A 1.2kb fragment was purified from the gel using Qiagen QIAquick gel purification kit (Qiagen GmbH) and this was ligated into the EcoRV digested, and CIAP treated pGIT5.1 vector to give the plasmid ⁇ MEN20.
  • the restriction enzymes BspHl(New England Biolabs) and BstXl (New England Biolabs)
  • Plasmid pMEN20 was digested with the restriction enzyme Xmnl (New England Biolabs), opening up the plasmid in the recA downstream UTR.
  • the ermClrpsL cassette from pMENl 1 was ligated in to give the plasmid pMEN21.
  • This plasmid consists of the 3' end of the recA gene on one side of the ermClrpsL cassette and the downstream UTR on the other side, in the Neisseria uptake vector pGIT5.1 so that the remClrpsL cassette can be inserted downstream of the recA gene, without interrupting it.
  • the recA upstream UTR region was PCR amplified using the primer CHI 38 and CHI 40 (GTCGACCGGAACAAATGGGGTATGTGG) (SEQ ID NO: 18) resulting in a 562bp PCR product that was gel purified and cloned into the cloning vector pGEM- T (Promega Corporation) to give the plasmid pMEN19.
  • the recA downstream UTR was PCR amplified using the primer CH151(GATATCCATTACCATGGATAA CGGC) (SEQ ID NO: 19) and CH153
  • Flanking regions from both plasmids, pMEN19 and pMEN23 were released from the vector by digestion with the restrictions enzymes Sail (New England Biolabs) and EcoRV (Invitrogen Ltd). These fragments were gel purified and ligated into EcoRV digested pGIT5.1 vector, in a three-way ligation. This resulted in the plasmid pMEN25.
  • a unique marker sequence (CGAACGCGCATAGTCTGCT) (SEQ ID NO: 21) for PCR identification of vaccine strains was inserted into the Sail site, between the two flanking regions to generate the plasmid pMEN26.
  • pMEN26 consists of the recA upstream UTR and the recA downstream UTR with a unique marker sequence between them, in the Neisseria uptake vector pGIT5.1.
  • Deletion of genes Deletion of all three genes was carried out by transformation of a streptomycin resistant parental cell line (Sml.3.2) using a selection and counter selection method.
  • a "clean mutant” involves the deletion of our target gene by homologous recombination using gene flanking regions either side of an ermC-rpsL expression cassette (using wild-type rpsL sequence). Deletion of the target gene will then result in insertion of the ermC-rpsL cassette confering a streptomycin sensitive/erythromycin resistant phenotype. These mutants can be selected on agar plates containing erythromycin (Sigma- Aldrich Company Ltd) at 5 ⁇ g/ml.
  • the second step of counter selection involves homologous recombination using flanking regions of the target gene without any insert between them. Recombination with this vector would result in the removal of the ermC-rpsL cassette resulting in a streptomycin resistant/erythromycin sensitive phenotype. These mutants can be selected for on agar plates containing streptomycin (Sigma- Aldrich Company Ltd) at 500 ⁇ g/ml. The resulting deletion mutant will not contain any antibiotic resistance cassettes but will be in a streptomycin resistant background, as a result of a spontaneous mutation in the rpsL gene, which we have selected for (as described earlier).
  • the plasmid pMEN13 was used to knockout aroB and insert the ermC-rpsL cassette through homologous recombination between the aroB flanking regions. Neisseria axe naturally competent bacteria so that by adding plasmid DNA onto a bacterial lawn, plasmid will be taken up by the bacteria and the process of homologous recombination can occur.
  • pMEN13 transformed bacteria were selected for on GC agar (Oxoid Ltd) plates containing erythromycin (5 ⁇ g/ml). A stock of the erythromycin resistant isolates in 40%Glycerol/Foetal Bovine Serum was frozen down and stored at -80 °C, before proceeding to the next step.
  • the plasmid pMEN12 was then used to remove the ermC-rpsL cassette through homologous recombination of the aroB flanking regions.
  • pMEN12 transformed bacteria were selected for on GC agar plates (Oxoid, U.K.) containing streptomycin (strep at 500 ⁇ g/ml). Deletion of the aroB gene and removal of antibiotic cassette was confirmed by PCR, southern blot and phenotype analysis involving the requirements for aromatic amino acids for growth.
  • the second deletion carried out was either the deletion of the synX gene, or the galE gene as described below.
  • svnX gene deletion aroB deletion was followed by the deletion of synX gene.
  • the plasmid pMEN15 was used for the deletion of synXan ⁇ insertion of ermC-rpsL cassette through homologous recombination between the synX flanking regions.
  • pMEN15 transformed bacteria were selected for on GC agar plates containing erythromycin (5 ⁇ g/ml). A stock of the erythromycin resistant isolates was frozen down before proceeding to the next step.
  • the plasmid pMEN5 was used for the removal of the antibiotic cassette through homologous recombination between the synX flanking regions.
  • pMEN5 transformed bacteria were selected for on GC agar plates containing streptomycin (at 500 ⁇ g/ml). Deletion of the synX gene and removal of antibiotic cassette was confirmed by PCR, southern blot and phenotype assay involving an ELISA assay using a N meningitidis group B specific capsule antibody.
  • galE gene deletion aroB deletion was followed by the deletion of galE gene.
  • the plasmid pME ⁇ 17 was used for the deletion of galE and insertion of ermC-rpsL cassette through homologous recombination between the galE flanking regions.
  • pMEN17 transformed bacteria were selected for on GC agar plates containing erythromycin (at 5 ⁇ g/ml). A stock of the erythromycin resistant isolates was frozen down before proceeding to the next step.
  • the plasmid pGIT5.1 - ⁇ galE was used for the removal of the antibiotic cassette through homologous recombination between the galE flanking regions.
  • pGIT5.1 - ⁇ galE transformed bacteria were selected for on GC agar plates containing streptomycin (strep at 500 ⁇ g/ml). Deletion of the galE gene and removal of antibiotic cassette was confirmed by PCR, southern blot and phenotype assay involving the analysis of lipo-oligosaccharide (LOS) profile by polyacrylamide gel electrophoresis (PAGE).
  • LOS lipo-oligosaccharide
  • the plasmid pMEN21 was first used to insert the ermC-rpsL cassette downstream of the recA open reading frame (ORF) through homologous recombination. It was important not to affect the expression of recA as this would render any further homologous recombination impossible.
  • pMEN21 transformed bacteria were selected for on GC agar plates containing erythromycin (5 ⁇ g/ml). A stock of the erythromycin resistant isolates was frozen down before proceeding to the next step. Removal of the ermC-rpsL cassette and the entire recA ORF was carried out through uptake of and homologous recombination with the plasmid pMEN26.
  • the plasmid pMEN26 also inserts a small unique marker sequence so that our deletion mutant can easily be detected by PCR using oligonucleotides specific to this sequence (SWKl 17).
  • SWKl 17 oligonucleotides specific to this sequence
  • pMEN26 transformed bacteria were selected for on GC agar plates containing streptomycin (500 ⁇ g/ml). Deletion of the recA gene and removal of antibiotic cassette was confirmed by PCR, southern blot and UV sensitivity phenotype of recA deletion mutant.
  • Neisseria meningitidis B16B6 triple mutant constructs (a) aroB, synX, recA, and also (b) aroB, galE, recA, can be made as described above. These triple mutants can be used in the experiments as described below:
  • mice were then challenged by the intraperitoneal route on day 23 with 2 x 10 ⁇ 7 cfu of wild-type B16B6, and they were then closely monitored to observe any adverse reactions.
  • Results are shown in Figure 1. All mice immunised with our mutant constructs (test groups) survived the challenge with the wild-type B16B6. However, in the diluent control group 7 out of the 8 mice died. Two mice in each of the test groups showed signs of slight illness for 24 hours post challenge; but all others remained healthy with no signs of illness. In the control group the one surviving mouse showed signs of severe illness post-challenge.
  • aroBlsynXlrecA Groups of eight mice were immunised intranasally with 0.5 x 10 A8 cfu of our triple mutant B16B6 construct aroBlsynXlrecA on days 0 and 14. Controls were four mice inoculated with diluent only (Mueller-Hinton broth). All mice were then challenged intranasally with 2 x 10 ⁇ 8 cfu of wild-type B16B6 on day 29.
  • Nasal washes were then taken from the mice in 0.5ml of Muller- Hinton Broth (Oxoid, U.K.) 23 hours post challenge, these were plated onto GC agar containing 1% Vitox (Oxoid, U.K.) in order to determine numbers of bacteria present.
  • Results are shown in Figure 2. Wild-type B16B6 bacteria were recovered in nasal washes from all of the control mice (with concentrations of bacteria ranging from 1 x 10 ⁇ 3 to 2 x 10 ⁇ cfu/ml). By contrast, no wild-type B16B6 bacteria were recovered from nasal washes of mice immunised with our mutant construct aroBlsynXlrecA. Hence, these results show protection from subsequent challenge with wild-type B 16B6 by intranasal vaccination with construct (a).
  • mice were immunised twice, by either the intraperitoneal route or the subcutaneous route, with 10 ⁇ 8 cfu of either the aroBlsynXlrecA triple B16B6 mutant or the aroBlgalElrecA triple B16B6 mutant. Controls were immunised with the single aroB mutant or with the diluent alone (Muller-Hinton Broth). Six mice in each group were bled on day 21.
  • OMV Outer Membrane Vesicle
  • the OMV preparations were made by re-suspending an optimally growing bacterial of N meningitidis B16B6 culture in deoxycholate buffer. Glass beads were then added to this culture and the culture agitated at 60°C for about one hour. The culture was then centrifuged for thirty minutes at sixteen thousand rpm. The supernatant was taken and centrifuged at thirty-three thousand rpm for one hour. The resulting pellet was re-suspended in UHP water and the protein content determined by using the bicinchoninic acid (BCA) protein quantitation assay kit (obtainable from Pierce Chemical Company, Rockford, Illinois, USA).
  • BCA bicinchoninic acid
  • the 96 well plate was washed six times in PBS/Tween buffer.
  • Sera obtained from the mice was diluted in carbonate buffer either one in ten thousand (for intraperitoneal injected mice) or one in one hundred (for subcutaneous injected mice).
  • Diluted serum was added to the 96 well plates along with a standard and blanks (carbonate buffer only).
  • Standard serum was obtained from a pool of vaccinated and challenged mice, to produce a definite positive response.
  • the test samples were titrated down the plate using one in two dilutions. The plate was then incubated at 37°C for two hours. The plate was then washed six times in PBS/Tween buffer.
  • Goat anti-mouse IgHRP immunoglobulin horse radish peroxidase conjugated
  • the plate was then incubated at 37°C for two hours. Plates were washed as before and o-phenylenediamine tablets (Sigma) dissolved in phosphate-citrate buffer plus hydrogen peroxide were added to each well to detect the anti-Ig HRP.
  • the plate was read on an ELISA plate reader at 492 nm. The results (obtained after subtracting the average blank) were plotted on a graph and the responses were compared by using the mid-point OD from the standard and using the OD to calculate the titers of serum antibodies present in the samples.
  • mice Groups of six mice were immunised twice by the intraperitoneal route with 10 ⁇ 8 cfu of either the aroBlsynXlrecA triple B 16B6 mutant, or the aroBlgalElrecA triple B16B6 mutant on days 0 and 14. Controls were immunised with the diluent alone (Muller-Hinton Broth; Oxoid). The mice were bled on day 21, and the sera pooled. A serum bactericidal assay (SBA) was then performed on each group of sera to measure levels of serum antibodies as follows: the serum samples were heat inactivated for 30 minutes at 56°C and were tested in two fold dilutions against selected strains of Neisseria meningitidis.
  • SBA serum bactericidal assay
  • a human serum with no bactericidal activity against the target strains was used as an external complement source for serogroup B strains; rabbit complement was used for the group C strain.
  • the pooled sera was assayed against strain Neisseria meningitidis TR52 (which carries class three porins homologous to B16B6), serogroup B strain of Neisseria meningitidis H44/76 and also three other serogroup Neisseria meningitidis B strains which represent those that are most prevalent and emerging in England and Wales (MOI 240101, 240183 and 240355).
  • a serogroup C strain of Neisseria meningitidis, Cl l was also included.
  • the bactericidal litre is recorded as the highest reciprocal serum dilution yielding greater than or equal to 50% killing as compared to the number of target cells present before incubation with the serum and complement.
  • Results are shown in Figure 4. Immunisation by the intraperitoneal route using either one of our triple mutant constructs elicited antibodies which reacted with heterologous strains of Neisseria meningitidis i.e. strains which are other than the B16B6 strain. Immunisation with the diluent control did not elicit such antibodies. These results indicate that our triple mutants can likely be cross-protective i.e. they can protect against multiple strains of eisseria meningitidis and not just against the B16B6 strain.
  • Heparin anti-coagulated blood was collected from a human donor previously screened for the ability to support growth in their blood of the B16B6 wild-type bacterium. Overnight cultures were grown on agar and were then scraped into medium. This was followed by incubation in Muller-Hinton broth containing 1%
  • Vitox (Sigma) for about 4 hours at 37°C, and then by dilution in Phosphate buffered saline (PBS; Sigma) to give a concentration of 10 ⁇ O cfu/ml (based on an OD at
  • Live attenuated bacteria made and grown as described herein can be formulated with well known pharmaceutically acceptable excipients such as glycerol, and phosphate buffered saline, to make vaccine compositions which can be administered to a human or non-human animal subject to elicit an immune response, e.g. by intranasal, subcutaneous or intramuscular administration.
  • Dosage can be in the range about 10 ⁇ to about 10 ⁇ l2 cfu of bacteria per dose, e.g. from about 10 ⁇ 7 to about 10 ⁇ 9 cfu, e.g. about 10 ⁇ 8 or 10 ⁇ 9 cfu per dose.
  • Immunisation can be carried out either with single doses, or with multiple doses (especially for example to enhance cross strain and/or cross group protection), e.g. up to about 4 doses up to about 4 weeks apart, and also optionally a booster dose after about 6 months.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne des préparations vivantes ou mortes à partir de bactéries Neisseria mutantes atténuées, par exemple, N. meningitidis, présentant les mutations suivantes: a) mutation d'atténuation auxotrophique, par exemple, mutation de AroA ou de AroB, b) mutation de capsule, par exemple, mutation de synX ou galE et également c) mutation réduisant une recombinaison bactérienne ou un captage d'ADN exogène, telle que les mutations de RecA et/ou de comA. Les mutants et leurs préparations peuvent être utilisés dans des compositions de vaccin.
PCT/GB2004/001504 2003-04-07 2004-04-07 Preparations de vaccins WO2004089408A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0308691A GB0308691D0 (en) 2003-04-07 2003-04-07 Vaccine preparations
GB0308691.5 2003-04-07

Publications (2)

Publication Number Publication Date
WO2004089408A2 true WO2004089408A2 (fr) 2004-10-21
WO2004089408A3 WO2004089408A3 (fr) 2004-12-02

Family

ID=9956824

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2004/001504 WO2004089408A2 (fr) 2003-04-07 2004-04-07 Preparations de vaccins

Country Status (2)

Country Link
GB (1) GB0308691D0 (fr)
WO (1) WO2004089408A2 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010094064A1 (fr) * 2009-02-20 2010-08-26 Australian Poultry Crc Pty Limited Vaccins vivants atténués
WO2014037445A1 (fr) * 2012-09-05 2014-03-13 Lohmann Animal Health Gmbh Préparation de vaccins vivants
CN104995292A (zh) * 2012-12-07 2015-10-21 洛曼动物健康有限责任公司 活疫苗制备
WO2020168146A1 (fr) * 2019-02-14 2020-08-20 University Of Florida Research Foundation, Inc. Vaccin à base de snodgrassella alvi commensale d'abeilles contre neisseriaceae pathogènes

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998056901A2 (fr) * 1997-06-09 1998-12-17 Medical Research Council Vaccin vivant attenue
WO2001009350A2 (fr) * 1999-08-03 2001-02-08 Smithkline Beecham Biologicals S.A. Composition de vaccin
WO2001087939A2 (fr) * 2000-05-18 2001-11-22 Microscience Limited Genes de virulence, proteines, et leur utilisation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998056901A2 (fr) * 1997-06-09 1998-12-17 Medical Research Council Vaccin vivant attenue
WO2001009350A2 (fr) * 1999-08-03 2001-02-08 Smithkline Beecham Biologicals S.A. Composition de vaccin
WO2001087939A2 (fr) * 2000-05-18 2001-11-22 Microscience Limited Genes de virulence, proteines, et leur utilisation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HOLMES L ET AL: "IN VIVO EVALUATIONS OF LIVE ATTENUATED NEISSERIA MENINGITIDIS SEROGROUP B CONSTRUCTS" IMMUNOLOGY, OXFORD, GB, vol. 101, no. SUPPL 1, December 2000 (2000-12), page 34, XP001013651 ISSN: 0019-2805 *
SWARTLEY JOHN S ET AL: "Identification of a genetic locus involved in the biosynthesis of N-acetyl-D-mannosamine, a precursor of the (alpha-2 fwdarw 8)-linked polysialic acid capsule of serogroup B Neisseria meningitidis" JOURNAL OF BACTERIOLOGY, vol. 176, no. 5, 1994, pages 1530-1534, XP002293244 ISSN: 0021-9193 *

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010094064A1 (fr) * 2009-02-20 2010-08-26 Australian Poultry Crc Pty Limited Vaccins vivants atténués
CN102317439A (zh) * 2009-02-20 2012-01-11 澳大利亚家禽Crc有限公司 减毒活疫苗
RU2556813C2 (ru) * 2009-02-20 2015-07-20 Острэйлиан Паултри Срс Пти Лимитед Живые аттенуированные вакцины
WO2014037445A1 (fr) * 2012-09-05 2014-03-13 Lohmann Animal Health Gmbh Préparation de vaccins vivants
EP3415643A1 (fr) * 2012-09-05 2018-12-19 Lohmann Animal Health GmbH Préparation de vaccins vivants
CN104995292A (zh) * 2012-12-07 2015-10-21 洛曼动物健康有限责任公司 活疫苗制备
JP2015536142A (ja) * 2012-12-07 2015-12-21 ローマン・アニマル・ヘルス・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングＬｏｈｍａｎｎ Ａｎｉｍａｌ Ｈｅａｌｔｈ ＧｍｂＨ 生ワクチンの調製
EA030355B1 (ru) * 2012-12-07 2018-07-31 Ломанн Энимал Хелс Гмбх Получение живых вакцин
US10828362B2 (en) 2012-12-07 2020-11-10 Elanco Tiergesundheit Ag Preparation of live vaccines
US11904008B2 (en) 2012-12-07 2024-02-20 Elanco Tiergesundheit Ag Preparation of live vaccines
WO2020168146A1 (fr) * 2019-02-14 2020-08-20 University Of Florida Research Foundation, Inc. Vaccin à base de snodgrassella alvi commensale d'abeilles contre neisseriaceae pathogènes
US12005110B2 (en) 2019-02-14 2024-06-11 University Of Florida Research Foundation, Incorporated Honeybee commensal Snodgrassella alvi vaccine against pathogenic Neisseriaceae

Also Published As

Publication number Publication date
GB0308691D0 (en) 2003-05-21
WO2004089408A3 (fr) 2004-12-02

Similar Documents

Publication Publication Date Title
EP1970449B1 (fr) Mutants attenués de SPI2 de salmonelles utilisés comme porteurs d'antigènes
JP3415145B2 (ja) 弱毒化細菌における組換えタンパク質の発現
EP1135025B1 (fr) Systeme de stabilisation de plasmides permettant d'administrer des antigenes
US5631010A (en) Genetically stable cholera vaccines with deletions of ctxA, recA and attRS1
JPH04501351A (ja) 細胞の遺伝的集団において所望の組換え遺伝子を維持する方法
AU763898B2 (en) Attenuated microorganisms for the treatment of infection
EP1100536A2 (fr) Vaccins vivants attenues de salmonella servant a lutter contre les pathogenes aviaires
Guidolin et al. Genetics of Vibrio cholerae and its bacteriophages
AU743654B2 (en) LKTA deletion mutant of P. haemolytica
WO2004089408A2 (fr) Preparations de vaccins
WO2022120172A2 (fr) Systèmes de vecteur de vaccin contre la salmonelle atténuée à immunité protectrice améliorée (piesv)
RU2130970C1 (ru) Культура v.cholerae, способ получения делеционных мутантов
US20040241190A1 (en) Vaccine preparations
US5470729A (en) Method of isolating restriction fragment deletions in Vibrio cholerae, and products thereof
JP3379582B2 (ja) Ｖｉｂｒｉｏ ｃｈｏｌｅｒａｅ ０１（ｃｖｄ１１１）および−非０１（ｃｖｄ１１２およびｃｖｄ１１２ｒｍ）血清群ワクチン株、その作製方法、およびその産物
EP0358692B1 (fr) Vaccins contre le cholera
WO2006065549A2 (fr) Vaccin vivant utile pour l'immunisation contre les infections provoquees par les coccidioides spp
JPH0630569B2 (ja) 遺伝子工学的に作成された無毒性Ｖｉｂｒｉｏ ｃｈｏｌｅｒａｅ、その用途及びその製造方法
JPH11501203A (ja) 大腸菌およびサルモネラ菌中における淋菌ｐｉタンパクおよびワクチンの製造
MXPA96002679A (en) Defective mutants in penetration in agar bla

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase