WO2004007705A1 - Nukleotidsequenzen codierend für deregulierte phosphoglycerat-dehydrogenasen coryneformer bakterien sowie verfahren zur herstellung von l-serin - Google Patents

Nukleotidsequenzen codierend für deregulierte phosphoglycerat-dehydrogenasen coryneformer bakterien sowie verfahren zur herstellung von l-serin Download PDF

Info

Publication number
WO2004007705A1
WO2004007705A1 PCT/DE2003/002290 DE0302290W WO2004007705A1 WO 2004007705 A1 WO2004007705 A1 WO 2004007705A1 DE 0302290 W DE0302290 W DE 0302290W WO 2004007705 A1 WO2004007705 A1 WO 2004007705A1
Authority
WO
WIPO (PCT)
Prior art keywords
deregulated
serine
phosphoglycerate dehydrogenase
gene
microorganism
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/DE2003/002290
Other languages
German (de)
English (en)
French (fr)
Other versions
WO2004007705A9 (de
Inventor
Lothar Eggeling
Petra Peters-Wendisch
Roman Netzer
Hermann Sahm
Robert Faurie
Birgit Klassen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Forschungszentrum Juelich GmbH
Amino GmbH
Original Assignee
Forschungszentrum Juelich GmbH
Amino GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AT03763598T priority Critical patent/ATE479745T1/de
Priority to DE50313042T priority patent/DE50313042D1/de
Priority to DK03763598.4T priority patent/DK1520013T3/da
Priority to MXPA05000527A priority patent/MXPA05000527A/es
Priority to JP2004520314A priority patent/JP2006524032A/ja
Priority to BR0312374-0A priority patent/BR0312374A/pt
Application filed by Forschungszentrum Juelich GmbH, Amino GmbH filed Critical Forschungszentrum Juelich GmbH
Priority to US10/520,999 priority patent/US7732176B2/en
Priority to EP03763598A priority patent/EP1520013B1/de
Publication of WO2004007705A1 publication Critical patent/WO2004007705A1/de
Anticipated expiration legal-status Critical
Publication of WO2004007705A9 publication Critical patent/WO2004007705A9/de
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00Preparation of nitrogen-containing organic compounds
    • C12P13/04Alpha- or beta- amino acids
    • C12P13/06Alanine; Leucine; Isoleucine; Serine; Homoserine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y101/00Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01095Phosphoglycerate dehydrogenase (1.1.1.95)

Definitions

  • the invention relates to nucleotide sequences of coryneform bacteria coding for proteins involved in the biosynthesis of L-serine and to methods for producing L-serine.
  • the amino acid L-serine is used in the food, feed and pharmaceutical industries, as well as in human medicine. In addition, it serves as a building block for the synthesis of other industrially usable products, such as. B. L-tryptophan from indole and L-serine.
  • L-serine can be produced by fermentation of strains of coryneform bacteria.
  • So z. B. a strain of Corynebacterium glycinophilum able to form L-serine from glycine and carbohydrates (Kubota K, Kageyama K, Shiro T and Okumura S (1971) Journal of General Applications in Microbiology, 17: 167-168; Kubota K, Kageyama K, Maeyashiki I, Yamada K and Okumura S (1972) Journal of General Applications in Microbiology 18: 365).
  • the enzyme L-serine hydroxymethyl transferase is involved in the conversion of glycine to L-serine (Kubota K and Yokozeki K (1989) Journal of Fermentation and Bioengeneering, 67 (6): 387-390).
  • the strains used also show a reduced L-serine breakdown, which indicates a decrease in the activity of the enzyme L-serine dehydratase (Kubota K, Kageyama K, Shiro T and Okumura S (1971) Journal of General Applications in Microbiology, 17: 167-168; Kubota K (1985) Agricultural Biological Chemistry, 49 : 7-12).
  • L-serine is fermented from methanol and glycine with the help of methylotrophic bacteria, such as. B. Hyphomicrobium strains (Izumi Y, Yoshida T, Miyazaki SS, Mitsunaga T, Ohshiro T, Shiamo M, Miyata A and Tanabe T (1993) Applied Microbiology and Biotechnology, 39: 427-432).
  • the amino acid glycine must be used as a precursor for the formation of the amino acid L-serine.
  • coryneform bacteria are known which can produce L-serine directly from carbohydrates without the addition of further precursors.
  • strains which belong to the genus Corynebacterium glutamicum, are characterized by the fact that they are e.g. B. are resistant to the L-serine analogues serine hydroxamate and ⁇ -chloroalanine and were obtained by undirected mutagenesis
  • Brevibacterium flavum strains which have defects in L-serine degradation due to undirected mutagenesis, have an increased activity of the 3-phosphoglycerate dehydrogenase encoded by serA, and overexpress the genes serB and serC originating from Escherichia coli (EP0931833A2) ).
  • the deregulated sexA gene used here was obtained by undirected mutagenesis and differs from the wild type gene only by a single base exchange. The expression of this gene has the disadvantage that it can easily be reverited and thus returned to the regulated state.
  • a disadvantage of previously known 3-phosphoglycerate dehydrogenases is their feedback inhibition by L-serine, which, for example, reduces the productivity of the microbial production of L-serine.
  • the region responsible for this regulation by L-serine is the C-terminus of the protein. From WO 93/12235 a DNA is known which for a
  • 3-phosphoglycerate dehydrogenase from E. coli coded, the C-terminus of which was changed by 25%, completely deleted or into which an insertion was carried out in a specific region, so that there was less inhibition by L-serine.
  • this 3-phosphoglycerate dehydrogenase showed only a low activity. An improved L-serine production was not demonstrated with the deregulated 3-phosphoglycerate dehydrogenase.
  • the wild type serA sequence is generally known and can be found in the databases known to those skilled in the art or in the attached sequence listing according to SEQ ID No. 6 can be removed.
  • 3-phosphoglycerate dehydrogenases a decreased feed back inhibition by L-serine while maintaining activity.
  • Dehydrogenases or microorganisms with a 3-phosphate dehydrogenase phoglycerat have a reduced "feedback inhibition by L-serine while retaining the activity. It is another object of the invention to provide an improved method for the microbial production of L-serine to provide.
  • the object is achieved according to the invention with the features specified in the characterizing part of claim 1, 2, 3, 4 or 5. Furthermore, the object is achieved based on the preamble of claim 9 according to the invention, with the features specified in the characterizing part of claim 9. The object is also achieved according to the invention based on the preamble of claim 10, with the features specified in the characterizing part of claim 10. The object is also achieved based on the preamble of claim 11 according to the invention, with the features specified in the characterizing part of claim 11. The object is further achieved according to the invention on the basis of the preamble of claim 20, with the features specified in the characterizing part of claim 20.
  • the object is also achieved according to the invention by the features specified in the characterizing part of claim 26. Furthermore, the task is based on the preamble of claim 27 solved according to the invention, by the features specified in the characterizing part of claim 27.
  • nucleic acids and polypeptides according to the invention With the nucleic acids and polypeptides according to the invention, it is now possible to provide a 3-phosphoglycerate dehydrognase which has no or a reduced L-serine feedback inhibition compared to naturally occurring or genetically unmodified nucleic acids or enzymes while maintaining the 3-phosphoglycerate Has dehydrogenase activity. This property is summarized below under the name "deregulated”. Furthermore, it is possible to provide microorganisms and processes with which L-serine production is possible with higher yields than previously known microbial processes.
  • the invention relates to the provision of nucleic acids coding for a deregulated 3-phosphoglycerate dehydrogenase, hereinafter referred to as PGD, containing a gene sequence serA according to SEQ ID No 1, 2, 3, 4 or 5 or an allele, homologue or derivative of these nucleotide sequences or hybridizing with these nucleotide sequences.
  • PGD deregulated 3-phosphoglycerate dehydrogenase
  • the nucleic acids according to the invention are distinguished by the fact that they consist of coryneform bacteria, preferably prefers the genus Corynebacterium or Brevibacterium, particularly preferably from Corynebacterium glutamicum, to be isolated.
  • coryneform bacteria preferably prefers the genus Corynebacterium or Brevibacterium, particularly preferably from Corynebacterium glutamicum, to be isolated.
  • Examples of wild types of coryneform bacteria deposited in stock cultures are, Corynebacterium glutamicum ATCC 13032 and Corynebacterium acetoglutamicum ATCC 15806 or also Brevibacterium flavum ATCC 14067.
  • mutants or production strains suitable for the production of L-serine are organisms from the group Arthrobacter, Pseudomonas , Nocardia, Methylobacterium, Hyphomycrobium, Alcaligenes or Klebsiella.
  • the present invention is characterized in more detail by the specification of the bacterial strains mentioned above, which, however, has no limiting effect.
  • a nucleic acid or a nucleic acid fragment is to be understood as a polymer made from RNA or DNA, which can be single or double-stranded and optionally contain natural, chemically synthesized, modified or artificial nucleotides.
  • DNA polymer in this case also includes ge 'nominal specific DNA, cDNA, or mixtures thereof.
  • alleles are to be understood as functional equivalents, ie essentially equivalent nucleotide sequences.
  • Functionally equivalent sequences are those sequences which, despite a different nucleotide sequence, for example due to the degeneracy of the genetic code, still have the desired functions.
  • Functional equivalents thus include naturally occurring variants of the sequences described here, as well as artificial, e.g. B. obtained by chemical synthesis and optionally to the Sequences codon usage of the host organism adapted nucleotide ⁇ .
  • a functional equivalent is also understood to mean, in particular, natural or artificial mutations in an originally isolated sequence which continue to show the desired function. Mutations include substitutions, additions, deletions, exchanges or insertions of one or more nucleotide residues. So-called meaning mutations are also included here, which can lead to the exchange of conserved amino acids at the protein level, but which do not lead to a fundamental change in the activity of the protein and are therefore function-neutral. This also includes changes in the nucleotide sequence which affect the N-terminus of a protein at the protein level, but without significantly impairing the function of the protein.
  • the present invention also makes such a
  • Nucleotide sequences encompassed which are obtained by modification of the nucleotide sequence, resulting in corresponding derivatives.
  • the aim of such a modification can e.g. B. the further limitation of the coding sequence contained therein or z. B. also the insertion of further restriction enzyme interfaces.
  • artificial DNA sequences are the subject of the present invention as long as they impart the desired properties, as described above.
  • Such artificial DNA sequences can be, for example, by back-translating proteins or by computer-aided programs (molecular modeling) can be determined by in vitro selection. Coding DNA sequences obtained by back-translating a polypeptide sequence according to the codon usage specific for the host organism are particularly suitable. The specific codon usage can easily be determined by a person familiar with molecular genetic methods by computer analysis of other, already known genes of the organism to be transformed.
  • homologous sequences are to be understood as those which are complementary to and / or hybridize with the nucleotide sequences according to the invention.
  • hybridizing sequences includes, according to the invention, substantially similar nucleotide sequences from the group of DNA or RNA, which enter into a specific interaction (binding) with the aforementioned nucleotide sequences under stringent conditions known per se. This also includes short nucleotide sequences with a length of, for example, 10 to 30, preferably 12 to 15 nucleotides. According to the invention, this includes also so-called primers or probes.
  • sequence regions preceding the coding regions are also included.
  • sequence regions with a regulatory function are included here. They can be used for transcription and RNA stability or influence RNA processing and translation. Examples of regulatory sequences include
  • the invention furthermore relates to a gene structure comprising at least one of the nucleotide sequences described above coding for a deregulated PDG and also operatively linked regulatory sequences which control the expression of the coding sequences in the host cell.
  • the present invention relates to a vector containing a nucleotide sequence of the type described above coding for a deregulated PDG, to this operatively linked regulatory nucleotide sequences and to additional nucleotide sequences for selecting transformed host cells, for replication within the host cell or for integration into the corresponding host cell genome.
  • the vector according to the invention can contain a gene structure of the aforementioned type.
  • Suitable vectors are those that are replicated in coryneform bacteria such as. B. pZl (Menkel E, Thierbach G, Eggeling L, Sahm H., 1989, Appl Environ
  • probes or primers can be synthesized and used to amplify and isolate, for example, genes from other microorganisms, preferably coryneform bacteria, using the PCR technique.
  • the present invention thus also relates to a probe for identifying and / or isolating genes coding for proteins involved in the biosynthesis of L-serine, this probe being produced starting from the nucleic acid sequences of the type described above and containing a label suitable for detection ,
  • the probe can be a partial section of the sequence according to the invention, for example from a conserved area which, for. B.
  • the present invention furthermore relates to a deregulated PGD or a part thereof, encoded by a nucleic acid sequence according to the invention according to SEQ ID No 1, 2, 3, 4 or 5 or its variations of the type described above.
  • the present invention also relates to a deregulated PGD with a Amino acid sequence according to SEQ ID No 7, 8, 9, 10 or 11 or a modified form of these polypeptide sequences or isoforms thereof or mixtures thereof.
  • a 3-phosphoglycerate dehydrogenase with an amino acid sequence according to SEQ ID No 7 has also proven suitable.
  • Isoforms are to be understood as enzymes with the same or comparable substrate and activity specificity, but which have a different primary structure.
  • modified forms are understood to mean enzymes in which there are changes in the sequence, for example at the N-terminus of the polypeptide or in the region of conserved amino acids, but without impairing the function of the enzyme. These changes can be made in the form of amino acid exchanges using methods known per se.
  • the present invention relates to polypeptides with the function of a deregulated PGD, the amino acid sequence of which is changed in such a way that they are desensitive to feedback-regulating compounds, for example the metabolic end products (L-serine) regulating their activity (feedback-desensitive).
  • a deregulated PGD the amino acid sequence of which is changed in such a way that they are desensitive to feedback-regulating compounds, for example the metabolic end products (L-serine) regulating their activity (feedback-desensitive).
  • the polypeptides according to the invention are distinguished by the fact that they originate from coryneform bacteria, preferably of the genus Corynebacterium or Brevibacterium, particularly preferably of the species Corynebacterium glutamicum or Brevibacterium, particularly preferably from Corynebacterium glutamicum.
  • Examples of wild types of coryneform bacteria deposited in parent cultures are Corynebacterium glutamicum ATCC 13032 and Corynebacterium acetoglutamicum ATCC 15806 or Brevibacterium flavum ATCC 14067.
  • mutants or production strains suitable for the production of L-serine are organisms from the group Arthrobacter, Pseudomonas, Nocardia, Methylobacterium, Hyphomycrobium, Alcaligenes or Klebsiella.
  • the present invention is characterized in more detail by the specification of the bacterial strains mentioned above, which, however, has no limiting effect.
  • the present invention also relates to
  • Transfer of at least one of the nucleic acid sequences according to the invention or a part thereof coding for a deregulated PGD, an allele, homologue or derivative thereof into a host system also includes the transfer of a gene construct or vector according to the invention into a host system.
  • This transfer of DNA into a host cell takes place using genetic engineering methods. The preferred method here is transformation and particularly preferably the transfer of DNA by electroporation.
  • a homologous host system has proven to be particularly suitable.
  • a homologous host system is understood to mean microorganisms which all belong to a related family. According to the invention, this includes coryneform bacteria into which the nucleic acids isolated from coryneform bacteria according to the invention are introduced.
  • a transformed microorganism resulting from a successfully carried out nucleic acid transfer thus differs from the correspondingly not transformed microorganism in that it contains additional nucleic acids of the type according to the invention and accordingly for can emboss.
  • the bacterium Corynebacterium glutamicum and preferably the strain ATCC 13032 are representative of a suitable homologous host system.
  • a complex medium such as e.g. B. LB Medium (T.
  • the bacterial suspension can be harvested for cultivation and used for further investigation, for example for the transformation or for the isolation of nucleic acids by conventional methods. This procedure can also be applied analogously to other coryneform bacterial strains.
  • Bacteria of the genus Corynebacterium or Brevibacterium are preferred as host systems.
  • the species Corynebacterium glutamicum is particularly preferred within the genus Corynebacterium, and the species Brevibacterium flavum is particularly preferred within the genus Brevibacterium.
  • the representatives of these genera include strains that are characterized in their properties as wild type.
  • Corynebacterium glutamicum ATCC 13032 Corynebacterium glutamicum ATCC 14752, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium melassecola ATCC 17965, Corynebacterium thermocaminogenium39ibm Brex 1405 Brex, Breibmibacterium Brex, Breymabacterium 138, Breymabacterium Bref divaricatum ATCC 14020 to name.
  • the present invention also includes bacterial strains as a host system, which are known as Characterize L-serine producing mutants or amino acid production strains. These can e.g. B. starting from wild-type strains by classic (chemical or physical) or genetic engineering methods.
  • strains suitable according to the invention include Corynebacterium glutamicum ATCC 21586, Corynebacterium glutamicum KY 10150, Corynebacterium glutamicum ATCC 13032 ⁇ panBC and Brevibacterium ketoglutamicum ATCC 21222.
  • those production strains which are known to the person skilled in the art are also suitable according to the invention, and are known to those skilled in the art from microbial , B. Enterobacteria, Bacillaceae or yeast species.
  • the present invention is characterized in more detail by the selected examples of microorganisms, but is not limited.
  • the present invention further relates to a genetically modified microorganism containing, in replicable form, a nucleic acid according to the invention of the type described above, which is expressed more intensely than the correspondingly non-genetically modified microorganism and / or whose number of copies is increased.
  • the present invention also includes a genetically modified microorganism containing, in replicable form, a gene structure or a vector of the type described above.
  • the present invention also relates to a genetically modified microorganism containing a polypeptide according to the invention with the function of a deregulated PGD of the previously described Type which has a reduced or no feedback inhibition by L-serine compared to the correspondingly non-genetically modified microorganism while maintaining the PGD activity.
  • a genetically modified microorganism according to the invention is further characterized in that it is a coryneform bacterium, preferably of the genus Corynebacterium or Brevibacterium, particularly preferably of the species Corynebacterium glutamicum or Brevibacterium flavum.
  • genes can be amplified by methods known per se, such as the polymerase chain reaction (PCR) with the aid of short, synthetic nucleotide sequences (primers) and then isolated.
  • PCR polymerase chain reaction
  • primers are generally produced on the basis of known gene sequences based on existing homologies in conserved areas of the genes and / or taking into account the GC content of the DNA of the microorganism to be examined.
  • a further procedure for the isolation of coding nucleotide sequences is the complementation of so-called defect mutants of the organism to be examined, which have at least phenotypically a functional loss in the activity of the gene to be examined or the corresponding protein. Complementation is to be understood as the elimination of the genetic defect of the mutant and extensive restoration of the original appearance before the mutagenesis, which is achieved by introducing functional genes or gene fragments from the microorganism to be examined.
  • a classic mutagenesis method for producing defect mutants is, for example, the treatment of the bacterial cells with chemicals such as. B. N-methyl-N-nitro-N-nitrosoguanidine or UV radiation.
  • Such methods for triggering mutations are generally known and can be found, inter alia, in Miller (A Short Course in Bacterial Genetics, A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria (Cold Spring Harbor Laboratory Press, 1992)) or in the manual “Manual of Methods for General Bacteriology "of the American Society for Bacteriology (Washington DC, USA, 1981).
  • the present invention also relates to a method for the microbial production of L-serine, wherein at least one of the nucleic acids according to the invention, isolated from a coryneform bacterium, is transferred to a host organism and expressed there, the gene expression and / or the activity of the correspondingly encoded polypeptide is increased compared to the correspondingly not genetically modified microorganism, this genetically modified microorganism is used for the microbial production of L-serine and the correspondingly formed L-serine is isolated from the culture medium.
  • the number of copies of the corresponding genes can be increased to achieve increased gene expression (overexpression). Furthermore, the promoter and / or regulatory region and / or the ribosome binding site which is located upstream of the structural gene can be changed accordingly in such a way that expression takes place at an increased rate. Expression cassettes which enter upstream of the structural gene act in the same way. be built. Inducible promoters also make it possible to increase expression in the course of the fermentative L-serine production. Expression is also improved by measures to extend the life of the mRNA.
  • the genes or gene constructs can either be present in plasmids with different copy numbers or can be integrated and amplified in the chromosome. Furthermore, the activity of the enzyme itself can also be increased or increased by preventing the breakdown of the enzyme protein.
  • overexpression of the genes in question can also be achieved by changing the media composition and culture management. Instructions for this can be found by Martin et al. (Bio / Technology 5, 137-146 (1987)), Guerrero et al. (Gene 138, 35-41 (1994)), Tsuchiya and Morinaga (BioRechnology 6, 428-430 (1988)), at Eikmanns et al. (Gene 102, 93-98 (1991)), in European Patent EPS 0 472 869, in US Patent 4,601,893, by Schwarzer and Pühler (Bio / Technology 9, 84-87 (1991), by Reinscheid et al.
  • the genetically modified microorganisms produced according to the invention can be used continuously or discontinuously. They can be cultured in the batch process (batch cultivation) or in the fed batch (experience feed) or repeated fed batch process (repetitive feed process) for the purpose of producing L-serine.
  • batch cultivation batch cultivation
  • fed batch experience feed
  • repeated fed batch process repetitive feed process
  • a summary of known cultivation methods can be found in the textbook by Chmiel (bioprocess technology 1st introduction to bioprocess engineering (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (bioreactors and peripheral facilities (Vieweg Verlag, Braunschweig / Wiesbaden, 1994)).
  • the culture medium to be used must meet the requirements of the respective strains in a suitable manner. Descriptions of culture media of various microorganisms are contained in the manual "Manual of Methods for General Bacteriology" of the American Society for Bacteriology (Washington DC, USA, 1981).
  • sugar and carbohydrates such as. B. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, oils and fats such as. B. soybean oil, sunflower oil, peanut oil and coconut oil, fatty acids such as. As palmitic acid, stearic acid and linoleic acid, alcohols such as. B. glycerol and ethanol and organic acids such as. B. acetic acid can be used.
  • Organic nitrogen-containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be used as the nitrogen source.
  • the nitrogen sources can be used individually or as a mixture.
  • Phosphoric acid, Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used.
  • the culture medium must also contain salts of metals such.
  • Suitable precursors can also be added to the culture medium.
  • the feedstocks mentioned can be added to the culture in the form of a one-off batch or added in a suitable manner during the cultivation.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid are used in a suitable manner to control the pH of the culture.
  • anti-foaming agents such as B. fatty acid polyglycol esters.
  • suitable selective agents can be used in the medium
  • Fabrics e.g. B. Antibiotics can be added.
  • oxygen or gas mixtures containing oxygen such as e.g. B. air introduced into the culture.
  • the temperature of the culture is usually 20 ° C to 45 ° C, and preferably
  • L-serine formation can be carried out by anion exchange chromatography with subsequent ninhydrin derivatization, as in Spackman et al. (Analytical Chemistry, 30, (1958), 1190), or it can be done by reversed phase HPLC as in Lindroth et al. (Analytical Chemistry (1979) 51: 1167-1174).
  • the microorganisms which are the subject of the present invention can produce L-serine from glucose, sucrose, lactose, mannose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol. It can be the representatives of coryneform bacteria already described in more detail above. A selection of results from the fermentation is shown in Table 6.
  • the genetically modified microorganisms according to the invention are distinguished here by a substantially improved L-serine production compared to the correspondingly not transformed microorganisms (wild types) or the microorganisms which only contain the vector without a gene insert. In a special embodiment variant of the present invention, it is shown that the overexpression of the homologous C-terminally shortened serA gene in C. glutamicum ATCC
  • 13032DpanBCpZlserA ⁇ l97 leads to an at least 40% increase in L-serine accumulation in the medium compared to the control strains (Tab. 6). Due to the overexpression of other genes that have a positive effect on the L-serine biosynthetic pathway, an even further increase in L-serine production can be expected.
  • amino acid production strains are to be understood as Corynebacterium glutamicum strains or homologous microorganisms which are modified by classic and / or molecular genetic methods in such a way that their metabolic flow increases in the direction of the biosynthesis of amino acids or their descendants (metabolic engineering).
  • these amino acid production strains one or more genes and / or the corresponding enzymes, which are at crucial and correspondingly complex regulated key positions in the metabolic pathway (bottleneck), are changed or even deregulated.
  • the present invention includes all known amino acid production strains, preferably of the genus Corynebacterium or homologous organisms.
  • those production strains are also included which the person skilled in the art can produce by analogy with knowledge from other microorganisms, for example enterobacteria, bacillaceae or types of yeast, using customary methods.
  • the figures show examples of plasmids used and a comparison of the primary structure of the PGD and alleles of serA constructed by means of PCR.
  • the protein of the hyperthermophilic bacterium T. mari tima is the shortest with a length of 327 amino acids, while the 3-phosphoglycerate dehydrogenase from E. coli with 410 amino acids has an intermediate length.
  • Fig. 2 Overview of the alleles of serA constructed by means of PCR, which code for the deregulated, C-terminally shortened PGD.
  • the serA gene region of the wild type (above) and the deletion constructs according to the invention are shown.
  • the areas marked light, dark and black correspond to the definition as in FIG. 1.
  • the sequence of the serA gene coding for the 3-phosphoglycerate dehydrogenase from C. glutamicum from the patent database was used (Nakagawa, S., Mizoguchi, H., Ando, S., Hayashi, M., Ochiai, K., Yokoi, H., Tateishi, N., Senoh, A., Ikeda, M. And Ozaki, A.
  • glutamicum such as that from Mycobacterium tuberculosis (GenBank accession number AL123456) and some other bacteria such as Bacillus subtilis (Sorokin, A., Azevedo, V., Zumstein, E., Galleron, N., Ehrlich, SD and Serror, P. Microbiology 142 (Pt 8), 2005-2016 (1996)) and Aquifex aeolicus (GenBank accession number AE000657) with 530 amino acids is extraordinarily long.
  • This group of enzymes also includes the 3 -phosphoglycerate dehydrogenases from animals such as rats (Achouri Y., Rider MH, Van Schaftingen E. and Robbi M., 1997, Biochem. J., 323: 365-370) and Human (Cho HM, Jun DY, Bae MA, Ahn JD, Kim YH.,
  • a second, reverse-complementary primer was selected, which was 199 bp behind the stop codon and carries a BamHI restriction site (serA-r: 5'-GGATCCGACTGGTGAGGGTCAAGTCC-3 ').
  • the expected PCR product is 2040 bp in length.
  • Reverse-complementary primers were selected to generate the deletions. They are located in the gene area and all also have an interface for BamEI.
  • the primer serA ⁇ 211-r (5'-GGATCCTTAACCGGAAACGTTCACAGC3 ') lies 956 bp behind the start codon, so that a 1196 bp long PCR product is produced.
  • the deletion lies approximately in the area of the presumable transition from substrate binding to regulatory domain (see Fig. 1 and Fig. 2).
  • the primer serA ⁇ 205-r (5'-GGATCCTTACTCTTCGCCCACGCGACC3 ') is 974 bp behind the start codon and the expected PCR product has a length of 1214 bp.
  • the C-terminal deletion in this case is 205 amino acids and the protein ends behind the amino acid glutamate at position 325. The undirected exchange of this amino acid to lysine leads to a deregulation of the 3-phosphoglycerate dehydrogenase (EP 0 931 833). Both deletions lie in an area in which the deletion ( ⁇ 209 amino acids) of the protein is also present
  • Rat was generated (Achouri Y., Rider MH, Van Schaftingen E. and Robbi M., 1997, Biochem. J., 323: 365- 370).
  • serA ⁇ l88-r lie 998 bp and 1025 bp behind the ATG and are located upstream from the transition from substrate binding domain to regulatory domain in E. coli.
  • GGATCCTTAATCCAGGCCACGGCCATT3 generates and cuts off the region of 79 amino acids that bears the greatest similarity to the regulatory domain of E. coli (Fig. 2).
  • all reverse-complementary primers that are supposed to lead to a truncated protein were placed behind the interface the stop codon TAA inserted.
  • the PCR reaction was carried out in 30 cycles in the presence of 200 ⁇ M deoxynucleotide triphosphates (dATP, dCTP, dGTP, dTTP), 1 ⁇ M each of the corresponding oligonucleotide, 100 ng chromosomal DNA from Corynebacterium glutamicum ATCC13032, 1/10 volume 10-fold reaction buffer and 2.6 units of a heat-stable Taq / Pwo DNA polymerase mixture (Expand High Fidelity PCR System from Röche Diagnostics, Mannheim, Germany) in a thermal cycler (PTC-100, MJ Research, Inc., Watertown, USA) under the following conditions: 94 ° C for 60 seconds, 50 ° C for 90 seconds and 72 ° C for 2 minutes.
  • deoxynucleotide triphosphates dATP, dCTP, dGTP, dTTP
  • a heat-stable Taq / Pwo DNA polymerase mixture Exand High Fide
  • the DNA fragments obtained were extracted using the QIAExII gel extraction kit (Qiagen) according to the manufacturer, isolated from a 0.8% agarose gel, blunt-ended cloned into the Smal site of the vector pUC18 using the Sure Clone Kit (Amersham Pharmacia Biotech). The plasmids were checked for correctness by restriction mapping. This cloning was carried out in the Escherichia coli strain DH5 ⁇ mcr (Grant et al., Proceedings of the National Academy of Sciences of the United States of America USA (1990) 87: 4645-4649).
  • the serA gene and the serA deletion constructs were then inserted into the E. coli / C. glutamicum pendulum vector pZl (Menkel E, Thierbach G, Eggeling L, Sahm H., 1989, Appl Environ Microbiol 55 (3): 684-688).
  • the vector mediates kanamycin resistance.
  • the inserts of the deletion constructs were cut out of the pUC18 vector with the restriction enzymes EcoRI and BamEI.
  • the overhanging DNA ends were filled in using Klenow treatment and the fragments were blunt-ended ligated into the seal-cut vector pZl.
  • the wild type serA gene was also treated with Klenow after EcoRI restriction and blunt-end ligated into the seal-cut vector pZl.
  • the plasmids pZlserA, pZlserA_479, pZlserA_1188 pZlserA_dl97 pZlserA-4205 and pZlserAd211 were carried out by Electroporation introduced individually into C. glutamicum. As a control, the empty plasmid pZl was also electroporated according to C. glutamicum ATCC 13032.
  • strains 13032pZl, 13032pZlser ⁇ , 13032pZlserA ⁇ 79, 13032pZlserA ⁇ l88, 13032pZlserA ⁇ l97, 13032pZlserA ⁇ 205 and 13032pZlserA ⁇ 211 thus obtained were then analyzed for overexpression of the 3-phosphoglycerate dehydrogenase-dehydrogenase-3-enzyme test.
  • the medium was identical to that in Keilhauer et al. described medium CGXII (Journal of Bacteriology (1993) 175: 5593-5603), but additionally contained 25 ⁇ g / ml kanamycin.
  • the composition of the by Keilhauer et al. described medium is shown in Table 1.
  • the cells were harvested in the exponential growth phase at ODsoo from 5 to 8 and twice in 100 mM
  • Tris-HCl, pH 7.5 washed.
  • the cell pellets were then frozen at -20 ° C until digestion.
  • the frozen cell pellets were then thawed on ice and resuspended with 2 ml of cold 100 mM Tris-HCl pH 7.5 / 10% glycerol and digested in a Brenson Sonifier for 10 min.
  • the cell debris was then removed by centrifugation at 13000 rpm and 4 ° C in a Sigma 202 MK centrifuge.
  • the supernatants obtained in this way were initially extracted as crude extracts via a PD-10 column according to the manufacturer
  • Table 2 Components of the test batch for determining the 3 -phosphoglycerate dehydrogenase activity
  • Table 3 Overexpression of the serA gene and the C-terminally truncated serA alleles.
  • This strain is pantotenate-auxotrophic due to the deletion of the pantothenate biosynthesis genes panB and panC, and is characterized by the fact that it secretes approx. 50 mM alanine and 8 mM valine under pantothenate limitation due to an increased accumulation of pyruvate.
  • the strain forms approx. 100 ⁇ M L-serine and is therefore suitable as a starting strain for the construction of an L-serine producer.
  • the strain 13032 ⁇ panBCpZlserA transformed with the plasmid pZlserA was deposited with the DSMZ under DSM No. 14922 on April 11, 2002 in accordance with the Budapest Treaty.
  • the three strains were grown in complex medium (CgIII with 2% glucose and with 50 ⁇ g / 1 kanamycin), and the fermentation medium CGXII (J Bacteriol (1993) 175: 5595-5603) were inoculated from the precultures.
  • the medium additionally contained 50 ⁇ g / 1 kanamycin and 1 ⁇ M pantothenate.
  • Two independent fermentations were carried out. After culturing for 24 or 35 hours at 30 ° C. on a rotary shaker at 120 rpm, the amount of L-serine accumulated in the medium was determined.
  • the amino acid concentration was determined by means of high pressure liquid chromatography (J Chromat (1983) 266: 471-482).
  • the result of the fermentation is in Table 6 shown, and it turns out that the overexpression of the wild-type serA gene causes an approximately 10% increase in L-serine accumulation in the medium.
  • the overexpression of the deregulated 3-phosphoglycerate dehydrogenase achieves an increase of up to 40% compared to the control strain which only carries the empty plasmid.
  • the use of the constructed and described gene for the deregulated L-serine biosynthesis enzyme 3-phosphoglycerate dehydrogenase represents a method to decisively improve the L-serine formation.
  • microorganism referred to under I was received by this international depository on (date of first deposit) and an application for the conversion of this first deposit into a deposit under the Budapest Treaty was received on (date of receipt of the request for conversion). , '

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/DE2003/002290 2002-07-10 2003-07-08 Nukleotidsequenzen codierend für deregulierte phosphoglycerat-dehydrogenasen coryneformer bakterien sowie verfahren zur herstellung von l-serin Ceased WO2004007705A1 (de)

Priority Applications (8)

Application Number Priority Date Filing Date Title
DE50313042T DE50313042D1 (de) 2002-07-10 2003-07-08 Nukleotidsequenzen codierend für deregulierte phosphoglycerat-dehydrogenasen coryneformer bakterien sowie verfahren zur herstellung von l-serin
DK03763598.4T DK1520013T3 (da) 2002-07-10 2003-07-08 Nukleotidsekvenser der koder for deregulerede phosphoglycerat-dehydrogenaser i coryneforme bakterier, samt fremgangsmåde til fremstilling af L-serin
MXPA05000527A MXPA05000527A (es) 2002-07-10 2003-07-08 Secuencias nucleotidas que codifican a las deshidrogenasas de fosfoglicerato desregularizadas de bacterias corineformes y procedimiento para la produccion de l-serina.
JP2004520314A JP2006524032A (ja) 2002-07-10 2003-07-08 コリネ型バクテリアの脱調節されたホスホグリセラート−デヒドロゲナーゼをコードするヌクレオチド配列並びにl−セリンの製造方法
BR0312374-0A BR0312374A (pt) 2002-07-10 2003-07-08 Sequências de nucleotìdeos codificando fosfoglicerato-desidrogenases desreguladas de bactérias corineformes e processo para a preparação de l-serina
AT03763598T ATE479745T1 (de) 2002-07-10 2003-07-08 Nukleotidsequenzen codierend für deregulierte phosphoglycerat-dehydrogenasen coryneformer bakterien sowie verfahren zur herstellung von l- serin
US10/520,999 US7732176B2 (en) 2002-07-10 2003-07-08 Nucleotide sequences that encode deregulated phosphoglycerate dehydrogenases of coryneform bacteria and method for producing L-serine
EP03763598A EP1520013B1 (de) 2002-07-10 2003-07-08 Nukleotidsequenzen codierend für deregulierte phosphoglycerat-dehydrogenasen coryneformer bakterien sowie verfahren zur herstellung von l-serin

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10231297.4 2002-07-10
DE10231297A DE10231297A1 (de) 2002-07-10 2002-07-10 Nukleotidsequenzen coryneformer Bakterien codierend für an der Biosynthese von L-Serin beteiligte Proteine sowie Verfahren zur Herstellung von L-Serin

Publications (2)

Publication Number Publication Date
WO2004007705A1 true WO2004007705A1 (de) 2004-01-22
WO2004007705A9 WO2004007705A9 (de) 2005-03-31

Family

ID=30009893

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE2003/002290 Ceased WO2004007705A1 (de) 2002-07-10 2003-07-08 Nukleotidsequenzen codierend für deregulierte phosphoglycerat-dehydrogenasen coryneformer bakterien sowie verfahren zur herstellung von l-serin

Country Status (11)

Country Link
US (1) US7732176B2 (https=)
EP (1) EP1520013B1 (https=)
JP (1) JP2006524032A (https=)
KR (1) KR20060015439A (https=)
AT (1) ATE479745T1 (https=)
BR (1) BR0312374A (https=)
DE (2) DE10231297A1 (https=)
DK (1) DK1520013T3 (https=)
MX (1) MXPA05000527A (https=)
WO (1) WO2004007705A1 (https=)
ZA (1) ZA200501158B (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024084049A3 (en) * 2022-10-20 2024-07-18 Cysbio Aps Genetically modified host cells producing l-serine

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007144018A1 (en) * 2006-06-12 2007-12-21 Metabolic Explorer Ethanolamine production by fermentation
US20130316416A1 (en) * 2012-02-23 2013-11-28 Massachusetts Institute Of Technology Engineering microbes and metabolic pathways for the production of ethylene glycol
CN114134185B (zh) * 2021-10-30 2024-06-21 新泰市佳禾生物科技有限公司 一种发酵生产l-丝氨酸的方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5624828A (en) * 1990-11-22 1997-04-29 Kyowa Hakko Kogyo Co. Ltd. Process for producing L-tryptophan in serine auxotrophic microorganisms belonging to the genus corynebacterium or brevabacterium
EP0943687A2 (en) * 1998-01-12 1999-09-22 Ajinomoto Co., Inc. Method of producing L-serine by fermentation
US6180373B1 (en) * 1992-09-28 2001-01-30 Consortium f{umlaut over (u)}r elektrochemische Industrie GmbH Microorganisms for the production of tryptophan and process for the preparation thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4066543B2 (ja) * 1998-01-12 2008-03-26 味の素株式会社 発酵法によるl−セリンの製造法

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5624828A (en) * 1990-11-22 1997-04-29 Kyowa Hakko Kogyo Co. Ltd. Process for producing L-tryptophan in serine auxotrophic microorganisms belonging to the genus corynebacterium or brevabacterium
US6180373B1 (en) * 1992-09-28 2001-01-30 Consortium f{umlaut over (u)}r elektrochemische Industrie GmbH Microorganisms for the production of tryptophan and process for the preparation thereof
EP0943687A2 (en) * 1998-01-12 1999-09-22 Ajinomoto Co., Inc. Method of producing L-serine by fermentation

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ARCHER J A C ET AL: "A C-TERMINAL DELETION IN CORYNEBACTERIUM-GLUTAMICUM HOMOSERINE DEHYDROGENASE ABOLISHES ALLOSTERIC INHIBITION BY L THREONINE", GENE (AMSTERDAM), vol. 107, no. 1, 1991, pages 53 - 60, XP001155222, ISSN: 0378-1119 *
BELL JESSICA K ET AL: "De-regulation of D-3-phosphoglycerate dehydrogenase by domain removal.", EUROPEAN JOURNAL OF BIOCHEMISTRY, vol. 269, no. 17, September 2002 (2002-09-01), =ejb&page=aims September, 2002, pages 4176 - 4184, XP002255645, ISSN: 0014-2956 *
DATABASE EMBL [online] XP002255654, retrieved from EBI Database accession no. AAY31651 *
DATABASE EMBL [online] XP002255655, retrieved from EBI Database accession no. AR162219 *
PETERS-WENDISCH P ET AL: "3-Phosphoglycerate dehydrogenase from Corynebacterium glutamicum: The C-terminal domain is not essential for activity but is required for inhibition by L-serine.", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 60, no. 4, 20 December 2002 (2002-12-20), pages 437 - 441, XP002255644, ISSN: 0175-7598 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024084049A3 (en) * 2022-10-20 2024-07-18 Cysbio Aps Genetically modified host cells producing l-serine

Also Published As

Publication number Publication date
WO2004007705A9 (de) 2005-03-31
BR0312374A (pt) 2005-04-12
JP2006524032A (ja) 2006-10-26
DK1520013T3 (da) 2010-12-20
ZA200501158B (en) 2007-04-25
MXPA05000527A (es) 2005-09-30
DE50313042D1 (de) 2010-10-14
KR20060015439A (ko) 2006-02-17
EP1520013B1 (de) 2010-09-01
ATE479745T1 (de) 2010-09-15
US7732176B2 (en) 2010-06-08
DE10231297A1 (de) 2004-02-05
EP1520013A1 (de) 2005-04-06
US20060106207A1 (en) 2006-05-18

Similar Documents

Publication Publication Date Title
DE102004001674B4 (de) Verfahren zur Herstellung von L-Lysin unter Einsatz von Methanol verwertenden Bakterien
EP1094111B1 (de) Coryneforme Bakterien mit einer Deletion der Phosphoenolpyruvat-Carboxykinase und ihre Verwendung
EP2354235B1 (de) Verfahren zur fermentativen Herstellung von L-Aminosäuren unter Verwendung coryneformer Bakterien
DE19951975A1 (de) Neue für das poxB-Gen codierende Nuleotidsequenzen
DE60115900T2 (de) Nukleotidsequenzen kodierend für das mdha gen aus corynebakterium glutamicum
DE60033026T4 (de) Verfahren zur fermentativen Herstellung von L-Aminosäuren durch Verstärkung des zwf Gens
DE60312592T2 (de) Verfahren zur Herstellung von L-Lysin unter Verwendung Coryneformer Bakterien die ein attenuiertes Malat Enzym-gen enthalten
DE10162387A1 (de) Für das rpoB-Gen kodierende Nukleotidsequenzen
DE102005019967A1 (de) Verfahren zur fermentativen Herstellung von L-Aminosäuren
EP1601773A2 (de) Nukleotidsequenzen coryneformer bakterien codierend f r am l -serinstoffwechsel beteiligte proteine sowie verfahren zur mikrobiellen herstellung von l-serin
EP1239040A2 (de) Mutationen im rpoB-Gen L-Lysin produzierender Corynebacterium glutamicum-Stämme und Verfahren zur Herstellung von L-Lysin
EP1520013B1 (de) Nukleotidsequenzen codierend für deregulierte phosphoglycerat-dehydrogenasen coryneformer bakterien sowie verfahren zur herstellung von l-serin
EP1259622B1 (de) Nukleotidsequenzen kodierend fur proteine beteiligt an der biosynthese von l-serin, verbessertes verfahren zur mikrobiellen herstellung von l-serin sowie ein dazu geeigneter genetisch veranderter mikroorganismus
DE10162386A1 (de) Für das rpsL-Gen kodierende Nukleotidsequenzen
DE102005049527B4 (de) Verfahren zur Herstellung von L-Serin, Gensequenz, Vektoren sowie Mikroorganismus
DE10055870A1 (de) Neue für das nadC-Gen kodierende Nukleotidsequenzen
DE10055869A1 (de) Neue für das nadA-Gen kodierende Nukleotidsequenzen
DE60115913T2 (de) Nukleotid sequenzen kodierend für das csta gen aus corynebacterium glutamicum
DE10220574A1 (de) Verfahren zur Herstellung von Aminosäuren mit coryneformen Bakterien unter Verwendung von Phosphoglucose-Isomerasen aus coryneformen Bakterien
DE10112098A1 (de) Neue für das chrA-Gen kodierende Nukleotidsequenzen
EP1143003A2 (de) Nukleotidsequenzen, die für das rplk-Gen kodieren, und Verfahren zur Herstellung von L-Aminosäuren
DE10017057A1 (de) Neue für das rpIK Gen kodierende Nukleotidsequenzen
DE10009799A1 (de) Nukleotidsequenzen kodierend für Proteine beteiligt an der Biosynthese von L-Serin und Verfahren zu dessen Herstellung
DE10140095A1 (de) Für das tmk-Gen kodierende Nukleotidsequenzen
DE10113958A1 (de) Neue für das mikE17-Gen kodierende Nukleotidsequenzen

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): BR JP KR MX US ZA

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2003763598

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2004520314

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: PA/a/2005/000527

Country of ref document: MX

Ref document number: 1020057000470

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2005/01158

Country of ref document: ZA

Ref document number: 200501158

Country of ref document: ZA

COP Corrected version of pamphlet

Free format text: PAGES 1-15, SEQUENCE LISTING, REPLACED BY CORRECT PAGES 1-15

WWP Wipo information: published in national office

Ref document number: 2003763598

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2006106207

Country of ref document: US

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 10520999

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 1020057000470

Country of ref document: KR

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Ref document number: JP

WWP Wipo information: published in national office

Ref document number: 10520999

Country of ref document: US