WO2004064709A2 - Agent thrombolytique - Google Patents

Agent thrombolytique Download PDF

Info

Publication number
WO2004064709A2
WO2004064709A2 PCT/CA2004/000044 CA2004000044W WO2004064709A2 WO 2004064709 A2 WO2004064709 A2 WO 2004064709A2 CA 2004000044 W CA2004000044 W CA 2004000044W WO 2004064709 A2 WO2004064709 A2 WO 2004064709A2
Authority
WO
WIPO (PCT)
Prior art keywords
coil
hirudin
clot
terminal end
thrombin
Prior art date
Application number
PCT/CA2004/000044
Other languages
English (en)
Other versions
WO2004064709A3 (fr
Inventor
Qun Lian
Sui-Lam Wong
Original Assignee
University Technologies International Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Technologies International Inc. filed Critical University Technologies International Inc.
Publication of WO2004064709A2 publication Critical patent/WO2004064709A2/fr
Publication of WO2004064709A3 publication Critical patent/WO2004064709A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/49—Urokinase; Tissue plasminogen activator
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/305—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F)
    • C07K14/31—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Micrococcaceae (F) from Staphylococcus (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/815—Protease inhibitors from leeches, e.g. hirudin, eglin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a thrombolytic agent and, in particular, to a heterodimer comprising staphylokinase and hirudin.
  • AMI Acute myocardial infarction
  • APSAC anisoylated plasminogen streptokinase activator complex
  • tP A tissue specific plasminogen activator
  • urokinase tP A is the most commonly used.
  • tP A is fibrin specific
  • its short in vivo biological half-life and sensitivity to plasminogen activator inhibitors in circulation require the use of high doses of tPA, to achieve effective clot lysis.
  • tPA exerts only partial fibrin specificity. This results in depletion of plasma proteins such as coagulation factors V and VIH, and to a certain degree, plasminogen and fibrinogen.
  • Approximately 57% of the patients treated with tPA can restore their blood flow to an acceptable level within 90 minutes after receiving the treatment.
  • 10-30% of patients show reocclusion shortly after clot dissolution.
  • the reformed secondary clots are usually platelet-rich and show strong resistance to lysis mediated by tP A.
  • a low but significant percentage of the patients also suffer from stroke.
  • Staphylokinase shows promise for use as a blood clot dissolving agent [10].
  • SAK does not bind directly to fibrin, it can act indirectly on fibrin by binding plasmin(ogen) to form a 1 : 1 stoichiometric S AK-plasmin(ogen) complex. The resulting complex can then function as the plasminogen activator to convert plasminogen to plasmin which will cause clot lysis.
  • SAK has tlirombolytic potency comparable to tPA, several multi- center clinical trials demonstrate that the SAK-plasmin complex is more specific for fibrin than is tPA [11-13] .
  • plasminogen activators are generally administered together with an anticoagulant substance such as heparin. This results in improved thrombolysis as compared to treatment with only a plasminogen activator (Tebbe et al., Z. Kardiol. 80, Suppl: 3, 32 (1991)).
  • Various clinical results indicate that, in parallel with the dissolution of clots, an increased tendency towards coagulation occurs (Szczeklik et al., Arterioscl. Thromb. 12, 548 (1992); Goto et al., Angiology 45, 273 (1994)).
  • thrombin molecules which are enclosed in the clot are released when the clot dissolves.
  • plasminogen activators may also accelerate the activation of prothrombin and thus act in opposition to thrombolysis (Brommer et al., Thromb. Haemostas. 70, 995 (1993)).
  • Anticoagulant substances such as heparin, hirugen, hirudin, argatroban, protein C and recombinant tick anticoagulant peptide (TAP) can counter this increased tendency towards re-occlusion during thrombolysis and can thus enhance the success of lysis therapy (Yao et al., Am. J. Physiol. 262 (Heart Circ. Physiol.
  • hirudin One of the strongest thrombin inhibitors is hirudin, first isolated from the leech Hirudo medicinales. There are various isoforms of this 65 amino acid protein, which differ in regard to their amino acid sequences. All isoforms of hirudin block the binding of thrombin to a substrate, for example fibrinogen, and also block the active center of thrombin (Rydel et al., Science 249, 277 (1990); Bode and Huber, Molecular Aspects of Inflammation, Springer, Berlin, Heidelberg, 103-115 (1991); Stone and Hofsteenge, Prot. Engineering 2, 295 (1991); Dodt etal., Biol. Chem. Hoppe-Seyler 366, 379 (1985)).
  • hirudin small polypeptides derived from hirudin, which also act as thrombin inhibitors, are known in the art (Maraganore et al., Biochemistry 29, 7095 (1990); Krstenansky et al. in J. Med. Chem. 30, 1688 (1987); Yue et al, Prot. Engineering 5, 77 (1992)).
  • the use of hirudin in combination with a plasminogen activator for the treatment of thrombotic diseases is described in U.S. Pat. No.4,944,943 and U.S. Pat. No. 5,126,134.
  • the use of hirudin derivatives in combination with a thrombolytic agent is known from PCT International Patent Application WO 91/01142, the contents of which are incorporated herein by reference.
  • Hirullin is a 61 amino acid long protein which was first isolated from the leech Hirudo manillensis. Hirullin is similar to hirudin in regard to its action and inhibitor strength, but differs considerably from hirudin in regard to its amino acid sequence. It is also possible to derive smaller polypeptides from hirullin, which are good thrombin inhibitors (Krstenansky et al., Febs Lett. 269, 465 (1990)).
  • the three-dimensional structure of the hirudin-thrombin complex and site-directed mutagenesis of hirudin illustrate that the N-terminal ⁇ -amino group of hirudin forms a hydrogen bond with Serl95 in the catalytic site of thrombin [34, 35].
  • SAK its processing by plasmin to remove the first 10 amino acids to expose the positively charged lysine residue at position 11 is essential for the activity of SAK [24, 36].
  • a processed version of staphylokinase can be engineered using recombinant DNA technology, the presence of a positively charged residue at the N-terminus of the processed staphylokinase is absolutely required [24].
  • a thrombolytic agent that combines a plasminogen actuator such as staphylokinase and a thrombin inhibitor such as hirudin, such that biologic activity of each component in retained.
  • Applicants have engineered a "Y" shaped heterodimer comprising a plasminogen activator and a thrombin inhibitor which can be targeted to freshly formed thrombin-rich thrombi to initiate clot lysis and minimize clot reformation through the inhibition of thrombin.
  • the invention comprises a heterodimer including a plasminogen activator and a thrombin inhibitor, wherein each of the plasminogen activator and the thrombin inhibitor comprises a free N-terminus.
  • the plasminogen activator comprises staphylokinase and the thrombin inhibitor comprises hirudin.
  • the proteins used in this invention may be produced by genetic engineering.
  • synthetic oligonucleotides encoding the proteins are cloned into suitable plasmids and expressed in E. coli under the control of the trp or tac promoter.
  • Particularly preferred is the trp promoter.
  • inducible regulatory systems in B. subtilis may be used, including sucrose inducible system (sacB based promoter system with appropriate regulatory sequence), xylose induction system and gluconate induction system, hi one embodiment, the expression vector system includes a constitutively expressed P43 promoter isolated from B. subtilis.
  • this invention comprises plasmids for use in the production of the heterodimeric protein which plasmids comprise operons which comprise a constitutively expressed promoter or a regulable promoter, a synthetic structural gene for a protein according to the invention, and one or two terminators downstream of the structural gene.
  • the plasmids according to the invention can be expressed in B. subtilis strains, particularly in extracellular protease deficient strains, for example WB600, WB700 or WB800, and secreted into the extracellular medium.
  • the invention comprises a pair of nucleic acids that encodes for a a plasminogen activator and a thrombin inhibitor that can be combined to form a heterodimer.
  • the plasminogen activator comprises staphylokinase and the thrombin inhibitor comprises hirudin.
  • the nucleic acids may form plasmids or other vectors used to transform cells.
  • the invention may comprise cells transformed with plasmids of the present invention.
  • the invention comprises compositions for treating thrombotic diseases comprising the thrombolytic agents described herein as well as methods of treating subjects with thrombotic diseases with the thrombolytic agents described herein.
  • Fig. 1 shows the structure of a hirudin-E coil (HE) and staphylokinase-K coil (SK) heterodimer (HE-SK).
  • Figure 1 A shows a molecular model of HE-SK. E-coil and K-coil serve as the heterodimerization domains. A cysteine residue located at position "d" of the first heptad repeat in each coiled coil allows the formation of an interchain disulfide bond as illustrated in the model.
  • SAK represents staphylokinase.
  • Figure IB shows a helical wheel presentation of the coiled-coil heterodimerization domain. Positions of the heptad repeat are marked from "a" to "g".
  • FIG. 2 shows the secretory production of hirudin-E coil (HE) and staphylokinase-K coil (SK).
  • Figure 2A shows a Coomassie blue stained SDS-polyacrylamide gel.
  • Figure 2B shows a Western blot probed with hirudin specific polyclonal antibodies. Lanes 1-4 in Figures 2 A and 2B are the culture supernatant from WB600[pUB18] (negative control), WB600[pHirudin-E coil], WB700[pHirudin-E coil] and WB800[pHirudin-E coil], respectively. Asterisk marks the position of the secreted hirudin-E coil.
  • Figure 2C shows another Coomassie blue stained SDS-polyacrylamide.
  • Figure 2D shows a Western blot probed with staphylokinase specific polyclonal antibodies.
  • Lanes 1-5 in Figures 2C and 2D are the culture supernatant from WB600[pUB 18] (negative control), WB600[pSAK], WB600[pSAK-K coil], WB700[pSAK- K coil], and WB800[pSAK-K coil], respectively.
  • M represents the molecular weight markers.
  • FIG. 3 shows SDS-PAGE and Western blot analyses of purified hirudin-E coil, SAK-K coil and HE-SK.
  • Figure 3 A shows a Coomassie blue stained SDS-polyacrylamide gel for himdin- E coil and SAK-K coil.
  • Lanes 1 and 2 are the purified hirudin-E coil and SAK-K coil analyzed in the presence of reducing agent (mercaptoethanol).
  • Lanes 4-5 are the same samples analyzed in the absence of reducing agent.
  • Lane 3 is an empty lane without any sample loading. Its presence is to minimize the diffusion of reducing agent from lane 2 to lane 4.
  • Figure 3B shows a Western blot probed with hirudin specific polyclonal antibodies.
  • Lanes 1 and 2 are purified hirudin-E coil (before and after the disulfide-bond reshuffling treatment) analyzed in the absence of reducing agent.
  • Lane 3 is an empty lane.
  • Lane 4 is the purified hirudin-E coil analyzed in the presence of reducing agent.
  • Figure 3C shows a Coomassie blue stained SDS-polyacrylamide gel for purified HE-SK.
  • Lanes 2 and 3 are purified HE-SK (before and after disulfide-bond reshuffling) analyzed in the absence of reducing agent.
  • M represents the molecular weight markers.
  • Fig. 4 shows a characterization of purified HE-SK.
  • Figure 4A shows a Coomassie blue stained SDS-polyacrylamide gel for purified HE-SK. Failure to see the hirudin-E coil band in lane 1 is because of the poor staining of this protein with Coomassie blue.
  • Figure 4B shows a Western blot probed with staphylokinase specific polyclonal antibodies.
  • Figure 4C shows a Western blot probed with hirudin specific polyclonal antibodies. Lanes 1 and 3 are purified HE-SK analyzed in the presence and absence of reducing agent, respectively.
  • Figure 4D shows a molecular mass determination of purified HE-SK by MALDI-TOF mass spectrometry.
  • Peaks corresponding to various protonated HE-SK species are marked.
  • the two peaks with the molecular weights of 12,092 and 21,043 represent the mono-protonated HE and SK species, respectively. This indicates the presence of low levels of non-crosslinked HE-SK in the purified HE-SK preparation.
  • Fig. 5 shows the biological activities of purified HE-SK.
  • Figure 5 A shows a staphylokinase activity determination. Plasminogen (1 ⁇ M) and SAK (5 nM) or HE-SK (5 nM) were incubated at 37°C. At different time points, samples were collected and assayed for plasmin activity. Closed square and open circle represent the plasminogen activation activities of SAK and HE-SK, respectively.
  • Figure 5B shows a hirudin activity determination as reflected by the inhibition of thrombin activity.
  • Thrombin activity was determined in the presence of increasing concentration of hirudin [open circle with a solid line] or HE in HE-SK (before [closed triangle with a dash line] and after [closed square with a dash line] the disulf ⁇ de bond reshuffling).
  • the data in both panels A and B represent the mean values ( ⁇ SD) of three independent experiments.
  • FIG. 6 shows a quantification and inhibition of clot-bound thrombin activity. Fibrin clots were formed by adding increasing amounts (expressed in terms of thrombin concentration in the clot formation process) of thrombin.
  • Figure 6 A shows the activity of clot-bound thrombin. The clots were either washed extensively with HBS (open circle) or remained unwashed (closed circle). Thrombin activity was then determined.
  • Figure 6B shows the inhibition of clot-bound thrombin activities. Clot-bound thrombin activities from washed clots were determined in the presence of hirudin (closed triangle), HE-SK (closed square) or in the presence of HBS (control, open circle).
  • Figure 6C shows the correlation between the amounts of thrombin activities inhibited by either hirudin (open triangle) or HE-SK (closed square) and the amounts of thrombin used in the clot formation process.
  • the data presented in each panel represent the mean value ( ⁇ SD) of three independent experiments.
  • Fig. 7 shows the correlation between the clot lysis effect mediated by HE-SK and the thrombin concentrations used in the clot formation process.
  • Clot lysis was mediated by either 75 nM SAK (closed square) or 75 nM HE-SK (closed circle).
  • Fig. 8 shows a fibrin-clot lysis mediated by various thrombolytic agents.
  • SAK alone, SAK with hirudin (S+H) and HE-SK were used in this study in the absence ( Figure 8A) and presence ( Figure 8B) of fibrinogen (4 r ⁇ g/ml).
  • the concentration of both the thrombolytic agents and hirudin is 75 nM.
  • Fig. 9 demonstrates plasma-clot lysis mediated by various thrombolytic agents. Stability of the plasma clot (closed diamond) was monitored with the addition of plasma in the absence of any externally added thromoblytic agents. Other plasma clots are lysed in the presence of 7,200 nM SAK alone (open triangle), 600nM HE-SK (open circle), 1,200 nM SAK with 600 nM hirudin (closed square). A set of representative results out of three independent experiments is presented here.
  • the present invention provides for an engineered thrombolytic agent comprising a combination of an N-terminus dependent plasminogen activator and an N-terminus dependent thrombin inhibitor.
  • the practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, microbiology, recombinant DNA, and immunology. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, J. et al. (Cold Spring Harbor Laboratory Press (1989)); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed.
  • plasminogen activator means a naturally occurring, recombinant or synthetic protein which converts plasminogen to plasmin, either by an enzymatic mode of action or by formation of a complex with plasminogen.
  • thrombin inhibitor means a naturally occurring, recombinant or synthetic protein which prevents clot formation by inhibiting the activity of the serine protease thrombin.
  • anticoagulant includes thrombin inhibitors but may also include proteins which prevent clot formation through another mode of action.
  • staphylokinase or "SAK” means a protein having a sequence of 136 amino acids which is secreted by numerous strains of Staphylococcus aureus, and its variants or derivatives. It converts plasminogen (Pg), the inactive proenzyme of the fibrinolytic system, into its proteolytic form plasmin, which causes liquefaction of fibrin and dissolution or lysis of a thrombus (blood clot). Unlike the two mammalian plasminogen activators, tPA and urokinase, staphylokinase does not act as an enzyme but instead converts plasminogen by formation of a stoichiometric complex.
  • Recombinant SAK refers to SAK that is isolated as expressed from a recombinant cell, e.g., a microbial cell, e.g., a B. subtilis cell, or in a eukaryotic cell such as a yeast or an insect cell, which cell is transformed with a vector bearing a gene that encodes, for example, an SAK or SAK variant protein.
  • hirudin means an anticoagulant peptide that occurs naturally in the salivary glands of the medical leech Hirudo medicinalis, and its variants. Its anticoagulant activity comes from the chemical ability to inhibit thrombin. As used herein, “hirudin” may refer to both natural and recombinant forms of the peptide.
  • thrombus means a clot formed in the circulation of the cardiovascular system from blood constituents which contains fibrin, and includes without limitation a clot located in any tissue or organ such as heart, brain, vein, artery, and lung.
  • fibrin means the product of fibrinogen produced by action of thrombin during the clotting or coagulation of blood, and found in blood clots.
  • dissolution or “lysis” or “dissolving” of a thrombus refers to a reduction in size of a thrombus, or its elimination from a subject.
  • the term "subject” means an animal in need of therapy for, or susceptible to, a condition of thrombosis or its sequelae such as myocardial infarction, which condition is remediable or alleviated through dissolution or lysis of a thrombus.
  • the animal is a mammal, such as a human or a non-human mammal such as a dog, cat, pig, cow, sheep, goat, horse, rat, or mouse. Most preferably, the animal is a human.
  • the term "subject” does not exclude an individual that is normal in all respects.
  • the subject may be a candidate for future treatment by clot lysis, having formerly been treated surgically or by therapy with an agent that dissolves clots, and may be under treatment with such an agent.
  • the term "patient” means a human subject who has presented at a clinical setting with a particular symptom or symptoms suggesting the need for treatment with a thrombolytic agent.
  • the term includes a human subject whose symptoms can be indicative of thrombotic conditions (in at least one anatomical site), such as myocardial infarction (heart), venous thrombosis (vein), pulmonary embolism (lung), cerebral thrombosis (brain), graft thrombosis (implanted graft), and arterial thrombosis (artery), e.g. coronary thrombosis (coronary artery).
  • the term includes a human subject whose diagnosis alters during the course of disease progression, such as by development of further disease symptoms, or remission of the disease, either spontaneously or during the course of a therapeutic regimen or treatment.
  • variant means a protein or nucleic acid molecule that is substantially similar in structure and biological activity to another protein or nucleic acid, and may substitute for the molecule of which it is a variant. Thus, provided that the molecule possesses an activity common with the other and may substitute for the other, it is considered a variant even if the composition or secondary, tertiary or quaternary structure of the molecule is not identical to that of the other, or if the amino acid or nucleotide sequence is not identical to that of the other.
  • fragment refers to a portion of a native or variant bacterial protein, such as the SAK protein or the nucleotide sequence encoding that protein.
  • fragment includes a chemically synthesized protein or nucleic acid fragment, for example, of SAK or the gene encoding SAK.
  • the tenn "effective dose” means that amount of a composition including a plaminogen activator and an anticoagulant that is provided to achieve a therapeutic effect, such as dissolution of a thrombus or reduction in size of a thrombus.
  • the present invention combines staphylokinase and hirudin as a heterodimer with a dimerization domain fused to the C-terminal end of each component.
  • Staphylokinase is a representative of plasminogen activators which require a free N-terminus for biological activity.
  • Hirudin is representative of anticoagulants which require a free N-terminus for biological activity. Whether a particular plasminogen activator or a particular anticoagulant requires a free N-terminus for biological activity may be known in the art.
  • a "free N-terminus” includes the amino terminal end of the native protein or one that is created by a natural process or a directed process.
  • Fibrinolysis is the process of degrading a thrombus or clot through proteolytic cleavage of its fibrin meshwork.
  • the key activity of a proteolytic enzyme on a protease precursor (zymogen) in this process is that of Pg conversion to plasmin (Pn), whose function is specifically modulated by protein-protein interactions with inhibitors, e.g., 2-antiplasmin, and activators, e.g., the endogenous tissue Pg activator (t-PA), the bacterial agents SAK or streptokinase and others.
  • Pg-Pn plasmin
  • t-PA endogenous tissue Pg activator
  • SAK streptokinase
  • SAK converts Pg (without cleavage) into a catalytically efficient Pg activator. At least three functional steps in this process are known: SAK forms a tight stable activator complex with Pg or Pn; SAK generates or unmasks the latent active site in Pg creating a 'virgin enzyme' (Pg*); and SAK modifies the substrate specificity of Pg* or Pn so that the complex can cleave Pg molecules.
  • hirudin The C-terminal region of hirudin is known to bind to the thrombin cleft (also known as the anion-binding exosite) mainly through electrostatic interactions. With the presence of a flexible linker sequence, the addition of a dimerization domain to hirudm at the C-terminal end should have a minimal effect on hirudin activity. C-terminal hirudin fusions have been constructed in the prior art and all are known to retain biological activity [33,37].
  • the dimerization domain may comprise engineered coiled coil sequences (also commonly known as a leucine zipper) which are described in the literature [20] and may include any coiled coil sequence that can form a heterodimeric structure.
  • the Applicants have created modified coil sequences to serve as the dimerization domain. These coil sequences are designated herein as "K coil” and "E coil”.
  • K coil and E coil each comprise heptad repeats.
  • the seven residues occupy positions "a" to "g" in a helical coiled coil sequence, as shown in Figure IB.
  • at least three heptad repeats are used, which should result in successful dimerization. More preferably, at least five heptad repeats are used, for the formation of stable dimers [38].
  • the amino acids in the heptad repeats are chosen for their ability to form a coiled coil and for their ability to heterodimerize. Dimerization may be facilitated by choosing oppositely charged amino acids for each coiled coil.
  • one coil may include positively charged residues such as lysine or arginine, while the other coil may include negatively charged residues such as glutamate or aspartate.
  • the heptad repeats comprise a bulky hydrophobic amino acid in positions "a" and "d", such as valine, leucine, isoleucine, phenylalanine, tryptophan or methionine.
  • the heptad repeats have the sequence VSALKQK (SEQ JJD NO: 1) for K coil and VSALEQE (SEQ ID NO: 2) for E coil.
  • each coil is occupied by glutamine (Q), which is a polar amino acid and has a strong preference towards forming an ⁇ - helical structure.
  • Q glutamine
  • lysine residues are at the adjacent positions "e” and "g” (Fig. IB).
  • E coil glutamate residues occupy the equivalent positions.
  • the E coil sequence is negatively charged with a calculated pi of 3.29 and the K coil sequence is positively charged with a theoretical pi of 10.61. Since the pi for SAK and hirudin are 7.74 and 4.04, respectively, SAK in combination with K coil will be positively charged and hirudin in combination with E coil will be negatively charged at physiological pH.
  • engineered molecules can be purified using ion-exchange chromatography, as is known in the art.
  • one heptad repeat in each of K coil and E coil include a cysteine residue in an appropriate position.
  • position "d" in the first helical turn of each coiled coil is occupied by cysteine.
  • a hydrophilic, flexible linker of 20 amino acids ([GSTSG] 3 SGSPG) (SEQ ID NO: 3) is inserted between staphylokinase andK coil (Fig. 1 A). Since hirudin is much smaller than staphylokinase, a shorter 15 amino-acid linker ([STSGG] 2 STSPG) (SEQ ID NO: 4) may be inserted between hirudin and E coil.
  • proteins other than the proteins described above and in the Examples which comprise a plasminogen activator, a linker and a dimerization domain, can be made.
  • proteins other than the proteins described above and in the Examples which comprise thrombin inhibitor, a linker and a dimerization domain, can be made. These other proteins are intended to be included herein.
  • Homologs of SAK proteins can be generated by mutagenesis, for example, by a point mutation causing a substitution or a deletion. For instance, a mutation can give rise to a homolog which retains substantially the same biological activity of the SAK from which it was derived.
  • a protein is considered to be an SAK homolog if it has SAK biological activity (if it can bind and activate Pg).
  • Homology refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each of two sequences, which may be aligned for purposes of comparison. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are homologous or identical at that position. The degree of homology between sequences is a function of the number of matching or identical positions shared by the sequences.
  • the invention includes nucleic acids which encode first and second peptides wherein the first peptide comprises staphylokinase and a first dimerization domain and the second peptide comprises hirudin and a second dimerization domain, hi one embodiment, the first dimerization domain comprises K coil as described above and the second dimerization domain comprises E coil as described above.
  • the first peptide may have the amino acid sequence of amino acids 30-221 of SEQ ID NO: 14.
  • the second peptide may have the amino acid sequence of amino acids 30-144 of SEQ D NO:16.
  • nucleic acids encode a protein comprising an amino acid sequence at least 60% homologous, more preferably 70% homologous and most preferably 80%, 90%, or 95% homologous with the amino acid sequences referred to above.
  • Nucleic acids which encode polypeptides having an activity of subject SAK and hirudin proteins and having at least about 90%o, more preferably at least about 95%, and most preferably at least about 98% homology with the amino acid sequences referred to above are within the scope of the invention.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • expression vector includes any vector, (e.g., a plasmid, cosmid or phage chromosome) containing a gene construct in a form suitable for expression by a cell (e.g., linked to a promoter). Expression vectors are capable of directing the expression of genes to which they are operatively linked.
  • Expression vectors for expression of a gene and capable of replication in a cell of a bacterium such as an Escherichia, a Bacillus, a Streptomyces, a Streptococcus, or in a cell of a simple eukaryotic organism such as the yeast Saccharomyces oxPichia, or in a cell of a eukaryotic multicellular organism such as an insect, a bird, a mammal, or a plant, are within the preferred embodiments of the present invention.
  • Such vectors may carry functional replication-specifying sequences (replicons) both for a host for expression, for example a Streptomyces, and for a host, for example, E. coli, for genetic manipulations and vector construction.
  • Useful expression control sequences include, for example, the early and late promoters of SV40, adenovirus or cytomegalovirus immediate early promoter, the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage lambda, the control regions for fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase, e.g., Pho5, the promoters of the yeast . ⁇ -mating factors, the polyhedron promoter of the baculovirus system, sucrose inducible system (sacB based promoter system with appropriate regulatory sequence), xylose induction system and gluconate induction system, and the constitutively expressed promoter system P43 isolated from B. subtilis, and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or
  • the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed, h one embodiment, the expression vector includes a recombinant gene encoding a peptide as described above.
  • Such expression vectors can be used to transfect cells and thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein. These procedures are well known to those skilled in the art.
  • compositions and Dosages include any and all solvents, dispersion media, e.g., human albumin or cross-linked gelatin polypeptides, coatings, antibacterial and antifungal agents, isotonic, e.g., sodium chloride or sodium glutamate, and absorption delaying agents, and the like that are physiologically compatible.
  • the carrier is suitable for oral, intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion).
  • the active compound can be coated in a material to protect the compound from the action of acids and other natural conditions that can inactivate the compound.
  • parenteral administration and “administered parenterally” as used herein mean modes of administration other than oral and topical administration, usually by bolus injection or infusion, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.
  • Dosage regimens are adjusted to provide the optimum desired response, e.g., a therapeutic response, such as dissolution of a clot.
  • a therapeutic response such as dissolution of a clot.
  • a single bolus can be administered, several divided doses can be administered over time or the dose can be proportionally reduced and administered over a time period by infusion, or increased, as indicated by the exigencies of the therapeutic situation.
  • a suitable daily dose of a composition of the invention will be that amount of the composition which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above. It is preferred that administration be intravenous, intracoronary, intramuscular, intraperitoneal, or subcutaneous.
  • the thrombolytic agent of the present invention may be modified to reduce the immunogenicity of the agent.
  • Polyethylene glycol-derivatized variants of SAK have been constructed and shown to reduce their clearance from plasma as a result of lowered immunogenicity (Collen, D. et al., Circulation, 2000 Oct. 10; 102(15): 1766-72).
  • modified agents are within the scope of the claimed invention.
  • the structural genes encoding both K coil and E coil sequences were assembled by using several long synthetic oligonucleotides (Primers 1-4 for K coil and primers 5-8 for E coil) with a PCR-based strategy [22, 23].
  • K coil sequence portions of the primer 2 sequence are complementary to primers 1 and 3, respectively, and part of the primer 4 sequence is complementary to primer 3.
  • primers 1-4 are listed as follows:
  • Primer 1 5'GGGGATCCCCTGGACAGAAAGTTTCTGCTTGCAAA
  • Primer 2 5'CTTTTTGTTTTAAAGCGCTCACTTTCTGTTTAAGCGCGCTAACT TTCTGTTTGCAAGCAGAAAC 3' [SEQ ID NO: 6];
  • Primer 3 5' GTGAGCGCTTTAAAAC AAAAAGTGTC AGC ACTTAAGC AAAA
  • the assembled sequence encodes a portion of a linker sequence and the entire K coil sequence with a Baml ⁇ l site at the 5' end and an Hp ⁇ l site at the 3' end.
  • This sequence was ligated to Hindi digested pUC19 as a blunt-end fragment to generate pUC19-K coil.
  • the E coil sequence was assembled with a similar approach using four primers to generate a DNA fragment with a Spel site at the 5' end and a Sphl site at the 3' end. The fragment was ligated to HincH cut pUC19 to generate pUC19-E coli via a blunt-end ligation. Sequences of the primers 5-8 are listed as followed. Primer5:5'GGACTAGTCCTGGACAGGAAGTTTCTGCTTGCGAA CAG 3' [SEQ ID NO: 9];
  • Primer6 5'CTTCTTGTTCAAGTGCTGAAACTTCTTGTTCTAATGCGCTCACT TCCTGTTCGCAAGCAGAAAC 3' [SEQ ID NO: 10]; Primer7:5 'CAGCACTTGAACAAGAAGTTAGCGCGCTTGAACAAGAAGT
  • Nucleotide sequences of both the K coil and E coil sequences in pUC19-K coil and pUC19-E coil were determined and confirmed to be free of PCR errors.
  • Plasmid pSAK-K coil is the B. subtilis vector for secretory production of staphylokinase-K coil (SK). It is a derivative of the pUB18-SAK-Kl vector [24] which encodes a staphylokinase fusion carrying the kringle 1 domain from human plasminogen. pSAK-K coil was generated by replacing the BamHI/Hpal fragment encoding a portion of the linker sequence and the kringle 1 domain sequence in pUB18-SAK-Kl with the synthetic Bam ⁇ UHp ⁇ l K coil sequence from pUC19-K coil.
  • Plasmid pSAK-K coil comprises the following artificial nucleotide sequence encoding staphylokinase-K coil sequence.
  • the first 87 nucleotides encode the Bacillus subtilis levansucrase signal peptide sequence.
  • Nucleotides 88-495 encode mature staphylokinase.
  • Nucleotides 496-555 encode the flexible linker sequence.
  • Nucleotides 556-663 encode the synthetic K coil sequence which is an engineered coiled coil sequence rich in lysine.
  • Nucleotides 664-666 are the translation teraiination codon.
  • the nucleotide sequence SEQ ID NO: 13 codes for a polypeptide having the following amino acid sequence: l IV ⁇ N ⁇ KKFAKQA TVLTFTTALL AGGATQAFAS SSFDKGKYKK
  • Plasmid pHirudin-E coil is the B. subtilis vector for secretory production of hirudin-E coil (HE) and is a derivative of pUB18-Hirudin-SAK [24] which produces a hirudin fusion with SAK at the C-t ⁇ rminal end.
  • HE hirudin-E coil
  • pUB18-Hirudin-SAK pUB18-Hirudin-SAK
  • Plasmid pHirudin-Ecoil comprises the following synthetic construct nucleotide sequence which is a 451 -nucleotide BsaBl/Sphl fragment.
  • Nucleotides 2 - 88 encode the Bacillus subtilis levansucrase signal peptide sequence (amino acids 1-29). Nucleotides 89-283 encode hirudin (amino acids 30-94). Nucleotides 284-328 encode the flexible linkage (amino acids 95-109). Nucleotides 329-436 encode the synthetic E-coil sequence. Nucelotides 437-439 are the translation termination codon.
  • nucleotide sequence SEQ ID NO: 15 codes for a polypeptide having the following amino acid sequence:
  • HE, SK and HE-SK For HE purification, 50 ml of WB800 [pHirudin-E-coil] culture supernatant was collected by centrifugation and dialyzed against 4 liters of 17 mM potassium phosphate buffer (pH 6.0) at 4°C overnight. The dialyzed sample was applied to a DE52 (Whatman, England) column (15x1.5 cm) equilibrated with the same buffer. After washing the column until the absorbance at 280 nm was less than 0.02, HE was eluted using a 150 ml linear gradient (0-0.7 M NaCI) in the same buffer. The HE-containing fractions (0.25 - 0.35 M NaCI) were combined and dialyzed.
  • WB800 [pHirudin-E-coil] culture supernatant was collected by centrifugation and dialyzed against 4 liters of 17 mM potassium phosphate buffer (pH 6.0) at 4°C overnight. The dialyzed sample
  • the sample was concentrated in 0.1M NaHCO 3 buffer (pH8.3) containing 0.05 M NaCI to a final volume of 200-300 ⁇ l using a Centricon unit.
  • the concentrated sample was then loaded onto a Bio-Prep SE 100/17 column and eluted with 12 ml 0.1M NaHCO 3 buffer (pH 8.3) containing 0.05 M NaCI buffer at a flow rate of 0.4 ml/min. Fractions containing HE were pooled and concentrated by ultrafiltration.
  • HE-SK 50 ml of culture supernatant was collected, dialyzed and applied to a DE52 column.
  • HE-SK was separated with a linear salt gradient of 0-0.5 M NaCI (in 150 ml) and the HE-SK containing fractions (0.1-0.15 M NaCI) were further purified by gel filtration.
  • SK purification 50 ml of culture supernatant was collected, dialyzed against 4 liters of 17 mM potassium phosphate buffer (pH 7.0) at 4°C overnight and applied to a Macro-Prep High S column (Bio-Rad, 5x1.5 cm) previously equilibrated with the same buffer. After washing the column until A 280 was less than 0.1, SK was eluted from the column with a linear salt gradient (0-1.0 M NaCI in 100 ml of the same buffer). SK monomer-containing fractions (0.4-0.5 M of NaCI) were further purified by gel filtration as described above in 0.1 M sodium phosphate buffer (pH 5.8) containing 0.1 M NaCI.
  • HE, SK and HE-SK were quantified spectrophotometrically at 280 nm using molar extinction coefficients of 3,400 M ' 1 , 17,330 M ' 20,730 M ' 1 (30), respectively.
  • the disulfide-bond reshuffling of HE or HE-SK was performed using the method described by Chang [21] with modification. Briefly, each protein sample was dialyzed and concentrated to a final concentration of 50-70 ⁇ M in 0.1 M NaHCO 3 buffer (pH 8.3) in the absence of any extra salt, to minimize dimer formation. The reshuffling process proceeded at 4°C overnight in a microcentrifuge tube by adding cysteine (cys) and cystine (cys-cys) to final concentrations of 4 mM and 2 mM, respectively. The efficiency of the reshuffling process was determined by non-reducing SDS-PAGE and Western blotting.
  • MALDI-TOF Matrix-assisted laser desorption ionization-time of flight
  • Cross-linked fibrin clots were prepared by adding human thrombin (Sigma Canada, Oakville, Ontario) at final concentrations from 0.1 to 2 NTH units/ml to 4 mg/ml human fibrinogen (Sigma) in HEPES -buffered saline (HBS, 0.02 M HEPES, 0.13 M NaCI; pH 7.4) containing 20 mM CaCl at room temperature. Immediately after mixing, 100 ⁇ l of the polymerizing solution was transferred to a microtiter plate (Falcon 35-3912, Becton Dickinson, N.J.). The clots were formed at room temperature for 2 hours. Two sets of clots were formed.
  • the first set of fibrin clots was washed with 100 ⁇ l of HBS followed by careful removal of the washing buffer. This step was repeated 5 times until no thrombin activity in the wash buffer was detected.
  • the second set of clots was unwashed and used as the control to determine the ratio of thrombin incorporated into the fibrin clot.
  • thrombin specific chromogenic substrate N-j>-Tosyl-G ⁇ y-Pro-Arg p-nitroanilide, Sigma
  • Thrombin activity Fig. 6A was expressed as the initial rate of color development (mOD/min).
  • hirudin and its derivatives were performed under two different conditions with hirudin and its derivatives (HE and HE-SK) as the inhibitors.
  • the first series was performed with thrombin freely in solution while the second series was determined with clot-bound thrombin.
  • increasing amounts of hirudin and its derivatives were incubated with thrombin (final concentration: 1 NTH unit/ml) at room temperature in HBS containing 0.2 mg/ml BSA.
  • the reaction was started by the addition of 50 ⁇ l of 560 ⁇ M thrombin specific chromogenic substrate to the thrombin/hirudin mixture (50 ⁇ l).
  • Thrombin activity was determined as described above. IC 50 values of hirudin and its derivatives were then determined (Fig. 5B). To monitor the inhibition of the clot-bound thrombin activity by hirudin and its derivatives, each washed fibrin clot was incubated with 100 ⁇ l of either HBS or inhibitors (75 nM). After incubation at room temperature for 1 hr, liquid was carefully removed without disturbing the clot, and the clot was then washed with HBS to remove any unbound inhibitors. Finally, chromogenic substrate was added to each clot and the rate of color development (at 405 nm) was measured.
  • the activity of the non-inhibited clot-bound thrombin was plotted over the thrombin concentrations used to form the clot (Fig. 6B).
  • the amount of clot-bound thrombin inhibited by the inhibitor was determined as the differences of thrombin activities between the clots treated with the inhibitor and the clots treated with HBS (Fig. 6C).
  • Clot lysis assays In a first clot lysis assay, washed fibrin clots with different amounts of clot-bound thrombin were prepared according to the above-mentioned conditions. Each clot was treated with 100 ⁇ l of 75 nM SAK or HE-SK for 1 hr. The solution was then removed by pipetting. Each clot was washed once with HBS to remove any unbound thrombolytic agent. Clot lysis was initiated by the addition of 100 ⁇ l of 1 ⁇ M plasminogen in HBS. The lysis process was monitored using the microtiter plate reader until the turbidity of the clot reached the minimal value.
  • T 50% for clot lysis which represented the time required to achieve a 50% lysis of the fibrin clot, was obtained from the graphs.
  • the T 5 o 0 values for the clots with different amounts of thrombin incorporated inside were then plotted over the thrombin concentration used in forming the clot to determine the thrombin effects on the clot lysis mediated by HE-SK (Fig. 7).
  • fibrin clots formed in the presence of 0.8 NTH unit/ml of thrombin
  • fibrin clots were generated as described above and the assays were all performed at room temperature
  • clot lysis was initiated by the addition of 100 ⁇ l of a freshly prepared thrombolytic solution (75 nM SAK or HE-SK + 1 ⁇ M plasminogen).
  • the clot lysis process was monitored for 1 hr. After this incubation, liquid ( ⁇ 100 ⁇ l ) was carefully removed, and 100 ⁇ l of a 1 ⁇ M plasminogen solution was layered on each clot.
  • the third fibrin clot lysis assays were identical to the second one except that all the plasminogen containing solution used in this set of assays also contained 4 mg/ml fibrinogen.
  • Cross-linked plasma clots were prepared using freshly prepared, citrated platelet-poor human plasma pooled from healthy donors. Once prepared, plasma was aliquoted and stored at - 20°C until use. Clotting was initiated by adding human thrombin to 0.8 NIH unit/ml (final concentration) and CaCl to 20 mM (final concentration) at room temperature. Immediately after mixing, 50 ⁇ l of the polymerizing plasma was transferred to microtiter plate. The clots were formed at room temperature for 2 hours.
  • Clot lysis was performed by adding 50 ⁇ l of plasma containing freshly added thrombolytic agent (600 nM HE-SK, 7,200 nM SAK or 1,200 nM SAK plus 600 nM hirudin) on each clot. The clot lysis process was monitored. After 1-hour incubation, liquid (plasma with unbound thrombolytic agent and thrombin) on top of the clot was removed and the same amount of plasma was added to the clot. One plasma clot was incubated with 50 ⁇ l of plasma as the control to monitor the stability of the plasma clot during the assay period. The T 5 o /0 values were used to compare the clot lysis potencies of each agent.
  • thrombolytic agent 600 nM HE-SK, 7,200 nM SAK or 1,200 nM SAK plus 600 nM hirudin
  • WB800 differs from WB700 by the inactivation of a wall bound protease, WprA [27, 39]
  • this protease either directly or indirectly, accounts for the observed degradation of SAK-K coil.
  • Staphylokinase by itself is resistant to the residual proteases from WB600 and WB700 [40].
  • the major cleavage sites are mainly located within the K coil sequence.
  • the K coil sequence is almost identical to the E coil sequence with the exception that lysine rather than glutamate is located at positions "e" and "g" of the coiled coil sequence, the residual protease(s) in WB600 and WB700 that mediate(s) the cleavage is(are) suggested to have a preference to cut after a lysine residue.
  • Hirudin-E coil was purified to homogeneity from the culture supernatant of WB800[pHirudin-E coil] using a two-step purification scheme: a DE-52 cellulose column and a BioRad Bio-Prep SE 100/17 gel filtration column (Fig. 3A, lane 1). Staphylokinase-K coil was also purified to homogeneity (Fig. 3 A, lane 2) using a similar approach (a MacroS column and a BioRad Bio-Prep SE100/17 column). Interestingly, staphylokinase-K coil was found to be well resolved into two peaks in the cation exchange column.
  • hirudin-E coil stained very poorly in SDS-polyacrylamide gel. Since Coomassie blue is reported to bind preferentially to arginine and aromatic residues in proteins [41], the low content of these residues in hirudin-E coil provides an explanation for this observation.
  • the production yields of hirudin-E coil and SAK-K coil in the culture supernatant before purification were estimated to be 20 mg/liter (1.66 ⁇ M) and 99 mg/liter (4.7 ⁇ M), respectively.
  • the secretory production yield of HE-SK under the co-cultivation condition was estimated to be 50 mg/liter (1.51 ⁇ M).
  • the apparent molecular mass of HE-SK in SDS-PAGE was 43 kDa (Fig. 4A)
  • mass spectrometric analysis MALDI-TOF
  • Fig. 4D mass spectrometric analysis
  • the result also supported the idea that a disulfide bridge was formed between the heterodimeric coiled coil sequences to make HE-SK a single entity.
  • Low levels of heterodimeric HE-SK that did not form the disulfide bond in the coiled-coil region were also observed from the MALTI-TOF mass spectrogram.
  • Reshuffling of disulfide bonds in hirudin-E coil and HE-SK B. subtilis has been shown to produce biologically active secretory proteins with disulfide bonds such as TEM- ⁇ -lactamase and single-chain antibody fragments [27, 31, 42]. These proteins have either one or two pairs of disulfide bonds and the cysteine residues involved in disulfide bond formation are arranged in a sequential manner (i.e. the first cysteine in the sequence pairs with the second and the third cysteine pairs with the fourth). In the case of hirudin, there are three pairs of disulfide bonds and the cysteine residues that form the disulfide bonds are not arranged in a sequential manner (i.e.
  • staphylokinase-K coil does not contain any intramolecular disulfide bonds, it showed the same mobility in SDS-PAGE under both reducing and non-reducing conditions (Fig. 3A, lane 2 vs lane 5).
  • purified hirudin- E coil was allowed to reshuffle its disulfide bonds in the presence of 4 mM cysteine and 2 mM cystine. After this treatment, both the monomeric and dimeric hirudin-E coil molecules were in a more compact structure and migrated faster. As shown in Fig.
  • hirduin-E coil showed an apparent molecular mass of 21 kDa.
  • Thrombin inhibition assays indicated that reshuffled hirudin-E coil showed an activity comparable to hirudin.
  • the IC 50 of hirudin and the reshuffled hirudin-E coil were 5.2 and 5.5 nM, respectively.
  • Purified HE-SK also showed a faster migration after the reshuffling treatment (Fig. 3C). Before reshuffling, the IC 50 of hirudin in HE-SK was 22 nM (Fig. 5B). After reshuffling, the IC 50 value decreased to 5.6 nM.
  • thrombin binds to fibrin directly through an interaction at its anion- binding exosite [46]. With time, thrombin that is bound to or trapped within blood clots will leak out and the thrombm content in an aged clot will gradually decrease. Therefore, the clot bound thrombin would potentially serve as an interesting marker to differentiate a freshly formed clot from an aged clot [47].
  • the pathologic thrombi are freshly formed and therefore should be thrombin rich.
  • a physiological haemostatic plug that has been formed for a while should be thrombin poor.
  • HE-SK should be able to differentiate these two different types of clots.
  • Thrombin activity was then determined using a thrombin specific chromogenic substrate. Within the range tested, the amounts of thrombin trapped in washed fibrin clots were proportional to the amounts of thrombin added during the clot formation process (Fig. 6A). In comparison with the unwashed clots, thrombin activity retained in each washed clot was about 79.5 ⁇ 4.2% of the total input thrombin activity.
  • Washed fibrin clots formed in the presence of different amounts of thrombin were used in this study. 100 ⁇ l of 75 nM hirudin or HE-SK was layered on top of each clot which occupied a volume of 100 ⁇ l. The mixtures were incubated for 60 min. The concentration of hirudin or HE-SK at a final concentration of 75 nM was selected in this study because the clinical doses of SAK used in thrombolysis [48] are usually 5-15 mg/patient (64-192 nM in circulation). After several extensive washes to remove any unbound hirudin or HE-SK, thrombin activity within these fibrin clots was determined.
  • HE-SK could still inhibit 84% of the clot bound thrombin activity.
  • the differences of the thrombin activities between the clots treated with the thrombin inhibitors (hirudin or HE-SK) and the clots treated with HBS (control) were plotted over the thrombin concentration used in forming the clot, it clearly showed a thrombin dose dependent inhibition mediated by both hirudin and HE-SK (Fig. 6C). Therefore, a fibrin clot with higher levels of clot bound thrombin would bind higher levels of HE-SK.
  • HE-SK can be targeted to fibrin clots depending on the level of the clot-bound thrombin, we determined whether a fibrin clot with higher levels of clot-bound thrombin can be lysed faster.
  • an in vitro clot lysis assay was established. Two series of fibrin clots were formed in the presence of different amounts of thrombin. After washing to remove any unbound thrombin, one set of clots was incubated with HE-SK (100 ⁇ l at a concentration of 75 nM). The second set of clots was incubated with staphylokinase (same concentration as HE-SK).
  • thrombolytic agents i.e. HE-SK and SAK
  • HBS HBS
  • a 100- ⁇ l plasminogen solution (1 ⁇ M, physiological concentration) was then added to initiate the clot lysis event.
  • the clot lysis process was monitored by the reduction of the clot turbidity with time.
  • This assay was designed to examine the clot lysis effect of the clot bound HE-SK.
  • the removal of the unbound thrombolytic agents was designed with the objective to account for the short in vivo half life (3-10 minutes) of SAK in human [49]. As shown in Fig.
  • T 50 o /0 it took SAK 250 minutes to achieve a 50% clot lysis (T 50 o /0 ) and the T 50 o /0 values remained fairly constant for the different clots formed with different thrombin concentrations.
  • the T 0 o /o values for clot lysis mediated by HE-SK indeed decreased as the amounts of thrombin used in clot formation (i.e. the amounts of clot-bound thrombin) increased.
  • T 50 o /o values reached the lowest value of ⁇ 100 min and remained constant at that level when the thrombin concentrations used in clot formation was 0.8 NTH unit/ml or higher.
  • Pathologic thrombi are formed in the presence of plasminogen so that some plasminogen molecules will be trapped in or bound to the thrombi, contrast, the interior of the fibrin clots formed under the in vitro conditions with purified fibrinogen and thrombin is essentially plasminogen free. Based on this in vitro study, it is important to recognize that HE-SK indeed can promote clot lysis in proportion to the amounts of the clot-bound thrombin up to a certain level.
  • Fibrin clots were formed in the presence of thrombin at a final concentration of 0.8 NTH units/ml in an ELISA plate. These clots were then washed and incubated with either SAK or HE-SK in the presence of plasminogen for one hour. Solution containing unbound thrombolytic agents (100 ⁇ l) was removed from each well. Since these clots were quite fragile, they were not washed. Plasminogen (1 ⁇ M, 100 ⁇ l) was then added to each well to continue the clot lysis event. The change in clot turbidity including the first hour incubation with thrombolytic agents in the presence of plasminogen was then monitored.
  • T 50% values for SAK and HE-SK were 192 ⁇ 3 min and 152 ⁇ 2.3 min, respectively (Fig. 8 A). This represents a 21% reduction of T 50% for HE-SK.
  • the larger T 5 oo o value for HE-SK under this assay condition reflected the removal of some of the clot-bound HE-SK molecules during the washing step because of the partial clot lysis in the presence of both HE- SK and plasminogen during the first hour of pre-incubation.
  • HE-SK should have an anticoagulant effect.
  • a third in vitro clot lysis assay was developed. In this assay, fibrin clots formed in the presence of 0.8 NTH units/ml of thrombin were washed to remove the unbound thrombin.
  • Thrombolytic agents SAK or HE-SK
  • SAK or HE-SK Thrombolytic agents
  • the growth of the preformed clot was not as dramatic when HE-SK was used as the thrombolytic agent.
  • the longer time required for 50% clot lysis in this assay reflected the simultaneous occurrence of both clot formation and clot lysis events, h comparison to the T 50 o o value of SAK, T 5 o» /0 for HE-SK showed a reduction by 30%.
  • a plasma clot assay was applied to monitor the effectiveness of HE- SK in clot lysis. This is important because plasma contains various factors such as plasminogen, fibrinogen, piOthrombin, ⁇ 2 -antiplamin and other factors that may influenze both the clot formation and clot lysis events. Under this condition, thrombin (0.8 NTH unit/ml) was added to plasma to induce the clot formation. The clots were washed with HBS and then resuspended in plasma containing either SAK or HE-SK with a 1-hour incubation.
  • the plasma containing unbound thrombolytic agents was then removed and replaced with 50 ⁇ l plasma. Changes in clot turbidity were monitored including the first hour of incubation with thrombolytic agents. In this assay, the concentration of each thrombolytic agent was adjusted to give a T 50 o o of -120 minutes. The difference in the concentration of these thrombolytic agents required to reach such a clot lysis rate was compared. This method for comparison was used because SAK at a final concentration of 600 nM (even up to 1,200 nM) failed to show any measurable clot lysis while HE-SK worked effectively at this concentration. As shown in Fig.
  • thrombin bound to the surface of the clot can promote clot growth, but thrombin buried inside the clot can be re-exposed during the fibrinolytic event mediated by SAK [54]. It has been well established that with excess plasmin generation in plasma, plasmin can generate more thrombin from prothrombin via three different mechanisms [55] . Plasmin can activate factor XII to factor XTIa which can then activate kallikrein from prokallikrein [56]. Both factor XTIa and kallikrein are involved in the initial phase of the intrinsic coagulation pathway that leads to thrombin generation.
  • plasmin can also activate factor V which is one of the key components in the prothrombinase complex which mediates the conversion of prothrombin to thrombin [57].
  • factor V is one of the key components in the prothrombinase complex which mediates the conversion of prothrombin to thrombin [57].
  • plasmin has been shown to increase the activity of the factor V ⁇ Ta/LXa complex [58]. All these mechanisms lead to more thrombin generation in plasma. With a low dose of SAK, no systemic activation of plasmin resulted. However, under the experimental conditions used in this study, 7,200 nM staphylokinase can induce systemic plasminogen activation since the physiological concentration of human plasminogen is 1-2 ⁇ M and the ⁇ -antiplasmin concentration is only about half of the concentration of plaminongen [59].
  • thrombin can activate factor XWL which mediates the crosslinking between fibrin chains and the covalent immobilization of ⁇ 2 -antiplasmin to fibrin [60].
  • a thrombin-activatable fibrinolysis inhibitor (TAFI) which is a plasma carboxypeptidase that selectively removes C-terminal lysine residues from fibrin [61] can also be activated. This will reduce the binding of both plasmin(ogen) and SAK-plamsin(ogen) complex to fibrin since these molecules bind to fibrin via the interactions between the kringle domains of plasmin(ogen) and the C-terminal lysine residues in fibrin generated during fibrinolysis. All these factors will make the plasma clots more resistant to fibrinolysis and can account for the requirement of SAK at high concentration for effective plasma clot lysis within 160 minutes.
  • HE-SK mediated clot lysis did not show any significant growth of the plasma clot. Furthermore, the concentration (600 nM) of HE- SK required to achieve a T 50% of 120 min was 12 times lower than that for SAK. These data illustrated the dramatic effect of HE-SK in preventing clot growth and promoting clot lysis. This is the result of the combination of both the clot targeting effect and thrombin inhibition effect of hirudin.
  • the SAK concentration required to generate a T 50% of 122 minute was 1,200 nM, which is two times higher than that of HE-SK.
  • HE-SK a very promising agent for the treatment of AMI.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Un agent thrombolytique comprend un hétérodimère formé d'un activateur du plasminogène et d'un inhibiteur de thrombine. L'activateur du plasminogène peut être une staphylokinase possédant un premier domaine de dimérisation joint à l'extrémité terminal C. cet agent thrombolytique peut être l'hirudine possédant un second domaine de dimérisation joint à l'extrémité terminal C.
PCT/CA2004/000044 2003-01-17 2004-01-19 Agent thrombolytique WO2004064709A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US31987503P 2003-01-17 2003-01-17
US60/319,875 2003-01-17

Publications (2)

Publication Number Publication Date
WO2004064709A2 true WO2004064709A2 (fr) 2004-08-05
WO2004064709A3 WO2004064709A3 (fr) 2004-09-16

Family

ID=32770145

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2004/000044 WO2004064709A2 (fr) 2003-01-17 2004-01-19 Agent thrombolytique

Country Status (1)

Country Link
WO (1) WO2004064709A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012071649A1 (fr) 2010-11-29 2012-06-07 National Research Council Of Canada Agents bivalents de liaison dimérisés par liaison covalente

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020173620A1 (en) * 2000-07-07 2002-11-21 Paul Habermann Bifunctional fusion proteins formed from hirudin and TAP

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020173620A1 (en) * 2000-07-07 2002-11-21 Paul Habermann Bifunctional fusion proteins formed from hirudin and TAP

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
CHAO H ET AL: "Use of a heterodimeric coiled-coil system for biosensor application and affinity purification" JOURNAL OF CHROMATOGRAPHY B: BIOMEDICAL SCIENCES & APPLICATIONS, ELSEVIER SCIENCE PUBLISHERS, NL, vol. 715, no. 1, 11 September 1998 (1998-09-11), pages 307-329, XP004147004 ISSN: 1570-0232 *
ICKE CHRISTIAN ET AL: "Fusion proteins with anticoagulant and fibrinolytic properties: functional studies and structural considerations." MOLECULAR PHARMACOLOGY. AUG 2002, vol. 62, no. 2, August 2002 (2002-08), pages 203-209, XP002289259 ISSN: 0026-895X *
KOHN W D ET AL: "De novo design of alpha-helical coiled coils and bundles: models for the development of protein-design principles" TRENDS IN BIOTECHNOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 16, no. 9, September 1998 (1998-09), pages 379-389, XP004173181 ISSN: 0167-7799 *
LIAN QUN ET AL: "Engineering of a staphylokinase-based fibrinolytic agent with antithrombotic activity and targeting capability toward thrombin-rich fibrin and plasma clots." THE JOURNAL OF BIOLOGICAL CHEMISTRY. 18 JUL 2003, vol. 278, no. 29, 18 July 2003 (2003-07-18), pages 26677-26686, XP002289256 ISSN: 0021-9258 *
LIJNEN H R ET AL: "FUNCTIONAL PROPERTIES OF A RECOMBINANT CHIMERIC PROTEIN WITH COMBINED THROMBIN INHIBITORY AND PLASMINOGEN-ACTIVATING POTENTIAL" EUROPEAN JOURNAL OF BIOCHEMISTRY, BERLIN, DE, vol. 234, no. 1, 1995, pages 350-357, XP000887319 ISSN: 0014-2956 *
SZARKA S J ET AL: "Staphylokinase as a plasminogen activator component in recombinant fusion proteins." APPLIED AND ENVIRONMENTAL MICROBIOLOGY. FEB 1999, vol. 65, no. 2, February 1999 (1999-02), pages 506-513, XP002289257 ISSN: 0099-2240 *
TANG A ET AL: "The coiled coils in the design of protein-based constructs: hybrid hydrogels and epitope displays" JOURNAL OF CONTROLLED RELEASE, ELSEVIER SCIENCE PUBLISHERS B.V. AMSTERDAM, NL, vol. 72, no. 1-3, 14 May 2001 (2001-05-14), pages 57-70, XP004246436 ISSN: 0168-3659 *
TRIPET B ET AL: "Engineering a de novo-designed coiled-coil heterodimerization domain for the rapid detection, purification and characterization of recombinantly expressed peptides and proteins" PROTEIN ENGINEERING, OXFORD UNIVERSITY PRESS, SURREY, GB, vol. 9, no. 11, 1996, pages 1029-1042, XP002125681 ISSN: 0269-2139 *
WIRSCHING FRANK ET AL: "Modular design of a novel chimeric protein with combined thrombin inhibitory activity and plasminogen-activating potential." MOLECULAR GENETICS AND METABOLISM. MAR 2002, vol. 75, no. 3, March 2002 (2002-03), pages 250-259, XP002289258 ISSN: 1096-7192 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012071649A1 (fr) 2010-11-29 2012-06-07 National Research Council Of Canada Agents bivalents de liaison dimérisés par liaison covalente

Also Published As

Publication number Publication date
WO2004064709A3 (fr) 2004-09-16

Similar Documents

Publication Publication Date Title
US5759542A (en) Compositions and methods for the delivery of drugs by platelets for the treatment of cardiovascular and other diseases
JP3122127B2 (ja) 抗凝血タンパク質
JP2851423B2 (ja) 活性化可能なフィブリン溶解および抗血栓症タンパク質
US8143027B2 (en) Method of making a plasminogen activator polypeptide with clot-specific streptokinase activity
Reed et al. Identification of a plasminogen binding region in streptokinase that is necessary for the creation of a functional streptokinase-plasminogen activator complex
JP3189052B2 (ja) 抗血液凝固活性を有するポリペプチド
JP2713467B2 (ja) バンパイアバット唾液プラスミノーゲン賦活体
US20090169553A1 (en) Novel Protein Fusion/Tag Technology
Szarka et al. Staphylokinase as a plasminogen activator component in recombinant fusion proteins
EP0804580B1 (fr) Anticorps recombine se liant au calcium contre la proteine c
Lian et al. Engineering of a staphylokinase-based fibrinolytic agent with antithrombotic activity and targeting capability toward thrombin-rich fibrin and plasma clots
US20090087421A1 (en) Novel Recombinant Staphylokinase Derivatives and the Preparations and Applications thereof
JPH11235173A (ja) キメラセリンプロテアーゼ
RU2183214C2 (ru) Природный и рекомбинантный ингибиторы тромбина, их получение и применение
EP2600891B1 (fr) Protéines de fusion recombinants possédant des propriétés thrombolytiques et anticoagulantes
WO2004064709A2 (fr) Agent thrombolytique
Wirsching et al. Modular design of a novel chimeric protein with combined thrombin inhibitory activity and plasminogen-activating potential
CN113416724A (zh) 一种组织型纤溶酶原激活剂的重组蛋白及其应用
US5523287A (en) Thrombin-inhibitory protein from assassin bugs
WO2008046256A1 (fr) Hemocoagulase
Arora et al. Design of a thrombin inhibitory staphylokinase based plasminogen activator with anti-reocclusion potential
CA2162986A1 (fr) Proteines possedant des proprietes fibrinolytiques et anticoagulantes
Yan et al. Construction, expression, and characterization of a recombinant annexin B1-low molecular weight urokinase chimera in Escherichia coli
US8088372B2 (en) Thrombin mutant
JPH08510903A (ja) 蛭ヒルド・メディシナリスの組換えｘａ因子インヒビターの作製

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase