WO2004087956A2 - Lignees cellulaires - Google Patents

Lignees cellulaires Download PDF

Info

Publication number
WO2004087956A2
WO2004087956A2 PCT/GB2004/001458 GB2004001458W WO2004087956A2 WO 2004087956 A2 WO2004087956 A2 WO 2004087956A2 GB 2004001458 W GB2004001458 W GB 2004001458W WO 2004087956 A2 WO2004087956 A2 WO 2004087956A2
Authority
WO
WIPO (PCT)
Prior art keywords
nav
channel
cell
nucleic acid
utr
Prior art date
Application number
PCT/GB2004/001458
Other languages
English (en)
Other versions
WO2004087956A3 (fr
Inventor
Lodewijk Victor Dekker
Iain Fraser James
Original Assignee
Ionix Pharmaceuticals Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0307632A external-priority patent/GB0307632D0/en
Priority claimed from GB0307633A external-priority patent/GB0307633D0/en
Application filed by Ionix Pharmaceuticals Limited filed Critical Ionix Pharmaceuticals Limited
Publication of WO2004087956A2 publication Critical patent/WO2004087956A2/fr
Publication of WO2004087956A3 publication Critical patent/WO2004087956A3/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5058—Neurological cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels

Definitions

  • the present invention relates generally to cell lines that express functional 5 Nav 1.8 sodium channels and to uses of such cells.
  • VGSCs are transmembrane proteins responsible for bestowing electrical excitability upon almost all excitable membranes.
  • the pore is gated by depolarization o of the cell membrane, transiently allowing Na + ions to enter into the cell, and generating the upswing of an action potential.
  • VGSCs undergo inactivation, limiting the action potential duration, and allowing rapid membrane repolarization followed by a return to the resting state. All known VGSCs exhibit remarkable functional similarities and this is reflected in a high degree of amino-acid s sequence homology.
  • natural toxins are known to discriminate well between Na + channel subtypes.
  • tetrodotoxin from the Puffer fish, can selectively block subtypes of neuronal VGSCs at single nanomolar concentrations, whereas other neuronal VGSCs remain unblocked by the toxin at micromolar concentrations.
  • TTX-R TTX-insensitive or o resistant
  • WO 97/01577 (University College London) relates to a novel 1,957 amino 5 acid TTX-insensitive VGSC from mammalian sensory neurons (which has been designated Nav 1.8).
  • the sodium channel Nav 1.8 (also known as SNS or PN3) is expressed exclusively in small diameter sensory neurones that co ⁇ espond to A ⁇ or C-fibre nociceptors, which are the cells that transmit pain signals.
  • TTX tetrodotoxin
  • Nav 1.8 is normally expressed in sensory neurons, however it has been difficult to provoke ectopic functional expression of this sodium channel alpha subunit in cell lines, even in the presence of accessory beta-sUbunits.
  • the present invention derived from the inventors' finding of cell lines capable of functionally expressing a Nav 1.8 channel.
  • the present invention provides a method of identifying a modulator of Nav 1.8, which method comprises:
  • the invention also provides a method of identifying a modulator of Nav 1.8, comprising the steps of:
  • the cell line is a neuroblastoma cell line of the type SH-S Y5 Y or BE(2)-C.
  • the heterologous nucleic acid comprises the 3' and/or 5' untranslated region (UTR) of a Nav 1.8 gene or a functional variant of the 3 ' and/or 5 ' UTR of a Nav 1.8 gene, said UTR or variant UTR being operably linked 0 to the region encoding the Nav 1.8 channel.
  • UTR untranslated region
  • Modulators of Nav 1.8 identified by the methods of the invention may be formulated as pharmaceutical compositions. These formulations may be used for the treatment of pain.
  • the invention also provides cells as described herein in relation to the 5 screening methods of the invention.
  • the invention provides a cell comprising a heterologous nucleic acid molecule having a sequence which encodes a Navl.8 channel, wherein the cell expresses pi 1 from an endogenous gene at a sufficient level to allow a Nav 1.8 channel expressed from said heterologous nucleic acid to mediate a sodium current across a membrane of the cell.
  • the o invention provides such cells wherein the heterologous nucleic acid comprises the 3 ' and/or 5' untranslated region (UTR) of a Nav 1.8 gene or a functional variant of the 3' and/or 5' UTR of a Nav 1.8 gene, said UTR or variant UTR being operably linked to the region encoding the Nav 1.8 channel.
  • UTR untranslated region
  • Cells of the invention that are capable of expressing a functional Nav 1.8 5 channel may be produced by a process comprising the steps of transfecting a cell which endogenously expresses pl i with a nucleic acid construct comprising a nucleic acid sequence encoding a Nav 1.8 channel operably linked to a promoter and optionally culturing said cell.
  • the invention also provides cells obtained or obtainable by such a process.
  • the invention also provides a nucleic acid comprising:
  • the invention provides vectors and cell lines comprising such nucleic acid sequences.
  • the invention also provides a nucleic acid comprising:
  • (d) a sequence capable of selectively hybridizing to any of the sequences of (a) to (c). ' is The invention provides vectors and cell lines comprising such nucleic acid sequences.
  • Neuroblastoma cells lines (A: SH-S Y5 Y; B: BE(2)-C; C: ND8.34; D: Kelly) were transfected with pcDNA3.1 (squares) or pcDNA3.1-rNav 1.8 (circles) and grown under G418 selection. G418 resistant cell populations were harvested. Functional expression of Nav 1.8 in control (squares) or Nav 1.8 expression (circles) cells was determined in an ion flux assay using a membrane potential sensitive dye 5 (right panels) by increasing concentrations of deltamethrin in the buffer. To determine TTX resistance, 250 nM TTX was added during the assay (open symbols: no TTX; filled symbols: 250 nM TTX).
  • Figure 2 Functional expression of rat Navl.8 in transfected BE(2)-C and SH- o SY5Y cell populations
  • Navl.8 cyclophilin expression levels were determined by RT-PCR (inset). Functional expression of Navl.8 was deteimined in a depolarisation assay using a membrane potential sensitive dye by increasing concentrations of deltamethrin in the buffer. To determine TTX resistance, 250 nM TTX was added during the assay (open symbols: no TTX; filled symbols: 250 nM TTX). A: BE(2)-C cells. B: SH-SY5Y cells. Data represent averages ⁇ standard error of three observations. Data in were fitted by non-linear regression using GraphPad Prism software (sigmoidal dose response (variable slope option)) with no presetting. 0
  • Figure 3 Lack of functional expression of rat Navl.8 in transfected Kelly and ND8.34 cell populations
  • G418 resistant pools were derived from neuroblastoma Kelly cells' (A) or neuroblastoma x DRG hybrid ND8.43 cells (B).
  • A neuroblastoma Kelly cells'
  • B neuroblastoma x DRG hybrid ND8.43 cells
  • Figure 5 Analysis of clonal cell lines expressing rat Navl.8
  • Clonal cell lines were derived from the G418-resistant pools tested in Figure 2.
  • a and C Clones were tested in the depolarisation assay for responses to increasing concentrations of deltamethrin in the presence of 250 nM TTX.
  • B andD The effect of BUI 890 CL on depolarisation induced by 10 ⁇ M deltamethrin.
  • B rat Navl.8 expressing BE(2)-C clone#2.
  • D ratNa v 1.8 expressing SH-SY5Y clone#5.
  • the data represent averages ⁇ standard errors of 12 (BE(2)-C) or 14 (SH-SY5Y) observations at each data point, obtained in three separate experiments.
  • A Functional expression of Nav 1.8 in pIRESneo2#l (squares) or pIRESneo2- hNavl.8#4 (circles) determined in an ion flux assay using a membrane potential sensitive dye in the presence of increasing concenfrations of deltamethrin in the buffer. Assays were performed in the presence ef-250 nM-TTXi
  • B As in C except that a pIRESneo2#l control cell was used in the recording.
  • Figure 7 Expression of human Navl.8 in SH-SY5Y cells.
  • SH-S Y5 Y cells were transfected with human Navl .8, grown under G418 selection and clonal cell lines were derived.
  • A response to increasing concentrations of deltamethrin in the presence (filled symbols) or absence (open symbols) of 250 nM TTX.
  • the data represent averages +/- standard e ⁇ ors of three observations. The example shown is representative of three independent experiments
  • B The effect of Bill 890 CL on depolarisation induced by 10 ⁇ M deltamethrin.
  • the data represent averages ⁇ standard eirors of 12 observations at each data point, obtained in three separate experiments.
  • Figure 8 Current voltage relationship of rat and human Navl.8
  • SY-SY5Y cells expressing rat (left) or human (right) Navl .8 were held at a holding potential of -80 mV and currents were evoked by stepwise depolarisation to between -80 and 80 mV (30msec lOmV incrementing voltage steps, P/8 leak 5 subtracted). Recordings were made in the presence of 1 ⁇ M TTX.
  • Top panels exemplary records of one cell.
  • Figure 9 TTX-resistant current in clonal SH-SY5Y cells expressing hNavl.8 + 3'UTR i o
  • Individual clonal populations were established of G418-resistant SH-S Y5 Y cells transfected -with the vector pIRESneo2 -hNavl.8 + 3'UTR. Recordings of l ⁇ M TTX resistant cu ⁇ ent in clone pIRESneo2-hNavl.8#2 are shown. The cells were analysed as described above in relation to Figure 6B.
  • SH-SY5Y cells were transfected with pIRESneo2-gpNavl.8 or with o pIRESneo2, grown under G418 selection and clonal cell lines were derived. Cells were then analysed in the fluorescence depolarization assay A: response of pj r RESneo2-transfected cells to increasing concentrations of deltamethrin in the presence (triangles) or absence (squares) of TTX. B: response of p_RESneo2- gpNav 1.8 -transfected cells to increasing concentrations of deltamethrin in the presence (triangles) or absence (squares) of TTX.
  • SEQ ID NO: 1 is the DNA sequence of the rat Nav 1.8 channel gene and SEQ ID NO: 2 is the amino acid sequence that it encodes. These sequences are publicly available from GenBank under accession number X92184. 0 SEQ ED NO: 3 is the DNA sequence of the human Nav 1.8 channel gene and
  • SEQ ID NO: 4 is the amino acid sequence that it encodes. These sequences are publicly available from GenBank under accession number AF117907.
  • SEQ ID NO: 5 is a DNA sequence of the human Nav 1.8 channel gene, including the 5' and 3 ⁇ UTR regions. This sequence differs from that of SEQ ID NO: s 3 as follows: T1738C, T2835C, G3114A, C3218T, A3351G, T5205C, C5715T.
  • SEQ ID NO: 6 is the amino acid sequence encoded by SEQ ID NO: 5. This differs from SEQ ID NO: 4 at A1073V.
  • SEQ ID NO: 7 is the DNA sequence of the rat pli gene and SEQ ID NO: 8 is the amino acid sequence that it encodes. These sequences are publicly available from o GenBank under accession number J03627.
  • SEQ ID NO: 9 is the DNA sequence of the human pi 1 gene and SEQ ID NO: 10 is the amino acid sequence that it encodes. These sequences are publicly available from GenBank under accession number NM_002966.
  • SEQ ID Nos 11 to 16 show primers used in the Examples below.
  • 5 SEQ ID NO: 17 is the DNA sequence of the guinea pig Navl.8 channel gene and SEQ ID NO: 18 is the amino acid sequence that it encodes.
  • the present mvention relates generally to cells capable of functionally o expressing the Nav 1.8 sodium channel. As described in more detail below, such cells may be exploited, inter alia, in screening methods for the identification of modulators of the Nav 1.8 channel.
  • the present application relates to the regulation or modulation of functional 5 expression of sodium channels, in particular voltage gated sodium channels (VGSCs).
  • VGSCs voltage gated sodium channels
  • the present invention relates to the Nav 1.8 sodium channel (also refe ⁇ ed to as the Na v 1.8 sodium channel).
  • the amino acid sequences for the rat and human Nav 1.8 channels and their encoding nucleotide sequences are publicly 0 available.
  • the nucleotide and amino acid sequences for rat Nav 1.8 are given in SEQ ED Nos: 1 and 2 respectively and the nucleotide and amino acid sequences for human Nav 1.8 are given in SEQ ID Nos: 3/5 and 4/6 respectively.
  • a suitable Nav 1.8 channel for use in the methods ot the invention may be any of these Nav 1.8 channels or a species or allelic variant of any thereof.
  • the proteins (or nucleic acids) employed in the present invention may therefore also be a variant of any of these o Nav 1.8 channels which retains activity as a sodium chamiel.
  • a suitable channel may have greater than 65%, greater than 70%, greater than 75%, greater than 85%;, greater than 95% or greater than 98% amino acid identity with the rat, human or Guinea pig Nav 1.8 sequences.
  • a functional variant may be a modified version of a Nav 1.8 polypeptide 5 which may have, for example, amino acid substitutions, deletions or additions. Such substitutions, deletions or additions may be made, for example, to the sequences of the rat, human or Guinea pig Nav 1.8 polypeptides shown in SEQ ID NOs 2, 4, 6 and 18. Any deletions, additions or substitutions must still allow the Nav 1.8 channel to function. That is, any deletions, additions or substitutions should allow the Nav 1.8 o channel to bind pl i and to function as a sodium channel.
  • At least 1 , at least 2, at least 3, at least 5, at least 10, at least 20 or at least 50 amino acid substitutions or deletions may be made up to a maximum of 70 or 50 or 30. For example, from 1 to 70, from 2 to 50, from 3 to 30 or from 5 to 20 amino acid substitutions or deletions may be made. Typically, if substitutions are made, the substitutions will be conservative substitutions, for example accordmg to the following Table. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other. Deletions are preferably deletions of amino acids from regions not involved in the interaction with pi 1 or regions not necessary for sodium channel function.
  • a suitable variant channel is one which retains sodium channel function.
  • a suitable variant of a Nav 1.8 sodium channel may have the normal function of a voltage gated sodium channel (VGSC), for example the ability to mediate a sodium current across a membrane.
  • VGSC voltage gated sodium channel
  • the function of a VGSC may be measured as described below. It may also retain the tetrodotoxin insensitivity of the Nav 1.8 channel.
  • a suitable variant preferably also retains the ability to bind pl i.
  • a suitable variant channel may retain the intracellular domain of a wild type Nav 1.8 channel.
  • a prefe ⁇ ed variant of the rat Nav 1.8 channel may retain the N-terminal intracellular domain found at positions 1 to 127 of SEQ ID NO: 2.
  • a suitable variant channel may have a sequence comprising amino acids 53 to 127 or amino acids 75 to 102 of SEQ ED NO: 2, which are known to be involved in binding to pi 1 protein, or a species or allelic variant of this region.
  • a suitable variant Nav 1.8 channel may be a fragment of a wild type Nav 1.8 channel or of a variant thereof as described above.
  • a suitable fragment may be a 5 truncated channel, wherein, for example, 1%, 2%, 5%, 10%, 15%, 20%, 25%, 50% or more of the original Nav 1.8 sequence has been removed.
  • a suitable fragment may consist of or comprise a fragment of a full length Nav 1.8 channel, for example, 1%, 2%, 5%, 10%, 15%, 20%, 25%, 50% or more of a full length sequence.
  • a suitable fragment may be any fragment which retains the ability to bind a pi 1 0 peptide.
  • a suitable fragment may also retain the ability to function as a sodium ' channel.
  • a fragment may be, for example, 10, 20, 30, 50, 75, 100, 150, 200, 300, 500, 750, 1000, 1500 or more amino acids in length.
  • a . suitable Nav 1.8 chaimel may comprise a fragment of a wild-type or variant Nav 1.8 sequence as part of its aniino acid sequence. Such a variant will retain the s ability to bind pl i, and the ability to act as a sodium channel.
  • a fragment which retains the ability to bind pl i may be derived from the intracellular domain of the full-length channel. Such a fragment may include the entire intracellular domain or a part thereof.
  • a prefe ⁇ ed fragment of the Nav 1.8 channel may comprise at least part of the N-terminal intracellular domain, for example amino acids 1 to 127 of SEQ ID o NO: 2.
  • fragments represent sequences which are believed to be either unique to the channel, or are at least well conserved between Nav 1.8 channels.
  • Prefe ⁇ ed fragments of SEQ ID NO: 2 include amino acid positions 1 to 25, 26 to 50 and 51 to 127.
  • a fragment which retains the ability to bind pl i may consist of or comprise the sequence of amino acids 53 to 127 or 75 to 102 of SEQ ID NO: 2. 5 Such a fragment may be, for example, 28 to 50, 28 to 100, 28 to 200, 28 to 500, 28 to 1000 amino acids in length or larger.
  • a suitable fragment may comprise a part of the sequence of amino acids 53 to 127 or 75 to 102, for example, 5, 10, 15, 20, or 25 contiguous ammo acids from this region or from a variant of tins region as defined above, which retain the ability to bind pli.
  • a Nav 1.8 channel for use in the invention has an amino acid sequence comprising: (a) the amino acid sequence of SEQ ID NO: 2, 4, 6 or 18;
  • Such a VGSC will retain the ability to bmd a pi 1 protein and to mediate a Na + current across a membrane, such as the plasma membrane of the cell.
  • the term "derived" includes variants produced by modification of the authentic native sequence e.g. by introducing changes into the 0 full-length or part-length sequence, for example substitutions, insertions, and/or deletions.
  • Tins may be achieved by any appropriate technique, including restriction of the sequence with an endonuclease followed by the insertion of a selected base sequence (using linkers if required) and ligation. Also possible is PCR-mediated mutagenesis using mutant primers. It -may, forhrstance, be preferable to add in or s remove restriction sites in order to facilitate further cloning. There may be up to five, for example up to ten or up to twenty or more nucleotide deletions, insertions and/or substitutions made to the full-length or part length sequence provided functionality is not totally lost.
  • Parameters are preferably set, using the 5 default matrix, as follows: Gapopen (penalty for the first residue in a gap): - 16 for DNA; Gapext (penalty for additional residues in a gap): -4 for DNA KTUP word length: 6 for DNA.
  • homology in this context can be judged by probing under appropriate stringency conditions.
  • One common formula for calculating the stringency conditions required to achieve hybridization between (complementary) o nucleic acid molecules of a specified sequence homology is (Sambrook et al., 1989):
  • T m 81.5°C + 16.6Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex.
  • Preferred conditions will give hybridisation of molecules at least 70% homology as described above.
  • Peptides or polypeptides of the invention, or variants thereof, may be chemically modified, for example, post-translationally modified.
  • they 5 may be glycosylated or comprise modified amino acid residues.
  • They can be in a variety of forms of polypeptide derivatives, including amides and conjugates with polypeptides.
  • Chemically modified proteins or functional variants thereof also include those having one or more residues chemically derivatized by reaction of a functional side 0 group.
  • Such derivatized side groups include those which have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t- butyloxycarbonyl groups, chloroacetyl groups and formyl groups.
  • Free carboxyl groups may be derivatized to form salts, methyl and ethyl esters or other types of esters or hydrazides.
  • Free hydroxyl groups may be derivatized to form Oracyl-or O- * s alkyl derivatives.
  • the imidazole nitrogen of histidine may be derivatized to form N- im-benzylhistidine.
  • chemically modified proteins or functional variants thereof are those which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids.
  • 4-hydroxyproline may be substituted for o proline or homoserine may be substituted for serine.
  • the present invention also encompasses the use of nucleic acids which encode Nav 1.8 channels of the invention to produce such proteins.
  • nucleic acids which encode Nav 1.8 channels of the invention to produce such proteins.
  • 5 provided in the sequence listing are nucleic acid sequences encoding the rat Nav 1.8 channel (SEQ ID NO: 1), the human Nav 1.8 channel (SEQ ID NO: 3 / SEQ ID NO: 5) and the Guinea pig Nav 1.8 channel (SEQ ID NO: 17).
  • the mvention relates to test compounds and putative modulators, such compounds and modulators may be in the form of peptides of proteins. Such peptides or proteins o may be provided by expression of nucleic acids that encode them.
  • the nucleic acids of die mvention may consist essentially of a sequence encoding a Nav 1.8 channel, or may comprise further nucleic acid sequences.
  • the nucleic acids may comprise additional sequences normally located 3' or 5' to the coding sequence of the gene of interest. Such sequences may be from the 3' and/or 5' untranslated region (UTR) of the gene.
  • 5 a nucleic acid of the invention may comprise a sequence from the 3 ' UTR of the Nav 1.8 gene, a sequence from the 5 ' UTR of the Nav 1.8 gene, or both 3 ' and 5 ' UTR sequences from the Nav 1.8 gene.
  • a nucleic acid of the invention comprises the 3' UTR of a Nav 1.8 gene or a functional variant of such a 3' UTR, operably linked to the region encoding the Nav 1.8 channel.
  • the nucleic acids of the invention may include the naturally occurring
  • a nucleic acid encoding Nav 1.8 may additionally comprise one or both of the sequences located at nucleotides 1 to 413 and 6285 to 6841 of the human Nav 1.8 sequence given in SFQ ' ⁇ D NOX5 or One or both of the" sequences 1 to 413 and 6287 5 to 6841 of SEQ ID NO: 5.
  • a nucleic acid encoding a Nav 1.8 channel may additionally comprise one or both of the sequences located at nucleotides 1 to 203 and 6078 to 6524 of the rat Nav.1.8 sequence given in SEQ ID NO. 1 or one or both of the sequences 1 to 203 and 6075 to 6524 of SEQ ID NO: 1.
  • a nucleic acid encoding a Nav 1.8 channel may additionally o comprise one or both of the sequences located at nucleotides 1 to 247 and 6077 to
  • nucleic acid encoding Nav 1.8 may include a functional variant of any of these UTR sequences.
  • a sequence originating from 5' to a gene of interest will be located 5 5' to the gene in a nucleic acid of the invention and a sequence originating from 3 ' to a gene of interest will be located 3' to the gene in a nucleic acid of the invention. In a prefe ⁇ ed embodiment both 5' and 3' sequences will be present.
  • nucleic acids of, or for use in, the present invention may be provided isolated and/or purified from their natural environment, in substantially o pure or homogeneous form, or free or substantially free of other nucleic acids of the species of origin. Where used herein, the term “isolated” encompasses all of these possibilities.
  • Nucleic acid accordmg to the present mvention may be in the form of, or derived from, cDNA, RNA, genomic DNA and modified nucleic acids or nucleic acid analogs.
  • Nucleic acid sequences which encode a polypeptide in accordance with the 5 present invention can be readily prepared by the skilled person using the hiformation and references contained herein and techniques known in the art (for example, see Sambrook, Fritsch and Maniatis, "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1989, and Ausubel et al, Short Protocols in Molecular Biology, John Wiley and Sons, 1992). These techniques include (i) the o use of the polymerase chain reaction (PCR) to amplify samples of the relevant nucleic acid, e.g. from genomic sources, (ii) chemical synthesis, or (iii) preparation of cDNA sequences.
  • PCR polymerase chain reaction
  • the present invention provides cells that comprise a heterologous nucleic acid that enco es ' a Nav 1.8 channel and is operably linked to a promoter.
  • the s invention relates to use of a heterologous nucleic acid molecule which comprises a nucleotide sequence encoding a Nav 1.8 chamiel described above, in the various methods of the invention.
  • heterologous is used broadly herein to indicate that the gene/sequence of nucleotides in question have been introduced into cells using o genetic engineering, i.e. by human intervention.
  • a heterologous gene may replace an endogenous equivalent gene, i.e. one which normally performs the same or a similar function, or the inserted sequence may be additional to the endogenous gene or other sequence.
  • Nucleic acid heterologous to a cell may be non-naturally occurring in cells of that type, variety or species.
  • 5 Heterologous expression may be achieved by transfection with a vector as described herein that allows expression of a polypeptide of the invention. Alternatively, heterologous expression may be achieved by activating one or more endogenous genes in the cell that are normally not expressed.
  • expression of an endogenous gene may be upregulated o artificially. This may be achieved by methods l ⁇ iown in the art, for example by targeting one or more transcription factors to bhid to the desired gene(s), e.g. the endogenous Nav 1.8 gene, in the genome of the cell.
  • Suitable transcription factors may comprise a domain capable of binding specifically to the gene of interest, e.g. a zinc finger domain, and a functional domain that can regulate expression of the gene.
  • a transcription factor may be introduced into a cell as a protein or may be expressed from encoding DNA introduced into a cell.
  • Suitable transcription factors may be generated using the ZFP technology of Sangamo BioSciences, Inc. (www.sangamo.com).
  • UTRs Untranslated Regions
  • the present inventors have also identified and cloned the 5' and 3' UTRs of the human and guinea pig Nav 1.8 genes. When either, or both, of these UTRs are operably linked to the sequence encoding Nav 1.8 they result in an increase in the stability of Nav 1.8 expression in the cell lines of the invention. That is in the presence of the 5 - and/or 3' UTR the expression of the Nav 1.8 channel is maintained over a longer period of time than in the absence of the UTR.
  • the present invention provides for the use of the 5' and/or 3' UTRs of human Nav 1.8 and functional variants of these sequences to increase the stability of Nav 1.8 expression hi the cell lines of the invention.
  • the sequence of the human UTRs is provided in SEQ ED No: 5.
  • the sequence of the 5' UTR is given at nucleotides 1 to 413 of SEQ ID No: 5.
  • the sequence of the 3' UTR is given at nucleotides 6285 to 6841 or 6287 to 6841 of SEQ ID No: 5.
  • the invention therefore provides a nucleic acid comprising the nucleotide sequence of nucleotides 1 to 413 and/or 6285 to 6841 of SEQ ID No: 5 or a nucleic acid compsrising the nucleotide sequence of nucleotides 1 to 413 and/or 6287 to 6841 of SEQ ID NO: 5.
  • the invention provides vectors and cell lines comprising such sequences and their use in the methods of the invention.
  • the invention also provides functional variants of the human 5' and 3' Nav 1.8 UTRs.
  • a functional variant of a human Nav 1.8 UTR sequence is one that, when operably linked to the Nav 1.8 encoding region in a cell line of the invention, results in Nav 1.8 expression being maintained for longer than when the variant UTR is absent.
  • Nav 1.8 expression typically starts to decline later and/or at a lower rate than when an equivalent nucleic acid is employed which lacks the UTR.
  • a functional variant has the same effect on Nav
  • the functional variant may result in a higher or lower increase in stability than the naturally occurring UTR, but as long as it produces increased Nav 1.8 stability in comparison to in the absence of the UTR it may be considered a functional variant.
  • the increase in Nav 1.8 stability that occurs when the UTRs are present can be measured at the protein level.
  • Nav 1.8 protein will typically be present in the cell for a longer period of time as a result of the inclusion of the UTR than in the absence of the UTR.
  • Nav 1.8 expression hiay begin to " decline later or at a lowerrate than in-an s equivalent cell line transformed with a construct lacking the UTR.
  • the increase in stability of protein expression may, for example, be measured by Western blotting.
  • the levels of Navl.8 may, for example, take twice, five times, or ten times longer to decline than in the control.
  • the UTRs may exert their effect at the level of mRNA o stability. Thus in the presence of the UTRs the half-life of the mRNA is increased.
  • the stability of the transcript encoding Nav 1.8 may be greater than in the absence of the variant UTR.
  • the half-life of transcripts with the UTR may, for example, be twice, three, 5 five or ten times as long than that of the stability of the same RNA lacking the UTR.
  • the increases in mRNA stability and/or amounts may be measured by any suitable technique. Northern blotting, RT-PCR or real-time PCR may be used to demonstrate an increase in the total amount of Nav 1.8 encoding mRNA present.
  • the increase in the stability of Nav 1.8 expression may also be measured at 0 the functional level.
  • the level of sodium current across the membrane may be maintained at a given level for longer in the presence of the UTR because levels of Nav 1.8 are maintained.
  • a control construct lacking the UTR may result in a cell line where the sodium flux decreases before the equivalent cell line transformed with a construct including the UTR.
  • the rate of decline may also be steeper in the control cell line.
  • the variants of the UTRs may be produced by any sequence changes from the naturally occurring UTRs that result in a variant that is still functional.
  • the variant may be produced by nucleotide substitations, insertions or deletions.
  • the variant may have for example from 1, 2 or 3 to 10, 25, 50 or 100 nucleotide substitutions, deletions or insertions in comparison to the naturally occurring UTR sequence.
  • Various deletions, insertions and duplications may be made to the naturally occurring sequence in order to produce the variant UTRs.
  • the variants of the UTRs employed may be fragments of the naturally occurring UTRs or may co ⁇ espond to variant sequences of shorter regions of the whole l ⁇ att ⁇ rally occurring UTR.
  • the fragments maf, for example ' !; be from 50 to " 500 ⁇ preferably from 100 to 400 and more preferably from 200 to 300 bases of the naturally occurring UTR or of a variant region of the naturally occurring UTR.
  • the variant UTRs may, for example, have a degree of nucleotide sequence homology to the naturally occu ⁇ ing sequence of the UTR of at least 60%, preferably at least 75%, more preferably at least 80% homology to the naturally occu ⁇ ing UTR. In some cases the degree of homology may be preferably at least 85, 90%, 95%, 97% or 99% homology, for example over a region of at least 15, 20, 30, 100 more contiguous nucleotides.
  • a variant of the human 5' UTR will have at least 75%, more preferably at least 80%, even more preferably at least 90% and still more preferably at least 975 homology to the human 5' UTR.
  • the variant may, for example, show such levels of homology to nucleotides 1 to 413 of SEQ ID No: 5 .
  • variants of the human .3' UTR may have similar levels of homology to the naturally occurring human 3 ' UTR and in particular at least 69%, preferably at least 75%, more preferably at least 85% homology and even more preferably at least 95% homology to the human 3' UTR.
  • the variant may, for example, show such levels of homology to nucleotides 6287 to 6841 or nucleotides 6285 to 6841 of SEQ ID No: 5.
  • the present invention also provides a nucleic acid comprising the complement of the sequence of nucleotides 1 to 413 of SEQ ID No: 5 and/or nucleotides 6285 to 6841 of SEQ ID No: 5 or a nucleic acid comprising the complement of the sequence of nucleotides 1 to 413 of SEQ ID NO: 5 and/or nucleotides 6287 to 6841 of SEQ ID NO: 5.
  • the invention further provides the complement of any of the variant UTR sequences discussed.
  • Sequences which are capable of selectively hybridizing to the sequence of nucleotides 1 to 413 of SEQ ID No: 5 and/or nucleotides 6287 to 6841 of SEQ ID No: 5 and/or nucleotides 6285 to 6841 of SEQ ID NO: 5 are also provided as are sequences capable of selectively hybridizing to the variant UTR sequences discussed.
  • Selective hybridisation means that generally the polynucleotide can hybridize to the relevant polynucie ⁇ tide, or portibn thereof, -at a level "significantly above background. '
  • the signal level generated by the interaction between the polynucleotides is typically at least 10 fold, preferably at least 100 fold, as intense as interactions between other polynucleotides.
  • the intensity of interaction may be measured, for example, by radiolabelling the polynucleotide, e.g. with P.
  • Selective hybridisation is typically achieved using conditions of medium to high stringency (for example 0.03M sodium chloride and 0.003M sodium citrate at from about 50°C to about 60°C).
  • nucleic acids of the invention may comprise UTRs from the Nav 1.8 genes of other species and their functional variants.
  • nucleic acids may be used in the cell lines and methods of the invention.
  • the variants may be as defined above in relation to the human Nav 1.8 UTRs.
  • the rat UTRs may be employed in the nucleic acids of the invention.
  • the nucleic acid may comprise one or both of the sequences located at nucleotides 1 to 203 and 6075 to 6524 of the rat Nav.1.8 sequence given in SEQ
  • ED NO. 1 one or both of the sequences located at nucleotides 1 to 203 and 6087 to 6524 of SEQ ID NO: 1, or may comprise a functional variant of either, or both, UTRs.
  • the invention also provides vectors and cell lines comprising such sequences.
  • the Guinea pig UTRs may be employed in the nucleic acids of the invention.
  • the nucleic acid may comprise one or both of the sequences located at nucleotides 1 to 247 and 6077 to 6631 of the Guinea pig Nav 1.8 sequence given in SEQ ID NO: 17 or may comprise a functional variant of either or both UTRs.
  • the invention also provides vectors or cell lines comprising such sequences.
  • the 5 ' or 3 ' UTR Nav 1.8 sequences employed in the invention may be derived from the same organism as the region encoding the Nav 1.8 gene. Alternatively, a 5' or 3' sequence may be derived from a different organism or may be a variant of a naturally occu ⁇ ing 5' or 3 ' sequence. hi one embodiment the whole of the naturally occuring 5 'UTR and/or 3' UTR of a Nav 1.8 gene will be employed in the nucleic acids of the invention. Techniques such as -RACE (Rapid Amplification of cDNA Ends) may be used to clone the.UTRs. so that they can be used in the invention. In some cases, the full UTR may not be available and a partial length UTR may be employed as long as it results in an increase in the stability of Nav 1.8 expression compared to stability of expression in its absence.
  • -RACE Rapid Amplification of cDNA Ends
  • a heterologous nucleic acid may be introduced into a cell by any method known in the art, for example as described below.
  • the heterologous nucleic acid is introduced in the form of a nucleic acid construct which is introduced into a suitable cell.
  • the cell may be transfected with such a contract.
  • a suitable nucleic acid construct may be any construct that is capable of expressing the Nav 1.8 gene.
  • the Nav 1.8 channel is introduced into a cell by causing or allowing the expression in the cell of an expression construct or vector.
  • a test peptide or polypeptide may be introduced by causing or allowing the expression in a cell of an expression construct or vector that includes a sequence encoding the test peptide or polypeptide.
  • a construct for delivery of a nucleic acid of the invention may include any other regulatory sequences or structural elements as would commonly be included in such a system, and as is described below.
  • the vector components will usually include, but are not limited to, one or more of an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence.
  • nucleic acid sequences which enable a vector to replicate in one or more selected host cells are well known for a variety of bacteria, yeast, and viruses.
  • various viral origins SV40, polyoma, adenovirus, VSV or BPV are useful for cloning vectors in mammalian cells.
  • an expression vector e.g. in the form of a plasmid, cosmid, viral particle, phage, or any other suitable vector or construct which can be taken up by a cell' and used to 'express a coding sequence.
  • Expression. vectors usually contain a promoter which is operably linked to the protein-encoding nucleic acid sequence of interest, so as to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. "Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional control" of the promoter.
  • Transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), from heterologous mammalian promoters, e.g. the actin promoter or an immunoglobulin promoter, and from heat-shock promoters, provided such promoters are compatible with the host cell systems.
  • viruses such as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), from heterologous ma
  • Expression vectors of the invention may also contain -one or more selection genes. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins e.g. ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available 5 from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
  • reporter genes which may be any suitable reporter gene used in the art.
  • reporter genes include chloramphemcol acetyl rransferase (CAT), ⁇ -galactosidase, luciferase or GFP.
  • Nucleic acid constructs for example plasmids or other expression vectors of o the invention may remain in the cells of the invention or may integrate into the host genome. Such constructs may make use of one or more components of the expression systems of the host genome in order to allow expression of the Nav 1.8 gene of the construct.
  • Suitable ' vectors of the " invention include the following: 5 pIRESneo2-rNavl.8 (incl 5 ' and 3 ' UTR) pcDNAS.l-rNavl.8 (incl 5' and 3' UTR) pIRESneo2-hNavl.8 pIRESneo2-hNavl.8+3 'UTR pIRESneo2-hNavl.8+5 'UTR o pIRESneo2-hNavl.8+5 'UTR+3 'UTR pcDNA3.1-rNavl.8
  • High throughput screening of Nav 1.8 channels requires stable, functional 5 expression of cloned Nav 1.8 channels in an appropriate cell line, since primary DRG neurons are not suitable for this purpose.
  • Primary, sympathetic neurons provide a context in which ectopically expressed Nav 1.8 channels are fully functional i.e. have properties identical to those of endogenous Nav 1.8 channels. However, these primary neurons are not suitable for high throughput screening.
  • Ectopic expression o of Nav 1.8 channels can also be provoked in COS cells or CHO cells, both of which are used extensively as vehicles to generate stable cell lines for high throughput screens, hi these contexts, however, the expressed current is different from that in cells that endogenously express Nav 1.8.
  • Suitable cells or cell lines for use in the invention are those which endogenously express pl i.
  • pl i is a member of the S-100 family small calcium binding proteins
  • pi 1 is also known as annexin-H light chain, lipocortin-II light chain, calpactin I light chain, 42C, or S-100 related protem, and these terms may be used interchangeably herein. It is present in a variety of cells separately or as a o heterotetramer.
  • the heterotetramer is composed of two copies of p36, also known as annexin-II or calpactin-I heavy chain, and two copies of pi 1.
  • the cells of the invention endogenously express pl i. That is, under the culture conditions, the cells express pli protein from its encoding DNA within the genome of the cell, either constitutively or upon stimulation
  • the pl i gene itself is 5 not artificially introduced into the cell.
  • a suitable pl i protein may be a full-length pl i protem or a species or allelic variant thereof.
  • a suitable pli may have the rat amino acid sequence of SEQ ID NO: 8 or the human amino acid sequence of SEQ ID NO: 10.
  • a suitable pl i protein may be a species or allelic variant of one of these pli sequences. o
  • the pli protein should be expressed from the endogenous pl i gene in the genome of the cell.
  • the endogenous pli gene may be a naturally occu ⁇ ing pl i gene or may have been artificially modified or mutated.
  • a cell expressing such a variant is suitable for use in the present invention if the cell expresses pli from its endogenous genomic pl i gene at a sufficient level to allow Nav 1.8 channels expressed from a 5 vector of the invention to mediate a sodium current across a membrane of the cell.
  • Modified pli proteins may have a sequence at least 70% identical to the sequence of an endogenous pl i such as rat or human pli sequences of SEQ ID Nos. 8 and 10 respectively. Typically there would be 75% or more, 85% or more, 95% or more or 98% or more identity between the modified sequence and the authentic o sequence.
  • a variant may comprise a fragment of a naturally occurring pl i sequence.
  • a variant pi 1 peptide may comprise amino acids 33 to 77 of SEQ ID NO: 8 which are believed to be involved in the modification of Nav 1.8 functional expression.
  • variant pi 1 peptides comprising variants, for example allelic or species variants of such fragments.
  • a functional variant may be a modified version of a pi 1 polypeptide which may have, for example, amino acid substitutions, deletions or additions. Such substitutions, deletions or additions may be made, for example, to the sequences of the rat or human pli polypeptides shown in SEQ ID NOs 8 and 10. Any deletions, additions or substitutions must still allow the pi 1 peptide to function. That is, any deletions, additions or substitutions should allow the pi 1 channel to bind Nav 1.8 and allow it to function as a sodium channel. At least 1, at least 2, at least 3, at least 5, at least 10, at least 20 or at least 30 amino acid substitutions or deletions, for example, may be made up to a maximum of 50 or 40 or 30. For example, from 1 to 50, from 2 to 40, from 3 to 30 or from 5 to 20 amino acid substitutions or deletions may be made. Typicallycif substitutions are made, ⁇ the substitutions will be conservative substitutions, for example as explained in the Table above.
  • a suitable variant pl i may be a fragment of a wild type p 11 or of a variant thereof as described above.
  • a suitable fragment may be a truncated pi 1, wherein, for example, 1%, 2%, 5%, 10%, 15%, 20%, 25%, 50% or more of the originalpl l sequence has been removed.
  • a suitable fragment may consist of or comprise a fragment of a full length pi 1, for example, 1%, 2%, 5%, 10%, 15%, 20%, 25%, 50% or more of a full length sequence.
  • a suitable fragment may be any fragment which retains the ability to bind a VGSC.
  • a fragment may be, for example, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70 80, 90 or more amino acids in length.
  • a suitable pi 1 may comprise a fragment of a wild-type or variant pi 1 sequence as part of its amino acid sequence. Such a variant will retain the ability to bind a Nav 1.8 channel and allow the channel to mediate a sodium current across a membrane.
  • a pi 1 fragment which retains the ability to bind VGSC may consist of or comprise the sequence of amino acids 33 to 77 of SEQ BD NO: 8. Such a pi 1 fragment may be, for example, 44 to 50, 44 to 60, 44 to 70, 44 to 80 amino acids in length or larger.
  • a suitable pli fragment may comprise a part of the sequence of aniino acids 33 to 77 of SEQ ID NO: 8, for example, 5, 10, 15, 20, 25, 20, 40 or more amino acids from this region which retain the ability to bind VGSC.
  • a suitable variant pl i sequence may be derived as described above.
  • a suitable cell is therefore a cell that endogenously expresses pi 1 at a sufficient level to allow Nav 1.8 channels to be functionally expressed within said cell. That is, the level of pi 1 should be sufficient to allow the Nav 1.8 channels to mediate a sodium current across a membrane of the cell. The ability to mediate such a current may be assessed by the methods described in more detail below.
  • the sodium current may be a tetrodotoxin-resistant sodium current.
  • the cell or cell line is from or is derived from a neural source.
  • the cell may be from a neuroblastoma cell line.
  • Neuroblastic tumours are derived from primordial neural crest cells which ultimately populate the s) ⁇ npathetic ganglia, adrenal medulla and other sites.
  • Various neuroblastoma cell lines have been established from such tumours, mainly from metastitic tumour populations. These ⁇ cell lines -are ' capable of unlimited proliferation, in vitro and have in many eases . retained some aspect of neuronal morphology or function. They are also amenable to transfection.
  • Prefe ⁇ ed neuroblastoma cell lines include SH-S Y5 Y (Cancer Research, 1978; 38: 3751 andJ Nat. Cancer Institute 1983; 71: 741) and BE(2)-C (Cancer Research 1978; 38: 3751).
  • SH-S Y5Y (ECACC No. 94030304) is a thrice-cloned sub-line of bone marrow biopsy derived line SK-N-SH (ECACC No. 86012802).
  • SH- S Y5 Y has dopamine-beta-hydroxylase activity and can convert glutamate to the neurotaransmitter GABA.
  • SH-SY5Y will form tumours in nude mice in approximately 3-4 weeks.
  • BE(2)-C (ECACC No.
  • a cell line of the invention may be a SH-SY5Y cell line that stably expresses human Navl .8. Such a cell line may be utilised in an assay as described herein, for example an assay for compounds capable of modulating, preferably inhibiting, membrane depolarisation mediated via the Navl .8 channel.
  • Cells for use in the methods of the invention may be obtained by providing such a suitable pi 1 -expressing cell, and introducing into said cell a nucleic acid construct of the invention that comprises a sequence encoding a Nav 1.8 channel. 5 Further cells of the invention may be produced by culturing such transfected cells and by allowing them to proliferate. The progeny of a cell of the invention will preferably also carry the heterologous nucleic acid of the invention and will retain the ability to express functional Nav 1.8 sodium channels. Cells of the invention may be further modified, for example by cell fusion. For example, a neuroblastoma cell of l o the invention may be fused with another cell to form a hybrid cell using methods known in ffte art. The present invention provides cells obtained or obtainable by such methods.
  • tra ⁇ sf rmation may employ any available technique.
  • Fo is eukaryotic cells, suitable techniques may mclude calcium phosphate transfection, DEAE-Dextran, electroporation, lipo some-mediated transfection and transduction using retro virus or other virus, e.g. vaccinia or, for insect cells, baculo virus.
  • retro virus or other virus e.g. vaccinia or, for insect cells, baculo virus.
  • the calcium phosphate precipitation method of Graham and van der Eb, Virology 52:456-457 (1978) can be employed.
  • General aspects of mammalian cell 0 host system fransformations have been described in U.S. Patent No. 4,399,216.
  • the cells used hi methods of the present invention may be present in, or extracted from, organisms, or may be cells or cell lines transiently or permanently 5 transfected with the appropriate nucleic acids.
  • the term "in vivo" where used herein includes all these possibilities.
  • in vivo methods may be performed in a suitably responsive cell line which expresses the Nav 1.8 channel from a vector introduced mto the cell.
  • the cell line may be in tissue culture or may be, for example, a cell line xenograft in a non-human animal subject.
  • the cell lines used in assays of the invention may be used to achieve transient expression of Nav 1.8 or may be stably transfected with constructs which express a Nav 1.8 protein. Means to generate stably transformed cell lines are well known in the art and such means may be used here.
  • the present invention therefore encompasses cells in which Nav 1.8 proteins and pi 1 peptides are expressed such that the two proteins interact to upregulate the 5 functional expression of the Nav 1.8 channel. Such cells are suitable for use in the screening methods of the invention.
  • Cells of the invention may be cultured in conventional nutrient media.
  • the culture conditions such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation, hi general, principles, protocols, o and practical techniques for maximizing the productivity of cell cultures can be found in "Mammalian Cell Biotechnology: a Practical Approach", M. Butler, ed. JRL Press, (1991) and Sambrook et al, supra.
  • the cells of the invention may comprise any of the nucleic acids of the invention.
  • the cell may be one in which the heterologous nucleic acid.
  • s comprises the 5' and/or 3' untranslated region (UTR) of a Nav 1.8 gene or a functional variant of the 5' and/or 3' UTR of a Nav 1.8 gene, said UTR or variant UTR being operably linked to the region encoding the Nav 1.8 channel.
  • the cell may be one in which the heterologous nucleic acid comprises the sequence of nucleotides 1 to 413 of SEQ ID NO: 5, nucleotides 1 o to 203 of SEQ ID NO: 1 or nucleotides 1 to 247 of SEQ ID NO: 17, or a functional variant of any thereof, located 5' to a sequence encoding a Nav 1.8 channel.
  • the cell may be one in which the heterologous nucleic acid comprises the sequence of nucleotides 6287 to 6841 of SEQ ID NO: 5, nucleotides 6285 to 6841 of SEQ ED NO: 5, nucleotides 6075 to 6524 of SEQ ID NO: 1, 5 nucleotides 6078 to 6524 of SEQ ID NO: 1 or nucleotides 6077 to 6631 of SEQ ID NO: 17, or a functional variant of any thereof, located 3' to a sequence encoding a Nav 1.8 channel.
  • the cell may be one where the heterologous nucleic acid comprises the sequence of nucleotides 1 to 413 of SEQ ID o NO: 5, nucleotides 1 to 203 of SEQ ID NO: 1 or nucleotides 1 to 247 of SEQ ED NO: 17, or a functional variant of any thereof, located 5' to a sequence encoding a Nav 1.8 channel and the sequence of nucleotides 6287 to 6841 of SEQ ED NO: 5, nucleotides 6285 to 6841 of SEQ ID NO: 5, nucleotides 6075 to 6524 of SEQ ID NO: 1 nucleotides 6078 to 6524 of SEQ ID NO: 1 or nucleotides 6077 to 6631 of SEQ ID NO: 17, or a functional variant of any thereof, located 3' to a sequence encoding a Nav 1.8 channel.
  • the heterologous nucleic acid of the cell may be an expression vector.
  • the expression vector may be selected from pIRESneo2-rNavl.8, pcDNA3.1-rNavl.8, pIRESneo2-hNavl.8 and pcDNA3.1- hNavl.8.
  • the expression vector may comprise any of the prefe ⁇ ed heterologous nucleic acids listed above.
  • the Nav 1.8 channel has an amino acid sequence comprising:
  • heterologous nucleic acid in the celll comprises the sequence of SEQ ID NO: 1, 3, 5 or 17.
  • a cell of the invention may be a cell that does not endogenously express pi 1, but in which expression of pi 1 is stimulated, for example from the endogenous pi 1 gene, by introduction of a pi 1 polypeptide directly into the cell or via the introduction of a nucleic acid or vector capable of expressing pl i into the cell.
  • a cell may thus be made to express both pl i and Navl .8.
  • the pl i may be introduced into such a cell at the same time as, or separately from, the Navl .8.
  • a pi 1 or Navl.8 nucleotide or amino acid sequence may be any such sequence described herein. Suitable vectors for the introduction of the pi 1 and Navl .8 sequences into a cell are described herein.
  • such a cell will comprise a vector capable of expressing pli and a second vector, capable of expressing Navl .8, which comprises one or both of the 3' and 5' Navl.8 UTR sequences as described herein.
  • a suitable cell may be any cell which does not endogenously express pl i or Navl.8, for example an in vitro cell line such as a CHO cell.
  • One aspect of the present invention is based on the functional Nav 1.8 expression which can be achieved using the cells of the invention. This effect can be used to generate assays.
  • Such systems e.g. cell lines
  • Modulating herein includes any effect on the functional expression of a channel. This includes blocking or inhibiting the activity of the chaimel in the presence of, or in response to, an appropriate stimulator. Alternatively modulators may enhance the activity of the channel. Prefe ⁇ ed modulators are channel blockers or inhibitors.
  • the screening methods described herein generally assess whether a test compound or putative modulator is capable of causing a change in an activity of a Nav 1.8 channel. Any activity normally exhibited by a Nav 1.8 channel may be measured. For example, a suitable activity may be the ability to function as a sodium channel. This may be measured using methods known in the art such as those described herein.
  • a test compound may affect the ability of the channel to produce a sodium current across a membrane in which the channel is present.
  • a test compound may modulate the membrane depolarization normally mediated via the chamiel.
  • Such assays may include the application of a specific stimulus, for example a stimulus which would normally result in sodium current flow.
  • the present aspect of the invention may take the form of any, preferably in vivo, assay utilising the functional Nav 1.8 expression which can be achieved using the cells of the invention.
  • the term "in vivo" includes cell lines and the like as described above.
  • This assay is carried out in a cell in which the functional expression of Nav 1.8 has been allowed by exposure to an endogenously expressed pi 1 peptide. 5
  • the Nav 1.8 protein may be expressed under the control of an inducible promoter so that the level of Nav 1.8 expressed within the cell may be regulated.
  • the precise format of the assays of the invention may be varied by those of skill in the art 0 using routine skill and knowledge.
  • the invention therefore provides methods of modulating a Nav 1.8 chamiel that is functionally expressed in a pi 1 expressing cell line which method comprises the step of contacting said channel with a putative modulator thereof.
  • the contacting step may be in vivo or in vitro, as described in more detail 5 below.
  • Suitable systems for testing modulation (e.g. inhibition or blockage) of Nav 1.8 are disclosed e.g. in WO 97/01577.
  • Membrane currents are conveniently measured with the whole-cell configuration of the patch clamp method, according to the procedure detailed in the Examples.
  • Prefe ⁇ ed voltage clamps are those in which the cell potential is stepped from the holding potential of about -90 mV to test o potentials that range from about -110 mV to +60 to 80 mV.
  • TTX- R sodium cu ⁇ ents TTX
  • 4-amh ⁇ opyridine (AP) and CdCl 2 were used with tetraethyl ammonium ions (TEA), and Cs.
  • AP 4-amh ⁇ opyridine
  • CdCl 2 tetraethyl ammonium ions
  • Navl.8 can also be conveniently measured by membrane potential 5 readout using a membrane potential sensitive fluorescent dye.
  • a method for identifying a modulator of Nav 1.8 which method comprises the steps of:
  • the measured activity is the ability of the Nav 1.8 chaimel to mediate a sodium cu ⁇ ent across a membrane.
  • a decrease in the activity of the Nav 1.8 channel indicates that the test compound is an inhibitor of the Nav 1.8 channel.
  • the activity before and after the contacting with the test compound will be compared, and optionally the relative activity will be correlated with the modulatory activity of the test compound.
  • Compounds may therefore be identified that are capable of modulating the activity of a Nav 1.8 channel. Such compounds may have therapeutic use in the treatment or prevention of conditions associated with Nav 1.8 activity as described in more detail below.
  • the method may comprise the steps of:
  • An inhibition in the cu ⁇ ent indicates that the compound as a potential modulator of Nav 1.8 activity.
  • Such a compound may have therapeutic use in the treatment or prevention of conditions associated with Nav 1.8 activity, as described in more detail below.
  • the above methods may furtlier comprise the step of formulating said test compound as a pharmaceutical composition.
  • the method may further comprise administering said formulation to an individual for the treatment of pain.
  • Test substances may be used in an initial screen of, for example, 10 substances per reaction, and the substances of these batches which show inhibition tested individually.
  • Test substances may be used at a concentration of from InM to lOOO ⁇ M, preferably from l ⁇ M to lOO ⁇ M, more preferably from l ⁇ M to lO ⁇ M.
  • An inhibitor of Nav 1.8 activity is one which produces a measurable reduction in an activity of Nav 1.8, for example in a method described herein.
  • An inhibitor of Nav 1.8 is one which causes the activity of Nav 1.8, for example the ability of the Nav 1.8 to mediate a sodium cu ⁇ ent across a membrane, to be reduced or substantially eliminated, as compared to the activity in the absence of that inhibitor.
  • Prefe ⁇ ed inhibitors are those which inhibit the activity by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%), at least 95% or at least 99% at a concentration of the inhibitor of 1 ⁇ g l '1 , 10 ⁇ gml "1 , 100 ⁇ gml "1 , 500 ⁇ gml "1 , 1 mgrnl '1 , 10 mgml "1 , lOOm ml "1 .
  • the percentage inhibition represents, for example, the percentage decrease in sodium current mediated by the Nav 1.8 channel in a comparison of assays in the presence and absence of the test substance.
  • test substances which show activity in methods of the invention can be tested in in vivo systems, such as an animal disease model. Thus, candidate inhibitors could be tested for their ability to treat pain. Thus it can be determined -> whether test substances identified by methods of the invention are effective analgesic agents.
  • the invention also provides a compound identified by a method of the invention.
  • Methods of the present invention may be employed in high throughput screens analogous to those well known in the art.
  • any compounds may be used which may have an effect on Nav 1.8 functional expression.
  • Such an effect may, for example, be mediated by a direct effect on the channel, or indirectly by blocking or preventing the interaction between pl i and the Nav 1.8 channel.
  • a compound for use in dowmegulating functional expression of Nav 1.8 may be a compound which binds specifically to Nav 1.8 and/or the pi 1 peptide.
  • such a compound may bind to the intracellular domain of the Nav 1.8 channel, such as in the region of amino acids 53 to 127 or 75 to 102 of the rat Nav 1.8 sodium channel as given in SEQ ID NO: 2, or an equivalent region of a variant channel, or may bind in the region of amino acids 33 to 77 of a pi 1 peptide as given in SEQ ID NO: 8, or an equivalent region of a variant pli peptide.
  • a compound may therefore prevent binding between the Nav 1.8 chaimel and the pi 1 peptide and thereby prevent or inhibit the Nav 1.8 functional expression normally 5 caused by pl i.
  • Compounds (putative modulators) which may be used may be natural or synthetic chemical compounds used in drug screening programmes. Exfracts of plants which contain several characterised or uncharacterised components may also be used. In prefe ⁇ ed embodiments the substances may be provided e.g. as the o product of a combinatorial library such as are now well known in the art (see e.g.
  • the amount of putative modulator compound which may be added to an assay of the invention will normally be determined by trial and e ⁇ or depending upon the type of compound used. Typically, from about 0.01 to TOO nM " concentrations of putative-modulator s compound may be used, for example from 0.1 to 10 nM. Modulator compounds may be those winch either agonise or antagonise the interaction. Antagonists (hihibitors) of the interaction are particularly desirable.
  • Modulators which are putative inhibitor compounds can be derived from the pl i and Nav 1.8 protein sequences themselves.
  • Peptide fragments of from 5 to 40 0 amino acids, for example from 6 to 10 amino acids from the region of pi 1 and Nav 1.8 winch are responsible for the interaction between these proteins may be tested for then ability to disrupt this interaction.
  • such peptides may be derived from the intracellular domain of the Nav 1.8 chaimel such as the region of amino acids 53 to 127 or 75 to 102 of the rat Navl.8 sodium channel as given in SEQ ID 5 NO: 2, or from amino acids 33 to 77 of the rat pi 1 protein as given in SEQ ID NO: 8.
  • jAntibodies directed to the site of interaction in either protein or to regions in Nav 1.8 necessary for sodium channel activity form a further class of putative inhibitor compounds.
  • Candidate inhibitor antibodies may be characterised and their binding regions determined to provide single chain antibodies and fragments thereof o which are responsible for disrupting the interaction between p 11 and Nav 1.8 or for otherwise preventing or inhibiting Nav 1.8 channel activity.
  • a suitable antibody may bind to either the Nav 1.8 channel or the pi 1 peptide, and thereby prevent or block the interaction between these molecules.
  • Antibodies may be raised against specific epitopes of the Nav 1.8 or pi 1 peptide of the invention. For example, antibodies may be raised specifically against those regions, as described above, which are involved in the interaction between the Nav 1.8 channel and the p 11 peptide.
  • i Antibodies of the invention can be produced by any suitable method. Means for preparing and characterising antibodies are well known in the art, see for example Harlow and Lane ⁇ (198S) "Antibodies: A Laboratory Manual", Cold Spring Harbor " Laboratory Press, Cold Spring Harbor, NY. For example, an antibody may be produced by raising antibody in a host animal against the whole pol3 eptide or a fragment thereof, for example an antigenic epitope thereof, herein after the "immunogen".
  • a method for producing a polyclonal antibody comprises immunising a suitable host animal, for example an experimental animal, with the immunogen and isolating immunoglobulins from the animal's serum.
  • the animal may therefore be inoculated with the immunogen, blood subsequently removed from the animal and the IgG fraction purified.
  • a method for producing a monoclonal antibody comprises immortalising cells which produce the desired antibody.
  • Hybridoma cells may be produced by fusing spleen cells from an inoculated experimental animal with tumour cells (Kohler and Milstein (1975) Nature 256, 495-497).
  • An immortalized cell producing the desired antibody may be selected by a conventional procedure.
  • the hybridomas may be grown in culture or injected intraperitoneally for formation of ascites fluid or into the blood stream of an allogenic host or immunocompromised host.
  • Human antibody may be prepared by in vitro immunisation of human lymphocytes, followed by transformation of the lymphocytes with Epstein-Barr virus.
  • the experimental animal is suitably a goat, rabbit, rat or mouse.
  • the 5 immunogen may be administered as a conjugate in which the immunogen is coupled, for example via a side chain of one of the ammo acid residues, to a suitable carrier.
  • the carrier molecule is typically a physiologically acceptable carrier.
  • the antibody obtained may be isolated and, if desired, purified.
  • An antibody, or other compound "specifically binds" to a protein when it i o binds with preferential or high affinity to the protein for which it is specific but does substantially bind not bind or binds with only low affinity to other proteins.
  • immunoassays typically involve the formation of complexes between the specific protein and its antibody and the measurement of complex fo ⁇ nation.
  • decreased functional expression of a Nav 1.8 channel may be achieved by inhibiting the expression from the Nav 1.8 gene.
  • down- regulation of expression of a target gene may be achieved using anti-sense o technology or RNA interference.
  • a nucleotide sequence is placed under the confrol of a promoter in a "reverse orientation" such that transcription yields RNA which is complementary to normal mRNA transcribed from the "sense" strand of the target gene. See, for 5 example, Smith et ⁇ /,(1988) Nature 334, 724-726. Such methods would use a nucleotide sequence which is complementary to the coding sequence. Further options for down regulation of gene expression include the use of ribozymes, e.g.
  • RNA interference is based on the use of small double stranded RNA (dsRNA) duplexes known as small interfering or silencing RNAs (siRNAs). Such molecules are capable of inhibiting the expression of a target gene that they share sequence identity or homology to.
  • dsRNA small double stranded RNA
  • siRNAs small interfering or silencing RNAs
  • the dsRNA may be introduced into cells by techniques such as microinjection or transfection.
  • Methods of RNA interference are described in, for example, Hannon (2002) RNA Interference, Nature 418: 244-251 and Elbashir et al (2001) Duplexes of 21 -nucleotide RNAs mediate RNA interferenec in cultured mammalian cells, Nature 411: 494-498.
  • such methods may further include the step of testing the viability of the cells in the assay e.g. by use of a lactate dehydrogenase assay kit (Sigma). Tins step may provide, an indication of any " interference by the test agent of vital cellular functions.
  • Nav 1.8 modulator is intended to encompass any and all of the above modulator compounds which may be identified using any of the assays or design methods of the invention.
  • Such Nav 1.8 modulators identified by the methods of the present invention may be isolated, purified, formulated in a composition, such as a pharmaceutical composition, and/or used in therapy as described below.
  • Nav 1.8 modulators as described above may be provided isolated and/or purified from their natural environment, in substantially pure or homogeneous form, or free or substantially free of other materials from their source or origin. Where used herein, the term “isolated” encompasses all of these possibilities. They may optionally be labeled or conjugated to other compounds. Nav 1.8 modulators may be provided in substantially purified form. They may be in substantially isolated form, in which case they will generally comprise at least 80%, e.g. at least 90, 95, 97 or
  • the product is typically substantially free of other cellular components.
  • the product may be used in such a substantially isolated, purified or free fonn in the methods of the invention.
  • the Nav 1.8 modulators can be formulated into pharmaceutical compositions.
  • These compositions may comprise, in addition to one of the above substances, a 5 pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
  • the precise nature of the carrier or other material may depend on the route of administration, e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
  • Pharmaceutical compositions for oral administration may be in tablet, capsule, powder or liquid fonn.
  • a tablet may include a solid carrier such as gelatin or an adjuvant.
  • solid oral forms may contain, together with the active compound, diluents, e.g. lactose, dextrose, saccharose, cellulose, corn starch or potato starch; lubricants; e.g. silica, talc, stearic-acid, magnesium or calcium- stearate, s and/or polyethylene glycols; binding agents; e.g. starches, gum arabic, gelatin, methylcellulose, carboxymethylcellulose or polyvinyl py ⁇ olidone; disaggregating agents, e.g.
  • diluents e.g. lactose, dextrose, saccharose, cellulose, corn starch or potato starch
  • lubricants e.g. silica, talc, stearic-acid, magnesium or calcium- stearate, s and/or polyethylene glycols
  • binding agents e.g. starches, gum arabic, gelatin, methylcellulose, carboxymethylcellulose
  • Such pharmaceutical preparations may be manufactured in known manner, for example, by means of mixing, granulating, tabletting, sugar-coating, or film-coating processes.
  • Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological 5 salhie solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included. Liquid dispersions for oral administration may be syrups, emulsions or suspensions. The syrups may contain as earners, for example, saccharose or saccharose with glycerine and/or mannitol and/or sorbitol.
  • Suspensions and emulsions may contain as carrier, for o example a natural gum, agar, sodium alginate, pectin, methylcellulose, carboxymethylcellulose, or polyvinyl alcohol.
  • the suspensions or solutions for intramuscular injections may contain, together with the active compound, a pharmaceutically acceptable carrier, e.g. sterile water, olive oil, ethyl oleate, glycols, e.g. propylene glycol, and if desired, a suitable amount of lidocaine hydrochloride.
  • the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability.
  • Solutions for intravenous administration or infusion may contain as carrier, for example, sterile water or preferably they may be in the form of sterile, aqueous, isotonic saline solutions.
  • isotonic vehicles such as Sodimn Chloride Injection, Ringer's Injection, Lactated Ringer's Injection.
  • Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included, as required.
  • the modulators may be included in a pharmaceutical composition for formulated for slow release, ' such _& in microcapsules formed from biocompatible polymers or in liposomal carrier systems according to methods known in the art.
  • the peptide may be covalently conjugated to a water soluble polymer, such as a polylactide or biodegradable hydrogel derived from an amphipathic block copolymer, as described in U.S. Pat. No. 5,320,840.
  • Collagen-based matrix implants such as described in U.S. Pat. No. 5,024,841, are also useful for sustained delivery of peptide therapeutics.
  • a composition that includes a biodegradable polymer that is self-curing and that forms an implant in situ, after delivery in liquid form. Such a composition is described, for example in U.S. Pat. No. 5,278,202.
  • transdermal iontophoresis may preferably be administered by transdermal iontophoresis.
  • transdermal delivery This form of delivery can be effected according to methods known in the art.
  • transdermal delivery involves the use of a transdennal "patch" which allows for slow delivery of compound to a selected skin region.
  • patches are generally used to provide systemic delivery of compound, in the context of the present invention, such site-directed delivery can be expected to provide increased concentration of compound in selected regions of neurite proliferation.
  • Examples of 5 transdermal patch delivery systems are provided by U.S. Pat. No. 4,655,766 (fluid- imbibing osmotically driven system), and U.S. Pat. No. 5,004,610 (rate controlled transdermal delivery system).
  • transdermal delivery of peptides transdermal delivery may preferably be ' carried out using iontophoretic methods, such as described in U.S. Pat. No. 5,032,109 0 (electrolytic fransdermal delivery system), and in U.S. Pat. No. 5,314,502 (electrically powered iontophoretic delivery device).
  • permeation enhancing substances such as fat soluble substances (e.g., aliphatic carboxylic acids, aliphatic alcohols " ),- or water soluble substances (e.g-., alkane polyols such as ethylene glycol,. s 1,3-propanediol, glycerol, propylene glycol, and the like).
  • fat soluble substances e.g., aliphatic carboxylic acids, aliphatic alcohols "
  • water soluble substances e.g-., alkane polyols such as ethylene glycol,. s 1,3-propanediol, glycerol, propylene glycol, and the like.
  • a "super water-absorbent resin” may be added to transdermal formulations to further enhance fransdermal delivery.
  • Such resins include, but are not limited to, polyacrylates, saponified vinyl acetate-acrylic acid ester copolymers, cross-linked polyvinyl alcohol-maleic anhydride copolymers, o saponified polyacrylonitrile graft polymers, starch acrylic acid graft polymers, and the like.
  • Such formulations may be provided as occluded dressings to the region of interest, or may be provided in one or more of the transdermal patch configurations described above.
  • the compound is administered by epidural 5 injection.
  • Membrane permeation enhancing means can include, for example, liposomal encapsulation of the peptide, addition of a surfactant to the composition, or addition of an ion-pairing agent.
  • a membrane permeability enhancing means that includes administering to the subject a hypertonic dosing solution effective to disrupt meningeal barriers.
  • the modulators can also be administered by slow infusion. This method is particularly useful, when admmisfration is via the intrathecal or epidural routes mentioned above.
  • Implantable or body-mountable pumps useful in delivering compound at a regulated rate. One such pump described in U.S.
  • Pat. No. 4,619,652 is a body-mountable pump that can be used to deliver compound at a tonic flow rate or at periodic pulses.
  • An injection site directly beneath 5 the pump is provided to deliver compound to the area of need, for example, to the perineural region.
  • the modulators may be given orally or by nasal insufflation, according to methods known in the art.
  • administration is preferably in a "prophylactically effective amount” or a “t ⁇ erapeutically effective amount” (as “the case-may be, although s prophylaxis may be considered therapy), this being sufficient to show benefit to the individual.
  • a prophylaxis may be considered therapy
  • the actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g.
  • these agents could be produced in the 5 target cells by expression from an encoding gene introduced into the cells, e.g. in a viral vector (a variant of the VDEPT technique- see below).
  • the vector could be targeted to the specific cells to be treated, or it could contain regulatory elements which are switched on more or less selectively by the target cells.
  • the agent could be administered in a precursor form, for o conversion to the active form by an activating agent produced in, or targeted to, the cells to be treated.
  • an activating agent produced in, or targeted to, the cells to be treated.
  • This type of approach is sometimes known as ADEPT or VDEPT; the former involving targeting the activating agent to the cells by conjugation to a cell-specific antibody, while the latter involves producing the activating agent, e.g. an enzyme, in a vector by expression from encoding DNA in a viral vector (see for example, EP-A-415731 and WO90/07936).
  • Nav 1.8 modulators may be useful in the freatment or prophylaxis of a wide range of disorders.
  • the present invention provides a pharmaceutical composition comprising a Nav 1.8 modulator and its use in methods of therapy or diagnosis.
  • the present invention provides a pharmaceutical composition comprising one or more Nav 1.8 modulators as defined above and its use in methods of therapy or diagnosis.
  • the invention includes a method of producing analgesia in a mammalian subject, which method includes administering to the subject a Nav 1.8 " modulator of the present invention.”
  • Modulators of the channel may prevenl transmission of impulses along sensory neurons and thereby be useful in the treatment or prevention of acute, chronic or neuropathic pain.
  • Acute pain is temporary, generally lasting a few seconds or longer. Acute pain usually starts suddenly and is generally a signal of rapid-onset injury to the body or intense smooth muscle activity. Acute pain can rapidly evolve into chronic pain. Chronic pain generally occurs over a longer time period such as weeks, months or years.
  • the Nav 1.8 modulators of the invention may be used in the treatment or prevention of acute or chronic pain, or to prevent acute pain evolving into chronic pain.
  • Treatment of pain is intended to include any level of relief from the symptoms of pain, from a decrease in the level of pain to complete loss of the pain.
  • Prevention includes the prevention of the onset of pain, and the prevention of the worsening of pain, for example the worsening of pain symptoms or the progression from acute pain to chronic pain.
  • Examples of types of chronic pain which may be treated or prevented with the Nav 1.8 modulators of the present invention include osteoarthritis, rheumatoid artliritis, neuropathic pain, cancer pain, trigeminal neuralgia, primary and secondary hyperalgesia, inflaminatory pain, nociceptive pain, tabes dorsalis, phantom limb pain, spinal cord injury pain, central pain, post-herpetic pain and HIV pain, noncardiac chest pain, irritable bowel syndrome and pain associated with bowel disorders.
  • a method of preventing progression of pain in a subject at risk for developing such pain comprising administerhig to the subject a Nav 1.8 modulator of the present invention.
  • a composition may be administered alone or in combination with other treatments (e.g. treatments having analgesic effect such as NSAIDS), either simultaneously, separately or sequentially, dependent upon the condition to be freated.
  • treatments having analgesic effect such as NSAIDS
  • Rat Nav 1.8 (rNav 1.8) cDNA was obtained from John Wood, University College London (Akopian et al 1996 Nature 379: 257) and transfe ⁇ ed into pcDNA3.1 (InVifrogen, UK) and ⁇ IRESneo2 (BD Clontech, UK) using standard subcloning procedures.
  • Human Nav 1.8 (hNav 1.8) cDNA was obtained using human DRG RNA (Analytical Biological Services) as template for SmartTM cDNA synthesis (BD Clontech UK) followed by specific amplification of hNav 1.8 using Advantage Tag Polymerase (BD Clontech UK), based upon the sequence information in the public database.
  • 5' and 3' UTR sequences of hNavl.8 were obtained employing the SMART RACE PCR kit (BD Clontech, UK). 5 ' RACE PCR was carried out using the gene s specific primer Rv27: 5'GCAGCTGGTTGCAGGCTTTCAAGTC3' whilst 3' RACE PCR was carried out using the gene specific primer FW19:
  • Deletion fragments of the 3' UTR of human Navl.8 were generated by PCR l o using KOD polymerase with the plasmid pIRESneo2-hNavl .8+5'UTR+3 'UTR (see above) as template. PCR was carried out over 20 cycles (1 min at 92 oC, 1 min at 55 oC and 2 mins at 72 oC each) followed by a 5 min incubation at 72 oC. Fragments were purified by agarose gel electrophoresis and incubated for 10 min at 72 °C in a "final volurriAof 60 ⁇ l ' -witli Taq polymerase in tile presence of 2.5 mM dATP. Four ⁇ !
  • PCRJI InVitrogen
  • the nucleotide sequence of guinea pig Navl.8 is given in SEQ ID NO: 17.
  • the amino acid sequence encoded by that nucleotide sequence is given in SEQ ID NO: 18.
  • SH-SY5Y cells (ECACC No. 94030304) were maintained in Medium A (Ham's F12.-EMEM (EBSS) (1:1) + 2mM Gutamine + 1% Non Essential Amino Acids + 15% Foetal Bovine Serum).
  • Medium A Ham's F12.-EMEM (EBSS) (1:1) + 2mM Gutamine + 1% Non Essential Amino Acids + 15% Foetal Bovine Serum.
  • BE(2)-C cells (ECACC No. 95011817) were maintained in EMEM (EBSS) +1% non essential amino acids: Ham's F12 (1:1) +2mM glutamine +15% FBS (heat activated).
  • Kelly cells (ECACC No. 92110411) were maintained in DMEM +2mM glutamine +10% FBS.
  • ND7/23 cells (ECACC No. 92090903) and ND 8/34 cells (ECACC No. 92090904) were maintained hi DMEM +2mM glutamine +10% FBS.
  • CHO-S cells and RT4-B8 cells were maintained in DMEM +5% FBS.
  • pIRESneo2-rNavl.8 (incl 5 ' and 3 ' UTR): a Kpnl-Xbal fragment representing rNavl .8, blunt ended on both ends and cloned into the EcoRV site of pIRESneo2.
  • the vector pIRESneo2 was obtained from Clontech.
  • pcDNA3.1-rNavl.8 (incl 5 ' and 3 ' UTR): a Kpnl-Xbal fragment representing - rNavl .8 cloned into pcDNA3.1 cut with Kpnl and Xbal.
  • the vector pcDNA3.1 was obtained form Invitrogen Life Technologies.
  • pIRESneo2-hNavl.8 a fragment representing the coding domain of hNavl.8 cut with Clal and Notl, with the Clal site blunt ended, cloned into pIRESneo2 cut with EcoRV and Notl.
  • pIRESneo2-hNavl.8+3 'UTR An EcoNi-Notl fragment was taken from pCRII- 3 'UTR and transfe ⁇ ed mto pIRESneo2-hNavl .8 cut with EcoNI and Notl.
  • pIRESneo2-hNavl.8+5'UTR A 1973 bp BamHI fragment was taken from hNavl.8 coding domain and cloned into the pCRII-5'UTR. A Notl-Nhe fragment was taken from the resulting clone with the Notl site blunt ended. This fragment was cloned into pIRESneo2-hNavl.8 cut with Clal and Nhel with the Clal site blunt ended.
  • pIRESneo2-hNavl.8+5 'UTR+3 'UTR As for pIRESneo2-hNavl.8+5' UTR except that the NotI(blunf)-NheI fragment was cloned into ⁇ ERESneo2-hNavl.8+3'UTR cut with Clal and Nhel with the Clal site blunt ended.
  • pcDNA3.l-I.Nav 1.8 aKpnl-Notl fragment representing hNavl.8 coding domain cloned into pcDNA3.1 cut with Kpnl and Notl
  • SH-SY5Y cells i o were fransfected, incubated with actinomycin D or left untreated and then harvested for determination of the levels of Navl.8 mRNA. mRNA levels were measured by RT-PCR. mRNA stability was scored as the relative level of Navl.8 mRNA in Actinomycin D treated samples compared to untreated samples at each time point.
  • One ⁇ g of total RNA was reverse transcribed using AMV reverse transcriptase (Promega) in a final reaction o volume of 20 ⁇ l.
  • Cyclophilin mRNA levels were determined by PCR using 1 ⁇ l of cDNA as template and 1 mM primers in 30 cycles consisting of three temperature steps (30 sec at 94°C, 30 sec at 58°C and 3 min at 72°C) followed by a single 10 min extension at 72°C.
  • Nav 1.8 mRNA levels were measured using 2 ⁇ l of cDNA as template under the same conditions.
  • 5 Rat Navl.8 PCR was done with primers 5 ⁇ GAATCCGGGGAGTTGGA3' and 5'GTGACACTC/GTCATAGGA3 ⁇ resulting in a 1 kb fragment.
  • Human Navl.8 PCR was done using either the internal Navl.8 primers 5'TCCTCAGACTGATCCGAG3' and 5'TGTTGACCACGATGAGGAAGGAGAT3' (398 bp fragment) or using the o internal Na v l .8 primer 5 ' CTGATCC AGATGGACCTG3 ' in combination with a vector primer 5'TGGATCAGTTATCTATGCGG3' (1 kb fragment), pi 1 PCR was done with primers 5'GTCACATATGCCATCTCAAATGGAACAC3' and 5'TGACTGACGGATCCTTCTATGGGGGAAGCTGTGG3' (360bp amplified fragment) and cyclophilin PCR was done with 5 ⁇ CCCCACCGTGTTCTTCGAC3' and 5'CATTTGCCATGGACAAGATG3' primers (300 bp amplified fragment).
  • cells were washed and incubated in 100 ⁇ l buffer A (145mM TMA-C1 (Sigma), 2mM CaCl 2 , 0.8 mM MgCl 2 , lOmM Hepes, lOmM glucose, 5mM KCl, (Calbiochem), 14% (v/v) MPD, 0.3M Brilliant black, deltamethrin and sodium channel inhibitors at concentrations indicated in the results section) for 30-min at room temperature.
  • buffer A 145mM TMA-C1 (Sigma), 2mM CaCl 2 , 0.8 mM MgCl 2 , lOmM Hepes, lOmM glucose, 5mM KCl, (Calbiochem), 14% (v/v) MPD, 0.3M Brilliant black, deltamethrin and sodium channel inhibitors at concentrations indicated in the results section
  • TTX- resistance experiments TTX (Sigma) was present at 250nM final centration.
  • the extracellular recording solution contained the following (in mM): NaCl (140), TEA (20), HEPES (10), CaCl 2 (1) MgCl 2 (1), CdCI 2 (1), KCl (3), o tetrodotoxin (0.001).
  • the solution was buffered to pH 7.3 by addition of NaOH and the osmolarity was set to 320 mOsm by addition of sucrose.
  • the intracellular solution contained the following (in mM): CsF (140),EGTA-Na (1), HEPES (10) NaCl (10).
  • the solution was buffered to pH 7.3 by addition of CsOH and the osmolarity set to 320 mOsm by addition of sucrose.
  • Chemicals were either AnalaR (BDH Merck Ltd, Lutterworth, Leistershire, UK) or Sigma (Poole, Dorset, UK).
  • TTX was obtained from Alomone Labs (TCS Biologicals, Botolph Claydon, Bucks, UK). Any 5 tetrodotoxin sensitive sodium current was eliminated from all recordings by includhig 0.001 mM tetrodotoxin in the extracellular media.
  • Electrodes were fabricated from thin- walled glass capillaries (GC150TF-10; Harvard apparatus, Edenbridge, Kent, UK) and had an access resistence of 1.5-2 M ⁇ when filled with recording solution.. Recordings were made using a HEKA 0 patch amplifier (HEKA electronic, Lambrecht, Germany). Pulse protocols were generated and data stored to disk using pulse software (HEKA) running on a G4 Mac computer. Cells were routinely held at -120 mV, or at a holding potential as specified in the text.
  • HEKA pulse software
  • Endogenous pi 1 in neuroblastoma cells lines and ectopic expression of rNav 1.8 To identify neuroblastoma cells lines with high levels of endogenous pl i expression, RT-PCR experiments were performed. Of four different cell lines, SY- SY5Y and BE(2)-C cells showed high levels of pi 1 expression which was o comparable to the levels observed in RNA from DRG tissue. By contrast, pl i expression in Kelly cells, ND8.34 cells, CHO cells, ND 7.23 cells and RT4-B8 cells was much lower. A cyclophilin RNA/cDNA quality control showed equal signals in all cell lines.
  • rNav 1.8 For ectopic expression studies, cells were transfected with pcDNA3.1 or with 5 pcDNA3.1 -rNav 1.8 and grown under G418 selection. Cells were harvested and the presence of rNav 1.8 mRNA was measured by RT-PCR. The presence of rNav 1.8 mRNA was observed in all cell lines after introduction of the expression construct, but not in cells transfected with vector alone. A cyclophilin RNA/cDNA quality confrol showed equal signals in all transfected populations. o Analysis of the functional expression of rNav 1.8 showed differences in Na + fluxes between the cell types.
  • SH-S Y5Y cells Figure 1 A
  • BE(2)-C cells Figure IB
  • SH-S Y5Y cells Figure 1 A
  • BE(2)-C cells Figure IB
  • TTX-resistant, deltamethrin induced Na + ion flux in parallel with the expression of rNav 1.8.
  • Kelly cells Figure IC
  • ND8.34 cells Figure ID
  • No changes in ion flux were observed in control cells, fransfected with pcDNA3.1 only ( Figure 1 A-D).
  • SH-SY5 Y and BE(2)-C cells are not only able to express Nav 1.8 mRNA but these cells are also able to support the functional expression of rNav 1.8.
  • Kelly cells and ND8.34 cells are not.
  • SH-SY5Y and BE(2)-C cells would provide a suitable context for functional expression of Navl.8.
  • SH-SY5Y 0 or BE(2)-C cells were transfected with pcDNA3.1 -rat Navl .8 or with vector alone, subjected to G418 selection and assayed for expression of rat Navl.8 by RT-PCR.
  • Cells transfected with pcDNA3.1 -rat Nav 1.8 contained rat Nav 1.8 mRNA whilst pcDNA3.1 -transfected cells did not ( Figure 2A and B, insets).
  • a cyclophilin RNA/cDNA quality control showed -equal signals in-all fransfected populations.
  • rat Nav 1.8 mRNA was observed in all cell types after introduction of the expression construct, but not in cells transfected with vector alone ( Figure 3 A and 5 B, insets).
  • a cyclophilin RNA/cDNA quality control showed equal signals in all transfected populations.
  • these cell populations contain significant levels of rat Navl .8 mRNA, no TTX-resistant deltamethrin-dependent depolarisation was obseived in either cell line, above the levels in control populations ( Figure 3 A and B). Identical observations were made in ND7.23 cells (not shown).
  • rat Nav 1.8 in SH-SY5Y neuiOblastoma cells 5 hi order to measure the cu ⁇ ent associated with expression of rNav 1.8, clonal lines were isolated of the above populations of G418 resistant SH-SY5Y cells transfected with pcDNA3.1 or with pcDNA3.1 -rNav 1.8. High expression of rNavl .8 was seen in clone 5, transfected with pcDN A3.1 -rNavl .8, but not in clone 1, transfected with pcDNA3.1 alone.
  • rNavl .8 is associated with the o presence of a TTX-resistant current ( Figure 4) with a reversal potential of -64 mV.
  • Clonal cell of the above cell populations of SH-SY5Y and BE(2)-C cells expressing rNavl .8 were compared.
  • the presence of Navl .8 mRNA in the clonal cell lines was confirmed by RT-PCR.
  • a deltamethrin-induced, TTX-resistant depolarisation was observed in both cell lines ( Figure 5A and C, Table 1).
  • a cell line containing just the vector was analysed in parallel. No deltamethrin-induced signal was observed in this line (not shown).
  • the signal observed in Navl.8 expressing cells represented the activity of Navl.8.
  • the average EC50 value for deltamethrin activation of rNavl.8 in two clonal SH-SY5Y cells was 95 nM (Table 1).
  • the EC50 value obtained in three clonal BE(2)-C cell lines was 510 nM (Table 1).
  • the expression of functional rNavl .8 was furtiier validated using
  • BUI 890 CL an inhibitor of voltage gated sodium channels (Carter et al. 2000 Proc Natl Acad Sci USA 97: 4944 - 4949).
  • BUI 890 CL inhibited the depolarisation in a concentration dependent manner with an IC50 value of 580 nM in SH-SY5Y and 780 nM in BE(2)-C cells ( Figure 5B and D, Table 2).
  • IC50 value 580 nM in SH-SY5Y and 780 nM in BE(2)-C cells
  • the SH-S Y5 Y expression system was used to test suitability for the functional expression of human Nav 1.8.
  • a cDNA representing human Nav 1.8 was o obtained by reverse transcription of RNA from adult DRG tissue and subsequent
  • FIG. 6 A shows that expression of hNav 1.8 is associated with the appearance of a TTX-resistant, deltamethrin activated Na + ion flux component in these cells. Moreover, a TTX-resistant Na + cu ⁇ ent was observed 0 hi pIRESneo2-hNav 1.8#4 ( Figure 6B) which could not be detected in pIRESneo2#l ( Figure 6C). Three further independent cell lines were derived all of which showed a deltamethi-in-activated, TTX-resistant depolarisation.
  • the EC50 for deltamethrin was 620 nM ( Figure 7, Table 1). As observed for rat Navl.8, the deltamethrin-induced depolarisation was'i ⁇ ihbited by BUI 890 CL and the IC50 value was 560 nM -( Figure- 5 7, Table 2). Thus SH-SY5Y cells are able to support functional expression of hNav 1.8.
  • the SH-SY5 Y expression system was used to test suitability for the functional expression of guinea pig human Navl .8.
  • a cDNA representing guinea pig Navl.8 was obtained by reverse transcription of RNA from guinea pig DRG tissue and- subsequent PC-R amplification of cDNA.using degenerate .primers based upon s conserved sequence motifs in the known sequences of Navl .8 of different mammalian species.
  • the resulting cDNA was transfe ⁇ ed into the mammalian expression vector pIRESneo2.
  • the cDNA was extended to include the 5' and 3' UTRs by RACE PCR using unique guinea pig sequence primers.
  • clonal lines were o established of cells transfected with pIRESneo2-gpNav 1.8 with UTR sequences.
  • Control cells displayed TTX-sensitive cu ⁇ ents and were devoid of TTX- resistant currents.
  • currents were evoked by 30 or 50 ms step depolarisations from the holding potential to between -80 and +80 mV with 10 mV intervals (Figure 8A) and the peak cu ⁇ ent amplitude from 4 independent cells was plotted against the step potential ( Figure 8B).
  • the threshold of activation of the rat Navl .8 encoded current was -50 mV with a maximal inward cu ⁇ ent at 10 mV and a reversal potential at 74.8 mV. (Table 3).
  • Navl .8 showed a very similar pharmacological profile to human Navl .8 with BUI 890 CL, tetracaine, NW-1029 and mexiletine being inhibitory and the other blockers ineffective.
  • BUI 890 CL showed the highest potency and the sensitivity to BUI 890 CL was identical for rat and human Navl .8 irrespective of the cell line (Table 2).
  • TTX did not inhibit Navl .8 across the concentration range tested (up to 100 0 ⁇ M).
  • BUI 890 CL was consistently most active in the Navl.8 depolarisation. assay followed by tetracaine, NW-1029, mexiletine and lamotrigine/carbamezapine/lidocaine.
  • the general pattern of inhibition of Navl.8 co ⁇ elates well with the capacity of the agents to inhibit batrachotoxin binding to ITX-sensitive sodium channels.
  • BUI 890 CL inhibits batrachotoxin 5 binding to Navl .2 with an IC50 value of 49 nM
  • NW1015 a very close analogue of NW-1029
  • NW1015 has an IC50 value of 8 ⁇ M
  • lamofrigine a value of 185.9 ⁇ M
  • carbamezapine a value of 190 ⁇ M
  • B ⁇ i 890 CL and lamofrigine block Nav 1.2 in a state dependent manner, acting on the inactivated but not the resting channel.
  • Mexiletine is more effective in reversing the mechanical allodynia associated with nerve ischaemia than either lidocaine or lamofrigine (Erichsen et al. 2003 Eur J Pharmacol 458: 275-282), a pattern similar to the one observed in vitro o for the effects of these drags on Navl .8 function.
  • NW-1029 reverses the mechanical allodynia induced by chronic inflammation or by chronic construction of the sciatic nerve (Veneroni et al. 2003 Pahi 102: 17-25) and crobenetine and mexiletine reverse the mechanical joint hyperalgesia (Laird et al. 2001 Br. J. Pharmacol 134: 1742- 1748). Altogether this data is consistent with an involvement of Navl.8 in nociceptive signalling.
  • the hNavl.8 coding domain was extended into the 3' UTR up to the poly A tail.
  • a SH-S Y5 Y cell line was then established with the vector pIRESneo2-hNavl.8 + 3' UTR.
  • a tetrodotoxin-resistant current was measured in this cell line ( Figure 9) when compared with a control cell line ( Figure 6C). Over time, this current remained detectable in this cell line indicating that the presence of the 3' o UTR results in increased stability of Nav 1.8 expression.
  • Navl.8 constructs flanked by different portions of the UTR sequence were 5 introduced into SH-SY5 Y cells and Navl .8 mRNA levels were determined.
  • Four lirs o of Actinomycin treatment did not change mRNA levels in cells transfected with a
  • Navl .8 construct containing the full 3'UTR sequence up to the poly A tail.
  • Actinomycin treatment did not change mRNA levels in cells transfected with a Navl.8 construct containing the 3'UTR sequence up to nucleotide 469.
  • four hrs of Actinomycin treatment changed mRNA levels in cells fransfected with a Navl.8 construct containing the 3'UTR sequence up to nucleotide 260.
  • Further deletion of the 3'UTR up to nucleotide 154 restored the levels of mRNA.
  • the data suggest that the 3 'UTR contains elements that affect the stability of Navl .8 mRNA. These elements may be recognition elements for proteins or regions involved in RNA hairpin fonnation. The function of these proteins or hairpins is to destabilise or stabilise the RNA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des lignées cellulaires exprimant les canaux sodium Nav 1.8 fonctionnels. L'invention concerne plus particulièrement un procédé permettant d'identifier un modulateur du canal Nav 1.8. La première phase (a) de ce procédé consiste à mettre un composé test en contact avec une cellule comprenant un acide nucléique hétérologue portant une séquence codant un canal Nav 1.8. Dans ce cas, l'acide nucléique hétérologue comprend une région non traduite 3' et/ou 5' du gène Nav 1.8 ou une variante fonctionnelle de la région non traduite 3' et/ou 5' du gène Nav 1.8, cette région ou sa variante étant fonctionnellement reliée à la région codant le canal Nav 1.8. En outre, la cellule exprime le p11 provenant d'un gène endogène à un niveau suffisant pour permettre au canal Nav 1.8 exprimé depuis cet acide nucléique hétérologue de servir de médiateur à un courant sodium traversant une membrane de la cellule. La deuxième phase (b) de ce procédé consiste à mesurer une activité du canal Nav 1.8, un changement de l'activité du canal par rapport à l'activité en l'absence du composé de test indiquant que le composé du test est un modulateur du canal Nav 1.8.
PCT/GB2004/001458 2003-04-02 2004-04-02 Lignees cellulaires WO2004087956A2 (fr)

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
GB0307632A GB0307632D0 (en) 2003-04-02 2003-04-02 Chemical compounds
GB0307632.0 2003-04-02
GB0307633.8 2003-04-02
GB0307633A GB0307633D0 (en) 2003-04-02 2003-04-02 Chemical compounds
US47557003P 2003-06-04 2003-06-04
US60/475,570 2003-06-04
US48573503P 2003-07-10 2003-07-10
US48573003P 2003-07-10 2003-07-10
US60/485,735 2003-07-10
US60/485,730 2003-07-10

Publications (2)

Publication Number Publication Date
WO2004087956A2 true WO2004087956A2 (fr) 2004-10-14
WO2004087956A3 WO2004087956A3 (fr) 2005-03-03

Family

ID=32303749

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2004/001458 WO2004087956A2 (fr) 2003-04-02 2004-04-02 Lignees cellulaires

Country Status (2)

Country Link
GB (1) GB2400103A (fr)
WO (1) WO2004087956A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006047687A2 (fr) * 2004-10-27 2006-05-04 Schering Corporation Composition et technique d'inhibition d'acides nucleiques courts a interference de nav1.8
EP1942948A2 (fr) * 2005-11-04 2008-07-16 Alnylam Pharmaceuticals Inc. Compositions et methodes pour inhiber l'expression du gene nav1.8

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR3007762B1 (fr) * 2013-06-28 2015-09-04 Galderma Res & Dev Anticorps diriges contre le canal sodique nav1.9 humain et leurs utilisations pour le diagnostic des maladies cutanees inflammatoires
FR3007656B1 (fr) * 2013-06-28 2015-06-26 Galderma Res & Dev Modulateurs du canal sodique nav1.9 pour le traitement d'une maladie cutanee inflammatoire et methodes diagnostiques
FR3007763A1 (fr) * 2013-06-28 2015-01-02 Galderma Res & Dev Anticorps diriges contre le canal sodique nav1.9 humain et leurs utilisations en diagnostic

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001044293A2 (fr) * 1999-12-17 2001-06-21 Glaxo Group Limited Proteines du canal sodium
WO2001068681A2 (fr) * 2000-03-14 2001-09-20 Glaxo Group Limited Proteines de canal ionique modifiees
DE10054878A1 (de) * 2000-11-06 2002-05-08 Boehringer Ingelheim Int Natriumkanäle vom Typus der peripheren Nerven
WO2003006103A2 (fr) * 2001-07-12 2003-01-23 Merck & Co., Inc. Stimulation du champ electrique de cellules eucaryotes
WO2003016917A2 (fr) * 2001-08-20 2003-02-27 University College London Regulateurs et modulateurs de canaux sodiques
WO2003037900A2 (fr) * 2001-11-01 2003-05-08 Icagen, Inc. Pyrazolopyrimidines

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9513180D0 (en) * 1995-06-28 1995-08-30 Univ London Ion channel
US6184349B1 (en) * 1995-10-11 2001-02-06 Syntex (Usa) Inc. Cloned peripheral nerve, tetrodotoxin-resistant sodium channel α-subunit
JPWO2003016907A1 (ja) * 2001-08-17 2004-12-02 エーザイ株式会社 生体試料中のラミニン５抗原の測定試薬及び測定方法

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001044293A2 (fr) * 1999-12-17 2001-06-21 Glaxo Group Limited Proteines du canal sodium
WO2001068681A2 (fr) * 2000-03-14 2001-09-20 Glaxo Group Limited Proteines de canal ionique modifiees
DE10054878A1 (de) * 2000-11-06 2002-05-08 Boehringer Ingelheim Int Natriumkanäle vom Typus der peripheren Nerven
WO2003006103A2 (fr) * 2001-07-12 2003-01-23 Merck & Co., Inc. Stimulation du champ electrique de cellules eucaryotes
WO2003016917A2 (fr) * 2001-08-20 2003-02-27 University College London Regulateurs et modulateurs de canaux sodiques
WO2003037900A2 (fr) * 2001-11-01 2003-05-08 Icagen, Inc. Pyrazolopyrimidines

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
BIRCH P J ET AL: "Strategies to identify ion channel modulators: Current and novel approaches to target neuropathic pain" DRUG DISCOVERY TODAY 01 MAY 2004 UNITED KINGDOM, vol. 9, no. 9, 1 May 2004 (2004-05-01), pages 410-418, XP002295892 ISSN: 1359-6446 *
DATABASE BIOSIS [Online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; 2002, ZHOU X ET AL: "VINPOCETINE, A POTENT AND USE-DEPENDENT BLOCKER OF TTX-RESISTANT NAV1.8 SODIUM CHANNELS." XP002300610 Database accession no. PREV200300326329 & SOCIETY FOR NEUROSCIENCE ABSTRACT VIEWER AND ITINERARY PLANNER, vol. 2002, 2002, pages Abstract No. 743.15 URL-http://sf, 32ND ANNUAL MEETING OF THE SOCIETY FOR NEUROSCIENCE; ORLANDO, FLORIDA, USA; NOVEMBER 02-07, 2002 *
DATABASE EMBL EBI; 29 December 2002 (2002-12-29), "Homo sapiens 3 BAC RP11-1114A3, complete sequence" XP002295894 Database accession no. AC137625 *
DATABASE EMBL EBI; SV: AC116038.2 29 June 2002 (2002-06-29), "Homo sapiens chromosome 3 clone RP11-134J21" XP002295893 Database accession no. AC116038 *
JOHN VICTORIA H ET AL: "Heterologous expression and functional analysis of rat Nav1.8 (SNS) voltage-gated sodium channels in the dorsal root ganglion neuroblastoma cell line ND7-23." NEUROPHARMACOLOGY. MAR 2004, vol. 46, no. 3, March 2004 (2004-03), pages 425-438, XP002295891 ISSN: 0028-3908 *
OKUSE K ET AL: "ANNEXIN II LIGHT CHAIN REGULATES SENSORY NEURON-SPECIFIC SODIUM CHANNEL EXPRESSION" NATURE, MACMILLAN JOURNALS LTD. LONDON, GB, vol. 417, no. 6889, 6 June 2002 (2002-06-06), pages 653-656, XP001121255 ISSN: 0028-0836 *
RABERT DOUGLAS K ET AL: "A tetrodotoxin-resistant voltage-gated sodium channel from human dorsal root ganglia, hPN3/SCN10A" PAIN, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 78, no. 2, November 1998 (1998-11), pages 107-114, XP002198530 ISSN: 0304-3959 *
ZHOU XIAOPING ET AL: "Vinpocetine is a potent blocker of rat NaV1.8 tetrodotoxin-resistant sodium channels." THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS. AUG 2003, vol. 306, no. 2, August 2003 (2003-08), pages 498-504, XP002295890 ISSN: 0022-3565 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006047687A2 (fr) * 2004-10-27 2006-05-04 Schering Corporation Composition et technique d'inhibition d'acides nucleiques courts a interference de nav1.8
WO2006047687A3 (fr) * 2004-10-27 2006-07-06 Schering Corp Composition et technique d'inhibition d'acides nucleiques courts a interference de nav1.8
US7786291B2 (en) 2004-10-27 2010-08-31 Schering Corporation Compositions and methods for short interfering nucleic acid inhibition of Nav1.8
EP2371954A1 (fr) * 2004-10-27 2011-10-05 Schering Corporation Compositions et procédés d'inhibition par des petits acides nucléiques interférents dirigés contre NAv1.8
CN101103112B (zh) * 2004-10-27 2011-11-16 先灵公司 抑制Nav1.8的短干扰核酸组合物和方法
US8309703B2 (en) 2004-10-27 2012-11-13 Merck Sharp & Dohme Corp. Compositions and methods for short interfering nucleic acid inhibition of Nav1.8
EP1942948A2 (fr) * 2005-11-04 2008-07-16 Alnylam Pharmaceuticals Inc. Compositions et methodes pour inhiber l'expression du gene nav1.8
JP2009516505A (ja) * 2005-11-04 2009-04-23 アルナイラム ファーマシューティカルズ インコーポレイテッド Ｎａｖ１．８遺伝子の発現を抑制するための組成物および方法
EP1942948A4 (fr) * 2005-11-04 2010-03-03 Alnylam Pharmaceuticals Inc Compositions et methodes pour inhiber l'expression du gene nav1.8
US7902168B2 (en) 2005-11-04 2011-03-08 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of Nav1.8 gene
JP4929288B2 (ja) * 2005-11-04 2012-05-09 アルナイラム ファーマシューティカルズ， インコーポレイテッド Ｎａｖ１．８遺伝子の発現を抑制するための組成物および方法

Also Published As

Publication number Publication date
WO2004087956A3 (fr) 2005-03-03
GB0407620D0 (en) 2004-05-05
GB2400103A (en) 2004-10-06

Similar Documents

Publication Publication Date Title
Klugbauer et al. Calcium channel α 2 δ subunits: Differential expression, function, and drug binding
JP3628693B2 (ja) ヒトカルシウムチャンネル組成物及びその使用方法
JPH08509607A (ja) ヒトｎ−メチル−ｄ−アスパラギン酸受容体サブユニット、これをコードする核酸およびその用途
JPH08507441A (ja) ヒト神経細胞性ニコチン性アセチルコリン受容体組成物およびそれらの使用方法
US8252541B2 (en) Sodium channel protein type III α-subunit splice variant
JP2001525161A (ja) 低電位で活性化されるカルシウムチャネル組成物と方法
US7972813B2 (en) Tetrodotoxin-resistant sodium channel alpha subunit
US7563586B2 (en) Method of identifying a modulator of a voltage-gated sodium channel using cells expressing Nav1.8 and p11
WO2011022638A1 (fr) Inhibiteurs de trp et leurs utilisations
Grünewald et al. Importance of the γ-aminobutyric acidB receptor C-termini for G-protein coupling
Jones Ca2+ channels and epilepsy
JP2001512673A (ja) Ｋｃｎｑカリウムチャンネルおよびそれの活性調節方法
AU2002355997A1 (en) Sodium channel regulators and modulators
PT100423A (pt) Sistemas de ensaio da actividade da neurotrofina
US6589787B2 (en) T-type calcium channel variants; compositions thereof; and uses
WO2004087956A2 (fr) Lignees cellulaires
US20050233957A1 (en) Sodium channel regulators and modulators
JP2002330769A (ja) ヒトバニロイド受容体様タンパク質
US20080200408A1 (en) Deletion mutants of tetrodotoxin-resistant sodium channel alpha subunit
WO2005094808A1 (fr) Regulation d'un transporteur de glycine humain 2
Artim Activation of voltage-gated calcium current by action potentials and modulation by G proteins
Dell cAMP promotes retinal midline crossing at the zebrafish optic chiasm

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase