WO2004072222A2 - Procede pour preparer une collection de moyens de detection de genes inductibles par un mediateur de l’inflammation, et applications - Google Patents
Procede pour preparer une collection de moyens de detection de genes inductibles par un mediateur de l’inflammation, et applications Download PDFInfo
- Publication number
- WO2004072222A2 WO2004072222A2 PCT/FR2004/050047 FR2004050047W WO2004072222A2 WO 2004072222 A2 WO2004072222 A2 WO 2004072222A2 FR 2004050047 W FR2004050047 W FR 2004050047W WO 2004072222 A2 WO2004072222 A2 WO 2004072222A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleotide
- sequences
- collection
- sequence
- sample
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
Definitions
- the present invention relates to a method and tools for detecting inducible genes by inflammation mediators capable of determining the precise physiological situation of an individual in whom an inflammatory condition is suspected or diagnosed.
- the inflammatory reaction is one of the most common modes of response in the body to aggression.
- the induction of inflammation can be caused in particular by a bacterial, viral or fungal infection, by the development of cancerous tumors, by physical or chemical trauma or even during tissue necrosis.
- soluble mediators in particular soluble mediators produced by neutrophils, monocytes / macrophages, lymphocytes, mast cells and platelets, these soluble mediators of inflammation. being commonly designated "cytokines”, among which mention may be made of alpha, beta or gamma interferons, TNF alpha or interleukin-6.
- the Japanese company TaKaRa Biomedicals markets a DNA chip on which are immobilized approximately 240 fragments of cDNA, with a length of approximately 300 bases each, derived from genes encoding cytokines, such as the genes encoding TNF, interleukin 1 alpha, interleukin 16, “Platelet Derived Growth Factor beta” or “PDGF-beta”, or gamma interferon.
- this DNA chip essentially contains cDNAs derived from genes encoding many other proteins not specifically linked to inflammation, such as prolactin, the tumor protein p53, integrins, the oncogene GRO2, the activator of the protein.
- the complementary diagnostic assistance tools available today are very incomplete because the cDNAs immobilized on these DNA chips are not representative of the multiple physiological situations that can be encountered during the triggering of an inflammatory reaction of a given type, in an individual.
- the present invention relates to a method for preparing a set of means for detecting, in a body sample previously collected from an individual, the expression or level of expression of genes inducible by an inflammation mediator. It also relates to a set of detection means prepared by said method, comprising a collection of specific nucleotide probes.
- the invention also relates to a device for detecting the expression, or the level of expression of genes inducible by an inflammation mediator.
- the invention also relates to the use of a probe or of a plurality of nucleotide probes as defined above, for detecting the presence, in a sample, of one or of a plurality of acids ( s) nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by a mediator of inflammation.
- a probe or of a plurality of nucleotide probes as defined above, for detecting the presence, in a sample, of one or of a plurality of acids ( s) nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by a mediator of inflammation.
- the invention also relates to a method for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of a gene inducible by an inflammation mediator, characterized in that said method comprises the following steps: a) bringing into contact a set of detection means as defined above or a device as defined above, with a sample to be tested; b) detecting the hybrids formed between the nucleotide probe (s) contained in said set of means or in said device and the nucleic acids possibly present in the sample.
- the invention also relates to a method for producing an expression profile of inducible genes by an inflammation mediator from a sample containing the messenger RNAs synthesized by the cells of a human or non-human mammal. , or cDNAs obtained from said messenger RNAs, characterized in that it comprises the following steps: a) contacting a set of detection means as defined above or a device as defined above with said sample; c) Determine the identity of the nucleotide probes included in the set of means or in the device which are hybridized with the nucleic acids contained in the sample.
- kits or kits suitable for implementing the above methods are also forming part of the invention.
- sample is meant according to the invention a material resulting, directly or indirectly, from the removal of a tissue fragment or an aliquot of biological fluid from a human or non-human mammal whose physiological situation is to be specified. vis-à-vis a possible inflammatory reaction.
- the initial sample can be the result of a biopsy performed in the individual, or a sample of a biological fluid such as a blood, saliva, tears, urine sample, etc.
- the sample also includes a medium containing the cellular messenger RNAs extracted from a biopsy or from a sample of biological fluid.
- the sample can also be a medium containing cDNAs obtained from messenger RNAs previously extracted from the biopsy or from the removal of the biological fluid.
- nucleic acid nucleoid, etc.
- any conventional technique of molecular biology, microbiology and recombinant DNA known to those skilled in the art can be used. Such techniques are described for example by SAMBROOK et al. (1989), GLOVER (1985), GAIT (1984), HAMES and HIGGINS (1984) and AUSUBEL et al. (1994).
- nucleic acid means a bonuleoside deoxy, a ribonucleoside, a deoxyribonucleotide polymer, a hbonucleotide polymer, either in the form of a single-stranded molecule or of a double-stranded molecule, including RNA, DNA or a hybrid RNA / DNA molecule.
- nucleic acid embraces unnatural analogs of natural nucleotides.
- nucleotide designates both natural nucleotides (A, T, G, C) as well as modified nucleotides which comprise at least one modification such as (i) a purine analog, (ii) a analog of a pyrimidine, or (iii) a similar sugar, such modified nucleotides being described for example in PCT application No. WO 95/04064.
- nucleic acid include RNA, DNA, cDNA or even RNA / DNA hybrid sequences of more than one nucleotide, in single strand form or in double strand form.
- a nucleic acid “resulting directly” from the transcription of a determined gene essentially includes the messenger RNA (s) synthesized during the transcription step of said gene.
- a nucleic acid "resulting indirectly" from the transcription of a determined gene essentially includes a cDNA obtained by the reverse transcription of a messenger RNA synthesized during the step of transcription of said gene.
- reverse transcription of messenger RNA is carried out in the presence of a reverse transcriptase enzyme.
- a gene "inducible by an inflammation mediator” consists of a gene whose transcription step or translation step is modified under the action of an inflammation mediator. Primarily, this expression encompasses genes whose transcription is activated by the action of an inflammation mediator. However, it also includes genes whose transcription is inhibited or blocked by an inflammation mediator.
- inflammation mediator within the meaning of the invention, is meant a cytokine produced by the cells during the initiation or the development of an inflammatory reaction, local or systemic, in a human or non-human mammal.
- Mediators of inflammation include:
- Cytokines having a biological activity of increasing capillary permeability such as histamine, bradykinin, C3a, C5a, LTC4, LTD4, PGE2, prostaglandins, factor XII, the kiniogenic factor;
- cytokines having a biological vasoconstriction activity such as Thromboxane A2, leukotrienes C and D;
- Cytokines having a biological activity of increasing the adhesiveness of phagocytes to endothelial cells such as interleukin-1, TNF- ⁇ or LTB4;
- Cytokines having a biological activity of inducing or activating the proliferation of medullary stem cells, such as interleukin-1 and C3c;
- cytokines having a biological activity of cellular chemotaxis such as C5a, LTB4, interleukin-8, PAF (for the “Platelet Agregating Factor”), histamine, laminin, collagen fragments, lymphocyte factors, chemotactic factors;
- Cytokines having the biological activity of release of lysosomal intragranular mediators, such as C5a, interleukin-8, PAF;
- Cytokines having the biological activity of increasing the production of oxygen radicals, such as C5a, TNF- ⁇ , PAF, interleukin-8, interferon- ⁇ (gamma);
- Cytokines having the biological activity of increasing phagocytosis such as C3b, the Fc part of IgG, interferon- ⁇ , fibronectin;
- cytokines having a biological activity of formation of inflammatory granulomas, such as interferon- ⁇ , TNF- ⁇ and interleukin-1;
- - pyrogenic cytokines such as PGE2, interleukin-1 and TNF- ⁇
- - type I interferon cytokines such as interferon- ⁇ , interferon- ⁇ and interferon- ⁇ and type 11 interferon cytokines, such as interferon- ⁇
- type 11 interferon cytokines such as interferon- ⁇
- cytokines such as interleukin-1, interleukin-2, interleukin-3, interleukin-4, interleukin-5, interleukin-6, interleukin-7, Interleukin-8, Interleukin-9, Interleukin-10, Interleukin-12, Interleukin-13, Interleukin-15, Interleukin-17 or TNF- ⁇ .
- the "inflammation mediators” capable of inducing the genes selected according to the invention mainly include the type I and type II interferons defined above, TNF- ⁇ , IL-1, l 'IL-2, IL-3, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL -13, IL-15, angiotensin, LIF, CNTF, PDGF, erythropoietin, GCSF, GMCSF, growth hormone, oncostatin, prolactin and thrombopoietin.
- the present invention provides a method for preparing a set of means making it possible to detect the presence, in a sample, of nucleic acids resulting, directly or indirectly, from the transcription of one or more genes inducible by an inflammation mediator.
- mediators of inflammation As previously stated, the initiation and development of an inflammatory reaction in an individual is accompanied by the release of various soluble factors by the cells, called mediators of inflammation. Through a cascade reaction, the mediators of inflammation thus released will induce or stimulate the expression of other genes by cells, some of which are already known.
- Such detection is therefore likely to supplement a prior clinical diagnosis, without this detection, in itself, is not an essential step in a process for diagnosing an inflammatory condition in an individual.
- the applicant has shown according to the invention that the genes inducible by an inflammation mediator have common nucleic sequence characteristics.
- sequence of certain genes inducible by an inflammation mediator obligatorily contain a sequence corresponding to the original definition of a first nucleotide consensus motif designated "ISRE / IRF-E” or “ISRE”, or a sequence corresponding to the original definition of a second nucleotide consensus motif designated “IWRM”, the original sequence characteristics of which are described in detail in the present description.
- the work carried out by the inventors made it possible to define, for the first time, said consensus nucleotide patterns “ISRE” and “IWRM”, which made it possible to develop, according to the invention, a process for the preparation of '' a set of means for detecting the expression, or level of expression, of genes inducible by an inflammation mediator.
- the person skilled in the art therefore has the basic means enabling him to manufacture nucleotide probes specific for genes inducible by an inflammation mediator.
- genes inducible by an inflammation mediator consist of genes inducible by at least one inflammation mediator.
- ISRE insulin receptor RI
- IFN- ⁇ type I interferons
- IFN- ⁇ type II interferons
- IL-6 type II interferons
- the “IWRM” motif is in particular characteristic of genes inducible by type II interferons (IFN- ⁇ ), and has contributed to highlighting a response of the genes containing the “GIRE” motif to IL-1, IL-2, IL-3, IL-4, IL-5, IL- 6, IL-9, IL-10, IL-12, IL-13, IL-15, angiotensin, LIF, CNTF, PDGF, erythropoietin, GCSF, GMCSF, growth hormone, oncostatin, prolactin and thrombopoietin.
- IFN- ⁇ type II interferons
- each "N” represents, independently of one another, a nucleotide chosen from A, T (or U), G, or C and "x2" is an integer equal to 2 or 3.
- - (ii) genes which comprise, in their sequence, a nucleotide consensus motif designated "IWRM", "which can be characterized according to the invention by the following sequences:
- the subject of the invention is a method for the preparation of a set of means for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each resulting nucleic acid, directly or indirectly, from the transcription of a gene inducible by an inflammation mediator, characterized in that said method comprises the following steps: a) preparing a collection of nucleic acids contained in genes inducible by a mediator of l inflammation, according to the following preparation steps: ai) (i) Select, from one or more collections of nucleotide sequences of human origin, all of the sequences of which cover at least once the entire human genome, the sequences comprising at least one copy of a sequence chosen from sequences SEQ ID No.
- step a2) for each of the nucleotide sequences contained in said first collection created in step ai), eliminate the sequence SEQ ID No. 1, 2, 3 or 4 located at the 5 'end of said nucleotide sequence and ( ii) create a second collection of sequences containing all the sequences modified in (i), each of the sequences contained in said second collection constituting a "probe";
- a3) (i) Search, for each of the nucleotide sequences contained in the second collection of sequences created in step a2), of the presence of at least one copy of a sequence SEQ ID No. 1, 2, 3 or 4, then (ii) elimination, in said second collection, of sequences comprising at least one copy of one of the sequences SEQ ID No. 1, 2, 3 or 4, whereby a third collection of sequences, not comprising the sequences thus eliminated, is created;
- a4) (i) Search, for each of the nucleotide sequences contained in the third collection of sequences created in step a3), of each sequence of nucleotides corresponding to a nucleotide sequence of “Alu” type or of “repeated” type capable of be contained in said nucleotide sequence, then (ii) modification of the sequences comprising such a sequence of nucleotides, by masking said sequences of nucleotides corresponding to a nucleotide sequence of “Alu” type or of “repeat” type by replacement of each nucleotide A , T, G or C contained in said “Alu” or “repeated” sequence with a nucleotide “N” meaning indifferently A, T, G or C, then (iii) create a fourth collection of sequences containing all the sequences contained in the third collection, possibly modified according to (ii); a5) (i) Select, from one or more collections of sequences containing nucleot
- a6) (i) Select, in the fifth collection of sequences created in step a5), the sequences comprising at least 60 consecutive nucleotides defining a sequence having at least 97% nucleotide identity with a nucleotide sequence included in at least one of the “probes” contained in the second collection of sequences created in step a2), then (ii) creating a sixth collection of nucleotide sequences containing the sequences thus selected, said sixth collection of sequences consisting of the collection of nucleic acids contained in genes inducible by an inflammation mediator;
- step a) of the above method Six collections of sequences have been designated in step a) of the above method, essentially for the sake of clarity in understanding the method. According to a first embodiment, the six collections of sequences can concretely consist of six distinct collections of sequences.
- a single collection of sequences is created, the content of which in sequences is modified as each of the steps ai) to a6) is carried out.
- less than six collections of sequences are created, only some of them being created specifically during the performance of one or more of the steps ai) to a6) of the method, the others collections designated in the process each resulting at a given stage of the process, from a simple modification of the content in sequences of a collection created in the previous stage.
- the collection of detection means that it makes it possible to prepare comprises, for each gene inducible by an inflammation mediator, several probes hybridizing specifically with the latter.
- the collection of detection means comprises, on average, at least two, preferably three, and quite preferably at least four probes which hybridize specifically with each gene inducible by a mediator of the 'inflammation.
- the method described above is characterized in that it further comprises the following step c): c) immobilizing each of the nucleotide probes synthesized in step b) on a support.
- the above method is characterized in that the nucleotide probes are immobilized in an orderly manner on said support.
- the above method is characterized in that the nucleotide probes are immobilized on said support in the form of an ordered array of probes.
- the person skilled in the art is able, by simple routine operations, to synthesize the probes hybridizing specifically with the expression products of said inducible genes by a mediator of the inflammation, these probes constituting a set of detection means according to the invention, which is defined later in the description.
- Step a) of the method is advantageously carried out using a computer program, said computer program containing all of the instructions necessary to control a computer, in the memory of which it is loaded, the execution of all the sub-steps of step a) of the process.
- step a) of the method by executing the instructions of a computer program
- the person skilled in the art may refer to the basic software tools for programming and for searching and comparing. of nucleotide sequences described for example by AltschuI et al. (1990), Claverie et al. (1993), Wall et al. (1996), as well as the “xblast.c” and “blast.linux” software tools, the reference of which is given at the end of this description.
- Step a) of the method of the invention is described in detail below, and express reference is made to each of the modules of the computer program capable of performing each of the substeps ai) to a6) of the method.
- said computer program advantageously comprises a central module, called a "master program”, which includes the necessary instructions the execution of subroutines, called “modules”, each of its subroutines containing the instructions necessary for the execution of each of the sub-steps ai) to a6) of the method.
- master program allowing the realization of step a) of the method for human genomic sequences which contain the first nucleotide consensus motif "ISRE".
- a person skilled in the art is able to easily adapt this example of a master program for human genomic sequences containing the second nucleotide consensus motif "IWRM", by replacing in the program the structural characteristics of the "ISRE” motif with the structural characteristics of the “IWRM” motif which have been detailed previously in the present description.
- IWRM in the form of a regular expression within a complete genome (in this case the draft of the human genome, UCSC version of June 13, 2001, http: //genome.ucsc. edu /) with an offset window of +1 followed by a sequence of 285 nucleotides (called "Electronic” Probe) directly downstream of each pattern found.
- Step a2) corresponding to the pg2.pl program module
- This step consists of eliminating, from the file resulting from the first step, each pattern found and keeping the adjacent Electronic Probe (so as to exclude a localization of the consensus patterns on a transcribed sequence).
- Step a3) corresponding to the pq3.pl program module
- each of the Electronic Probes is tested for the possible presence of a second or more identical patterns in downstream of the first. Only Electronic Probes that do not contain it are kept.
- the complementary sense and reverse pattern are successively sought.
- Step a4) filtering step corresponding to the modules pq4 160.pl and pg4 15.pl, respectively
- each Electronic Probe against this bank is carried out by a program called Blastn (1) by successively setting two values to the parameter E (Expect Value) of the blastn program, respectively 10th-160 and 10th-15.
- This parameter, E-Value (Expect Value) of the Blastn program measures, after searching in a database, the number of alignments that could be due to chance. Consequently, the smaller this value, that is to say close to zero, the more significant the result obtained.
- the values set for this parameter successively 10e-160 and 10e-15, are intended to retain only the long alignments and the short alignments that are statistically significant.
- Step a5) corresponding to the program module pg5.pl
- the file resulting from step a4) (containing the electronic sequences in which the repeated sequences have been masked) is used by the Blastall program (5) against a bank of transcripts composed of the following files:
- Hs.fna.gz file (origin: ftp://ftp.ncbi.nih.goV/refseg/H sapiens / mRNA Prot /) retrieved 24-07-2002.
- blastn program parameters used correspond to those defined by default.
- Step a6) corresponding to the pg6.pl module
- the result file from step a5) was processed in order to select the significant homologies between the Electronic Probe and its transcript according to the following criteria:
- the length of the homology between the Electronic Probe and the homologous transcript is defined as a variable in the program (it was set to a value strictly greater than 60 nucleotides in this algorithm). This value was chosen on the one hand because it corresponds statistically to the size of an exon.
- the patterns sought (those responsible for early induction by cytokines) being predominantly located 100 nucleotides upstream from the transcription initiation site, it is highly likely that the alignment between the 285 nucleotides of the probe electronics and the first 300 nucleotides of transcripts covers a region of at least 60 nucleotides.
- the program In order to consider only the alignments starting at the start of the transcript (higher probability of being in the presence of the region immediately downstream of the initiation of the transcription), the program only selected the cases where the 60 nucleotides of the 300 nucleotides of the transcribed sequences are located at the 5 'end. Ideally, alignment begins at the first nucleotide of the 60 nucleotides. However, the program allowed alignment to begin within a window of 1 to 5 nucleotides from the 5 'end of the transcript (the value of 5 means preventing sequencing errors).
- a collection of nucleotide probes is synthesized specifically hybridizing with the transcript of at least one gene inducible by a mediator. inflammation, said transcript comprising a nucleotide sequence contained in the sixth collection of sequences prepared in step a6), said collection of probes thus synthesized consisting of the set of means for detecting the presence, in a sample; one or more nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by an inflammation mediator.
- nucleotide probe within the meaning of the invention, is meant a polynucleotide which hybridizes specifically to a nucleic acid contained in a sample, this nucleic acid resulting, directly or indirectly, from the transcription of a determined gene, said specific gene being inducible by an inflammation mediator.
- a nucleotide probe of the invention does not hybridize with any other nucleic acid also contained in the same sample, under appropriate stringency conditions used for the hybridization reaction, which are preferably conditions of high stringency.
- hybridization conditions within the meaning of the invention, is understood the following hybridization conditions:
- Prehybridization same conditions as for hybridization duration: 1 night.
- the parameters defining the stringency conditions depend on the temperature at which 50% of the paired strands separate (Tm).
- Tm is defined by the relation:
- Tm 81.5 + 0.41 (% G + C) +16.6 Log (cation concentration) - 0.63 (% formamide) - (600 / number of bases) (SAMBROOK et al., (1989) , pages 9.54-9.62).
- Tm 4 (G + C) + 2 (A + T).
- the hybridization temperature is approximately 5 to 30 ° C, preferably 5 to 10 ° C below Tm.
- hybridization conditions described above are used for the hybridization of a nucleic acid 20 bases in length and can be adapted as a function of the length of the nucleic acid whose hybridization is sought or of the type chosen marking, according to techniques known to those skilled in the art.
- the suitable hybridization conditions can for example be adapted according to the teaching contained in the work of HAMES and HIGGINS (1985) or even in the work of AUSUBEL et al. (1989).
- the level and the specificity of hybridization depends on various parameters, such as: a) the purity of the preparation of the nucleic acid on which the probe or the primer is to hybridize; b) the base composition of the probe or of the primer, the base pairs GC having a greater thermal stability than the base pairs A-T or AU; c) the length of the homologous base sequence between the probe or the primer and the nucleic acid; d) ionic strength: the rate of hybridization increases with increasing ionic strength and the duration of the incubation time; e) the incubation temperature; f) the concentration of the nucleic acid on which the probe or the primer is to hybridize; g) the presence of denaturing agents, such as agents promoting the breaking of hydrogen bonds, such as formamide or urea, which increase the stringency of the hybridization; h) the incubation time, the incubation rate increasing with the duration of the incubation; i) the presence of bulk exclusion agents, such as de
- a nucleotide probe according to the invention has a nucleotide sequence exactly complementary to the targeted target sequence.
- a first polynucleotide is considered to be "complementary" to a second polynucleotide when each base of the first nucleotide is paired with the base complementary to the second polynucleotide whose orientation is reversed.
- the complementary bases are A and T (or A and U), and C and G.
- a nucleotide probe according to the invention is a nucleotide probe specifically hybridizing, under high stringency hybridization conditions, with the nucleotide sequence of a messenger RNA, or of the corresponding cDNA, which is the product of the transcription of a gene inducible by an inflammation mediator of the invention.
- a nucleotide probe of the invention is at least 20 nucleotides in length and can reach a length of several kilobases, for example up to 6 kilobases, the maximum size of the probe being limited by the size of the targeted target sequence.
- a probe nucleotide according to the invention has a length ranging from 20 to 500 bases in length, preferably from 20 to 250 bases in length.
- a nucleotide probe according to the invention can comprise 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500, 600, 7100, 800, 900, 1000, 2000, 3000 or 4000 bases in length, the maximum size of the probe being limited by the size of the target nucleic acid targeted.
- nucleotide probe in general, can be defined by the following formula:
- - Ls is the length in bases of the probe
- - x is an integer equal to or greater than 20, and x is equal to or less than the base length (La) of the target nucleic acid targeted, resulting directly or indirectly from the transcription of an inducible gene by a mediator of l 'inflammation.
- a nucleotide probe according to the invention can be prepared by any suitable method well known to those skilled in the art, including by cloning and action of restriction enzymes or also by direct chemical synthesis according to techniques such as the phosphodiester method of NARANG et al. (1979) or BROWN et al. (1979), the diethylphosphoramidit.es method of BEAUCAGE et al. (1980) or the solid support technique described in European patent N ⁇ P 0 707 592.
- Each of the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention are included in a single cDNA obtained by reverse transcription of the messenger RNAs constituting a transcription product of a gene inducible by a mediator of inflammation.
- Each of the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention can therefore only be found in the sequence of a determined gene, or is complementary to a messenger RNA which is not produced only from this unique gene.
- nucleotide probe which hybridizes with a determined gene whose expression is inducible by a mediator of inflammation
- a person skilled in the art can synthesize a polynucleotide whose sequence is identical to a sequence of at least 20 consecutive nucleotides of the cDNA corresponding to this gene, or a polynucleotide complementary to a sequence of at least minus 20 consecutive nucleotides of a messenger RNA produced by this gene.
- the size of the target sequence will depend on the size sought for the nucleotide probe, within the limits specified above.
- a person skilled in the art can search for the complete mRNA or cDNA sequence of the single gene comprising one of the sequences contained in the sixth collection of sequences created in step a6) of the method of invention according to the following steps:
- step (iii) select, in the complete sequence selected in step (ii), the sequence of the polynucleotide to be synthesized to manufacture the nucleotide probe
- a person skilled in the art can synthesize at least one nucleotide primer specific for a single gene, from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention, then use this primer to produce a complete cDNA from a single messenger RNA with which said primer hybridizes, under the appropriate hybridization conditions, preferably high stringency hybridization conditions.
- the hybridization step, then the extension of the primer can be carried out by a person skilled in the art according to techniques conventional, by prior extraction of messenger RNAs present in human or non-human mammalian cells, in primary culture or in cell line, then contacting the specific primer under the appropriate hybridization conditions, then elongation of the primer in the presence of reverse transcriptase.
- nucleotide primer having undergone the elongation described above can then be directly used as a specific probe.
- the nucleotide primer having undergone the elongation described above can serve as a starting product for the manufacture of the final specific probe, for example by the action of xonucleases, or also by the action of endonucleases of restriction, according to techniques well known to those skilled in the art.
- a person skilled in the art can synthesize at least one nucleotide primer specific for a single gene, from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention, then use this primer to produce complete cDNA from a collection of clones comprising vectors into which cDNAs originating from human or non-human mammal cells are inserted, according to techniques known to those skilled in the art.
- the complete cDNA thus generated can then be directly used as a specific probe.
- the complete cDNA can serve as a starting product for the manufacture of the final specific probe, for example by the action of xonucleases, or also by the action of restriction endonucleases, according to techniques well known in the art. skilled in the art.
- the subject of the invention is a set of means for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from transcription a gene inducible by an inflammation mediator, characterized in that said set of means comprises, for each nucleic acid whose presence is sought, at least one nucleotide probe hybridizing specifically with said nucleic acid, said set of means being prepared by the process which has been described in detail in the present description.
- the sixth collection of sequences which consists of the collection of nucleic acids contained in genes inducible by an inflammation mediator, comprises unique sequences contained in genes which had, in the prior art, been more or less less characterized, from the point of view of their function. Thus, we can distinguish according to that for each of these genes:
- said gene possessed at least one function known in at least one physiological field other than inflammation
- the set of detection means of the invention comprises at least one probe which hybridizes specifically with a gene belonging
- said set of detection means comprises at least one probe hybridizing with a gene comprising a nucleotide sequence chosen from the sequences SEQ ID N ° 5 to SEQ ID N ° 10.
- the nucleotide sequences SEQ ID N ° 5 to SEQ ID N ° 10 are illustrated in particular by way of example and each consist of a single sequence found in the sequence of a gene of known function, said gene, or its expression products, which have not previously been described as genes whose expression is modified in an individual developing an inflammatory reaction.
- Said set of detection means can comprise probes each hybridizing specifically with a single one from 1, 2, 3, 4, 5 or 6 of the genes defined by each of the sequences SEQ ID No. 5 to SEQ ID No. 10.
- said set of detection means comprises at least one probe hybridizing with a gene comprising a nucleotide sequence chosen from the sequences SEQ ID N ° 11 to SEQ ID N ° 25.
- the nucleotide sequences SEQ ID N ° 11 to SEQ ID N ° 25 are illustrated in particular in the example and each consist of a unique sequence found in the sequence of a previously unknown function gene.
- Said set of detection means can comprise probes each hybridizing specifically with a single one from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 of the genes defined by each of the sequences SEQ ID No. 11 to SEQ ID No. 25.
- said set of detection means comprises at least one probe hybridizing with a gene comprising a nucleotide sequence chosen from the sequences SEQ ID No. 5 to SEQ ID No. 10 and at least one probe s hybridizing with a gene comprising a nucleotide sequence chosen from the sequences SEQ ID No. 11 to SEQ ID No. 25.
- the set of means according to the invention is characterized in that the nucleotide probe or probes are chosen from polynucleotides having at least 20 consecutive nucleotides of the sequences contained in the sixth collection of sequences created at step a6) of the method of the invention, or at least 20 consecutive nucleotides of the sequences complementary to the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention.
- the set of means according to the invention is characterized in that the nucleotide probe or probes are chosen from the sequences contained in the sixth collection of sequences created in step a6) of the method of invention, or a sequence complementary to the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention, or among the sequences complementary to the sequences contained in the sixth collection of sequences created in step a6 ) of the process of the invention.
- the set of detection means according to the invention is characterized in that each nucleotide probe consists of a polynucleotide included in the sequence of a messenger RNA or of a cDNA corresponding to a gene inducible by an inflammation mediator, which gene comprises a sequence contained in the sixth collection of sequences created in step a6) of the method of the invention, or in that each nucleotide probe consists of a polynucleotide whose sequence is complementary to that of a polynucleotide included in the sequence of a messenger RNA or of a cDNA corresponding to a gene inducible by an inflammation mediator, which gene comprises a sequence contained in the sixth collection of sequences created in step a6) of the method of the invention
- the set of means according to the invention comprises at least one nucleotide probe chosen from the nucleotide probes as defined above.
- the set of means according to the invention comprises all of the nucleotide probes as defined above.
- the set of means more includes their probes which hybridize specifically with a determined nucleic acid, resulting, directly or indirectly, from the transcription of a nductible gene by an inflammation mediator.
- the set of means comprises several nucleotide probes hybridizing with the same target sequence, the number of nucleotide probes of identical sequences can vary from 2 to 10 probes .
- the set of means of the invention allows a quantitative measurement of the target nucleic acid contained in the sample tested.
- the set of means comprises several nucleotide probes hybridizing with distinct target sequences included in said nucleic acid, the number of probes possibly varying from 2 to 10 probes.
- the set of means allows a high detection sensitivity, because of its capacity to detect said target nucleic acid in the test sample, even in the case where said target nucleic acid has undergone physical alterations in the sample, such as cuts by exo- or endonucleases present in the starting source material, for example in a cell extract, or present in the sample to be tested.
- the set of detection means according to the invention comprises, for a determined target nucleic acid, several nucleotide probes hybridizing specifically with the latter, as described for the probes s' hybridizing with nucleic acids comprising a sequence chosen from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention, or a sequence complementary to the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention.
- nucleic acids comprising the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention have common structural characteristics, which are representative of nucleic acids derived from genes inducible by an inflammation mediator .
- the set of detection means of the invention comprises at least 10, 20, 30, 40, 50, 50, 100, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or 1000 nucleotide probes as defined above.
- the total number of probes contained in the set of detection means of the invention depends first of all on the number of distinct target nucleic acids, each corresponding to a transcription product of a gene inducible by a mediator of inflammation, which one seeks to detect in the sample.
- the total minimum number of probes contained in the set of detection means of the invention is defined by the following formula:
- - y represents the number of distinct target nucleic acids that one seeks to detect.
- the total number of nucleotide probes contained in the set of detection means of the invention also depends on the number of identical nucleotide probes hybridizing with the same target sequence included in a determined nucleic acid which one seeks to detect and also depends on the number of probes hybridizing with distinct target sequences included in said target nucleic acid.
- the number of probes contained in the set of detection means of the invention can also be expressed according to the following formula:
- NtotaF [ ⁇ (aa1.A1ai) + (aa2.A1 a2 ) + ... + (any.A1 ay )] + [(ab1.A2 a2 ) + (ab2.A2 a2 ) + ... + (abny. A2 ay )] + ... + [(ax1.AX aX ) + (ax2.A1 a2 ) + ... + (axny.AX ay )]], in which:
- A1, A2, ..., AX represent the nucleic acids corresponding to the transcription products (mRNA or cDNA) of the A1, A2, ..., AX genes inducible by an inflammation mediator;
- - X is an integer whose maximum value is equal to the total number of sequences contained in the sixth collection of sequences created in step a6) of the method of the invention
- A1 a ⁇ , A1 a 2,, A1 an respectively represent the distinct target sequences ai, a2, ..., an, contained in the target nucleic acid A1, for which at least one probe hybridizes specifically;
- - n is an integer between 0 and 100, and is preferably equal to 0, 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20;
- any represent the number of identical probes hybridizing to the same target sequence A1 a - ⁇ , A1 a2 ,, A1 ay , contained in the target nucleic acid A1 and independently represent the one from the other, an integer between 0 and 100, advantageously between 0 and 50, and are preferably equal to 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20;
- a mandatory condition is that all of the detection means according to the invention contain at least one hybridizing probe. specifically with a nucleic acid comprising a sequence chosen from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention, or with a nucleic acid comprising a sequence complementary to a sequence chosen from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention.
- the set of detection means of the invention comprises at least one probe hybridizing with each of the nucleic acids comprising a sequence chosen from the sequences contained in the sixth collection of sequences created at step a6) of the method of the invention, or comprising a sequence complementary to a sequence chosen from the sequences contained in the sixth collection of sequences created in step a6) of the method of the invention.
- all of the detection means according to the invention may comprise only some of the above nucleotide probes, depending on the suspected physiological situation of the human or non-human mammal from which the sample originates. to test.
- the practical implementation of the set of detection means according to the invention may show that only certain subsets of probes will be necessary to obtain an exhaustive result of the precise physiological situation of the human or non-human mammal from which the sample comes. to be tested, according to the symptoms that this individual expresses, or according to the nature of the pre-diagnosis or clinical diagnosis already established, for example because only some of the genes inducible by an inflammation mediator are activated, or on the contrary inhibited or blocked, in a determined pathophysiological situation.
- Each of the nucleotide probes described above can be labeled, if desired, by incorporating a label detectable by spectroscopic, photochemical, biochemical, immunochemical or even chemical means.
- markers may consist of radioactive isotopes ( 32 P, 33 P,, 3 H, 35 S,), fluorescent molecules (5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin), chemiluminescent molecules or even ligands such as biotin.
- the labeling of the probes is preferably done by incorporating labeled molecules within the polynucleotides by extension of primers, or else by adding to the 5 ′ or 3 ′ ends.
- the nucleotide probes constituting the set of detection means of the invention can be in free form, in suspension in a solution suitable for carrying out the hybridization reaction with the nucleic acids possibly present in the sample to be tested. .
- Set of means or devices of the invention comprising the probes immobilized on a support ("DNA chips").
- the set of detection means according to the invention is characterized in that the nucleotide probe or probes contained therein are immobilized on a support.
- Nucleotide probes or primers according to the invention can be immobilized on a solid support.
- solid supports are well known to those skilled in the art and include surfaces of the wells of microtitration plates, polystyrene beads, magnetic beads, nitrocellulose strips, or even microparticles such as latex particles.
- the probes according to the invention immobilized on a support are ordered in arrays, as in "DNA chips".
- arrays as in "DNA chips".
- Such ordered matrices have been described in particular in US Pat. No. 5,143,854, in PCT applications No. WO 90/150 70 and 92/10092.
- Supporting arrays on which oligonucleotide probes have been immobilized at a high density are for example described in US Pat. Nos. 5,412,087 and in PCT application No. WO 95/11995.
- the probes contained in the set of detection means of the invention are immobilized on the support in an orderly manner, for example in the form of an array of probes.
- the position of each separate probe is predetermined and known.
- the invention also relates to a device for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from transcription of a gene inducible by an inflammation mediator, characterized in that said device comprises at least one nucleotide probe or a plurality of nucleotide probes as defined in the present description, the nucleotide probe or probes being immobilized on a support.
- the above device is characterized in that the plurality of nucleotide probes are immobilized in an orderly manner on said support.
- Said support on which the probes constituting the set of detection means according to the invention are immobilized consists of a solid support.
- the nucleotide probes are fixed to said support, directly or indirectly, by coupling one or more binding molecules ("linkers") to the support, then by coupling each probe to a free part of the binding molecule.
- the support may be a polymeric material, a glass, a ceramic, natural fibers, a silicone, a metal and composite materials of the materials mentioned above.
- the support has at least one substantially flat surface.
- practically flat is meant a surface which is macroscopically planar for optimal fixation of the nucleotide probes, for example in the form of a two-dimensional matrix network.
- the surface of the solid support can be functionalized with a silane, as described for example in the American patent application published under the number US 2002/20081597 (Lowe et al.).
- the immobilization support for the probes comprises olefinic groups, either that the olefinic groups are constitutive of the support material, or that they are incorporated into the support material by chemical reactions or by the surface deposition of molecules containing olefinic groups.
- the olefinic groups can be provided, for example, by fixing them with chlorosilane derivatives, then by oxidizing the olefinic groups to aldehyde.
- the surface of the support can also be functionalized by thiol groups, as described in US Patent No. US 5,412,087 (McGall et al.).
- the nucleotide probes are fixed in a non-covalent manner on the surface of the support, as described for example in American patent application No. 2002/20042069 (Myer et al.).
- the nucleotide probes are linked to the support by weak bonds such as electrostatic interactions, hydrophobic interactions, Van der Waals forces, etc.
- a set of detection means or a device according to the invention when it is in the form of a "DNA chip", can be prepared according to the techniques described in American patent n ° US 6,403,320 (Read et al.), The PCT application published under the number WO 95/11995 (Chee et al.) Or the PCT application published under the number WO 92/10092 (Fodor et al.).
- the set of detection means or the device according to the invention can also be in the form of matrices or stacked or “stacked arrays”, as described in the American patent application No. 2002/20051995 (Kumar).
- the detection of the hybrids formed can be carried out in particular by measuring fluorescence or measuring radioactivity, for example when the nucleic acids contained in the sample have been labeled, according to techniques known per se, either by a fluorescent molecule or by a molecule radioactive, prior to bringing them into contact with the set of detection means or with the detection device according to the invention.
- the detection of the presence of a probe / nucleic acid hybrid of the sample can also be carried out by measuring the variation of various physical parameters of the support, such as the variation of the temperature, of the wavelength of a light beam, of the conductivity or resistivity of the surface of the support, at the location of the support on which is immobilized a probe which has hybridized with a nucleic acid present in the sample to be tested.
- the location, on the surface of the support, of each nucleotide probe of known sequence is predetermined.
- measuring the presence of a probe / nucleic acid hybrid of the sample, at any point on the surface of the support on which the probes are immobilized makes it possible to first determine the different locations of the surface of the support. which the presence of a probe / nucleic acid hybrid of the sample is detected and / or quantified.
- a comparison of the spatial coordinates in two dimensions (for the two-dimensional ordered matrices) or in three dimensions (for the stacked or “stacked arrays”) with a preset table of correspondence between the different spatial coordinates of the support and the identity of the probe (s) immobilized at these coordinates makes it possible directly to determine the identity of genes inducible by an inflammation mediator which are active (if a hybridization with the corresponding probe (s) is detected) or inactive (if none hybridization with the corresponding probe (s) is not detected).
- the set of detection means or the detection device as defined above are useful, in general, for detecting the presence of nucleic acids, mainly messenger RNA or cDNA, indicating the level of activation d one or more genes inducible by an inflammation mediator.
- a subject of the invention is also the use of a probe or of a plurality of nucleotide probes as defined above, for detecting the presence, in a sample, of one or of a plurality of acids ( s) nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by a mediator of inflammation.
- a probe or of a plurality of nucleotide probes as defined above, for detecting the presence, in a sample, of one or of a plurality of acids ( s) nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by a mediator of inflammation.
- a human or non-human mammal in which an inflammatory reaction, local or systemic is suspected, or in which a local or systemic inflammatory reaction has already been diagnosed, if necessary generalized, such as for example a septic shock or a SIRS.
- the inflammatory reactions targeted include bacterial infections, whether acute, subacute or chronic.
- inflammations occurring in neoplastic pathologies including malignant lymphomas, visceral neoplasias (kidney cancers, cancers of the digestive system, lung cancers).
- inflammations occurring during systemic diseases such as chronic inflammatory rheumatism (e.g.
- rheumatoid arthritis e.g., systemic lupus erythematosus
- vasculitis e.g. Horton's disease or gnarly peri-ertheritis.
- cardiovascular disease e.g, deep vein thrombosis
- inflammatory disease e.g, Crohn's disease.
- various iatrogenic inflammatory reactions caused by side effects induced by drug therapy, such as example the induction of inflammatory side effects by the active antibiotic or anti-epileptic principles.
- the invention also relates to a method for detecting the presence, in a sample, of one or a plurality of nucleic acid (s), each nucleic acid resulting, directly or indirectly, from the transcription of a gene inducible by an inflammation mediator, characterized in that said method comprises the following steps: a) bringing a set of detection means or a detection device according to the invention into contact with a sample to be tested; b) detecting the hybrids formed between the nucleotide probe (s) contained in said set of means or in said device and the nucleic acids possibly present in the sample.
- the above method is characterized in that, in step b), the identity of the nucleotide probe (s) which have hybridized with the nucleic acid (s) present in the sample is determined.
- the above method is characterized in that, in step b), have determined the quantitative ratios of the different nucleic acids contained in the sample and which have hybridized with the nucleotide probes.
- the above method is characterized in that, in step b), the identity of the nucleotide probe or probes having hybridized with the nucleic acids contained in the sample is determined.
- the above method is characterized in that the nucleic acids contained in the sample are messenger RNAs synthesized by a human or non-human mammalian cell.
- the above method is characterized in that the nucleic acids contained in the sample are cDNAs obtained by reverse transcription of messenger RNA synthesized by a human or non-human mammalian cell
- a main utility of the set of detection means or of the device according to the invention is that it makes it possible to produce a profile of expression of inducible genes by an inflammation mediator, from a sample from an individual to be tested.
- the invention also relates to a method for producing an expression profile of inducible genes by an inflammation mediator from a sample containing the messenger RNAs synthesized by the cells of a human or non-human mammal. , or cDNAs obtained from said messenger RNAs, characterized in that it comprises the following steps: a) bringing a set of means or a device according to the invention into contact with said sample; c) Determine the identity of the nucleotide probes included in the set of means or in the device which are hybridized with the nucleic acids contained in the sample.
- the invention also relates to a method for producing an expression profile of inducible genes by an inflammation mediator from a sample containing the messenger RNAs synthesized by the cells of a human or non-human mammal, or cDNAs obtained from said messenger RNAs, characterized in that it comprises the following steps: a) carrying out the method for detecting the presence, in a sample, of one or more nucleic acid (s) (s), each nucleic acid resulting, directly or indirectly, from the transcription of an inducible gene by an inflammation mediator with said sample, as defined above; c) Determine the identity of the nucleotide probes which are hybridized with the nucleic acids contained in the sample.
- s nucleic acid
- the set of results obtained is likely to account for the evolution of the physiological or pathophysiological situation of the individual tested, over time.
- regular monitoring of the development or reduction of an inflammatory reaction or disease may be performed for a given individual.
- the drug treatment can be adapted more finely, more rigorously and more precisely than with current investigative tools.
- the implementation of a set of detection means or of a detection device according to the invention makes it possible to determine the minimum combinatorial required to bring out a lymphocyte population capable of producing a particular type of '', to characterize in detail the responses of helper lymphocytes ("helper") which control inflammatory immunity (Th1 and Th2 lymphocytes), identify the appropriate conditions to suppress the immune response (eg in the case of diseases allergic and parasitic).
- helper lymphocytes helper lymphocytes
- Th1 and Th2 lymphocytes helper lymphocytes
- identify the appropriate conditions to suppress the immune response eg in the case of diseases allergic and parasitic.
- the implementation of a set of detection means or of a detection device according to the invention allows the evaluation of the effects induced by type I interferons which are commonly used as therapeutic molecules in the treatment of diseases such as cancer, viral hepatitis and multiple sclerosis. Their use has in fact been limited due to the severe side effects, which can however be, to a certain extent, predicted by a precise study of the anti-viral and immunomodulatory properties, the more effectively the more we have the means to identify. the factors responsible for these side effects.
- the set of detection means and the detection device which are the subject of the present invention constitute one of the possible means of identifying the factors responsible for the aforementioned side effects.
- the development of a tolerance to the immunoregulatory effect during a daily treatment may require a therapeutic intervention spaced over time.
- the implementation of a set of detection means or a detection device according to the invention allows the clinician to quickly establish the optimal dose of drug as well as the frequency of treatment for a given individual. .
- the use of stem cells in order to regenerate differentiated tissues is a therapeutic approach which is being considered more and more seriously.
- One of the main obstacles lies in the characterization of the combination of factors making it possible to control the passage from the stem cell to a well-defined mature cell.
- Currently, several scientific teams are working on the development of culture media containing the molecules necessary for the development of differentiated cells of a given tissue type.
- the implementation of a set of detection means or of a detection device according to the invention makes it possible to identify the appropriate combination or combinations of specific growth factors, which allow the activation of the expression of suitable genes, markers of differentiation into a given cell type.
- the subject of the invention is also a kit or kit for the production of an expression profile of inducible genes by an inflammation mediator from a sample containing the messenger RNAs synthesized by the cells of a human mammal. or non-human, or cDNAs obtained from said messenger RNAs, characterized in that it comprises a set of means or a device according to the invention.
- the kit or kit as defined above further comprises the reagents necessary to carry out the hybridization reaction between the nucleotide probe (s) contained in said set of means or contained in said device.
- the kit or kit as defined above further comprises means intended to reveal the hybrids formed between the nucleotide probe or probes contained in said set of means or contained in said device and the nucleic acids contained in the 'sample.
- Example 1 Detailed description of 21 genes inducible by an inflammation mediator according to the invention from which the probes constituting the detection means according to the invention are produced.
- Each nucleotide sequence representative of a gene inducible by an inflammation mediator referenced below in the present description consists of a cDNA obtained from a messenger RNA resulting from the transcription of an inducible gene by a mediator of l 'inflammation according to the invention.
- Each nucleotide sequence below is contained in the sequence of the corresponding complete gene, said complete gene comprising in its sequence an “ISRE” motif as defined above.
- the cDNA sequences were classified according to each chromosome containing the corresponding gene.
- the cDNA sequences For each chromosome, the cDNA sequences have been classified according to whether they are found on the strand (+) or on the strand (-) of the DNA of the chromosome considered.
- the sequences For each strand (+) or (-) of a chromosome, the sequences have been classified according to whether they are oriented in the “sense” direction or in the “antisense” direction. For each strand of a determined chromosome, the sequences have been numbered as the Nth occurrence of the “ISRE” motif considered in the sequence of said strand (+) or (-) of said chromosome.
- each sequence also includes the abbreviated name of at least one electronic sequence database in which said sequence is listed:
- each sequence also includes the access number [identifier number] of the sequence in at least one of the sequence databases above.
- each sequence includes various annotations such as the DNA clones from which the sequence originates and the name of the protein for which this sequence codes.
- PINK1 PINK1
- PINK1 PINK1
- PINK1 PTEN induced putative kinase 1
- PINK1 PINK1
- PINK1 PTEN induced putative kinase 1
- SPATA1 Homo sapiens spermatogenesis associated 1
- XM_043407 Homo sapiens splicing factor, arginine / serine-rich 3 (SFRS3), mRNA.
- IHUMSRP20 Homo sapiens SR protein family, pre-mRNA splicing factor (SRp20) mRNA, complete cds
- EPSTI1 Homo sapiens epithelial stromal interaction 1 (breast) (EPSTI1), mRNA
- EPSTI1 Homo sapiens epithelial stromal interaction 1 (breast) (EPSTI1), mRNA
- guanine nucleotide binding protein beta subunit 4 (GNB4), mRNA. > 0NM_021629 Homo sapiens guanine nucleotide binding protein beta subunit 4
- Homo sapiens cDNA F J11028 is, clone P ACE1004128, highly similar to GUANINE NUCLEOTIDE-BINDING PROTEIN BETA SUBUNIT 4
- XM_054554 Homo sapiens hypothetical gene supported by AB033071; AB051480; AK000726; NM_015383 (LOC113657), mRNA.
- X _054260 Homo sapiens similar to KIAA1693 protein; hypothetical protein FLJ20719 (H. sapiens) (LOC91631), mRNA.
- KIAA0317 Homo sapiens KIAA0317 gene product (KIAA0317), mRNA.
- FLJ11896 FLJ11896
- E 4th- 65 128/129 99 + / -. 0 1-129 (128) 157-285 (128)
- Sbjct 1 caattatagattaaaaatatcagaagcatttccagattattcttaaaagttgatgagatc 60
- $ j i; open (F, $ ARGV [0])
- ISRE_PLUS select (ISRE_PLUS); open (ISRE_PLUS, “>isre_plus”); print ISRE_PLUS “$ seq1 ⁇ n"; select (ISRE_MOINS); open (ISRE_MOINS, ">isrejnoins”); print ISRE_MOINS “$ seq2 ⁇ n”; V. Module "pg4 160.p1"
- Module "pg5.p1" system "blastall -p blastn -d tc_bank -a2 -i chr1_alu2-> filejesultat '
- Tmax $ -1e10
- $ lmin (($ 2 ⁇ $ tmin)? $ 2: $ tmin);
- $ tmax (($ 1> $ tmax)? $ 1: $ tmax); ⁇ else ⁇
- $ tmin (($ 1 ⁇ $ tmin)? $ 1: $ lmin);
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP04708383A EP1590486A2 (fr) | 2003-02-05 | 2004-02-05 | Procede pour preparer une collection de moyens de detection de genes inductibles par un mediateur de l'inflammation, et applications |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0350013A FR2850669A1 (fr) | 2003-02-05 | 2003-02-05 | Procede pour preparer une collection de moyens de detection de genes inductibles par un mediateur de l'inflammation, et applications. |
FR0350013 | 2003-02-05 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2004072222A2 true WO2004072222A2 (fr) | 2004-08-26 |
WO2004072222A3 WO2004072222A3 (fr) | 2005-03-24 |
Family
ID=32696414
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/FR2004/050047 WO2004072222A2 (fr) | 2003-02-05 | 2004-02-05 | Procede pour preparer une collection de moyens de detection de genes inductibles par un mediateur de l’inflammation, et applications |
Country Status (3)
Country | Link |
---|---|
EP (1) | EP1590486A2 (fr) |
FR (1) | FR2850669A1 (fr) |
WO (1) | WO2004072222A2 (fr) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995011995A1 (fr) * | 1993-10-26 | 1995-05-04 | Affymax Technologies N.V. | Reseaux de sondes d'acide nucleique sur des microplaquettes biologiques |
WO2000006696A2 (fr) * | 1998-07-30 | 2000-02-10 | University Of South Florida | Procede de modulation du fonctionnement de facteurs de transcription |
WO2001040301A2 (fr) * | 1999-12-01 | 2001-06-07 | Akzo Nobel N.V. | Gene nouvellement identifie, interrompu en cas de schizophrenie |
-
2003
- 2003-02-05 FR FR0350013A patent/FR2850669A1/fr not_active Withdrawn
-
2004
- 2004-02-05 WO PCT/FR2004/050047 patent/WO2004072222A2/fr not_active Application Discontinuation
- 2004-02-05 EP EP04708383A patent/EP1590486A2/fr not_active Withdrawn
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995011995A1 (fr) * | 1993-10-26 | 1995-05-04 | Affymax Technologies N.V. | Reseaux de sondes d'acide nucleique sur des microplaquettes biologiques |
WO2000006696A2 (fr) * | 1998-07-30 | 2000-02-10 | University Of South Florida | Procede de modulation du fonctionnement de facteurs de transcription |
WO2001040301A2 (fr) * | 1999-12-01 | 2001-06-07 | Akzo Nobel N.V. | Gene nouvellement identifie, interrompu en cas de schizophrenie |
Non-Patent Citations (5)
Also Published As
Publication number | Publication date |
---|---|
FR2850669A1 (fr) | 2004-08-06 |
EP1590486A2 (fr) | 2005-11-02 |
WO2004072222A3 (fr) | 2005-03-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6607879B1 (en) | Compositions for the detection of blood cell and immunological response gene expression | |
Macedo et al. | Genetic variability of Trypanosoma cruzi: implications for the pathogenesis of Chagas disease | |
US20160194715A1 (en) | Molecular predictors of fungal infection | |
Bogaert et al. | Differential mucosal expression of Th17-related genes between the inflamed colon and ileum of patients with inflammatory bowel disease | |
CA2103933A1 (fr) | Fragments d'adn de mycobacteries, amorces d'amplification, sondes d'hybridation, reactifs et procede de detection de mycobacteries | |
EP1235933A2 (fr) | Marqueurs de reaction toxicologique | |
TW201022492A (en) | Blood transcriptional signature of mycobacterium tuberculosis infection | |
EP2021504A2 (fr) | Microréseaux de détection d'une sepsie | |
EP3384047B1 (fr) | Procede d'evaluation du risque de complications chez les patients qui presentent un syndrome de reponse inflammatoire systemique (sirs) | |
AU2016265726A1 (en) | Detection of T cell exhaustion or lack of T cell costimulation and uses thereof | |
TW200533758A (en) | Methods of diagnosis | |
Gras et al. | Changes in gene expression pattern of human primary macrophages induced by carbosilane dendrimer 2G-NN16 | |
CN115135779A (zh) | 鉴定宿主rna感染生物标志物 | |
Hart et al. | Quantitative gene expression profiling implicates genes for susceptibility and resistance to alveolar bone loss | |
Chitko-McKown et al. | Gene expression profiling of bovine macrophages in response to Escherichia coli O157: H7 lipopolysaccharide | |
WO2005032347A2 (fr) | Determination de la chemosensibilite de cellules a des agents cytotoxiques | |
JP2004507206A (ja) | 診断上重要な組織特異的遺伝子 | |
WO2004072222A2 (fr) | Procede pour preparer une collection de moyens de detection de genes inductibles par un mediateur de l’inflammation, et applications | |
GB2454799A (en) | Diagnosing infection, SIRS or sepsis using RT-PCR and biomarkers | |
Park et al. | Towards profiling the gene expression of fibroblasts from atopic dermatitis patients: human 8K complementary DNA microarray | |
JP6788256B2 (ja) | 冠動脈イベント予測のための方法及び試薬 | |
EP1462527A1 (fr) | Nouveaux marqueurs des affections intestinales inflammatoires | |
WO2021064327A1 (fr) | Procédé pour déterminer la capacité d'un individu à répondre à un stimulus | |
JP5726524B2 (ja) | 炎症性筋障害を診断および評価するための組成物および方法 | |
KR20030040518A (ko) | 생리활성 물질의 스크리닝 방법 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
DPEN | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed from 20040101) | ||
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2004708383 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2004708383 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2004708383 Country of ref document: EP |