WO2003064652A1 - Verfahren zur herstellung von zymosterol und/oder dessen biosynthetischen zwischen- und/oder folgeprodukten in transgenen organismen - Google Patents

Verfahren zur herstellung von zymosterol und/oder dessen biosynthetischen zwischen- und/oder folgeprodukten in transgenen organismen Download PDF

Info

Publication number
WO2003064652A1
WO2003064652A1 PCT/EP2003/000590 EP0300590W WO03064652A1 WO 2003064652 A1 WO2003064652 A1 WO 2003064652A1 EP 0300590 W EP0300590 W EP 0300590W WO 03064652 A1 WO03064652 A1 WO 03064652A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
organism
hmg
coa reductase
lanosterol
Prior art date
Application number
PCT/EP2003/000590
Other languages
English (en)
French (fr)
Inventor
Christine Lang
Markus Veen
Original Assignee
Basf Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Basf Aktiengesellschaft filed Critical Basf Aktiengesellschaft
Priority to EP03734683A priority Critical patent/EP1472355A1/de
Priority to US10/503,253 priority patent/US20060088903A1/en
Publication of WO2003064652A1 publication Critical patent/WO2003064652A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/007—Preparation of hydrocarbons or halogenated hydrocarbons containing one or more isoprene units, i.e. terpenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P33/00—Preparation of steroids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic

Definitions

  • the present invention relates to a method for producing zymosterol and / or its biosynthetic intermediate and / or secondary products by cultivating
  • Organisms especially yeasts, which have an increased lanosterol-C14-demethylase activity and an increased HMG-CoA reductase activity compared to the wild type, the nucleic acid constructs required for the production of the genetically modified organisms, and the genetically modified organisms, in particular yeasts themselves ,
  • Zymosterol its biosynthetic intermediates in sterol metabolism, such as farnesol, geraniol, squalene and lanosterol, and its biosynthetic secondary products of sterol metabolism, such as ergosterol (end product of sterol synthesis in yeast and fungi), lathosterol, cholesta-5, 7-dienol (Provitamin D3) and cholesterol (sterol biosynthesis in mammals) are compounds with high economic value.
  • biosynthetic intermediates in sterol metabolism such as farnesol, geraniol, squalene and lanosterol
  • biosynthetic secondary products of sterol metabolism such as ergosterol (end product of sterol synthesis in yeast and fungi), lathosterol, cholesta-5, 7-dienol (Provitamin D3) and cholesterol (sterol biosynthesis in mammals) are compounds with high economic value.
  • Squalene is used as a building block for the synthesis of terpenes. In hydrated form, it is used as squalane in dermatology and cosmetics, and in various derivatives as an ingredient in skin and hair care products.
  • Sterols such as zymosterol and Lx ⁇ os erol, can also be used economically, whereby lanosterol is raw and synthetic pivotal for the chemical synthesis of saponins and steroid hormones. Because of its good skin penetration and spreading properties, Lanosterol serves as an emulsion aid and active ingredient for skin creams.
  • Cholesta-5, 7-dienol serves as the starting material for the production of vitamin D3 by UV radiation and, like cholesterol, is the starting material for other steoid hormones.
  • An economical process for the production of zymosterol and / or its biosynthetic intermediate and / or secondary products is therefore of great importance.
  • WO 99/16886 describes a process for the production of ergosterol in yeasts which overexpress a combination of the genes tHMG, ERG9, SAT1 and ERG1.
  • the object of the present invention is to provide a further process for the production of zymosterol and / or its biosynthetic intermediates and / or secondary products with advantageous properties, such as a higher product yield.
  • Lanosterol-C14-demethylase activity means the enzyme activity of a lanosterol-Cl4-demethylase.
  • a lanosterol-C14-demethylase means a protein which has the enzymatic activity to convert lanosterol into 4, 4-dimethylcholesta-8, 14,24-trienol. Accordingly, lanosterol-C14-demethylase activity means the amount of lanosterol converted or amount of 4, 4-dimethylcholesta-8, 14, 24-trienol converted by the protein lanosterol-Cl4-demethylase in a certain time.
  • the converted amount of lanosterol or the amount of 4, 4-dimethylcholesta-8, 14, 24-trienol increased.
  • This increase in the lanosterol C14 deethylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of wild type lanosterol C14 demethylase activity.
  • HMG-CoA reductase activity is understood to mean the enzyme activity of an HMG-CoA reductase (3-hydroxy-3-methyl-glutaryl-coenzyme A reductase).
  • An HMG-CoA reductase means a protein which has the enzymatic activity to convert 3-hydroxy-3-methyl-glutaryl-coenzyme-A to mevalonate.
  • HMG-CoA reductase activity is understood to mean the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme A converted or amount of mevalonate formed in a certain time by the protein HMG-CoA reductase.
  • the HMG-CoA reductase activity is increased compared to the wild type, the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme-A or the formed amount of mevalonate increased.
  • This increase in HMG-CoA reductase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the Wild-type HMG-CoA reductase activity.
  • a wild type is understood to mean the corresponding non-genetically modified organism.
  • the increase in the lanosterol-Cl4-demethylase activity, the HMG-CoA reductase activity and the squalene epoxidase activity described below can be carried out independently of one another in different ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing the gene expression a nucleic acid encoding a lanosterol C14 demethylase, HMG-CoA reductase or squalene epoxidase compared to the wild type, for example by inducing the lanosterol C14 demethylase gene, HMG-CoA reductase gene or squalene epoxidase gene by activators or by introducing one or more nucleic acids encoding a lanosterol-C14-demethylase, HMG-CoA reductase or squalene
  • a nucleic acid encoding a lanosterol C14 demethylase, an HMG-CoA reductase or a squalene epoxidase By increasing the gene expression of a nucleic acid encoding a lanosterol C14 demethylase, an HMG-CoA reductase or a squalene epoxidase, the manipulation of the expression of the organism, in particular the yeast endogenous lanosterol C14 demethylases, HMG-CoA reductases or Understand squalene epoxidases. This can be achieved, for example, by changing the promoter DNA sequence for lanosterol C14 demethylases, HMG-CoA reductases or genes coding for squalene epoxidases.
  • Such a change which results in a changed or preferably increased expression rate of at least one endogenous lanosterol-C14-demethylase, HMG-CoA reductase or squalene epoxidase gene, can be carried out by deleting or inserting DNA sequences.
  • an altered or increased expression of at least one endogenous lanosterol-C14-demethylase, HMG-CoA reductase or squalene epoxidase gene can be achieved in that a regulator protein not occurring in the non-transformed organism with the promoter of these genes in Interaction occurs.
  • Such a regulator can represent a chimeric protein, which consists of a DNA binding domain and a transcriptional activator domain, as described for example in WO 96/06166.
  • the increase in lanosterol-C14-demethylase activity compared to the wild type is achieved by increasing the gene expression of a nucleic acid encoding a lanosterol-C4-demethylase.
  • the gene expression of a nucleic acid coding for a lanosterol C14 demethylase is increased by introducing one or more nucleic acids coding for a lanosterol C14 demethylase into the organism.
  • any lanosterol C14 demethylase gene (ERG11), that is to say any nucleic acids encoding a lanosterol C14 demethylase, can be used for this purpose.
  • ESG11 any lanosterol C14 demethylase gene
  • genomic lanosterol-C14-demethylase nucleic acid sequences from eukaryotic sources which contain introns the corresponding lanosterol-C14-demethylase is in the event that the host organism is unable or cannot be enabled express, preferably to use already processed nucleic acid sequences, such as the corresponding cDNAs.
  • lanosterol C14 demethylase genes are nucleic acids encoding a lanosterol C14 demethylase from Saccharomyces cerevisiae (Kalb VF, Loper JC, Dey CR, Woods CW, Sutter TR (1986) Isolation of a cytochrome P-450 structural gene from Saccharomyces cerevisiae, Gene 45 (3): 237-45), Candida albicans (Lamb DC, Kelly DE, Baldwin BC, Gozzo F, Boscott P, Richards WG, Kelly SL (1997) Differential inhibition of Candida albicans CYP51 with azole antifungal stereoisomers FEMS Microbiol Lett 149 (1): 25-30), Homo sapiens (Stromstedt M, Rozman D, Waterman MR.
  • At least one further lanosterol-Cl4-demethylase gene is thus present in the transgenic organisms according to the invention in comparison with the wild type.
  • the number of lanosterol Cl4 demethylase genes in the transgenic organisms according to the invention is at least two, preferably more than two, particularly preferably more than three, very particularly preferably more than five.
  • nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.
  • nucleic acids encoding proteins containing the amino acid sequence SEQ are preferably used. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, still more preferably at least 90%, most preferably at least 95% at the amino acid level with the SEQ sequence. ID. NO. 2, and which have the enzymatic property of a lanosterol C14 demethylase.
  • sequence SEQ. ID. NO. 2 shows the amino acid sequence of the Lano-sterol-C14-demethylase from Saccharomyces cerevisiae.
  • lanosterol-C14-demethylases and lanosterol-C14-demethylase genes can be found, for example, from various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ. ID. NO. 2 easy to find.
  • lanosterol-C14-demethylases and lanosterol-C14-demethylase genes can also be started, for example, from the sequence SEQ. ID. No. 1 from different organisms whose genomic sequence is not known, can be easily found in a manner known per se by hybridization and PCR techniques.
  • substitution is to be understood as meaning the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid has a similar property to the original amino acid, for example replacement of Glu by Asp, Gin by Asn, Val by Ile, Leu by Ile, Ser by Thr. Deletion is the replacement of an amino acid with a direct link. Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.
  • Inserts are insertions of amino acids into the polypeptide chain, whereby a direct bond is formally replaced by one or more amino acids.
  • Identity between two proteins is understood to mean the identity of the amino acids over the respective total protein length, in particular the identity obtained by comparison with the aid of the laser genes software from DNASTAR, ine. Madison, Wisconsin (USA) using the Clustal method (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) with the following settings Parameter is calculated:
  • a protein that has an identity of at least 30% at the amino acid level with the sequence SEQ. ID. NO. 2 is accordingly understood to be a protein which, when its sequence is compared with the sequence SEQ. ID. NO. 2, in particular according to the above program algorithm with the above parameter set, has an identity of at least 30%.
  • nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the Lanosterol-C14 demethylase from Saccharomyces cerevisiae (SEQ. ID. NO. 2).
  • Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.
  • codons are preferably used for this which are frequently used in accordance with the organism-specific codon usage.
  • the codon usage can be determined using computer evaluations other known genes of the organisms in question easily.
  • the protein is to be expressed, for example, in yeast, it is often advantageous to use the codon usage of the yeast in the back translation.
  • a nucleic acid containing the sequence SEQ is brought. ID. NO. 1 in the organism.
  • sequence SEQ. ID. NO. 1 represents the genomic DNA from Saccharomyces cerevisiae (ORF S0001049), which contains the lano-sterol-C14-demethylase of the sequence SEQ ID NO. 2 coded.
  • lanosterol C14 demethylase genes can also be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks, such as, for example, by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
  • the chemical synthesis from the nucleotide building blocks, such as, for example, by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
  • Synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897).
  • the attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
  • the HMG-CoA reductase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding an HMG-CoA reductase.
  • the gene expression of a nucleic acid encoding an HMG-CoA reductase is increased by introducing a nucleic acid construct containing a nucleic acid encoding an HMG-CoA reductase into the organism, the expression of which in the organism compared with the wild type, is subject to reduced regulation.
  • a reduced regulation compared to the wild type means a regulation which is reduced compared to the wild type defined above, preferably no regulation at the expression or protein level.
  • the reduced regulation can preferably be achieved by a promoter which is functionally linked in the nucleic acid construct to the coding sequence and which is subject to a reduced regulation in the organism compared to the wild-type promoter.
  • the average ADH promoter in yeast is only subject to a reduced regulation and is therefore particularly preferred as a promoter in the nucleic acid construct described above.
  • This promoter fragment of the ADHl2s promoter hereinafter also referred to as ⁇ DHl, shows an approximately constitutive expression
  • promoters with reduced regulation are constitutive promoters such as the TEF1 promoter from yeast, the GPD promoter from yeast or the PGK promoter from yeast (Mumberg D, Muller R, Funk M. (1995) Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995 Apr 1; 156 (1): 119-22; Chen CY, Oppermann H, Hitzeman RA. (1984) Homologous versus heterologous gene expression in the yeast, Saccharomyces cerevisiae. Nucleic Acids Res Dec 11; 12 (23): 8951-70.).
  • the reduced regulation can be achieved by using an HMG-CoA reductase encoding a nucleic acid as a nucleic acid, the expression of which in the organism is subject to a reduced regulation compared to the organism's own orthologic nucleic acid.
  • nucleic acid which encodes only the catalytic region of the HMG-CoA reductase (truncated (t-) HMG-CoA reductase) as the nucleic acid which encodes an HMG-CoA reductase.
  • This nucleic acid (t-HMG) described in EP 486 290 and WO 99/16886 only codes the catalytically active part of the HMG-CoA reductase, which lacks the membrane domain responsible for regulation at the protein level. This nucleic acid is therefore subject to a reduced one, especially in yeast Regulation and leads to an increase in gene expression of HMG-CoA reductase.
  • nucleic acids are introduced, preferably via the nucleic acid construct described above, which encode proteins containing the amino acid sequence SEQ. ID. NO. 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 30% at the amino acid level with the sequence SEQ. ID. NO. 4, and which have the enzymatic property of an HMG-CoA reductase.
  • sequence SEQ. ID. NO. 4 shows the amino acid sequence of the truncated HMG-CoA reductase (t-HMG).
  • HMG-CoA reductases and thus also of the t-HMG-CoA reductases reduced to the catalytic range or the coding genes can be found, for example, from various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID. NO. 4 easy to find.
  • HMG-CoA reductases and thus also for the t-HMG-CoA reductases reduced to the catalytic range or the coding genes can furthermore be started, for example, from the sequence SEQ. ID. No. 3 from different organisms, the genomic sequence of which is not known, can be easily found by hybridization and PCR techniques in a manner known per se.
  • a nucleic acid containing the sequence SEQ is particularly preferably used. ID. NO. 3 as nucleic acid, encoding a truncated HMG-CoA reductase.
  • the reduced regulation is achieved in that an HMG-CoA reductase encoding a nucleic acid is used as a nucleic acid, the expression of which in the organism is subject to reduced regulation compared to the organism's own orthologic nucleic acid, and a promoter is used which is subject to reduced regulation in the organism compared to the wild-type promoter.
  • a method for the production of zymosterol and / or its intermediate and / or secondary products is particularly preferred, in which an organism is used which, in addition to an increased Lanosterol-C14-demethylase and HMG-CoA reductase activity has an increased squalene epoxidase activity compared to the wild type.
  • Squalene epoxidase activity means the enzyme activity of a squalene epoxidase.
  • a squalene epoxidase is understood to mean a protein which has the enzymatic activity to convert squalene into squalene epoxide.
  • squalene epoxidase activity is understood to mean the amount of squalene converted or amount of squalene epoxide formed in a certain time by the protein squalene epoxidase.
  • the amount of squalene converted or the amount of squalene epoxide formed is increased in a certain time by the protein squalene epoxidase in comparison to the wild type.
  • This increase in squalene epoxidase activity is preferably at least 5%, more preferably at least 20, more preferably at least 50%, further preferably at least 100%, more preferably at least 300%, more preferably at least 500%, in particular at least 600% of the squalene epoxidase activity of the wild type ,
  • a wild type is understood to mean the corresponding non-genetically modified organism.
  • the squalene epoxidase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a squalene epoxidase.
  • the gene expression of a nucleic acid encoding a squalene epoxidase is increased by introducing one or more nucleic acids encoding a squalene epoxidase into the organism.
  • any squalene epoxidase gene that is to say any nucleic acids encoding a squalene epoxidase
  • ESGl squalene epoxidase gene
  • genomic squalene epoxidase nucleic acid sequences from eukaryotic sources which contain introns in the event that the host organism is unable or cannot be enabled, the corresponding squalene To express epoxidase, preferably to use already processed nucleic acid sequences, such as the corresponding cDNAs.
  • nucleic acids encoding a squalene epoxidase are nucleic acids encoding a squalene epoxidase from Saccharomyces cerevisiae (Jandrositz, A., et al (1991) The gene encoding squalene epoxidase from Saccharomyces cerevisiae: cloning and characterization. Genes 107: 155-160, from Mus musculus ( Kosuga K, Hata S, Osu i T, Sakakibara J, Ono T.
  • At least one further squalene epoxidase is thus present in the transgenic organisms according to the invention compared to the wild type.
  • the number of squalene epoxidase genes in the transgenic organisms according to the invention is at least two, preferably more than two, particularly preferably more than three, very particularly preferably more than five.
  • nucleic acids encoding proteins containing the amino acid sequence SEQ are preferably used. ID. NO. 6 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, still more preferably at least 90%, most preferably at least 95% at the amino acid level with the SEQ sequence. ID. NO. 6, and which have the enzymatic property of a squalene epoxidase.
  • sequence SEQ. ID. NO. 6 shows the amino acid sequence of squalene epoxidase from Saccharomyces cerevisiae.
  • squalene epoxidases and squalene epoxidase genes can be found, for example, from various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID. NO. 6 easy to find.
  • Further examples of squalene epoxidase and squalene epoxidase genes can also be found, for example, starting from the sequence SEQ. ID. No. 5 from different organisms whose genomic sequence is not known, can easily be found by hybridization and PCR techniques in a manner known per se.
  • nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the squalene epoxidase from Saccharomyces cerevisiae) (SEQ. ID. NO. 6).
  • Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.
  • codons are preferably used for this which are frequently used in accordance with the organism-specific codon usage.
  • the codon usage can easily be determined on the basis of computer evaluations of other known genes of the organisms in question.
  • the protein is to be expressed, for example, in yeast, it is often advantageous to use the codon usage of the yeast in the back translation.
  • a nucleic acid containing the sequence SEQ is brought. ID. NO. 5 in the organism.
  • sequence SEQ. ID. NO. 5 displays the genomic DNA
  • Saccharomyces cerevisiae (ORF S0003407), which contains the squalene epoxidase of the sequence SEQ ID NO. 6 coded.
  • All of the squalene epoxidase genes mentioned above can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
  • the chemical synthesis of oligonucleotides can, for example, in a known manner, according to the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press
  • organisms include, for example, bacteria, in particular bacteria of the genus Bacillus, Bscherichia coli, Lactobacillus spec. or Streptomyces spec. .
  • yeasts for example yeasts, in particular yeasts of the genus Saccharomyces cerecisiae, Pichia pastoris or Klyveromyces spec.
  • mushrooms for example mushrooms, in particular mushrooms of the genus Aspergillus spec, Penicillium spec. or Dictyostelium spec.
  • insect cell lines that are capable of producing zymosterol and / or its biosynthetic intermediates and / or secondary products as a wild type or through previous genetic modification.
  • yeasts in particular of the species Saccharomyces cerevisiae, in particular the yeast strains Saccharomyces cerevisiae AH22, Saccharomyces cerevisiae GRF, Saccharomyces cerevisiae DBY747 and Saccharomyces cerevisiae BY4741.
  • a wild type is understood to mean the corresponding non-genetically modified organism.
  • preference is given to increasing the lanosterol Cl4 demethylase activity, increasing the HMG-CoA reductase activity, increasing the squalene epoxidase activity or the wild type Content of zymosterol and / or its biosynthetic intermediate and / or secondary products understood a reference organism.
  • This reference organism is preferably the yeast strain Saccharomyces cerevisiae AH22.
  • the determination of the lanosterol C14 demethylase activity, the HMG-CoA reductase activity and the squalene epoxidase activity of the genetically modified organism according to the invention and of the reference organism is carried out under the following conditions:
  • HMG-CoA reductase The activity of the HMG-CoA reductase is determined as described in Th. Polakowski, Molecular biological influence on the ergo sterol metabolism of the yeast Saccharomyces cerevisiae, Shaker-Verlag, Aachen 1999, ISBN 3-8265-6211-9.
  • 10 9 yeast cells from a 48 h old culture are harvested by centrifugation (3500 ⁇ g, 5 min) and washed in 2 ml of buffer I (100 mM potassium phosphate buffer, pH 7.0).
  • the cell pellet is placed in 500 ⁇ l buffer 1 (cytosolic proteins) or 2 (100 mM potassium phosphate buffer pH 7.0; 1% Triton X-100) (total proteins) and 1 ⁇ l of 500 mM PMSF in isopropanol is added.
  • the liquid between the glass beads is transferred to a new Eppi.
  • Cell residues or membrane components are separated by centrifugation (14000 xg) for 15 min. The supernatant is transferred to a new Eppi and represents the protein fraction.
  • the activity of the HMG-CoA activity is determined by measuring the consumption of NADPH + H + in the reduction of 3-hydroxy-3-methylglutaryl-CoA, which is added as a substrate.
  • the substrate (10 ⁇ l 30 mM HMG-CoA) is then added, and a further 7.5 min are measured.
  • the HMG-CoA reductase activity is calculated by determining the specific NADPH degradation rate.
  • a microsome fraction (4-10 mg / ml protein in 100 mM potassium phosphate buffer) is diluted 1: 4, so that the protein concentration used for the test is 2 mg / ml.
  • the test is carried out directly in a cuvette.
  • a spatula tip of dithionite (S ⁇ 4 a) is added to the microsomes.
  • the baseline is recorded in the range of 380-500 nm with a spectrophotometer.
  • about 20-30 bubbles of CO are bubbled through the sample.
  • the absorption is now measured in the same area.
  • the level of absorption at 450 nm corresponds to the compartment of P450 enzyme in the test batch. 5
  • the activity of squalene epoxidase is determined as in Leber R, Landl K, Zinser E, Ahorn H, Spok A, Kohlwein SD, Turnowsky F, Daum G. (1998) Dual localization of squalene epoxidase, Erglp, in yeast reflects a relationship between the 10 endoplasmic reticulum and lipid particles, Mol. Biol. Cell. 1998, Feb; 9 (2): 375-86.
  • This method contains 0.35 to 0.7 mg microsomal protein or 3.5 to 75 ⁇ g lipid particle protein in 100 mM Tris-HCl, pH 7.5, 15 1 mM EDTA, 0.1 mM FAD, 3 mM NADPH, 0 , 1 mM squalene 2, 3-epoxidase cyclase inhibitor U18666A, 32 ⁇ M [ 3 H] squalene dispersed in 0.005% Tween 80 in a total volume of 500 ⁇ l.
  • the test is carried out at 30 ° C. After pretreatment for 20-10 min, the reaction is started by adding squalene and after 15, 30 or 45 min by lipid extraction with 3 ml of chloroform / methanol (2: 1 vol / vol) and 750 ⁇ l of 0.035% MgCl.
  • the lipids are dried under nitrogen and redissolved in 0.5 ml of 25 chloroform / methanol (2: 1 vol / vol). For one
  • biosynthetic intermediates of zymosterol are understood to mean all compounds which occur as intermediates in the organism used in the biosynthesis of zymosterol, preferably the compounds mevalonate, farnesyl pyrophosphate, geraniol pyrophosphate, squalene epoxide, 4-dimethylcholesta-8, 14,24-trienol , 4.4 dirn thylzymosterol, squalene, farnesol, geraniol, lanosterol and zymosterone.
  • biosynthetic secondary products of zymosterol are understood to mean all compounds that are derived biosynthetically from zymosterol in the organism used, i.e. , where zymosterol occurs as an intermediate. These can be compounds that the organism used naturally from zymo-
  • sterol such as 4, 4-dimethylzymosterol, 4-methylzymosterol, fecosterol, ergost-7-enol, episterol, ergosta-5, 7-dienol, in particular sterols with 5,7-diene structure in yeast and mushrooms.
  • compounds are also understood which can only be produced from zymosterol in the organism by introducing genes and enzyme activities from other organisms to which the starting organism has no orthological gene.
  • the yeast By introducing another human or murine nucleic acid encoding a human or murine delta-7 reductase, the yeast is able to produce cholesterol.
  • biosynthetic secondary products of zymosterol are therefore in particular fecosterol, episterol, Ergosta-5, 7-dienol, ergosterol, Cholesta-7, 24-dienol, Cholesta-5, 7.24-trienol, lathosterol, Cholesta-5, 7 -dienol (provitamin D3) and / or cholesterol understood.
  • Preferred biosynthetic secondary products are ergosterol, lathosterol and / or cholesta-5, 7-dienol (provitamin D3).
  • the compounds produced in the process according to the invention can be used in biotransformations, chemical reactions and for therapeutic purposes, for example for the production of vitamin D from ergosterol by means of UV radiation, and the production of vitamin D 3 from cholesta-5, 7-dienol (provitamin D3) UV radiation, or for the production of steroid hormones via biotransformation based on ergosterol.
  • the cultivation step of the genetically modified organisms is preferably referred to as harvesting the organisms and isolating zymosterol and / or its biosynthetic intermediates. and / or derived products from the organisms.
  • the organisms are harvested in a manner known per se in accordance with the respective organism.
  • Microorganisms such as bacteria, mosses, yeasts and fungi or plant cells, which are cultivated by fermentation in liquid nutrient media, can be separated off, for example, by centrifuging, decanting or filtering.
  • the isolation of zymosterol and / or its biosynthetic intermediates and / or secondary products from the harvested biomass is carried out jointly or each compound per se in a manner known per se, for example by extraction and optionally further chemical or physical purification processes, such as precipitation methods, crystallography, thermal Separation processes such as rectification processes or physical separation processes such as chromatography.
  • the transgenic organisms are preferably produced by transforming the starting organisms, in particular yeasts, either with a nucleic acid construct which contains the above-described nucleic acids, a lano-sterol-C14-demethylase and an HMG-CoA reductase with or several regulatory signals are functionally linked, which ensure transcription and translation in organisms, or by combined transformation of the starting organisms, in particular yeasts, with at least two nucleic acid constructs, a nucleic acid construct encoding the above-described nucleic acids a lanosterol C14 demethylase and a second nucleic acid construct the nucleic acids described above encoding an HMG-CoA reductase and each containing one or more regulatory Signals are functionally linked, which ensure transcription and translation in organisms.
  • Nucleic acid constructs in which the coding nucleic acid sequence is functionally linked to one or more regulatory signals which ensure transcription and translation in organisms, in particular in yeasts, are also called expression cassettes below.
  • Nucleic acid constructs containing this expression cassette are, for example, vectors or plasmids.
  • the invention further relates to nucleic acid constructs, in particular nucleic acid constructs functioning as an expression cassette, containing nucleic acids encoding a lanosterol-C14-demethylase and nucleic acids encoding an HMG-CoA reductase, which are functionally linked to one or more regulation signals that transcription and translation in organisms, ensure especially in yeasts.
  • this nucleic acid construct additionally comprises nucleic acids encoding a squalene epoxidase which are functionally linked to one or more regulation signals which ensure transcription and translation in organisms, in particular in yeasts.
  • transgenic organisms according to the invention can also be produced by transformation with a combination of nucleic acid constructs, the combination
  • the combination comprises
  • nucleic acid construct containing nucleic acids encoding a squalene epoxidase, which are functionally linked to one or more regulation signals, which ensure transcription and translation in organisms.
  • the regulation signals preferably contain one or more promoters which ensure transcription and translation in organisms, in particular in yeasts.
  • the expression cassettes contain regulatory signals, that is to say regulatory nucleic acid sequences which control the expression of the coding sequence in the host cell.
  • an expression cassette comprises upstream, i.e. at the 5 'end of the coding sequence, a promoter and downstream, i.e. at the 3 'end a terminator and, if appropriate, further regulatory elements which are operatively linked to the coding sequence in between for at least one of the genes described above.
  • An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended in the expression of the coding sequence.
  • any promoter which can control the expression of foreign genes in organisms, in particular in yeasts, is suitable as promoters of the expression cassette.
  • a promoter which is subject to reduced regulation in the yeast such as, for example, the middle ADH promoter, is preferably used in particular.
  • This promoter fragment of the ADHl2s promoter also referred to below as ADH1 shows an approximately constitutive expression
  • promoters with reduced regulation are constitutive promoters such as the TEF1 promoter from yeast, the GPD promoter from yeast or the PGK promoter from yeast (Mumberg D, Muller R, Funk M. (1995) Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995 Apr 14; 156 (1): 119-22; Chen CY, Oppermann H, Hitzeman RA. (1984) Homologous versus heterologous gene expression in the yeast, Saccharomyces cerevisiae. Nucleic Acids Res Dec 11; 12 (23): 8951-70.).
  • the expression cassette can also contain inducible promoters, in particular chemically inducible promoters, by means of which the expression of the lanosterol C14 demethylase gene, the HMG-CoA reductase gene or the squalene epoxidase gene in the organism can be controlled at a specific point in time.
  • Such promoters such as the Cupl promoter from yeast (Etcheverry T. (1990) Induced expression using yeast copper metallothionein promoter. Methods Enzymol. 1990; 185: 319-29.), The Gall-10 promoter from yeast (Ronicke V, Graulich W, Mumberg D, Muller R, Funk M. (1997) Use of conditional promoters for expression of heterologous proteins in Saccharomyces cerevisiae, Methods Enzymol. 283: 313-22) or the Pho5 promoter from yeast (Bajwa W, Rudolph H , Hinnen A. (1987) PH05 upstream sequences confer phosphate control on the constitutive PH03 gene. Yeast. 1987 Mar; 3 (1) -.33-42) can be used, for example.
  • any terminator which can control the expression of foreign genes in organisms, in particular in yeasts, is suitable as the terminator of the expression cassette.
  • the yeast tryptophan terminator (TRPl terminator) is preferred.
  • An expression cassette is preferably produced by fusing a suitable promoter with the nucleic acids described above, encoding a lanosterol C14 demethylase, an HMG-CoA reductase and / or a squalene epoxidase and a terminator according to common recombination and cloning techniques, as described, for example, in T. Maniatis, EF Fritsch and J.
  • nucleic acids according to the invention can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural nucleic acid constituents and consist of different heterologous gene segments from different organisms.
  • various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame.
  • adapters or linkers can be attached to the fragments.
  • the promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction parts for the insertion of this sequence.
  • the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites.
  • the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges.
  • the promoter can be native or homologous as well as foreign or heterologous to the host organism.
  • the expression cassette preferably contains the promoter, a coding nucleic acid sequence or a nucleic acid construct and a region for the transcriptional termination in the 5 '-3' transcription direction. Different termination areas are interchangeable.
  • the invention further relates to the use of the nucleic acids described above, the nucleic acid constructs described above or the proteins described above for the production of transgenic organisms, in particular yeasts.
  • transgenic organisms in particular yeasts, preferably have an increased content of zymosterol and / or its biosynthetic intermediate and / or secondary products compared to the wild type.
  • the invention therefore further relates to the use of the nucleic acids described above or the nucleic acid constructs according to the invention for increasing the content of zymosterol and / or its biosynthetic intermediate and / or secondary products in organisms which are capable of being wild type or by genetic manipulation, zymosterol and / or to produce its biosynthetic intermediates and / or secondary products.
  • proteins and nucleic acids described above can be used in the production of zymosterol and / or its biosynthetic intermediates and / or secondary products in transgenic organisms.
  • transformation The transfer of foreign genes into the genome of an organism, especially yeast, is called transformation.
  • Suitable methods for transforming yeasts are, for example, the LiAC method, as in Schiestl RH, Gietz RD. (1989) High efficiency transformation of intact yeast cells using Single stranded nucleic acids as a carrier, Curr Genet. Dec, -16 (5-6): 339-46, described electroporation as in Manivasakam P, Schiestl RH. (1993) High efficiency transformation of Saccharomyces cerevisiae by electroporation. Nucleic Acids Res. Sep 11; 21 (18): 4414-5, or the protoplasm as described in Morgan AJ. (1983) Yeast strain improvement by protoplast fusion and transformation, Experientia Suppl. 46: 155-66.
  • the construct to be expressed is preferably cloned into a vector, in particular into plasmids, which are suitable for transforming yeasts, such as, for example, the vector systems Yep24 (Naumovski L, Friedberg EC (1982) Molecular cloning of eucaryotic genes required for excision repair of UV-irradiated DNA: isolation and partial characterization of the RAD3 gene of Saccharomyces cerevisiae. J Bacteriol Oct; 152 (1): 323-31), Yepl3 (Broach JR, Strathern JN, Hicks JB. (1979) Transformation in yeast: development of a hybrid cloning vector and isolation of the CANl gene. Gene.
  • plasmids which are suitable for transforming yeasts, such as, for example, the vector systems Yep24 (Naumovski L, Friedberg EC (1982) Molecular cloning of eucaryotic genes required for excision repair of UV-irradiated DNA: isolation and partial characterization of the
  • the invention further relates to vectors, in particular plasmids containing the nucleic acids, nucleic acid constructs or expression cassettes described above.
  • the invention further relates to a method for producing genetically modified organisms by functionally introducing a nucleic acid or a nucleic acid construct described above into the starting organism.
  • the invention further relates to the genetically modified organisms, the genetic modification increasing the activity of a lanosterol C14 demethylase and an HMG-CoA reductase compared to a wild type.
  • the increase in lanosterol C14 demethylase activity takes place, as mentioned above, by an increase in the gene expression of a nucleic acid encoding a lanosterol Cl4 demethylase compared to the wild type.
  • the increase in the gene expression of a nucleic acid encoding a lanosterol C14 demethylase compared to the wild type is preferably carried out by increasing the number of copies of the nucleic acid encoding a lanosterol C14 demethylase in the organism.
  • the invention preferably relates to a genetically modified organism as described above which contains two or more nucleic acids encoding a lanosterol-Cl4-demethylase.
  • the HMG-CoA reductase activity is increased compared to the wild type, as mentioned above by increasing the gene expression of a nucleic acid encoding an HMG-CoA reductase.
  • the gene expression of a nucleic acid encoding an HMG-CoA reductase is increased by introducing a nucleic acid construct containing a nucleic acid encoding an HMG-CoA reductase into the organism, the expression of which in the organism compared with the wild type, is subject to reduced regulation.
  • the invention accordingly relates to a genetically modified organism as described above, which contains a nucleic acid construct containing a nucleic acid encoding an HMG-CoA reductase, the expression of which in the organism is subject to reduced regulation compared to the wild type.
  • the invention relates in particular to a genetically modified organism described above, characterized in that the nucleic acid construct contains a promoter which is subject to reduced regulation in the organism compared to the wild type and / or that an HMG-CoA reductase is encoded as the nucleic acid uses a nucleic acid that only encodes the catalytic region of HMG-CoA reductase.
  • Genetically modified organisms mentioned above are particularly preferred in which the genetic modification additionally increases the squalene epoxidase activity compared to a wild type.
  • the squalene epoxidase activity is increased, as mentioned above by increasing the gene expression of a nucleic acid encoding a squalene epoxidase compared to the wild type.
  • the gene expression of a nucleic acid encoding a squalene epoxidase is increased compared to the wild type by increasing the copy number of the nucleic acid encoding a squalene epoxidase in the organism.
  • the invention preferably relates to a genetically modified organism as described above which contains two or more nucleic acids encoding a squalene epoxidase.
  • the genetically modified organisms described above have an increased content of zymosterol and / or its biosynthetic intermediate and / or secondary products compared to the wild type.
  • the invention relates to a genetically modified organism described above, characterized in that the genetically modified organism has an increased content of zymosterol and / or its biosynthetic intermediate and / or secondary products compared to the wild type.
  • genetically modified organisms according to the invention are genetically modified yeasts or fungi, in particular genetically modified yeasts, in particular the genetically modified yeast species according to the invention, Saccharomyces cerevisiae, in particular the genetically modified yeast strains Saccharomyces cerevisiae AH22, Saccharomyces cerevisiae GRF, Saccharomyces cerevisiae477 DB47 ,
  • increasing the content of zymosterol and / or its biosynthetic intermediates and / or secondary products preferably means the artificially acquired ability to increase the biosynthesis of at least one of the aforementioned compounds in the genetically modified organism compared to the non-genetically modified organism.
  • wild type is preferably understood to mean the genetically unmodified organism, but in particular the reference organism mentioned at the beginning.
  • An increased content of zymosterol and / or its biosynthetic intermediates and / or secondary products compared to the wild type means in particular an increase in the content of at least one of the above-mentioned compounds in the organism by at least 50%, preferably 100%, more preferably 200%, particularly preferably 400 % understood in comparison to the wild type.
  • the content of at least one of the compounds mentioned is preferably determined by known analytical methods and preferably relates to the compartments of the organism in which sterols are produced.
  • the present invention has the following advantage over the prior art:
  • the method according to the invention makes it possible to increase the content of zymosterol and / or its biosynthetic intermediate and / or secondary products in the production organisms without suppressing the route to other secondary products and thus restricting the compound portfolio. If specific compounds are to be produced, the suppression or interruption of undesirable metabolic pathways provides an additional increase in the content of the desired product.
  • the plasmids were restricted (1 to 10 ⁇ g) in 30 ⁇ l batches. For this, the DNA was in 24 ul
  • Restriction mixture was incubated at 3 ° C for two hours. The restriction was checked with a mini gel.
  • the gel electrophoresis was carried out in mini gel or wide mini gel apparatus.
  • the mini gels (approx. 20 ml, 8 pockets) and the wide mini gels (50 ml, 15 or 30 pockets) consisted of 1% agarose in TAE. 1 x TAE was used as the running buffer.
  • the samples (10 ⁇ l) were mixed with 3 ⁇ l stopper solution and applied.
  • I-DNA cut with HindIII (bands at: 23.1 kb; 9.4 kb; 6.6 kb; 4.4 kb; 2.3 kb; 2.0 kb; 0.6 kb) served as the standard.
  • a voltage of 80 V was applied for 45 to 60 min.
  • the gel was then stained in ethidium bromide solution and recorded under UV light with the INTAS video documentation system or photographed with an orange filter. 3.
  • the desired fragments were isolated by gel elution.
  • the restriction mixture was applied to several pockets of a mini gel and separated. Only ⁇ -HindIII and a "sacrificial trace" were stained in ethidium bromide solution, viewed under UV light and the desired fragment was marked. This prevented the DNA of the remaining pockets from being damaged by the ethidium bromide and UV light.
  • the desired fragment could be cut out of the unstained gel piece using the marking.
  • the piece of agarose with the fragment to be isolated was placed in a dialysis tube, sealed with a little TAE buffer without air bubbles and placed in the BioRad mini-gel apparatus.
  • the running buffer consisted of 1 x TAE and the voltage was 100 V for 40 min.
  • the current polarity was then changed for 2 min in order to dissolve the DNA sticking to the dialysis tube.
  • the buffer of the dialysis tube containing the DNA fragments was transferred into reaction vessels and an ethanol precipitation was thus carried out.
  • 1/10 volume of 3 M sodium acetate, tRNA (1 ⁇ l per 50 ⁇ l solution) and 2.5 times the volume of ice-cold 96% ethanol were added to the DNA solution.
  • the mixture was incubated at -20 ° C. for 30 min and then centrifuged off at 12,000 rpm, 30 min, 4 ° C.
  • the DNA pellet was dried and taken up in 10 to 50 ⁇ l H0 (depending on the amount of DNA).
  • the DNA should come from an ethanol precipitation to prevent impurities from inhibiting the Klenow polymerase.
  • the incubation was carried out for 30 min at 37 ° C, by a further 5 min at 70 ° C
  • the final volume of 13.1 ⁇ l contained approx. 0.5 ⁇ l DNA with a vector insert ratio of 1: 5.
  • the sample was incubated at 70 ° C for 45 seconds, cooled to room temperature (approx. 3 min) and then incubated on ice for 10 min.
  • the ligation buffer was then added: 2.6 ⁇ l 500 mM TrisHCl pH 7.5 and 1.3 ⁇ l 100 mM MgCl and incubated on ice for a further 10 min.
  • 1 ⁇ l ligase (1 unit / pl) was added.
  • the entire treatment should be carried out as vibration-free as possible so as not to separate adjacent DNA ends again.
  • the ligation was carried out overnight at 14 ° C.
  • Competent Escherichia coli (E. coli) NM522 cells were transformed with the DNA of the ligation mixture.
  • a batch with 50 ⁇ g of the pScL3 plasmid ran as a positive control and a batch without DNA ran as a zero control.
  • a batch without DNA ran as a zero control.
  • E. coli colonies were placed overnight in 1.5 ml LB + ampicillin medium in table top centrifuge tubes at 37 ° C and
  • Plasmid preparation from E. coli (Maxi remplip) In order to isolate larger amounts of plasmid DNA, the Maxigarp method was carried out. Two flasks with 100 ml LB + ampicillin medium were inoculated with a colony or with 100 ⁇ l of a freezing culture which carries the plasmid to be isolated and incubated overnight at 37 ° C. and 120 rpm. The next day (200 ml) was transferred to a GSA beaker and centrifuged at 4000 rpm (2600 x g) for 10 min. The cell pellet was taken up in 6 ml of TE buffer.
  • lysozyme solution 20 mg / ml TE buffer
  • lysozyme solution 20 mg / ml TE buffer
  • the cells were then lysed with 12 ml of 0.2N NaOH, 1% SDS solution and a further 5 min of incubation at room temperature.
  • the proteins were raised by the addition of 9 ml of chilled 3 M sodium acetate solution (pH 4.8) and a 15 minute incubation
  • Yeast transformation For the yeast transformation, a preliminary cultivation of the strain Saccharomyces cerevisiae AH22 was set up. A flask with 20 ml of YE medium was inoculated with 100 ⁇ l of the freezing culture and incubated overnight at 28 ° C. and 120 rpm. The main cultivation was carried out under the same conditions in flasks with 100 ml of YE medium, which were inoculated with 10 ⁇ l, 20 ⁇ l or 50 ⁇ l of the preliminary cultivation.
  • the cell pellet was then taken up in 330 ⁇ l of lithium acetate buffer per 10 9 cells, transferred to a sterile 50 ml Erlenmeyer flask and shaken at 28 ° C. for one hour. As a result, the cells were competent for the transformation.
  • the cells needed time to express the resistance gene.
  • the transformation batches were mixed with 4 ml of YE medium and overnight at 28 ° C on the
  • Incubator 120 rpm incubated. The next day, the cells were centrifuged off (6000 rpm, 3 min) in 1 ml of YE medium and 100 ⁇ l or 200 ⁇ l thereof were plated out on YE + G418 plates. The plates were incubated at 28 ° C for several days.
  • the reaction conditions for the polymerase chain reaction have to be optimized for the individual case and are not unreservedly valid for every approach.
  • the amount of DNA used, the salt concentrations and the melting temperature can be varied.
  • it turned out to be beneficial to combine the following substances in an Eppendorf cone, which was suitable for use in a thermal cycler: 5 ⁇ l Super Buffer, 8 ⁇ l dNTP's (2 ⁇ l ( 0.1 U) Super Taq Polymerase ( 0.625 ⁇ M each), 5 ′ primer, 3 ′ primer and 0.2 ⁇ g template DNA, dissolved in so much water that a total volume of 50 ⁇ l results for the PCR mixture. The mixture was centrifuged briefly and covered with a drop of oil. Between 37 and 40 cycles were chosen for amplification.
  • the coding nucleic acid sequence for the expression cassette from the ADJ ⁇ promoter-ti ⁇ MC? Trypophan terminator was derived from the vector YepH2 (Polakowski et al. (1998) Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast. Appl. Microbiol Biotechnol ; 49 (1): 66-71) by PCR using standard methods as indicated above under the general reaction conditions.
  • the primers used here are the DNA oligomers AtHT-5 '(forward: tHMGNotF: 5'- CTGCGGCCGCATCATGGACCAATTG-GTGAAAACTG-3'; SEQ. ID. NO. 7) and AtHT-3 '(reverse: tHMGXhoR: 5 '- AACTCGAGAGACACATGGTGCTGTTGTGCTTC-3'; SEQ. ID. No. 8th) .
  • oligonucleotide sequences were selected which each contain the 5 'or 3' sequence of the ÜRA3 gene on the 5 'and 3' overhangs and the sequences of the loxP regions 5 'and 3' of the vector pUG-tHMG in the annealing region. This ensures that on the one hand the entire fragment including KariR and tHMG are amplified and on the other hand this fragment can subsequently be transformed into yeast and by homologous recombination this entire fragment is integrated into the 7A3 gene locus of yeast.
  • the resulting strain S. cerevisiae GRF-tHlura3 is uracil auxotroph and contains a copy of the tHMG gene under the control of the ADfiT promoter and the tryptophan terminator.
  • the yeast strain formed is treated with the cre recombinase vector pSH47 (Guldener U, Heck S, Fielder T, Beinhauer J, Hegemann JH. (1996) A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. Jul 1; 24 (13): 2519-24.).
  • the cre recombinase is expressed in the yeast by this vector, with the result that the sequence region recombines out within the two loxP sequences. As a result, only one of the two loxP sequences and the ⁇ DH-tHMG-TRP cassette remains in the URA3 gene locus.
  • the result is that the yeast strain loses G418 resistance again and is therefore suitable for integrating or removing further genes into the yeast strain using this cre-lox system.
  • the vector pSH47 can then be removed by counter-selection on YNB agar plates supplemented with uracil (20 mg / L) and FOA (5-fluoroorotic acid) (Ig / L).
  • uracil (20 mg / L)
  • FOA 5-fluoroorotic acid
  • the cells carrying this plasmid must first be cultivated under non-selective conditions and then grown on selective plates containing FOA. Under these conditions, only cells can grow that are unable to synthesize uracil itself. In this case, these are cells that no longer contain a plasmid (pSH47).
  • the yeast strain GRF-tHlura3 and the starting strain GRF were cultivated for 48 hours in WMXIII medium at 28 ° C. and 160 rpm in a 20 ml culture volume. Then 500 ⁇ l of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffle flask for 4 days at 28 ° C. and 160 rpm.
  • Yeast sterols yeast mutants as tools for the study of sterol metabolism. Methods Enzymol. 1985; 111: 333-46, extracted after 4 days and analyzed by gas chromatography. The values listed in Table 1 result. The percentages relate to the dry yeast weight.
  • the sequence of squalene epoxidase was obtained by PCR from genomic DNA from Saccharomyces cerevisiae S288C.
  • the primers used here are the DNA oligomers ERG1-5 '(forward: ErglNotF: 5' - CTGCGGCCGCATCATGTCTGCTGTTAACGT TGC- 3 '; SEQ. ID. No. 9) and ERG1-3' (revers.- ErglXhoR: 5 '- TTCTCGAGTTAACCAATCAACTCAC -3 '; SEQ. ID. No. 10).
  • the DNA fragment obtained was treated with the restriction enzymes Notl and Xhol and then into the vector pFlatl ( Figure 4), which had also previously been treated with the enzymes Notl and Xhol were treated by means of a ligase reaction integrated.
  • the resulting vector pFlatl-ERGl ( Figure 5) contains the ERG gene under the control of the ADff promoter and the tryptophan terminator.
  • the expression vector pFlatl-ERGl was then transformed into the yeast strain S. cerevisiae GRF tHlura3.
  • the yeast strain S. cerevisiae GRF tHlura3 / pFlatl-ERG2 obtained in this way was then cultivated for 48 hours in WMXIII medium at 28 ° C. and 160 rpm in a 20 ml culture volume. Then 500 ⁇ l of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffle flask for 4 days at 28 ° C. and 160 rpm.
  • Example 2 After 4 days, the sterols were extracted analogously to Example 1 and analyzed by gas chromatography. The values listed in Table 2 result. The percentages relate to the dry yeast weight.
  • Figures la and lb show the absolute (la) and percentage (lb) increase in the content of individual sterols in S. cerevisae GRF tHlura3 / pFlatl-ERGl compared to the parent strain S. cerevisae GRF tHlura3.
  • Example 3
  • lanosterol C14 demethylase (ERG11) was obtained by PCR from genomic DNA from Saccharomyces cerevisiae S288C.
  • the primers used here are the DNA oligomers ERG11-5 '(forward: ErgllNotF: 5'- CTGCGGCCGCAGGATGTCTGCTAC- CAAGTCAATCG -3'; SEQ. ID. No. 11) and ERGl1-3 '(revers: ErgllXhoR: 5'- ATCTCGTGTGTTATAT -3 '; SEQ ID No. 12).
  • the DNA fragment obtained was treated with the restriction enzymes NotJ and Xhol and then integrated into the vector pFlat3 ( Figure 6), which had also previously been treated with the enzymes Notl and Xhol, by means of a ligase reaction.
  • the resulting vector pFlat3-BRGll ( Figure 7) contains the ERG I gene under the control of the ADH promoter and the tryptophan terminator.
  • the expression vector pFlat3-ERGll was then transformed into the yeast strain S. cerevisiae GRF-tHlura3.
  • the yeast strain S. cerevisiae GRF tHlura3 / pFlat3 -ERG11 obtained in this way was then cultivated for 48 hours in WMXIII medium at 28 ° C. and 160 rpm in a 20 ml culture volume. Then 500 ⁇ l of this preculture were transferred to a 50 ml main culture of the same medium and cultivated in a baffle flask for 4 days at 28 ° C. and 160 rpm.
  • Example 3 After 4 days, the sterols were extracted analogously to Example 1 and analyzed by means of gas chromatography. The values listed in Table 3 result. The percentages relate to the dry yeast weight.
  • Figures 2a and 2b show the absolute (2a) and percentage (2b) increase in the content of individual sterols in S. cerevisae GRF-tHlura3 / pFlat3-ERGll compared to the original strain S. cerevisae GRF tHlura3.
  • Example 2 and pFlat3-E Gll (see Example 3) were transformed together and simultaneously into the yeast strain S. cerevisiae GRF tHlura3 and the two genes ERGl and ERGll were expressed simultaneously under the control of the ADH promoter and the tryptophan terminator.
  • the yeast strain S. cerevisiae GRF-tHlura3 / pFlatl-ERGl / pFlat3 -ERGll obtained in this way was then cultivated for 48 hours in WMXIII medium at 28 ° C. and 160 rpm in a 20 ml culture volume. Then 500 ⁇ l of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffle flask for 4 days at 28 ° C. and 160 rpm.
  • Example 4 After 4 days, the sterols were extracted analogously to Example 1 and analyzed by gas chromatography. The values listed in Table 4 result. The percentages relate to the dry yeast weight.
  • Figures 3a and 3b show the absolute (3a) and the percentage (3b) increase in the content of individual sterols in S. cerevisiae GRF tHlura3 / pFlatl-ERGl / pFlat3 -ERGll compared to the parent strain S. cerevisae GRF-tHlura3. Since it is known from the prior art (Tainaka et al., J, Ferment. Bioeng.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Die vorliegende Erfindung betrifft ein Verfahren zur Herstellung von Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten durch Kultivierung von Organismen, insbesondere Hefen, die gegenüber dem Wildtyp eine erhöhte Lanosterol-C14-Demethylase-Aktivität und eine erhöhte HMG-CoA-Reduktase Aktivität aufweisen, die zur Herstellung der genetisch veränderten Organismen benötigten Nukleinsäure-konstrukte, sowie die genetisch veränderten Organismen, insbesondere Hefen selbst.

Description

Verfahren zur Herstellung von Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten in transgenen Organismen
Beschreibung
Die vorliegende Erfindung betrifft ein Verfahren zur Herstellung von Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten durch Kultivierung von
Organismen, insbesondere Hefen, die gegenüber dem Wildtyp eine erhöhte Lanosterol-C14-Demethylase-Aktivität und eine erhöhte HMG-CoA-Reduktase Aktivität aufweisen, die zur Herstellung der genetisch veränderten Organismen benötigten Nukleinsäure- konstrukte, sowie die genetisch veränderten Organismen, insbesondere Hefen selbst.
Zymosterol, dessen biosynthetischen Zwischenprodukte des Sterol- stoffwechseis, wie beispielsweise Farnesol, Geraniol, Squalen und Lanosterol, sowie dessen biosynthetischen Folgeprodukte des Sterolstoffwechsels, wie Ergosterol (Endprodukt der Sterol- Synthese in Hefe und Pilzen), Lathosterol, Cholesta-5, 7-dienol (Provitamin D3) und Cholesterol (Sterolbiosynthese in Säugetieren) sind Verbindungen mit hohem wirtschaftlichen Wert.
Die wirtschaftliche Bedeutung von Ergosterol liegt zum einen in der Gewinnung von Vitamin D2 aus Ergosterol über UV-Bestrahlung, zum anderen in der Gewinnung von Steroidhor onen über Biotransformation, ausgehend von Ergosterol.
Squalen wird als Synthesebaustein für die Synthese von Terpenen benutzt . In hydrierter Form findet es als Squalan Verwendung in Dermatologie und Kosmetik sowie in verschiedenen Derivaten als Inhaltsstoff von Haut- und Haarpflegemitteln.
Weiterhin wirtschaftlich nutzbar sind Sterole, wie Zymosterol und LxΛos erol, wobei Lanosterol Roh- und Synthesepivotal für die chemische Synthese von Saponinen und Steroidhormonen ist. Wegen seiner guten Hautpenetration und Spreadingeigenschaften dient Lanosterol als Emulsionshilfs- und Wirkstoff für Hautcremes .
Cholesta-5, 7-dienol (Provitamin D3 ) dient als Ausgangsstoff für die Herstellung von Vitamin D3 durch UV-Bestrahlung und ist ebenso wie Cholesterol der Ausgangsstoff für weitere Steoid- hormone. Ein wirtschaftliches Verfahren zur Herstellung von Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten ist daher von großer Bedeutung.
Besonders wirtschaftliche Verfahren sind biotechnologische
Verfahren unter Ausnutzung natürlicher oder durch genetische Veränderung optimierter Organismen, die Zymosterol und/oder dessen biosynthetische Zwischen- und/oder Folgeprodukte herstellen.
Die Gene des Ergosterol-Stoffwechsels in Hefe sind weitgehend bekannt und kloniert, wie beispielsweise
Nukleinsäuren kodierend eine HMG-CoA-Reduktase (BMG) (Bason M.E. et al., (1988) Structural and functional conservation between yeast and human 3-hydroxy-3-methylglutaryl coenzyme A reductases, the rate-limiting enzyme of sterol biosynthesis. Mol Cell Biol 8:3797-3808,
die Nukleinsäure kodierend eine trunkierte HMG-CoA-Reduktase (t-HMG) (Polakowski T, Stahl U, Lang C. (1998) Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast. Appl Microbiol Biotechnol. Jan; 49(1) :66-71,
die Nukleinsäure kodierend eine Lanosterol-C14-Demethylase
(ERG11) (Kalb VF, Loper JC, Dey CR, Woods CW, Sutter TR (1986) Isolation of a cytochrome P-450 structural gene from Saccharo- myces cerevisiae. Gene 45 (3) .-237-45
und die Nukleinsäure kodierend eine Squalenepoxidase (ERG1)
(Jandrositz, A. , et al (1991) The gene encoding squalene epoxi- dase from Saccharomyces cerevisiae: cloning and characterization. Gene 107:155-160.
Weiterhin sind Verfahren bekannt, die eine Erhöhung des Gehalts an spezifischen Intermediaten und Endprodukten des Sterolstoff- wechsels in Hefen und Pilzen zum Ziel haben.
Es ist aus EP 486 290 bekannt, dass der Gehalt an Squalen und weiteren spezifischen Sterolen, wie beispielsweise Zymosterol in Hefen erhöht werden kann, indem man die Expressionsrate der HMG-CoA-Reduktase erhöht und gleichzeitig den Stoffwechselweg der Zymosterol-C24-Methyltransferase (ERG6) und der Ergosta- 5,7,24(28)-trienol-22-dehydrogenase (ERG5) unterbricht. Dieses Verfahren hat den Nachteil, dass Sterole, die in der Sterol-Biosynthese der Hefe nach Zymosterol folgen, nicht mehr hergestellt werden.
Aus T. Polakowski, Molekularbiologische Beeinflussung des
Ergosterolstoffwechsels der Hefe Saccharomyces cerevisiae, Shaker Verlag Aachen, 1999, Seite 59 bis 66 ist bekannt, dass die Erhöhung der Expressionsrate der HMG-CoA-Reduktase alleine ohne Unterbrechung des abfließenden Stoffwechselflusses wie in EP 486 290 lediglich zu einer leichten Erhöhung des Gehalts an frühen Sterolen, wie Squalen führt, während sich der Gehalt an späteren Sterolen, wie Ergosterol nicht signifikant ändert, bzw. tendentiell eher abnimmt .
WO 99/16886 beschreibt ein Verfahren zur Herstellung von Ergosterol in Hefen, die eine Kombination der Gene tHMG, ERG9, SATl und ERG1 überexprimieren.
Tainaka et al., J, Ferment. Bioeng. 1995, 79, 64-66, beschreiben ferner, dass die Überexpression von ERG11 (Lanosterol-C14- Demethylase) zu einer Anreicherung von 4 , 4-Dimethylzymosterol jedoch nicht von Ergosterol führt. Die Transformante zeigte gegenüber dem Wildtyp einen, je nach Fermentationsbedingungen, um den Faktor 1,1 bis 1,47 gesteigerten Zymosterolgehalt .
Aufgabe der vorliegenden Erfindung ist es, ein weiteres Verfahren zu Herstellung von Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten mit vorteilhaften Eigenschaften, wie einer höheren Produktausbeute, zur Verfügung zu stellen.
Demgemäß wurde ein Verfahren zur Herstellung von Zymosterol und/ oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten gefunden, indem man Organismen kultiviert, die gegenüber dem Wildtyp eine erhöhte Lanosterol-C14-Demethylase-Aktivität und eine erhöhte HMG-CoA-Reduktase Aktivität aufweisen.
Unter Lanosterol-C14-Demethylase-Aktivität wird die Enzymaktivität einer Lanosterol-Cl4-Demethylase verstanden.
Unter einer Lanosterol-C14-Demethylase wird ein Protein verstanden, das die enzymatische Aktivität aufweist, Lanosterol in 4, 4-Dimethylcholesta-8 , 14,24-trienol umzuwandeln. Dementsprechend wird unter Lanosterol-C14-Demethylase-Aktivität die in einer bestimmten Zeit durch das Protein Lanosterol-Cl4- Demethylase umgesetzte Menge Lanosterol bzw. gebildete Menge 4, 4-Dimethylcholesta-8 , 14, 24-trienol verstanden.
Bei einer erhöhten Lanosterol-C14-Demethylase-Aktivität gegenüber dem Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Protein Lanosterol-C14-Demethylase die umgesetzte Menge Lanosterol bzw. die gebildete Menge 4, 4-Dimethylcholesta-8 , 14, 24-trienol erhöht .
Vorzugsweise beträgt diese Erhöhung der Lanosterol-C14- De ethylase-Aktivität mindestens 5 %, weiter bevorzugt mindestens 20 %, weiter bevorzugt mindestens 50 %, weiter bevorzugt min- destens 100 %, bevorzugter mindestens 300 %, noch bevorzugter mindestens 500 %, insbesondere mindestens 600 % der Lanosterol- C14-Demethylase-Aktivität des Wildtyps .
Unter HMG-CoA-Reduktase-Aktivität wird die Enzymaktivität einer HMG-CoA-Reduktase (3-Hydroxy-3-Methyl-Glutaryl-Coenzym- A-Reduktase) verstanden.
Unter einer HMG-CoA-Reduktase wird ein Protein verstanden, das die enzymatische Aktivität aufweist, 3-Hydroxy-3-Methyl-Glutaryl- Coenzym-A in Mevalonat umzuwandeln.
Dementsprechend wird unter HMG-CoA-Reduktase-Aktivität die in einer bestimmten Zeit durch das Protein HMG-CoA-Reduktase umgesetzte Menge 3-Hydroxy-3-Methyl-Glutaryl-Coenzym-A bzw. gebildete Menge Mevalonat verstanden.
Bei einer erhöhten HMG-CoA-Reduktase-Aktivität gegenüber dem Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Protein HMG-CoA-Reduktase die umgesetzte Menge 3-Hydroxy-3-Methyl-Glutaryl-Coenzym-A bzw. die gebildete Menge Mevalonat erhöht .
Vorzugsweise beträgt diese Erhöhung der HMG-CoA-Reduktase- Aktivität mindestens 5 %, weiter bevorzugt mindestens 20 %, weiter bevorzugt mindestens 50 %, weiter bevorzugt mindestens 100 %, bevorzugter mindestens 300 %, noch bevorzugter mindestens 500 %, insbesondere mindestens 600 % der HMG-CoA-Reduktase- Aktivität des Wildtyps .
Unter einem Wildtyp wird der entsprechende nicht genetisch veränderte Organismus verstanden. Die Erhöhung der Lanosterol-Cl4-Demethylase-Aktivität, der HMG-CoA-Reduktase-Aktivität und der nachstehend beschriebenen Squalenepoxidase-Aktivität kann unabhängig voneinander durch verschiedene Wege erfolgen, beispielsweise durch Ausschalten von hemmenden Regulationsmechanismen auf Expressions- und Proteinebene oder durch Erhöhung der Genexpression einer Nukleinsäure kodierend eine Lanosterol-C14-Demethylase, HMG-CoA-Reduktase oder Squalenepoxidase gegenüber dem Wildtyp, beispielsweise durch Induzierung des Lanosterol-C14-Demethylase-Gens, HMG-CoA- Reduktase-Gens oder Squalenepoxidase-Gens durch Aktivatoren oder durch Einbringen von einer oder mehreren Nukleinsäuren codierend eine Lanosterol-C14-Demethylase, HMG-CoA-Reduktase oder Squalenepoxidase in den Organismus.
Unter Erhöhung der Genexpression einer Nukleinsäure codierend eine Lanosterol-C14-Demethylase, eine HMG-CoA-Reduktase oder eine Squalenepoxidase wird erfindungsgemäß auch die Manipulation der Expression der Organismus, insbesondere der Hefen eigenen endogenen Lanosterol-C14-Demethylasen, HMG-CoA-Reduktasen oder Squalenepoxidasen verstanden. Dies kann beispielsweise durch Veränderung der Promotor DNA-Sequenz für Lanosterol-C14- Demethylasen, HMG-CoA-Reduktasen oder Squalenepoxidasen kodierende Gene erreicht werden. Eine solche Veränderung, die eine veränderte oder vorzugsweise erhöhte Expressionsrate mindestens eines endogenen Lanosterol-C14-Demethylase-, HMG-CoA-Reduktase- oder Squalenepoxidase-Gens zur Folge hat, kann durch Deletion oder Insertion von DNA Sequenzen erfolgen.
Es ist, wie vorstehend beschrieben, möglich, die Expression mindestens einer endogenen Lanosterol-Cl4-Demethylase, HMG-CoA- Reduktase oder Squalenepoxidase durch die Applikation exogener Stimuli zu verändern. Dies kann durch besondere physiologische Bedingungen, also durch die Applikation von Fremdsubstanzen erfolgen.
Des weiteren kann eine veränderte bzw. erhöhte Expression mindestens eines endogenen Lanosterol-C14-Demethylase-, HMG-CoA- Reduktase- oder Squalenepoxidase-Gens dadurch erzielt werden, dass ein im nicht transformierten Organismus nicht vorkommendes Regulator-protein mit dem Promotor dieser Gene in Wechselwirkung tritt.
Solch ein Regulator kann ein chimäres Protein darstellen, welches aus einer DNA-Bindedomäne und einer Transkriptionsaktivätor- Domäne besteht, wie beispielsweise in WO 96/06166 beschrieben. In einer bevorzugten Ausführungsform erfolgt die Erhöhung der Lanosterol-C14-Demethylase-Aktivität gegenüber dem Wildtyp durch eine Erhöhung der Genexpression einer Nukleinsäure codierend eine Lanosterol-Cl4-Demethylase.
In einer weiter bevorzugten Ausführungsform erfolgt die Erhöhung der Genexpression einer Nukleinsäure codierend eine Lano- sterol-C14-Demethylase durch Einbringen von einer oder mehrerer Nukleinsäuren codierend eine Lanosterol-C14-Demethylase in den Organismus .
Dazu kann prinzipiell jedes Lanosterol-C14-Demethylase-Gen (ERG11) , also jede Nukleinsäuren die eine Lanosterol-C14- Demethylase codiert, verwendet werden. Bei genomischen Lano- sterol-C14-Demethylase-Nukleinsäure-Sequenzen aus eukaryontisehen Quellen, die Introns enthalten, sind für den Fall dass der Wirtsorganismus nicht in der Lage ist oder nicht in die Lage versetzt werden kann, die entsprechenden Lanosterol-C14-Demethylase zu expri ieren, bevorzugt bereits prozessierte Nukleinsäure- Sequenzen, wie die entsprechenden cDNAs zu verwenden.
Beispiele für Lanosterol-C14-Demethylase-Gene sind Nukleinsäuren, codierend eine Lanosterol-C14-Demethylase aus Saccharomyces cerevisiae (Kalb VF, Loper JC, Dey CR, Woods CW, Sutter TR (1986) Isolation of a cytochrome P-450 structural gene from Saccharomyces cerevisiae. Gene 45 (3) :237-45) , Candida albicans (Lamb DC, Kelly DE, Baldwin BC, Gozzo F, Boscott P, Richards WG, Kelly SL (1997) Differential inhibition of Candida albicans CYP51 with azole antifungal stereoisomers. FEMS Microbiol Lett 149 (1) :25-30) , Homo sapiens (Stromstedt M, Rozman D, Waterman MR. (1996) The ubiquitously expressed human CYP51 encodes lanosterol 14 alpha-demethylase, a cytochrome P450 whose expression is regulated by oxysterols. Arch Biochem Biophys 1996 May 1; 329 (1) :73-81c) oder Rattus norvegicus, Aoyama Y, Funae Y, Noshiro M, Horiuchi T, Yoshida Y. (1994) Occurrence of a P450 showing high homology to yeast lanosterol 14-demethylase (P450(14DM)) in the rat liver. Biochem Biophys Res Commun. Jun 30;201(3) :1320-6)
In den erfindungsgemäßen transgenen Organismen liegt also in dieser bevorzugten Ausführungsform gegenüber dem Wildtyp mindestens ein weiteres Lanosterol-Cl4-Demethylase-Gen vor. Die Anzahl der Lanosterol-Cl4-Demethylase-Gene in den erfindungsgemäßen transgenen Organismen beträgt mindestens zwei, vorzugsweise mehr als zwei, besonders bevorzugt mehr als drei, ganz besonders bevorzugt mehr als fünf .
Alle in der Beschreibung erwähnten Nukleinsäuren können beispielsweise eine RNA-, DNA- oder cDNA-Sequenz sein.
Bevorzugt verwendet man im vorstehend beschriebenen Verfahren Nukleinsäuren, die Proteine kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 30 %, vorzugsweise mindestens 50 %, bevorzugter mindestens 70 %, noch bevorzugter mindestens 90 %, am bevorzugtesten mindestens 95 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2, und die die enzymatische Eigenschaft einer Lanosterol-C14-Demethylase aufweisen.
Die Sequenz SEQ. ID. NO. 2 stellt die Aminosäuresequenz der Lano- sterol-C14-Demethylase aus Saccharomyces cerevisiae dar.
Weitere Beispiele für Lanosterol-C14-Demethylasen und Lanosterol- C14-Demethylase-Gene lassen sich beispielsweise aus verschiedenen Organismen deren genomische Sequenz bekannt ist durch Homologievergleiche der Aminosäuresequenzen oder der entsprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit der SEQ. ID. NO. 2 leicht auffinden.
Weitere Beispiele für Lanosterol-C14-Demethylasen und Lanosterol- C14-Demethylase-gene lassen sich weiterhin beispielsweise ausgehend von der Sequenz SEQ. ID. No. 1 aus verschiedenen Organismen deren genomische Sequenz nicht bekannt ist, durch Hybridisie- rungs- und PCR-Techniken in an sich bekannter Weise leicht auf- finden.
Unter dem Begriff "Substitution" ist in der Beschreibung der Austausch einer oder mehrerer Aminosäuren durch eine oder mehrere Aminosäuren zu verstehen. Bevorzugt werden sog. konservative Austausche durchgeführt, bei denen die ersetzte Aminosäure eine ähnliche Eigenschaft hat wie die ursprüngliche Aminosäure, beispielsweise Austausch von Glu durch Asp, Gin durch Asn, Val durch Ile, Leu durch Ile, Ser durch Thr. Deletion ist das Ersetzen einer Aminosäure durch eine direkte Bindung. Bevorzugte Positionen für Deletionen sind die Termini des Polypeptides und die Verknüpfungen zwischen den einzelnen Proteindomänen.
Insertionen sind Einfügungen von Aminosäuren in die Polypeptid- kette, wobei formal eine direkte Bindung durch ein oder mehrere Aminosäuren ersetzt wird.
Unter Identität zwischen zwei Proteinen wird die Identität der Aminosäuren über die jeweils gesamte Proteinlänge verstanden, insbesondere die Identität die durch Vergleich mit Hilfe der Lasergene Software der Firma DNASTAR, ine. Madison, Wisconsin (USA) unter Anwendung der Clustal Methode (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a micro- computer. Comput Appl. Biosci. 1989 Apr; 5 (2) : 151-1) unter Einstellung folgender Parameter berechnet wird:
Multiple alignment parameter: Gap penalty 10
Gap length penalty 10
Pairwise alignment parameter:
K-tuple 1 Gap penalty 3
Window 5
Diagonale saved 5
Unter einem Protein, das eine Identität von mindestens 30 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 2 aufweist, wird dementsprechend ein Protein verstanden, das bei einem Vergleich seiner Sequenz mit der Sequenz SEQ. ID. NO. 2, insbesondere nach obigen Programmalgorithmus mit obigem Parametersatz eine Identität von mindestens 30 % aufweist.
In einer weiter bevorzugten Ausführungsform werden Nukleinsäuren in Organismen eingebracht, die Proteine kodieren, enthaltend die Aminosäuresequenz der Lanosterol-C14-Demethylase aus Saccharomyces cerevisiae (SEQ. ID. NO. 2) .
Geeignete Nukleinsäuresequenzen sind beispielsweise durch Rückübersetzung der Polypeptidsequenz gemäß dem genetischen Code erhältlich.
Bevorzugt werden dafür solche Codons verwendet, die entsprechend der organismusspezifischen codon usage häufig verwendet werden. Die codon usage lässt sich anhand von Computerauswertungen anderer, bekannter Gene der betreffenden Organismen leicht ermitteln.
Soll das Protein beispielsweise in Hefe exprimiert werden, so ist es häufig vorteilhaft, die codon usage der Hefe bei der Rückübersetzung zu verwenden.
In einer besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ. ID. NO. 1 in den Organismus ein.
Die Sequenz SEQ. ID. NO. 1 stellt die genomische DNA aus Saccharomyces cerevisiae (ORF S0001049) dar, die die Lano- sterol-C14-Demethylase der Sequenz SEQ ID NO. 2 codiert.
Alle vorstehend erwähnten Lanosterol-C14-Demethylase-Gene sind weiterhin in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen wie beispielsweise durch Fragmentkondensation einzelner überlappender, komplementärer Nuklein- säurebausteine der Doppelhelix herstellbar. Die chemische
Synthese von Oligonukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoamiditmethode (Voet, Voet, 2. Auflage, Wiley Press New York, Seite 896-897) erfolgen. Die Anlagerung synthetischer Oligonukleotide und Auffüllen von Lücken mithilfe des Klenow-Fragmentes der DNA-Polymerase und Ligationsreaktionen sowie allgemeine Klonierungsverfahren werden in Sambrook et al. (1989), Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, beschrieben.
In einer bevorzugten Ausführungsform erfolgt die Erhöhung der HMG-CoA-Reduktase-Aktivität gegenüber dem Wildtyp durch eine Erhöhung der Genexpression einer Nukleinsäure codierend eine HMG-CoA-Reduktase .
In einer besonders bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens erfolgt die Erhöhung der Genexpression einer Nukleinsäure codierend eine HMG-CoA-Reduktase indem man ein Nukleinsäurekonstrukt, enthaltend eine Nukleinsäure codierend eine HMG-CoA-Reduktase in den Organismus einbringt, deren Expression in dem Organismus, verglichen mit dem Wildtyp, einer reduzierten Regulation unterliegt.
Unter einer reduzierten Regulation verglichen mit dem Wildtyp, wird eine im Vergleich zum vorstehend definierten Wildtyp ver- ringerte, vorzugsweise keine Regulation auf Expressions- oder Proteinebene verstanden. Die reduzierte Regulation kann vorzugsweise durch einen im Nukleinsäurekonstrukt mit der kodierenden Sequenz funktioneil verknüpften Promotor erreicht werden, der in dem Organismus, verglichen mit dem Wildtyp-Promoter einer reduzierten Regulation unterliegt .
Beispielsweise unterliegt der mittlere ADH-Pro otor in Hefe nur eine reduzierten Regulation und ist daher insbesondere als Promotor im vorstehend beschriebenen Nukleinsäurekonstrukt bevor- zugt .
Dieses Promotorfragment des ADHl2s Promotors, im folgenden auch ÄDHl bezeichnet, zeigt eine annähernd konstitutive Expression (Ruohonen L, Penttila M, Keranen S. (1991) Optimization of Bacillus alpha-amylase production by Saccharomyces cerevisiae. Yeast. May-Jun;7(4) :337-462; Lang C, LoomanAC. (1995) Efficient expression and secretion of Aspergillus niger RH5344 poly- galacturonase in Saccharomyces cerevisiae. Appl Microbiol Bio- technol. Dec;44 (1-2) .-147-56. ) , so dass die transkriptioneile Regulation nicht mehr über Inter ediate der Ergosterolbiosynthese abläuft .
Weitere bevorzugte Promotoren mit reduzierter Regulation sind konstitutive Promotoren wie beispielsweise der TEFl-Promotor aus Hefe, der GPD-Promotor aus Hefe oder der PGK-Promotor aus Hefe (Mumberg D, Muller R, Funk M. (1995) Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995 Apr 1 ; 156 (1) : 119-22; Chen CY, Oppermann H, Hitzeman RA. (1984) Homologous versus heterologous gene expression in the yeast, Saccharomyces cerevisiae. Nucleic Acids Res. Dec 11; 12 (23) : 8951-70.) .
Die reduzierte Regulation kann in einer weiteren bevorzugten Ausführungsform dadurch erreicht werden, dass man als Nukleinsäure codierend eine HMG-CoA-Reduktase eine Nukleinsäure verwendet, deren Expression in dem Organismus, verglichen mit der Organismus eigenen, orthologen Nukleinsäure, einer reduzierten Regulation unterliegt .
Besonders bevorzugt ist die Verwendung einer Nukleinsäure, die nur den katalytischen Bereich der HMG-CoA-Reduktase kodiert (trunkierte (t-) HMG-CoA-Reduktase) als Nukleinsäure, codierend eine HMG-CoA-Reduktase. Diese in EP 486 290 und WO 99/16886 beschriebene Nukleinsäure (t-HMG) kodiert nur den katalytisch aktiven Teil der HMG-CoA-Reduktase, die für die Regulation auf Proteinebene verantwortliche Membran-Domäne fehlt . Diese Nukleinsäure unterliegt somit, insbesondere in Hefe, einer reduzierten Regulation und führt zu einer Erhöhung der Genexpression der HMG-CoA-Reduktase .
In einer besonders bevorzugten Ausführungsform bringt man Nukleinsäuren, vorzugsweise via vorstehend beschriebenes Nukleinsäurekonstrukt, ein, die Proteine kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 4 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 30 % auf Aminosäure- ebene mit der Sequenz SEQ. ID. NO. 4, und die die enzymatische Eigenschaft einer HMG-CoA-Reduktase aufweisen.
Die Sequenz SEQ. ID. NO. 4 stellt die Aminosäuresequenz der trunkierten HMG-CoA-Reduktase (t-HMG) dar.
Weitere Beispiele für HMG-CoA-Reduktasen und damit auch für die auf den katalytischen Bereich reduzierten t-HMG-CoA-Reduktasen bzw. die kodierenden Gene lassen sich beispielsweise aus verschiedenen Organismen deren genomische Sequenz bekannt ist durch Homologievergleiche der Aminosäuresequenzen oder der entsprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit der SeQ ID. NO. 4 leicht auffinden.
Weitere Beispiele für HMG-CoA-Reduktasen und damit auch für die auf den katalytischen Bereich reduzierten t-HMG-CoA-Reduktasen bzw. die kodierenden Gene lassen sich weiterhin beispielsweise ausgehend von der Sequenz SEQ. ID. No. 3 aus verschiedenen Organismen deren genomische Sequenz nicht bekannt ist, durch Hybridisierungs- und PCR-Techniken in an sich bekannter Weise leicht auffinden.
Besonders bevorzugt verwendet man eine Nukleinsäure, enthaltend die Sequenz SEQ. ID. NO. 3 als Nukleinsäure, kodierend eine trunkierte HMG-CoA-Reduktase.
In einer besonders bevorzugten Ausführungsform wird die reduzierte Regulation dadurch erreicht, dass man als Nukleinsäure kodierend eine HMG-CoA-Reduktase eine Nukleinsäure verwendet, deren Expression in dem Organismus, verglichen mit der Organismus eigenen, orthologen Nukleinsäure, einer reduzierten Regulation unterliegt und einen Promotor verwendet, der in dem Organismus, verglichen mit dem Wildtyp-Promoter einer reduzierten Regulation unterliegt.
Besonders bevorzugt ist ein Verfahren zur Herstellung von Zymosterol und/oder dessen Zwischen- und/oder Folgeprodukten in dem man einen Organismus verwendet, der zusätzlich zu einer erhöhten Lanosterol-C14-Demethylase- und HMG-CoA-Reduktase-Aktivität gegenüber dem Wildtyp eine erhöhte Squalenepoxidase-Aktivität aufweist .
Unter Squalenepoxidase-Aktivität wird die Enzymaktivität einer Squalenepoxidase verstanden.
Unter einer Squalenepoxidase wird ein Protein verstanden, das die enzymatische Aktivität aufweist, Squalen in Squalenepoxid umzuwandeln.
Dementsprechend wird unter Squalenepoxidase-Aktivität die in einer bestimmten Zeit durch das Protein Squalenepoxidase umgesetzte Menge Squalen bzw. gebildete Menge Squalenepoxid verstanden.
Bei einer erhöhten Squalenepoxidase-Aktivität gegenüber dem Wildtyp wird somit im Vergleich zum Wildtyp in einer bestimmten Zeit durch das Protein Squalenepoxidase die umgesetzte Menge Squalen bzw. die gebildete Menge Squalenepoxid erhöht.
Vorzugsweise beträgt diese Erhöhung der Squalenepoxidase- Aktivität mindestens 5 %, weiter bevorzugt mindestens 20 , weiter bevorzugt mindestens 50 %, weiter bevorzugt mindestens 100 %, bevorzugter mindestens 300 %, noch bevorzugter mindestens 500 %, insbesondere mindestens 600 % der Squalenepoxidase-Aktivität des Wildtyps .
Unter einem Wildtyp wird, wie vorstehend erwähnt, der ent- sprechende nicht genetisch veränderte Organismus verstanden.
In einer bevorzugten Ausführungsform erfolgt die Erhöhung der Squalenepoxidase-Aktivität gegenüber dem Wildtyp durch eine Erhöhung der Genexpression einer Nukleinsäure codierend eine Squalenepoxidase.
In einer weiter bevorzugten Ausführungsform erfolgt die Erhöhung der Genexpression einer Nukleinsäure codierend eine Squalenepoxidase durch Einbringen von einer oder mehrerer Nukleinsäuren codierend eine Squalenepoxidase in den Organismus.
Dazu kann prinzipiell jedes Squalenepoxidase-Gen (ERGl) , also jede Nukleinsäuren die eine Squalenepoxidase codiert, verwendet werden. Bei genomischen Squalenepoxidase-Nukleinsäure-Sequenzen aus eukaryontischen Quellen, die Introns enthalten, sind für den Fall dass der Wirtsorganismus nicht in der Lage ist oder nicht in die Lage versetzt werden kann, die entsprechenden Squalen- epoxidase zu exprimieren, bevorzugt bereits prozessierte Nuklein- säuresequenzen, wie die entsprechenden cDNAs zu verwenden.
Beispiele für Nukleinsäuren kodierend eine Squalenepoxidase sind Nukleinsäuren, codierend eine Squalenepoxidase aus Saccharomyces cerevisiae (Jandrositz, A. , et al (1991) The gene encoding squalene epoxidase from Saccharomyces cerevisiae: cloning and characterization. Gene 107:155-160, aus Mus musculus (Kosuga K, Hata S, Osu i T, Sakakibara J, Ono T. (1995) Nucleotide sequence of a cDNA for mouse squalene epoxidase, Biochim Biophys Acta, Feb 21,-1260 (3) :345-8b) , aus Rattus norvegicus (Sakakibara J, Watanabe R, Kanai Y, Ono T. (1995) Molecular cloning and expression of rat squalene epoxidase . J Biol Chem Jan 6; 270 (1) : 17-20c) oder aus Homo sapiens (Nakamura Y, Sakakibara J, Izumi T, Shibata A, Ono T. (1996) Transcriptional regulation of squalene epoxidase by sterols and inhibitors in HeLa cells., J. Biol. Chem. 1996, Apr 5 ; 271 (14) : 8053-6) .
In den erfindungsgemäßen transgenen Organismen liegt also in dieser bevorzugten Ausführungsform gegenüber dem Wildtyp mindestens ein weiteres Squalenepoxidase vor.
Die Anzahl der Squalenepoxidase-Gene in den erfindungsgemäßen transgenen Organismen beträgt mindestens zwei, vorzugsweise mehr als zwei, besonders bevorzugt mehr als drei, ganz besonders bevorzugt mehr als fünf .
Bevorzugt verwendet man im vorstehend beschriebenen Verfahren Nukleinsäuren, die Proteine kodieren, enthaltend die Amino- säuresequenz SEQ. ID. NO. 6 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 30 %, vorzugsweise mindestens 50 %, bevorzugter mindestens 70 %, noch bevorzugter mindestens 90 %, am bevorzugtesten mindestens 95 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 6, und die die enzy atische Eigenschaft einer Squalenepoxidase aufweisen.
Die Sequenz SEQ. ID. NO. 6 stellt die Aminosäuresequenz der Squalenepoxidase aus Saccharomyces cerevisiae dar.
Weitere Beispiele für Squalenepoxidasen und Squalenepoxidase-Gene lassen sich beispielsweise aus verschiedenen Organismen deren genomische Sequenz bekannt ist durch Homologievergleiche der Aminosäuresequenzen oder der entsprechenden rückübersetzten Nukleinsäuresequenzen aus Datenbanken mit der SeQ ID. NO. 6 leicht auffinden. Weitere Beispiele für Squalenepoxidase und Squalenepoxidase-Gene lassen sich weiterhin beispielsweise ausgehend von der Sequenz SEQ. ID. No. 5 aus verschiedenen Organismen deren genomische Sequenz nicht bekannt ist, durch Hybridisierungs- und PCR- Techniken in an sich bekannter Weise leicht auffinden.
In einer weiter bevorzugten Ausführungsform werden Nukleinsäuren in Organismen eingebracht, die Proteine kodieren, enthaltend die Aminosäuresequenz der Squalenepoxidase aus Saccharomyces cerevisiae) (SEQ. ID. NO. 6).
Geeignete Nukleinsäuresequenzen sind beispielsweise durch Rückübersetzung der Polypeptidsequenz gemäß dem genetischen Code erhältlich.
Bevorzugt werden dafür solche Codons verwendet, die entsprechend der organismusspezifischen codon usage häufig verwendet werden. Die codon usage lässt sich anhand von Computerauswertungen anderer, bekannter Gene der betreffenden Organismen leicht ermitteln.
Soll das Protein beispielsweise in Hefe exprimiert werden, so ist es häufig vorteilhaft, die codon usage der Hefe bei der Rückübersetzung zu verwenden.
In einer besonders bevorzugten Ausführungsform bringt man eine Nukleinsäure, enthaltend die Sequenz SEQ. ID. NO. 5 in den Organismus ein.
Die Sequenz SEQ. ID. NO. 5 stellt die genomische DNA aus
Saccharomyces cerevisiae (ORF S0003407) dar, die die Squalenepoxidase der Sequenz SEQ ID NO. 6 codiert.
Alle vorstehend erwähnten Squalenepoxidase-Gene sind weiter- hin in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen wie beispielsweise durch Fragmentkondensation einzelner überlappender, komplementärer Nukleinsäurebausteine der Doppelhelix herstellbar. Die chemische Synthese von Oligo- nukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoamiditmethode (Voet, Voet, 2. Auflage, Wiley Press
New York, Seite 896-897) erfolgen. Die Anlagerung synthetischer Oligonukleotide und Auffüllen von Lücken mit Hilfe des Klenow- Fragmentes der DNA-Polymerase und Ligationsreaktionen sowie allgemeine Klonierungsverfahren werden in Sambrook et al . (1989), Molecular cloning: A laboratory anual, Cold Spring Harbor Laboratory Press, beschrieben. Unter Organismen werden erfindungsgemäß beispielsweise Bakterien, insbesondere Bakterien der Gattung Bacillus , Bscherichia coli, Lactobacillus spec. oder Streptomyces spec. ,
beispielsweise Hefen, insbesondere Hefen der Gattung Saccharomyces cerecisiae, Pichia pastoris oder Klyveromyces spec.
beispielsweise Pilze, insbesondere Pilze der Gattung Aspergillus spec , Penicillium spec. oder Dictyostelium spec.
sowie beispielsweise auch Insektenzellinien verstanden, die in der Lage sind, als Wildtyp oder durch vorherige genetische Veränderung Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten herzustellen.
Besonders bevorzugte Organismen sind Hefen, insbesondere der Spezies Saccharomyces cerevisiae, insbesondere die Hefestämme Saccharomyces cerevisiae AH22, Saccharomyces cerevisiae GRF, Saccharomyces cerevisiae DBY747 und Saccharomyces cerevisiae BY4741.
Unter einem Wildtyp wird, wie vorstehend erwähnt, der entsprechende nicht genetisch veränderte Organismus verstanden. In Fällen in denen der Organismus oder der Wildtyp nicht eindeutig zuordenbar ist, wird vorzugsweise unter Wildtyp für die Erhöhung der Lanosterol-Cl4-Demethylase-Aktivität , die Erhöhung der HMG-CoA-Reduktase-Aktivität, die Erhöhung der Squalenepoxidase- Aktivität bzw. des Gehalts an Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten ein Referenz- Organismus verstanden. Dieser Referenzorganismus ist vorzugsweise der Hefestamm Saccharomyces cerevisiae AH22.
Die Bestimmung der Lanosterol-C14-Demethylase-Aktivität, der HMG-CoA-Reduktase-Aktivität und der Squalenepoxidase-Aktivität des erfindungsgemäßen genetisch veränderten Organismus sowie des Referenzorganismus erfolgt unter folgenden Bedingungen:
Die Bestimmung der Aktivität der HMG-CoA-Reduktase erfolgt wie in Th. Polakowski, Molekularbiologische Beeinflussung des Ergo- sterolstoffwechsels der Hefe Saccharomyces cerevisiae, Shaker- Verlag, Aachen 1999, ISBN 3-8265-6211-9, beschrieben.
Demgemäß werden 109 Hefe-Zellen einer 48 h alten Kultur durch Zentrifugation (3500xg, 5 min) geerntet und in 2 ml Puffer I (100 mM Kaliumphosphat-Puffer, pH7,0) gewaschen. Das Zellpellet wird in 500 μl Puffer 1 (cytosolische Proteine) oder 2 (100 mM Kaliumphosphat-Puffer pH 7,0; 1 % Triton X-100) (Gesamtproteine) aufgenommen, und es wird 1 μl 500 mM PMSF in Isopropanol zuge- gegeben. Zu den Zellen kommen 500 μl Glasperlen (d= 0,5 mm), und die Zellen werden durch 5x eine Minute Vortexen aufgeschlossen. Die Flüssigkeit zwischen den Glasperlen wird in ein neues Eppi überführt. Zellreste bzw. Membranbestandteile werden durch 15 min Zentrifugieren (14000 x g) abgetrennt. Der Überstand wird in ein neues Eppi überführt und stellt die Proteinfraktion dar.
Die Aktivität der HMG-CoA Aktivität wird durch Messung des Ver- brauchs von NADPH+H+ bei der Reduktion von 3-Hydroxy-3-methyl- glutaryl-CoA, das als Substrat zugesetzt wird, bestimmt.
In einem Testansatz von 1000 μl werden 20 μl Hefeproteinisolat mit 910 μl Puffer I; 50 μl 0,1 M DTT und 10 μl 16 mM NADPH+H+ gegeben. Der Ansatz ist auf 30°C temperiert und wird für 7,5 min bei 340 nm im Photometer gemessen. Die Abnahme an NADPH, die in diesem Zeitraum gemessen wird, ist die Abbaurate ohne Substratzugabe und wird als Hintergrund berücksichtigt.
Danach erfolgt die Zugabe von Substrat (10 μl 30 mM HMG-CoA), und es werden weitere 7,5 min gemessen. Die Berechnung der HMG-CoA- Reduktase Aktivität erfolgt durch die Bestimmung der spezifischen NADPH-Abbaurate .
Die Bestimmung der Aktivität der Lanosterol-C14-Demethylase-
Aktivität erfolgt wie in Oura, T and Sato, R. (1964) The carbon monoxide binding pigment in liver microsomes. J. Biol. Chem. 239, 2370-2378, beschrieben. Bei diesem Test ist die Menge an P450- Enzym als Holoenzym mit gebundenem Häm semi-quantifizierbar. Das (aktive) Holoenzym (mit Häm) kann durch CO reduziert werden und nur das CO-reduzierte Enzym weist ein Absorbtionsmaximum bei 450 nm auf. So ist das Absorbtionsmaximum bei 450 nm ein Maß für die Aktivität der Lanosterol-C14-Demethylase .
Zur Durchführung der Aktivitätsbestimmung wird eine Microsomen- Fraktion (4-10 mg/ml Protein in 100 mM Kaliumphosphat Puffer) 1:4 verdünnt, so dass die für den Test eingesetzte Protein Konzentration 2 mg/ml beträgt. Der Test wird direkt in einer Küvette durchgeführt .
Zu den Microsomen wird eine Spartelspitze Dithionite (Sθ4 a ) zugeben. Mit einem Spektralphotometer wird die Baselinie aufgenommen im Bereich von 380-500 nm. Anschließend werden ca. 20-30 Blasen von CO durch die Probe gesprudelt. Die Absorbtion wird nun im selben Bereich gemessen. Die Höhe der Absorbtion bei 450 nm entspricht dem Abteil an P450 Enzym im Testansatz. 5
Die Bestimmung der Aktivität der Squalen Epoxidase erfolgt wie in Leber R, Landl K, Zinser E, Ahorn H, Spok A, Kohlwein SD, Turnowsky F, Daum G. (1998) Dual localization of squalene epoxidase, Erglp, in yeast reflects a relationship between the 10 endoplasmic reticulum and lipid particles, Mol. Biol. Cell. 1998, Feb;9 (2) :375-86, beschrieben.
Diese Methode enthält 0,35 bis 0,7 mg microsomales Protein oder 3,5 bis 75 μg Lipidpartikel Protein in 100 mM Tris-HCl, pH 7,5, 15 1 mM EDTA, 0 , 1 mM FAD, 3 mM NADPH, 0 , 1 mM squalene 2, 3-epoxidase cyclase inhibitor U18666A, 32 μM [3H] Squalen dispergiert in 0,005 % Tween 80 in einem Gesamtvolumen von 500 μl.
Der Test wird bei 30°C durchgeführt. Nach einer Vorbehandlung für 20 10 min, wird die Reaktion durch Zugabe von Squalen gestartet und nach 15, 30 oder 45 min durch Lipid Extraktion mit 3 ml Chloroform/Methanol (2:1 vol/vol) und 750 μl 0,035 % MgCl beendet.
Die Lipide werden unter Stickstoff getrocknet und in 0,5 ml 25 Chloroform/Methanol (2:1 vol/vol) rückgelöst. Für eine
Dünnschicht Chromatographie werden Teile auf eine Silica Gel 60 Platte (0,2 mm) gegeben und mit Chloroform als Laufmittel aufgetrennt. Die Positionen, die [3H]2, 3-oxidosqualen und [3H] Squalene enthalten wurden ausgekratzt und mit einem 30 Szintilationszähler quantifiziert.
Unter den biosynthetischen Zwischenprodukten des Zymosterols, werden alle Verbindungen verstanden, die im verwendeten Organismus bei der Biosynthese von Zymosterol als Zwischen- 35 produkte auftreten, vorzugsweise die Verbindungen Mevalonat, Farnesylpyrophosphat, Geraniolpyrophosphat, Squalenepoxid, 4-Dimethylcholesta-8, 14,24-trienol, 4,4 Dirn thylzymosterol, Squalen, Farnesol, Geraniol, Lanosterol und Zymosteron.
40 Unter den biosynthetischen Folgeprodukten des Zymosterols werden alle Verbindungen verstanden, die sich im verwendeten Organismus biosynthetisch von Zymosterol ableiten, d.h. , bei denen Zymosterol als Zwischenprodukt auftritt . Dies können Verbindungen sein, die der verwendete Organismus natürlicherweise aus Zymo-
45 sterol herstellt, wie beispielsweise 4, 4-Dimethylzymosterol, 4-Methylzymosterol, Fecosterol, Ergost-7-enol, Episterol, Ergosta-5, 7-dienol, insbesondere Sterole mit 5,7-Dienstruktur in Hefe und Pilzen. Es werden aber auch Verbindungen verstanden, die erst durch Einbringen von Genen und Enzymaktivitäten aus anderen Organismen, zu denen der Ausgangsorganismus kein ortho- loges Gen aufweist, im Organismus aus Zymosterol hergestellt werden können.
Beispielsweise können durch Einbringen von Säugergenen in Hefe, Folgeprodukte aus Zymosterol hergestellt werden, die natürlich nur in Säugern vorkommen:
Das Einbringen von beispielsweise humanen oder murinen Nukleinsäuren, kodierend eine humane oder murine Sterol-delta-8- delta-7-Isomerase und eine humane oder murine Delta-5-Desaturase in Hefe führt zur Produktion von Cholesta-7, 24-dienol, Cholesta- 5,7, 24-trienol, Lathosterol und/oder Cholesta-5, 7-dienol (Provitamin D3 ) .
Durch Einbringen einer weiteren humanen oder murinen Nukleinsäure, kodierend eine humane oder murine Delta-7-Reduktase wird die Hefe in die Lage versetzt Cholesterol zu produzieren.
Unter den biosynthetischen Folgeprodukten des Zymosterols werden daher insbesondere Fecosterol, Episterol, Ergosta-5, 7-dienol, Ergosterol, Cholesta-7, 24-dienol, Cholesta-5, 7,24-trienol, Latho- sterol, Cholesta-5, 7-dienol (Provitamin D3) und/oder Cholesterol verstanden.
Bevorzugte biosynthetische Folgeprodukte sind Ergosterol, Lathosterol und/oder Cholesta-5, 7-dienol (Provitamin D3).
Zur weiteren Steigerung des Gehalts an Folgeprodukten des Zymosterols ist es zusätzlich vorteilhaft, abfließende Stoffwechsel- wege, also Biosynthesewege die nicht zum gewünschten Produkt führen, zu unterdrücken.
Beispielsweise ist es bei vorstehend beschriebener Herstellung von Säuger-Sterolen die sich von Zymosterol ableiten in Hefen vorteilhaft, zusätzlich zur erfindungsgemäßen Aktivitätserhöhung der Lanosterol-C14-Demethylase und HMG-CoA-Reduktase sowie gegebenenfalls der nachstehend beschriebenen Squalenepoxidase, den natürlichen Biosyntheseweg in Hefe von Zymosterol zu Ergosterol zu unterdrücken oder zu unterbrechen, beispielsweise durch Ausschalten oder Deletion der ERG6 (C-24-Methyltransferase) oder ERG5 (Delta22-Reduktase) in Hefe, vorzugsweise durch Ausschalten oder Deletion von ERG6 und ERG5. Die im erfindungsgemäßen Verfahren hergestellten Verbindungen können in Biotransformationen, chemischen Reaktionen und zu therapeutischen Zwecken verwendet werden, beispielsweise zur Gewinnung von Vitamin D aus Ergosterol über UV-Bestrahlung, Gewinnung von Vitamin D3 aus Cholesta-5, 7-dienol (Provitamin D3) über UV-Bestrahlung, oder zur Gewinnung von Steroidhormonen über Biotransformation ausgehend von Ergosterol.
Im erfindungsgemäßen Verfahren zur Herstellung von Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten wird vorzugsweise dem Kultivierungsschritt der genetisch veränderten Organismen, im folgenden auch transgene Organismen bezeichnet, ein Ernten der Organismen und ein Isolieren von Zymosterol und/ oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten aus den Organismen angeschlossen.
Das Ernten der Organismen erfolgt in an sich bekannter Weise dem jeweiligen Organismus entsprechend. Mikroorganismen, wie Bakterien, Moose, Hefen und Pilze oder Pflanzenzellen, die durch Fermentation in flüssigen Nährmedien kultiviert werden, können beispielsweise durch Zentrifugieren, Dekantieren oder Filtrieren abgetrennt werden.
Die Isolierung von Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten aus der geernteten Biomasse erfolgt gemeinsam oder jede Verbindung für sich in an sich bekannter Weise, beispielsweise durch Extraktion und gegebenenfalls weiterer chemische oder physikalischer Reinigungsprozesse, wie beispielsweise Fällungsmethoden, Kristallographie, thermische Trennverfahren, wie Rektifizierverfahren oder physikalische Trennverfahren, wie beispielsweise Chromatographie.
Die Herstellung der transgenen Organismen, insbesondere Hefen erfolgt vorzugsweise durch Transformation der Ausgangsorganismen, insbesondere Hefen, entweder mit einem Nukleinsäurekonstrukt, das die vorstehend beschriebenen Nukleinsäuren codierend eine Lano- sterol-C14-Demethylase und eine HMG-CoA-Reduktase enthält, die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Organismen gewähr- leisten oder durch kombinierte Transformation der Ausgangsorganismen, insbesondere Hefen, mit mindestens zwei Nukleinsäurekonstrukt, wobei ein Nukleinsäurekonstrukt die vorstehend beschriebenen Nukleinsäuren codierend eine Lanosterol-C14- Demethylase und ein zweites Nukleinsäurekonstrukt die vorstehend beschriebenen Nukleinsäuren codierend eine HMG-CoA-Reduktase enthält und diese jeweils mit einem oder mehreren Regulations- Signalen funktionell verknüpft sind, die die Transkription und Translation in Organismen gewährleisten.
Nukleinsäurekonstrukte, in denen die kodierende Nukleinsäure- sequenz mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Organismen, insbesondere in Hefen gewährleisten, werden im folgenden auch Expressionskassetten genannt.
Nukleinsäurekonstrukte enthaltend diese Expressionskassette sind beispielsweise Vektoren oder Plasmide.
Dementsprechend betrifft die Erfindung ferner Nukleinsäurekonstrukte, insbesondere als Expressionskassette fungierende Nukleinsäurekonstrukte, enthaltend Nukleinsäuren kodierend eine Lanosterol-C14-Demethylase und Nukleinsäuren kodierend eine HMG- CoA-Reduktase, die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Organismen, insbesondere in Hefen gewährleisten.
In einer bevorzugten Ausführungsform umfasst dieses Nukleinsäurekonstrukt zusätzlich Nukleinsäuren, kodierend eine Squalenepoxidase, die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Organismen, insbesondere in Hefen gewährleisten.
Alternativ können die erfindungsgemäßen transgenen Organismen auch durch Transformation mit einer Kombination aus Nukleinsäure- konstrukten hergestellt werden, wobei die Kombination
a) ein erstes Nukleinsäurekonstrukt, enthaltend Nukleinsäuren codierend eine Lanosterol-C14-Demethylase, die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Organismen gewährleisten und
b) zweites Nukleinsäurekonstrukt, enthaltend Nukleinsäuren kodierend eine HMG-COA-Reduktase, die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Organismen gewährleisten umfasst. In einer bevorzugten Ausführungsform umfasst die Kombination
c) noch ein weiteres, drittes Nukleinsäurekonstrukt, enthaltend Nukleinsäuren codierend eine Squalenepoxidase, die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Organismen gewährleisten umfasst.
Vorzugsweise enthalten die Regulationssignale einen oder mehrere Promotoren, die die Transkription und Translation in Organismen, insbesondere in Hefen gewährleisten.
Die Expressionskassetten beinhalten Regulationssignale, also regulative Nukleinsäuresequenzen, welche die Expression der kodierenden Sequenz in der Wirtszelle steuern. Gemäß einer bevorzugten Ausführungsform umfasst eine Expressionskassette stromaufwärts, d.h. am 5 '-Ende der kodierenden Sequenz, einen Promotor und stromabwärts, d.h. am 3 '-Ende einen Terminator und gegebenenfalls weitere regulatorische Elemente, welche mit der dazwischen- liegenden kodierenden Sequenz für mindestens eines der vorstehend beschriebenen Gene operativ verknüpft sind.
Unter einer operativen Verknüpfung versteht man die sequenzielle Anordnung von Promotor, kodierender Sequenz, Terminator und ggf. weiterer regulativer Elemente derart, dass jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann.
Im folgenden werden beispielhaft die bevorzugten Nukleinsäure- konstrukte, Expressionskassetten und Plasmide für Hefen und
Pilze und Verfahren zur Herstellung von transgenen Hefen, sowie die transgenen Hefen selbst beschrieben.
Als Promotoren der Expressionskassette ist grundsätzlich jeder Promotor geeignet, der die Expression von Fremdgenen in Organismen, insbesondere in Hefen steuern kann.
Vorzugsweise verwendet man insbesondere einen Promotor, der in der Hefe einer reduzierten Regulation unterliegt, wie beispiels- weise der mittlere ADH-Promotor.
Dieses Promotorfragment des ADHl2s Promotors, im folgenden auch ADH1 bezeichnet, zeigt eine annähernd konstitutive Expression (Ruohonen L, Penttila M, Keranen S. (1991) Optimization of Bacillus alpha-amylase production by Saccharomyces cerevisiae. Yeast. May-Jun;7(4) :337-462; Lang C, LoomanAC. (1995) Efficient expression and secretion of Aspergillus niger RH5344 poly- galacturonase in Saccharomyces cerevisiae. Appl Microbiol Bio- technol. Dec; 44 (1-2) : 147-56. ) , so dass die transkriptioneile Regulation nicht mehr über Intermediate der Ergosterolbiosynthese abläuft .
Weitere bevorzugte Promotoren mit reduzierter Regulation sind konstitutive Promotoren wie beispielsweise der TEFl-Promotor aus Hefe, der GPD-Promotor aus Hefe oder der PGK-Promotor aus Hefe (Mumberg D, Muller R, Funk M. (1995) Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995 Apr 14; 156 (1) :119-22; Chen CY, Oppermann H, Hitzeman RA. (1984) Homologous versus heterologous gene expression in the yeast, Saccharomyces cerevisiae. Nucleic Acids Res. Dec 11; 12 (23) : 8951-70.) .
Die Expressionskassette kann auch induzierbare Promotoren, insbesondere chemisch induzierbaren Promotor enthalten, durch den die Expression des Lanosterol-C14-Demethylase-Gens, des HMG-CoA- Reduktase-Gens oder des Squalenepoxidase-Gens im Organismus zu einem bestimmten Zeitpunkt gesteuert werden kann.
Derartige Promotoren wie beispielsweise der Cupl-Promotor aus Hefe (Etcheverry T. (1990) Induced expression using yeast copper metallothionein promoter. Methods Enzymol. 1990;185:319-29.), der Gall-10-Promotor aus Hefe (Ronicke V, Graulich W, Mumberg D, Muller R, Funk M. (1997) Use of conditional Promoters for expression of heterologous proteins in Saccharomyces cerevisiae, Methods Enzymol.283 : 313-22) oder der Pho5-Promotor aus Hefe (Bajwa W, Rudolph H, Hinnen A. (1987) PH05 upstream sequences confer phosphate control on the constitutive PH03 gene. Yeast. 1987 Mar;3 (1) -.33-42) können beispielsweise benutzt werden.
Als Terminator der Expressionskassette ist grundsätzlich jeder Terminator geeignet, der die Expression von Fremdgenen in Organismen, insbesondere in Hefen steuern kann.
Bevorzugt ist der Tryptophan-Terminator aus Hefe (TRPl-Termina- tor) .
Die Herstellung einer Expressionskassette erfolgt vorzugsweise durch Fusion eines geeigneten Promotors mit den vorstehend beschriebenen Nukleinsäuren kodierend eine Lanosterol-C14- Demethylase, eine HMG-CoA-Reduktase und/oder eine Squalenepoxidase und einem Terminator nach gängigen Rekombinations- und Klonierungstechniken, wie sie beispielsweise in T. Maniatis, E.F. Fritsch und J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) sowie in T.J. Silhavy, M.L. Berman und L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) und in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987) beschrieben sind.
Die erfindungsgemäßen Nukleinsäuren können synthetisch hergestellt oder natürlich gewonnen sein oder eine Mischung aus synthetischen und natürlichen Nukleinsäure-Bestandteilen ent- halten, sowie aus verschiedenen heterologen Genabschnitten verschiedener Organismen bestehen.
Bevorzugt sind, wie vorstehend beschrieben, synthetische Nukleotid-Sequenzen mit Kodons, die von Hefen bevorzugt werden. Diese von Hefen bevorzugten Kodons können aus Kodons mit der höchsten Proteinhäufigkeit bestimmt werden, die in den meisten interessanten Hefespezies exprimiert werden.
Bei der Präparation einer Expressionskassette können verschiedene DNA-Fragmente manipuliert werden, um eine Nukleotid-Sequenz zu erhalten, die zweckmäßigerweise in der korrekten Richtung liest und die mit einem korrekten Leseraster ausgestattet ist. Für die Verbindung der DNA-Fragmente miteinander können an die Fragmente Adaptoren oder Linker angesetzt werden.
Zweckmäßigerweise können die Promotor- und die Terminator- Regionen in Transkriptionsrichtung mit einem Linker oder Polylinker, der eine oder mehrere Restriktionssteilen für die Insertion dieser Sequenz enthält, versehen werden. In der Regel hat der Linker 1 bis 10, meistens 1 bis 8, vorzugsweise 2 bis 6 Restriktionsstellen. Im allgemeinen hat der Linker innerhalb der regulatorischen Bereiche eine Größe von weniger als 100 bp, häufig weniger als 60 bp, mindestens jedoch 5 bp. Der Promotor kann sowohl nativ bzw. homolog als auch fremdartig bzw. heterolog zum Wirtsorganismus sein. Die Expressionskassette beinhaltet vorzugsweise in der 5 ' -3 ' -Transkriptionsrichtung den Promotor, eine kodierende Nuklemsäuresequenz oder ein Nukleinsäurekonstrukt und eine Region für die transkriptionale Termination. Verschiedene Terminationsbereiche sind gegeneinander beliebig austauschbar.
Ferner können Manipulationen, die passende Restriktionsschnittstellen bereitstellen oder die überflüssige DNA oder Restriktionsschnittstellen entfernen, eingesetzt werden. Wo Insertionen, Deletionen oder Substitutionen wie z.B. Transitionen und Transversionen in Frage kommen, können in vitro-Mutagenese, "primerrepair" , Restriktion oder Ligation verwendet werden. Bei geeigneten Manipulationen, wie z.B. Restriktion, "chewing- back" oder Auffüllen von Überhängen für "bluntends", können komplementäre Enden der Fragmente für die Ligation zur Verfügung gestellt werden.
Ferner betrifft die Erfindung die Verwendung der vorstehend beschriebenen Nukleinsäuren, der vorstehend beschriebenen Nukleinsäurekonstrukte oder der vorstehend beschriebenen Proteine zur Herstellung von transgenen Organismen, insbesondere Hefen.
Vorzugsweise weisen diese transgenen Organismen, insbesondere Hefen gegenüber dem Wildtyp einen erhöhten Gehalt an Zymosterol und /oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten auf .
Daher betrifft die Erfindung ferner die Verwendung der vorstehend beschriebenen Nukleinsäuren oder der erfindungsgemäßen Nukleinsäurekonstrukte zur Erhöhung des Gehalts an Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten in Organismen, die als Wildtyp oder durch genetische Manipulation in der Lage sind, Zymosterol und/oder dessen biosynthetische Zwischen- und/oder Folgeprodukte zu produzieren.
Die vorstehend beschriebenen Proteine und Nukleinsäuren können zur Herstellung von Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten in transgenen Organsimen verwendet werden.
Die Übertragung von Fremdgenen in das Genom eines Organismus, insbesondere von Hefe wird als Transformation bezeichnet.
Dazu können insbesondere bei Hefen an sich bekannte Methoden zur Transformation genutzt werden.
Geeignete Methoden zur Transformation von Hefen sind beispielsweise die LiAC-Methode, wie in Schiestl RH, Gietz RD. (1989) High efficiency transformation of intact yeast cells using Single stranded nucleic acids as a carrier, Curr Genet. Dec,-16 (5-6) :339-46, beschrieben, die Elektroporation wie in Manivasakam P, Schiestl RH. (1993) High efficiency transformation of Saccharomyces cerevisiae by electroporation. Nucleic Acids Res . Sep 11;21 (18) : 4414-5 , beschrieben oder die Protoplasierung, wie in Morgan AJ. (1983) Yeast strain improvement by proto- plast fusion and transformation, Experientia Suppl. 46:155-66 beschrieben. Vorzugsweise wird das zu exprimierende Konstrukt in einen Vektor, insbesondere in Plasmide kloniert, die geeignet sind, Hefen zu transformieren, wie beispielsweise die Vektorsysteme Yep24 (Naumovski L, Friedberg EC (1982) Molecular cloning of eucaryotic genes required for excision repair of UV-irradiated DNA: iso- lation and partial characterization of the RAD3 gene of Saccharomyces cerevisiae. J Bacteriol Oct; 152 (1) :323-31) , Yepl3 (Broach JR, Strathern JN, Hicks JB. (1979) Transformation in yeast: development of a hybrid cloning vector and isolation of the CANl gene. Gene. 1979 Dec;8 (1) : 121-33) , die pRS-Serie von Vektoren (Centromer und Episomal) (Sikorski RS, Hieter P. (1989) A System of Shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics . May; 122 (1) : 19-27) sowie die Vektorsysteme Ycpl9 oder pYEXBX.
Dementsprechend betrifft die Erfindung weiterhin Vektoren, insbesondere Plasmide enthaltend die vorstehend beschriebenen Nukleinsäuren, Nukleinsäurekonstrukte oder Expressionskassetten.
Die Erfindung betrifft ferner ein Verfahren zur Herstellung von genetisch veränderten Organismen indem man eine vorstehend beschriebene Nukleinsäure oder ein vorstehend beschriebenes Nukleinsäurekonstrukt in den Ausgangsorganismus funktionell einführt .
Die Erfindung betrifft ferner die genetisch veränderten Organismen, wobei die genetische Veränderung die Aktivität einer Lanosterol-C14-Demethylase und einer HMG-CoA-Reduktase gegenüber einem Wildtyp erhöht.
Vorzugsweise erfolgt die Erhöhung der Lanosterol-C14-Demethylase- Aktivität, wie vorstehend erwähnt durch eine Erhöhung der Genexpression einer Nukleinsäure codierend eine Lanosterol-Cl4- Demethylase gegenüber dem Wildtyp.
Vorzugsweise erfolgt die Erhöhung der Genexpression einer Nukleinsäure codierend eine Lanosterol-C14-Demethylase gegenüber dem Wildtyp durch Erhöhung der Kopienzahl der Nukleinsäure kodierend eine Lanosterol-C14-Demethylase im Organismus.
Dementsprechend betrifft die Erfindung bevorzugt einen vorstehend beschriebenen genetisch veränderten Organismus der zwei oder mehr Nukleinsäuren codierend eine Lanosterol-Cl4-Demethylase enthält. In einer bevorzugten Ausführungsform erfolgt die Erhöhung der HMG-CoA-Reduktase-Aktivität gegenüber dem Wildtyp, wie vorstehend erwähnt durch eine Erhöhung der Genexpression einer Nukleinsäure codierend eine HMG-CoA-Reduktase.
In einer besonders bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens erfolgt die Erhöhung der Genexpression einer Nukleinsäure codierend eine HMG-CoA-Reduktase indem man ein Nukleinsäurekonstrukt, enthaltend eine Nukleinsäure codierend eine HMG-CoA-Reduktase in den Organismus einbringt, deren Expression in dem Organismus, verglichen mit dem Wildtyp, einer reduzierten Regulation unterliegt.
Die Erfindung betrifft dementsprechend einen vorstehend beschriebenen genetisch veränderten Organismus, der ein Nukleinsäurekonstrukt enthält, enthaltend eine Nukleinsäure codierend eine HMG-CoA-Reduktase, deren Expression in dem Organismus verglichen mit dem Wildtyp einer reduzierten Regulation unterliegt.
In dieser bevorzugten Ausführungsform betrifft die Erfindung insbesondere einen vorstehend beschriebenen genetisch veränderter Organismus, dadurch gekennzeichnet dass das Nukleinsäurekonstrukt einen Promotor enthält, der in dem Organismus verglichen mit dem Wildtyp einer reduzierten Regulation unterliegt und/oder dass man als Nukleinsäure codierend eine HMG-CoA-Reduktase eine Nukleinsäure verwendet, die nur den katalytischen Bereich der HMG-CoA- Reduktase kodiert .
Besonders bevorzugt sind vorstehend erwähnte, genetisch ver- änderte Organismen bei denen die genetische Veränderung zusätzlich die Squalenepoxidase-Aktivität gegenüber einem Wildtyp erhöht .
Vorzugsweise erfolgt die Erhöhung der Squalenepoxidase-Aktivität, wie vorstehend erwähnt durch eine Erhöhung der Genexpression einer Nukleinsäure codierend eine Squalenepoxidase gegenüber dem Wildtyp.
Vorzugsweise erfolgt die Erhöhung der Genexpression einer Nukleinsäure codierend eine Squalenepoxidase gegenüber dem Wildtyp durch Erhöhung der Kopienzahl der Nukleinsäure codierend eine Squalenepoxidase im Organismus.
Dementsprechend betrifft die Erfindung bevorzugt einen vorstehend beschriebenen genetisch veränderten Organismus der zwei oder mehr Nukleinsäuren codierend eine Squalenepoxidase enthält . Die vorstehend beschriebenen genetisch veränderten Organismen weisen gegenüber dem Wildtyp einen erhöhten Gehalt an Zymosterol und/oder dessen biosynthetisσhen Zwischen- und/oder Folgeprodukten auf.
Dementsprechend betrifft die Erfindung einen vorstehend beschriebenen genetisch veränderten Organismus, dadurch gekennzeichnet, dass der genetisch veränderte Organismus gegenüber dem Wildtyp einen erhöhten Gehalt an Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten aufweist.
Bevorzugte, genetisch veränderte Organismen sind erfindungsgemäß genetisch veränderte Hefen oder Pilze, insbesondere erfindungsgemäß genetisch veränderte Hefen, insbesondere die erfindungs- gemäß genetisch veränderte Hefespezies Saccharomyces cerevisiae, insbesondere die genetisch veränderten Hefestämme Saccharomyces cerevisiae AH22, Saccharomyces cerevisiae GRF, Saccharomyces cerevisiae DBY747 und Saccharomyces cerevisiae BY4741.
Erhöhung des Gehaltes an Zymosterol und/oder dessen biosynthetischen Zwischen und/oder Folgeprodukten bedeutet im Rahmen der vorliegenden Erfindung vorzugsweise die künstlich erworbene Fähigkeit einer erhöhten Biosyntheseleistung mindestens einer dieser, eingangs erwähnten Verbindungen in dem genetisch veränderten Organsimus gegenüber dem nicht genetisch veränderten Organismus .
Unter Wildtyp wird dementsprechend, wie eingangs erwähnt, vorzugsweise der genetisch nicht veränderte Organismus, insbesondere aber der eingangs erwähnte ReferenzOrganismus verstanden.
Unter einem erhöhten Gehalt an Zymosterol und/oder dessen biosynthetischen Zwischen und/oder Folgeprodukten im Vergleich zum Wildtyp wird insbesondere die Erhöhung des Gehaltes mindestens einer der vorstehend erwähnten Verbindungen im Organismus um mindestens 50 %, vorzugsweise 100 %, bevorzugter 200 %, besonders bevorzugt 400 % im Vergleich zum Wildtyp verstanden.
Die Bestimmung des Gehalts an mindestens einer der erwähnten Verbindungen erfolgt vorzugsweise nach an sich bekannten analytischen Methoden und bezieht sich vorzugsweise auf die Kompartimente des Organismus in denen Sterole produziert werden. Die vorliegende Erfindung weist gegenüber dem Stand der Technik folgenden Vorteil auf:
Durch das erfindungsgemäße Verfahren ist es möglich, den Gehalt an Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten in den' ProduktionsOrganismen zu steigern ohne den Weg zu anderen Folgeprodukten zu unterdrücken und damit das Verbindungsportfolio einzuschränken. Bei gewünschter Produktion spezifischer Verbindungen liefert die Unterdrückung oder Unterbrechung unerwünschter Stoffwechselwege eine zusätzliche Steigerung des Gehalts an gewünschtem Produkt.
Die Erfindung wird durch die nun folgenden Beispiele erläutert, ist aber nicht auf diese beschränkt:
Allgemeine experimentelle Bedingungen
1. Restriktion
Die Restriktion der Plasmide (1 bis 10 μg) wurde in 30μl Ansätzen durchgeführt. Dazu wurde die DNA in 24 μl
H0 aufgenommen, mit 3 μl des entsprechenden Puffers, 1 ml RSA (Rinderserumalbumin) und 2 μl Enzym versetzt. Die Enzymkonzentration betrug 1 Unit/μl oder 5 Units/μl je nach DNA Menge. In einigen Fällen wurde dem Ansatz noch 1 μl RNase zugegeben, um die tRA abzubauen. Der
Restriktionsansatz wurde für zwei Stunden bei 3 °C inkubiert . Konrolliert wurde die Restriktion mit einem Minigel .
2. Gelelektrophoresen
Die Gelelektrophoresen wurden in Minigel- oder Wide- Minigelapparaturen durchgeführt. Die Minigele (ca. 20 ml, 8 Taschen) und die Wide-Minigele (50 ml, 15 oder 30 Taschen) bestanden aus l%iger Agarose in TAE. Als Laufpuffer wurde 1 x TAE verwendet. Die Proben (10 μl) wurden mit 3 μl Stopperlosung versetzt und aufgetragen. Als Standard diente I-DNA geschnitten mit Hindlll (Banden bei: 23,1 kb; 9,4 kb; 6,6 kb; 4,4 kb; 2,3 kb; 2,0 kb; 0,6 kb). Zur Auftrennung wurde eine Spannung von 80 V für 45 bis 60 min angelegt. Danach wurde das Gel in Ethidiumbromidlosung angefärbt und unter UV-Licht mit dem Video-Dokumentationssystem INTAS festgehalten oder mit einem Orange-Filter fotografiert . 3. Gelelution
Mittels Gelelution wurden die gewünschten Fragmente isoliert. Der Restriktionsansatz wurde auf mehrere Taschen eines Minigels aufgetragen und aufgetrennt. Nur λ-Hindlll und eine "Opferspur" wurden in Ethidium- bromidlösung angefärbt, unter UV-Licht betrachtet und das gewünschte Fragment markiert. Dadurch wurde verhindert, dass die DNA der restlichen Taschen durch das Ethidiumbromid und das UV-Licht geschädigt wird. Durch Aneinanderlegen des gefärbten und ungefärbten Gelstücks konnte anhand der Markierung das gewünschte Fragment aus dem ungefärbten Gelstück herausgeschnitten werden. Das Agarosestück mit dem zu isolierenden Fragment wurde in einen Dialyseschlauch gegeben, mit wenig TAE-Puffer luftblasenfrei verschlossen und in die BioRad-Minigel- apparatur gelegt. Der Laufpuffer bestand aus 1 x TAE und die Spannung betrug 100 V für 40 min. Danach wurde für 2 min die Strompolaritat gewechselt, um am Dialyseschlauch klebende DNA wieder zu lösen. Der die DNA- Fragmente enthaltende Puffer des Dialyseschlauches wurde in Reaktionsgefäße überführt und damit eine Ethanolfällung durchgeführt. Dazu wurde der DNA-Losung 1/10 Volumen an 3 M Natriumacetat, tRNA (1 μl pro 50 μl Lösung) und dem 2,5fachem Volumen an eiskaltem 96%igem Ethanol zugegeben. Der Ansatz wurde 30 min bei -20°C inkubiert und dann bei 12000 rpm, 30 min, 4°C abzentri- fugiert. Das DNA-Pellet wurde getrocknet und in 10 bis 50 μl H0 (je nach DNA-Menge) aufgenommen.
4. Klenow-Behandlung
Durch die Klenow-Behandlung werden überstehende Enden von DNA-Fragmenten aufgefüllt, so dass "blunt-ends" entstehen. Pro 1 μg DNA wurde folgender Ansatz zusammenpipettiert :
DNA-Pellet + 11 μl H20
+ 1,5 μl 10 x Klenow Puffer
+ 1 μl 0,1 M DTT
+ 1 μl Nucleotide (dNTP 2 mM)
25 + 1 μl Klenow-Polymerase (1 Unit/μl)
Die DNA sollte dabei aus einer Ethanolfällung stammen, um zu verhindern, dass Verunreinigungen die Klenow- Polymerase hemmen. Die Inkubation erfolgte für 30 min bei 37°C, durch weitere 5 min bei 70°C wurde die
Reaktion abgestoppt. Die DNA wurde aus dem Ansatz durch eine Ethanolfällung gewonnen und in 10 μl H20 aufgenommen.
5. Ligation Die zu ligierenden DNA-Fragmente wurden vereinigt.
Das Endvolumen von 13,1 μl enthielt ca. 0,5 μl DNA mit einem Vektor-Insert Verhältnis von 1:5. Die Probe wurde 45 Sekunden bei 70°C inkubiert, auf Raumtemperatur abgekühlt (ca. 3 min) und dann 10 min auf Eis inkubiert. Danach wurden die Ligationspu fer zugegeben: 2,6 μl 500 mM TrisHCl pH 7,5 und 1,3 μl 100 mM MgCl und weitere 10 min auf Eis inkubiert. Nach der Zugabe von 1 μl 500 mM DTT und 1 μl 10 mM ATP und nochmaligen 10 min auf Eis wurde 1 μl Ligase (1 Unit/pl) zugegeben. Die ganze Behandlung sollte möglichst erschütterungsfrei erfolgen, um aneinander- liegende DNA-Enden nicht wieder zu trennen. Die Ligation erfolgte über Nacht bei 14°C.
6. E. coli-Transformation
Kompetente Escherichia coli (E. coli) NM522 Zellen wurden mit der DNA des Ligationsansatzes transformiert. Als Positiv-Kontrolle lief ein Ansatz mit 50 μg des pScL3 Plasmids und als Null-Kontrolle ein Ansatz ohne DNA mit. Für jeden Transformationsansatz wurden
100 μl 8 % PEG-Losung, 10 μl DNA und 200 μl kompetente Zellen (E. coli NM522) in ein Tischzentrifugenröhrchen pipettiert. Die Ansätze wurden für 30 min in Eis gestellt und gelegentlich geschüttelt. Danach erfolgte der Hitzeschock: 1 min bei 42°C.
Für die Regeneration wurde den Zellen 1 ml LB-Medium zugegeben und für 90 min bei 37°C auf einem Schüttler inkubiert. Je 100 μl der unverdünnten Ansätze, einer 1:10 Verdünnung und einer 1:100 Verdünnung wurden auf LB + Ampicillin-Platten ausplattiert und über Nacht bei
37°C bebrütet.
7. Plasmid-Isolation aus E. coli (Minipräp)
E. coli-Kolonien wurden über Nacht in 1,5 ml LB + Ampi- cillin-Medium in Tischzentrifugenröhrchen bei 37°C und
120 rpm angezogen. Am nächsten Tag wurden die Zellen 5 min bei 5000 rpm und 4°C abzentrifugiert und das Pellet in 50 μl TE-Puffer aufgenommen. Jeder Ansatz wurde mit 100 μl 0,2 N NaOH, 1 % SDS-Lösung versetzt, gemischt und für 5 min auf Eis gestellt (Lyse der
Zellen) . Danach wurden 400 μl Na-Acetat/NaCl-Losung (230 μl H0, 130 μl 3 M Natriumacetat, 40 μl 5M NaCl) zugegeben, der Ansatz gemischt und für weitere 15 min auf Eis gestellt (Proteinfällung) . Nach 15 minütiger Zentrifugation bei 11000 rpm wurde der Überstand, der die Plasmid-DNA enthält, in ein Eppendorfgefäß über- führt. War der Überstand nicht vollständig klar, wurde nochmal zentrifugiert . Der Überstand wurde mit 360 μl eisgekühltem Isopropanol versetzt und für 30 min bei -20°C inkubiert (DNA-Fällung) . Die DNA wurde abzentri- fugiert (15 min, 12000 rpm, 4°C) , der überstand ver- worfen, das Pellet in 100 μl eisgekühltem 96 %igem
Ethanol gewaschen, 15 min bei -20°C inkubiert und erneut abzentrifugiert (15 min, 12000 rpm, 4°C) . Das Pellet wurde im Speed Vac getrocknet und dann in 100 μl H0 aufgenommen. Die Plasmid DNA wurde durch Restriktionsanalyse charakterisiert. Dazu wurden 10 μl jedes Ansatzes restringiert und in einem Wide-Minigel gelelektrophoretisch aufgetrennt (siehe oben) .
8. Plasmid-Aufarbeitung aus E. coli (Maxipräp) Um größere Mengen an Plasmid-DNA zu isolieren, wurde die Maxipräp Methode durchgeführt. Zwei Kolben mit 100 ml LB + Ampicillin-Medium wurden mit einer Kolonie bzw. mit 100 μl einer Gefrierkultur, die das zu isolierende Plasmid trägt, angeimpft und über Nacht bei 37°C und 120 rpm bebrütet. Die Anzucht (200 ml) wurde am nächsten Tag in einen GSA-Becher überführt und bei 4000 rpm (2600 x g) 10 min zentrifugiert. Das Zellpellet wurde in 6 ml TE-Puffer aufgenommen. Zum Abdau der Zellwand wurden 1,2 ml Lysozymlosung (20 mg/ml TE-Puffer) zugegeben und 10 min bei Raumtemperatur inkubiert. Anschließend erfolgte die Lyse der Zellen mit 12 ml 0,2 N NaOH, 1 % SDS Lösung und weiteren 5 min Inkubation bei Raumtemperatur. Die Proteine wurden durch die Zugabe von 9 ml gekühlter 3 M Natriumacetat- Lösung (pH 4,8) und einer 15minütigen Inkubation auf
Eis gefallt. Nach der Zentrifugation (GSA: 13000 rpm (27500 x g) , 20 min, 4°C) wurde der Überstand, der die DNA enthielt, in einen neuen GSA-Becher überführt und die DNA mit 15 ml eiskaltem Isopropanol und einer Inkubation von 30 min bei -20°C gefällt. Das DNA-Pellet wurde in 5 ml eisgekühltem Ethanol gewaschen und an der Luft getrocknet (ca. 30 bis 60 min) . Danach wurde es in 1 ml H20 aufgenommen. Es fand eine Überprüfung des Plasmids durch Restriktionsanalyse statt. Die Konzentration wurde durch Auftragen von Verdünnungen auf einem Minigel bestimmt. Zur Verringerung des Salz- gehaltes erfolgte eine 30- bis 60 minütige Mikrodialyse (Porengröße 0,025 μm) .
9. Hefe-Transformation Für die Hefe-Transformation wurde eine Voranzucht des Stammes Saccharomyces cerevisiae AH22 angesetzt. Ein Kolben mit 20 ml YE-Medium wurde mit 100 μl der Gefrierkultur angeimpft und über Nacht bei 28°C und 120 rpm bebrütet. Die Hauptanzucht erfolgte unter gleichen Bedingungen in Kolben mit 100 ml YE-Medium, die mit 10 μl, 20 μl oder 50 μl der Voranzucht angeimpft wurden.
9.1 Erstellen kompetenter Zellen Am nächsten Tag wurden die Kolben mittels Thomakammer ausgezählt und es wurde mit dem Kolben, der eine Zellzahl von 3 bis 5 x 107 Zellen/ml besaß weitergearbeitet. Die Zellen wurden durch Zentrifugation (GSA: 5000 rpm (4000 x g) 10 min) geerntet. Das Zell- pellet wurde in 10 ml TE-Puffer aufgenommen und auf zwei Tischzentrifugenröhrchen aufgeteilt (je 5 ml) . Die Zellen wurden 3 min bei 6000 rpm abzentrifugiert und noch zweimal mit je 5 ml TE-Puffer gewaschen. Anschließend wurde das Zellpellet in 330 μl Lithiu- macetat-Puffer pro 109 Zellen aufgenommen, in einen sterilen 50 ml Erlenmeyerkolben überführt und eine Stunde bei 28°C geschüttelt. Dadurch waren die Zellen kompetent für die Transformation.
9.2 Transformation
Für jeden Transformationsansatz wurden 15 μl Heringssperma DNA (10 mg/ml) , 10 μl zu transformierende DNA (ca. 0,5 μg) und 330 μl kompetente Zellen in ein Tischzentrifugenröhrchen pipettiert und 30 min bei 28°C (ohne Schütteln) inkubiert. Danach wurden 700 μl 50 %
PEG 6000 zugegeben und für eine weitere Stunde bei 28°C, ohne Schütteln, inkubiert. Es folgte ein Hitzeschock von 5 min bei 42°C. 100 μl der Suspension wurden auf Selektionsmedium (YNB, Difco) ausplattiert, m auf Leucinprototrophie zu selektionieren. Im Falle der Selektion auf G418 Resistenz wird nach dem Hitzeschock eine Regeneration der Zellen durchgeführt (s. unter 9.3 Regenerations- phase) 9.3 Regenerationsphase
Da der Selektionsmarker die Resistenz gegen G418 ist, brauchten die Zellen Zeit für die Expression des Resistenz-Gens. Die Transformationsansätze wurden mit 4 ml YE-Medium versetzt und über Nacht bei 28°C auf dem
Schüttler (120 rpm) bebrütet. Am nächsten Tag wurden die Zellen abzentrifugiert (6000 rpm, 3 min) in 1 ml YE-Medium aufgenommen und davon 100 μl bzw. 200 μl auf YE + G418-Platten ausplattiert. Die Platten wurden mehrere Tage bei 28°C bebrütet.
10. Reaktionsbedingungen für die PCR
Die Reaktionsbedingungen für die Polymerase Chain Reaction müssen für den Einzelfall optimiert werden und sind nicht uneingeschränkt für jeden Ansatz gültig. So kann unter anderem die eingesetzte Menge an DNA, die Salzkonzentrationen und die Schmelztemperatur variiert werden. Für unsere Problemstellung erwies es sich als günstig, in einem Eppendorfhütchen, das für den Einsatz im Thermocycler geeignet war, folgende Substanzen zu vereinigen: Zu 2 μl (= 0,1 U) Super Taq Polymerase wurden 5 μl Super Buffer, 8 μl dNTP's (je 0,625 μM) , 5 '-Primer, 3 '-Primer und 0,2 μg Matrizen DNA, gelost in soviel Wasser, dass sich ein Gesamtvolumen von 50 μl für den PCR Ansatz ergibt, zugegeben. Der Ansatz wurde kurz abzentrifugiert und mit einem Tropfen Öl überschichtet. Es wurden zwischen 37 und 40 Zyklen zur Amplifizierung gewählt.
Beispiele
Beispiel 1
Expression einer trunkierten HMG-CoA-Reduktase in
S. cerevisiae GRF
Die kodierende Nuklemsäuresequenz für die Expressionskassette aus ADJϊ-Promotor-tiϊMC?-Trypophan-Terminator wurde aus dem Vektor YepH2 (Polakowski et al. (1998) Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast. Appl Microbiol Biotechnol. Jan; 49(1) : 66-71) durch PCR unter Verwendung von Standardmethoden wie vorstehend unter den allgemeinen Reaktionsbedingungen angegeben aplifiziert .
Die hierbei verwendeten Primer sind die DNA Oligomere AtHT-5 ' (forward: tHMGNotF: 5'- CTGCGGCCGCATCATGGACCAATTG- GTGAAAACTG-3 ' ; SEQ. ID. NO. 7) und AtHT-3 ' (reverse: tHMGXhoR: 5 ' - AACTCGAGAGACACATGGTGCTGTTGTGCTTC-3 ' ; SEQ. ID. No. 8) .
Das erhaltene DNA-Fragment wurde nach einer Klenow-Behandlung in den Vektor pUG6 in die EcoRV-Schnittstelle Blunt-end ein- kloniert und ergab den Vektor püG6-tHMG (Abbildung 8) .
Nach Plasmidisolation wurde ein erweitertes Fragment aus dem Vektor pUG-tHMG mittels PCR amplifiziert, so dass das resultierende Fragment aus folgenden Komponenten besteht:
1 oxP- kanMX-ADH-'Promotor- tHMG- Tryptpnan-Terminator-2 oxP . AIs Primer wurden Oligonukleotidsequenzen ausgewählt, die an den 5' und 3' Überhängen je die 5' oder die 3' Sequenz des ÜRA3-Gens enthalten und im annealenden Bereich die Sequenzen der loxP-Regionen 5' und 3' des Vektors pUG-tHMG. So ist gewährleistet, dass einerseits das gesamte Fragment inklusive KariR und tHMG amplifiziert werden und anderseits dieses Fragment anschließend in Hefe transformiert werden kann und durch homologe Rekombination dieses gesamte Fragment in den 7A3-Genlocus der Hefe integriert.
Als Selektionsmarker dient die Resistenz gegen G418. Der resultierende Stamm S. cerevisiae GRF-tHlura3 ist Uracil auxotroph und enthält eine Kopie des Genes tHMG unter der Kontrolle des ADfiT-Promotors und des Tryptophan-Terminators .
Um die Resistenz gegen G418 anschließend wieder zu entfernen, wird der entstandene Hefestamm mit dem cre Rekombinase Vektor pSH47 (Guldener U, Heck S, Fielder T, Beinhauer J, Hegemann JH. (1996) A new efficient gene disruption cassette for repeated use in budding yeast . Nucleic Acids Res . Jul 1;24(13) :2519-24.) transformiert. Durch diesen Vektor wird die cre Rekombinase in der Hefe exprimiert, was zur Folge hat, dass der Sequenz-Bereich innerhalb der beiden loxP- Sequenzen heraus rekombiniert. Dies hat zur Folge, dass lediglich eine der beiden loxP-Sequenzen und die ΑDH-tHMG-TRP Kassette in dem URA3-Genlocus enthalten bleibt. Die Folge ist, das der Hefestamm die G418-Resistenz wieder verliert und damit geeignet ist, weitere Gene mittels dieses cre-lox Systems in den Hefestamm zu integrieren bzw. zu entfernen. Der Vektor pSH47 kann daraufhin durch eine Gegenselektion auf YNB-Agarplatten supplimentiert mit Uracil (20 mg/L) und FOA (5-Fluoroorotic acid) (Ig/L) wieder entfernt werden. Dazu müssen die Zellen, die dieses Plasmid tragen, zunächst unter nicht selektiven Bedingungen kultiviert werden und anschließend auf FOA-haltigen Selektivplatten angezogen werden. Unter diesen Bedingungen können lediglich Zellen wachsen, die nicht in der Lage sind, Uracil selbst zu synthetisieren. Dies sind in diesem Fall Zellen, die kein Plasmid (pSH47) mehr enthalten.
Der Hefestamm GRF-tHlura3 und der Ausgangsstamm GRF wurden 48 Stunden lang in WMXIII-Medium bei 28°C und 160 rpm in einem 20 ml Kulturvolumen kultiviert. Anschließend wurden 500 μl dieser Vorkultur in eine 50 ml Hauptkultur des gleichen Mediums überführt und für 4 Tage bei 28°C und 160 rpm in einem Schikanekolben kultiviert.
Die Sterole wurden nach der Methode wie in Parks LW, Bottema CD, Rodriguez RJ, Lewis TA. (1985) Yeast sterols: yeast mutants as tools for the study of sterol metabolism. Methods Enzymol. 1985;111:333-46, beschrieben, nach 4 Tagen extrahiert und mittels Gaschromatographie analysiert . Es ergeben sich die in Tabelle 1 aufgelisteten Werte. Die prozentualen Angaben beziehen sich auf das Hefetrockengewich .
Tabelle 1
Figure imgf000036_0001
Beispiel 2
Expression von ERGl in S. cerevisiae GRF tHlura3
(t-HMG + ERGl)
Die Sequenz der Squalenepoxidase wurde durch PCR aus genomischer DNA von Saccharomyces cerevisiae S288C gewonnen. Die hierbei verwendeten Primer sind die DNA-Oligomere ERG1-5 ' (forward: ErglNotF: 5' - CTGCGGCCGCATCATGTCTGCTGTTAACGT TGC- 3'; SEQ. ID. No. 9) und ERG1-3 ' (revers.- ErglXhoR: 5' - TTCTCGAGTTAACCAATCAACTCACCAAAC-3' ; SEQ. ID. No. 10).
Das erhaltene DNA-Fragment wurde mit den Restriktionsenzymen Notl und Xhol behandelt und anschliessend in den Vektor pFlatl (Abbildung 4) , der zuvor ebenfalls mit den Enzymen Notl und Xhol behandelt wurde, mittels einer Ligase-Reaktion integriert .
Der resultierende Vektor pFlatl-ERGl (Abbildung 5) enthält das ERG -Gen unter der Kontrolle des ADff-Promotors und des Tryptophan-Terminators .
Der Expressionsvektor pFlatl-ERGl wurde anschliessend in den Hefestamm S. cerevisiae GRF tHlura3 transformiert. Der so gewonnene Hefestamm S. cerevisiae GRF tHlura3/pFlatl-ERG2 wurde anschliessend 48 Stunden lang in WMXIII-Medium bei 28°C und 160 rpm in einem 20 ml Kulturvolumen kultiviert. Anschließend wurden 500 μl dieser Vorkultur in eine 50 ml Hauptkultur des gleichen Mediums überführt und für 4 Tage bei 28°C und 160 rpm in einem Schikanekolben kultiviert.
Die Sterole wurden nach 4 Tagen analog Beispiel 1 extrahiert und mittels Gaschromatographie analysiert. Es ergeben sich die in Tabelle 2 aufgelisteten Werte. Die prozentualen Angaben beziehen sich auf das Hefetrockengewicht.
Tabelle 2
Figure imgf000037_0001
Abbildung la und lb zeigt die absolute (la) und prozentuale (lb) Zunahme des Gehalts einzelner Sterole in S. cerevisae GRF tHlura3/pFlatl-ERGl im Vergleich zum Ausgangsstamm-Stamm S. cerevisae GRF tHlura3. Beispiel 3
Expression von ERG11 in S. cerevisiae GRF-tHlura3 { t-HMG + ERG11 )
Die Sequenz der Lanosterol-C14-Demethylase (ERG11) wurde, durch PCR aus genomischer DNA von Saccharomyces cerevisiae S288C gewonnen.
Die hierbei verwendeten Primer sind die DNA-Oligomere ERG11-5' (forward: ErgllNotF: 5'- CTGCGGCCGCAGGATGTCTGCTAC- CAAGTCAATCG -3'; SEQ. ID. No. 11) und ERGl1-3 ' (revers: ErgllXhoR: 5'- ATCTCGAGCTTAGATCTTTTGTTCTGGATTTCTC -3'; SEQ ID No . 12) .
Das erhaltene DNA-Fragment wurde mit den Restriktionsenzymen NotJ und Xhol behandelt und anschließend in den Vektor pFlat3 (Abbildung 6), der zuvor ebenfalls mit den Enzymen Notl und Xhol behandelt wurde, mittels einer Ligase-Reaktion integriert. Der resultierende Vektor pFlat3-BRGll (Abbildung 7) enthält das ERG l-Gen unter der Kontrolle des ADH-Promotors und des Tryptophan-Terminators .
Der Expressionsvektor pFlat3-ERGll wurde anschließend in den Hefestamm S. cerevisiae GRF-tHlura3 transformiert. Der so gewonnene Hefestamm S. cerevisiae GRF tHlura3/pFlat3 -ERG11 wurde anschließend 48 Stunden lang in WMXIII- Medium bei 28°C und 160 rpm in einem 20 ml Kulturvolumen kultiviert. Anschließend wurden 500 μl dieser Vorkultur in eine 50 ml Hauptkultur des gleichen Mediums überführt und für 4 Tage bei 28°C und 160 rpm in einem Schikanekolben kultiviert.
Die Sterole wurden nach 4 Tagen analog Beispiel 1 extrahiert und mittels Gaschromatographie analysiert. Es ergeben sich die in Tabelle 3 aufgelisteten Werte. Die prozentualen Angaben beziehen sich auf das Hefetrockengewicht.
Tabelle 3
Figure imgf000038_0001
Abbildungen 2a und 2b zeigen die absolute (2a) und prozentuale (2b) Zunahme des Gehalts einzelner Sterole in S. cerevisae GRF-tHlura3/pFlat3-ERGll im Vergleich zum Ausgangs-Stamm S . cerevisae GRF tHlura3.
Beispiel 4
Kombinierte Expression von ERGl und ERGll in S. cerevisiae
GRF tHlura3 (t-HMG + ERGl + ERGll)
Die beiden episomalen Expressionsvektoren pFlatl-ERGl (s.
Beispiel 2) und pFlat3-E Gll (s. Beipiel 3) wurden gemeinsam und gleichzeitig in den Hefestamm S. cerevisiae GRF tHlura3 transformiert und die beiden Gene ERGl und ERGll gleichzeitig unter der Kontrolle des ADH-Promotors und des Tryptophan- Terminators exprimiert.
Der so gewonnene Hefestamm S. cerevisiae GRF-tHlura3/ pFlatl-ERGl/pFlat3 -ERGll wurde anschließend 48 Stunden lang in WMXIII- Medium bei 28°C und 160 rpm in einem 20 ml Kultur- volumen kultiviert. Anschließend wurden 500 μl dieser Vorkultur in eine 50 ml Hauptkultur des gleichen Mediums überführt und für 4 Tage bei 28°C und 160 rpm in einem Schikanekolben kultiviert.
Die Sterole wurden nach 4 Tagen analog Beispiel 1 extrahiert und mittels Gaschromatographie analysiert. Es ergeben sich die in Tabelle 4 aufgelisteten Werte. Die prozentualen Angaben beziehen sich auf das Hefetrockengewicht.
Tabelle 4
Figure imgf000039_0001
Abbildungen 3a und 3b zeigen die absolute (3a) und die prozentuale (3b) Zunahme des Gehalts einzelner Sterole in S. cerevisiae GRF tHlura3/pFlatl-ERGl/pFlat3 -ERGll im Vergleich zum Ausgangs-Stamm S . cerevisae GRF-tHlura3. Da aus dem Stand der Technik (Tainaka et al., J, Ferment. Bioeng. 1995, 79, 64-66) bekannt ist, dass die Überexpression von ERGll zu keiner signifikanten Erhöhung des Ergosterol- gehalts in Hefe führt und aus Beispiel 1 ersichtlich ist, dass die Expression einer t-HMG zu keiner signifikanten Erhöhung des Ergosterolgehalts in Hefe führt, ist es als überraschend zu bezeichnen, dass die Überexpression beider Gene zu einer Steigerung des Ergosterolgehalts um 100 % führt .

Claims

Patentansprüche
1. Verfahren zur Herstellung von Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten durch
Kultivierung von Organismen, die gegenüber dem Wildtyp eine erhöhte Lanosterol-C14-Demethylase-Aktivität und eine erhöhte HMG-CoA-Reduktase Aktivität aufweisen.
2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass man zur Erhöhung der Lanosterol-C14-Demethylase-Aktivität die Genexpression einer Nukleinsäure kodierend eine Lanosterol- C14-Demethylase gegenüber dem Wildtyp erhöht .
3. Verfahren nach Anspruch 2, dadurch gekennzeichnet, dass man zur Erhöhung der Genexpression eine oder mehrere Nukleinsäuren kodierend eine Lanosterol-C14-Demethylase, in den Organismus einbringt .
4. Verfahren nach Anspruch 3, dadurch gekennzeichnet, dass man Nukleinsäuren einbringt, die Proteine kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 2 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 30 % auf Aminosäureebene mit der Sequenz
SEQ. ID. NO. 2, und die die enzymatische Eigenschaft einer Lanosterol-Cl4-Demethylase aufweisen.
5. Verfahren nach Anspruch 4, dadurch gekennzeichnet, dass man eine Nukleinsäure, enthaltend die Sequenz SEQ. ID. NO. 1 einbringt .
6. Verfahren nach einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, dass man zur Erhöhung der HMG-CoA-Reduktase-Aktivi- tat die Genexpression einer Nukleinsäure kodierend eine HMG- CoA-Reduktase gegenüber dem Wildtyp erhöht.
7. Verfahren nach Anspruch 6, dadurch gekennzeichnet, dass man zur Erhöhung der Genexpression ein Nukleinsäurekonstrukt, enthaltend eine Nukleinsäure kodierend eine HMG-CoA-Reduktase in den Organismus einbringt, deren Expression in dem Organismus, verglichen mit dem Wildtyp, einer reduzierten Regulation unterlieg .
8. Verfahren nach Anspruch 7, dadurch gekennzeichnet, dass das Nukleinsäurekonstrukt einen Promotor enthält, der in dem Organismus, verglichen mit dem Wildtyp-Promotor, einer reduzierten Regulation unterliegt.
5
9. Verfahren nach Anspruch 7 oder 8, dadurch gekennzeichnet, dass man als Nukleinsäure kodierend eine HMG-CoA-Reduktase eine Nukleinsäure verwendet, deren Expression in dem Organismus, verglichen mit der Organismus eigenen, orthologen
10 Nukleinsäure, einer reduzierten Regulation unterliegt.
10. Verfahren nach Anspruch 9, dadurch gekennzeichnet, dass man als Nukleinsäure kodierend eine HMG-CoA-Reduktase eine Nukleinsäure verwendet, die nur den katalytischen Bereich
15 der HMG-CoA-Reduktase kodiert.
11. Verfahren nach Anspruch 10, dadurch gekennzeichnet, dass man Nukleinsäuren einbringt, die Proteine kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 4 oder eine von dieser
20 Sequenz durch Substitution, Insertion oder Deletion von Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 30 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 4, und die die enzymatische Eigenschaft einer HMG-CoA-Reduktase aufweisen.
25
12. Verfahren nach Anspruch 11, dadurch gekennzeichnet, dass man eine Nukleinsäure, enthaltend die Sequenz SEQ. ID. NO. 3 einbringt .
30 13. Verfahren nach einem der Ansprüche 1 bis 12, dadurch gekennzeichnet, dass man einen Organismus verwendet, der zusätzlich gegenüber dem Wildtyp eine erhöhte Squalenepoxidase-Aktivität aufweist .
35 14. Verfahren nach Anspruch 13, dadurch gekennzeichnet, dass man zur Erhöhung der Squalenepoxidase-Aktivität die Genexpression einer Nukleinsäure kodierend eine Squalenepoxidase gegenüber dem Wildtyp erhöht.
40 15. Verfahren nach Anspruch 14, dadurch gekennzeichnet, dass man zur Erhöhung der Genexpression eine oder mehrere Nukleinsäuren kodierend eine Squalenepoxidase, in den Organismus einbringt .
45
16. Verfahren nach Anspruch 15, dadurch gekennzeichnet, dass man Nukleinsäuren einbringt, die Proteine kodieren, enthaltend die Aminosäuresequenz SEQ. ID. NO. 6 oder eine von dieser Sequenz durch Substitution, Insertion oder Deletion von 5 Aminosäuren abgeleitete Sequenz, die eine Identität von mindestens 30 % auf Aminosäureebene mit der Sequenz SEQ. ID. NO. 6, und die die enzymatische Eigenschaft einer Squalenepoxidase aufweisen.
10 17. Verfahren nach Anspruch 16, dadurch gekennzeichnet, dass man eine Nukleinsäure, enthaltend die Sequenz SEQ. ID. NO. 5 einbringt .
18. Verfahren nach einem der Ansprüche 1 bis 17, dadurch gekenn- 15 zeichnet, dass man als Organismus Hefe verwendet.
19. Verfahren nach einem der Ansprüche 1 bis 18, dadurch gekennzeichnet, dass man nach dem Kultivieren den Organismus erntet und anschließend Zymosterol und/oder dessen biosynthetische
20 Zwischen- und/oder Folgeprodukte aus dem Organismus isoliert.
20. Nukleinsäurekonstrukt, enthaltend Nukleinsäuren kodierend eine Lanosterol-C14-Demethylase und Nukleinsäuren kodierend eine HMG-CoA-Reduktase, die mit einem oder mehreren Regulati- 5 onssignalen funktionell verknüpft sind, die die Transkription und Translation in Organismen gewährleisten.
21. Nukleinsäurekonstrukt nach Anspruch 20, enthaltend zusätzlich Nukleinsäuren, die eine Squalenepoxidase kodieren. 0
22. Kombination aus Nukleinsäurekonstrukten, wobei die Kombination
a) ein erstes Nukleinsäurekonstrukt, enthaltend Nuklein- 35 säuren kodierend eine Lanosterol-Cl4-Demethylase, die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Organismen gewährleisten und
0 b) ein zweites Nukleinsäurekonstrukt, enthaltend Nukleinsäuren kodierend eine HMG-COA-Reduktase, die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Organismen gewähr1eisten 5 umfasst.
23. Kombination gemäß Anspruch 22, dadurch gekennzeichnet, dass die Kombination
c) noch ein weiteres, drittes Nukleinsäurekonstrukt, ent- 5 haltend Nukleinsäuren kodierend eine Squalenepoxidase, die mit einem oder mehreren Regulationssignalen funktionell verknüpft sind, die die Transkription und Translation in Organismen gewährleisten umfasst.
10 24. Nukleinsäurekonstrukte oder Kombination von Nukleinsäure- konstrukten gemäß einem der Ansprüche 20 bis 23, dadurch gekennzeichnet, dass die Regulationssignale einen oder mehrere Promotoren und einem oder mehrere Terminatoren enthalten, die die Transkription und Translation in Organismen
15 gewährleisten.
25. Nukleinsäurekonstrukte oder Kombination von Nukleinsäure- konstrukten gemäß Anspruch 24, dadurch gekennzeichnet, dass man Regulationssignale verwendet, die die Transkription und 0 Translation in Hefen gewährleisten.
26. Genetisch veränderter Organismus, wobei die genetische Veränderung die Aktivität einer Lanosterol-C14-Demethylase und einer HMG-CoA-Reduktase gegenüber einem Wildtyp erhöht. 5
27. Genetisch veränderter Organismus nach Anspruch 26, dadurch gekennzeichnet, dass die Erhöhung der Lanosterol-Cl4-Demethy- lase-Aktivität durch eine Erhöhung der Genexpression einer Nukleinsäure kodierend eine Lanosterol-C14-Demethylase gegen- 0 über dem Wildtyp bewirkt wird.
28. Genetisch veränderter Organismus nach Anspruch 27, dadurch gekennzeichnet, dass der Organismus zwei oder mehr Nukleinsäuren kodierend eine Lanosterol-Cl4-Demethylase enthält. 5
29. Genetisch veränderter Organismus nach einem der Ansprüche 26 bis 28, dadurch gekennzeichnet, dass die Erhöhung der HMG- CoA-Reduktase-Aktivität durch eine Erhöhung der Genexpression einer Nukleinsäure kodierend eine HMG-CoA-Reduktase gegenüber 0 dem Wildtyp bewirkt wird.
30. Genetisch veränderter Organismus nach Anspruch 29, dadurch gekennzeichnet, dass der Organismus ein Nukleinsäurekonstrukt enthält, enthaltend eine Nukleinsäure kodierend eine HMG-CoA- 5 Reduktase, deren Expression in dem Organismus verglichen mit dem Wildtyp einer reduzierten Regulation unterliegt.
31. Genetisch veränderter Organismus nach Anspruch 30, dadurch gekennzeichnet, dass das Nukleinsäurekonstrukt einen Promotor enthält, der in dem Organismus verglichen mit dem Wildtyp einer reduzierten Regulation unterliegt.
32. Genetisch veränderter Organismus nach Anspruch 30 oder 31, dadurch gekennzeichnet, dass man als Nukleinsäure kodierend eine HMG-CoA-Reduktase eine Nukleinsäure verwendet, die nur den katalytischen Bereich der HMG-CoA-Reduktase kodiert.
33. Genetisch veränderter Organismus nach einem der Ansprüche 26 bis 32, dadurch gekennzeichnet, dass die genetische Veränderung zusätzlich die Squalenepoxidase-Aktivität gegenüber einem Wildtyp erhöht .
34. Genetisch veränderter Organismus nach Anspruch 33, dadurch gekennzeichnet, dass die Erhöhung der Squalenepoxidase- Aktivität durch eine Erhöhung der Genexpression einer Nukleinsäure kodierend eine Squalenepoxidase-Aktivität gegenüber dem Wildtyp bewirkt wird.
35. Genetisch veränderter Organismus nach Anspruch 34, dadurch gekennzeichnet, dass der Organismus zwei oder mehr Nukleinsäuren kodierend eine Squalenepoxidase-Aktivität enthält .
36. Genetisch veränderter Organismus nach einem der Ansprüche 26 bis 35, dadurch gekennzeichnet, dass der genetisch veränderte Organismus gegenüber dem Wildtyp einen erhöhten Gehalt an Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten aufweist.
37. Genetisch veränderter Organismus nach einem der Ansprüche 26 bis 36, dadurch gekennzeichnet dass man als Organismus Hefe verwendet .
38. Verwendung eines genetisch veränderten Organismus nach einem der Ansprüche 26 bis 37 zur Herstellung von Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten.
39. Verfahren zur Herstellung von genetisch veränderten Organismen gemäß einem der Ansprüche 26 bis 37, dadurch gekennzeichnet, dass man Nukleinsäuren gemäß einem der Ansprüche 3 bis 5 und Nukleinsäurekonstrukte gemäß einem der Ansprüche 7 bis 11 in das Genom des Ausgangsorganismus einführt .
40. Verfahren gemäß Anspruch 39, dadurch gekennzeichnet, dass man zusätzlich Nukleinsäuren gemäß einem der Ansprüche 15 bis 17 in das Genom des AusgangsOrganismus einführt.
41. Verwendung der Nukleinsäuren gemäß einem der Ansprüche 3 bis 5 oder 15 bis 17 oder der Nukleinsäurekonstrukte gemäß einem der Ansprüche 7 bis 11 zur Erhöhung des Gehalts an Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten in Organismen.
PCT/EP2003/000590 2002-01-29 2003-01-22 Verfahren zur herstellung von zymosterol und/oder dessen biosynthetischen zwischen- und/oder folgeprodukten in transgenen organismen WO2003064652A1 (de)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP03734683A EP1472355A1 (de) 2002-01-29 2003-01-22 Verfahren zur herstellung von zymosterol und/oder dessen biosynthetischen zwischen- und/oder folgeprodukten in transgenen organismen
US10/503,253 US20060088903A1 (en) 2002-01-29 2003-01-22 Method for the production of zymosterol and/or the biosynthetic intermediate and/or subsequent products thereof in transgenic organisms

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10203346.3 2002-01-29
DE10203346A DE10203346A1 (de) 2002-01-29 2002-01-29 Verfahren zur Herstellung von Zymosterol und/oder dessen biosynthetischen Zwischen- und/oder Folgeprodukten in transgenen Organismen

Publications (1)

Publication Number Publication Date
WO2003064652A1 true WO2003064652A1 (de) 2003-08-07

Family

ID=7713289

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2003/000590 WO2003064652A1 (de) 2002-01-29 2003-01-22 Verfahren zur herstellung von zymosterol und/oder dessen biosynthetischen zwischen- und/oder folgeprodukten in transgenen organismen

Country Status (4)

Country Link
US (1) US20060088903A1 (de)
EP (1) EP1472355A1 (de)
DE (1) DE10203346A1 (de)
WO (1) WO2003064652A1 (de)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011023298A1 (en) 2009-08-26 2011-03-03 Organobalance Gmbh Genetically modified organisms for the production of lipids
WO2011067144A1 (en) 2009-12-03 2011-06-09 Dsm Ip Assets B.V. Production of non-yeast sterols by yeast

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050037946A1 (en) * 2003-01-13 2005-02-17 Millennium Pharmaceuticals, Inc. Methods and compositions for treating cardiovascular disease using 1722, 10280, 59917, 85553, 10653, 9235, 21668, 17794, 2210, 6169, 10102, 21061, 17662, 1468, 12282, 6350, 9035, 1820, 23652, 7301, 8925, 8701, 3533, 9462, 9123, 12788, 17729, 65552, 1261, 21476, 33770, 9380, 2569654, 33556, 53656, 44143, 32612, 10671, 261, 44570, 41922, 2552, 2417, 19319, 43969, 8921, 8993, 955, 32345, 966, 1920, 17318, 1510, 14180, 26005, 554, 16408, 42028, 112091, 13886, 13942, 1673, 54946 or 2419
WO2008130372A2 (en) * 2006-09-28 2008-10-30 Microbia, Inc. Production of sterols in oleaginous yeast and fungi
CN103052713A (zh) 2010-07-07 2013-04-17 陶氏益农公司 官能化线性dna盒的生成及植物中量子点/纳米颗粒介导的投递
BR112013000434A2 (pt) 2010-07-07 2016-05-17 Dow Agrosciences Llc entrega de molécula de dna linear usando pontos quânticos pegilados para transformação estável em plantas.
WO2020176547A1 (en) 2019-02-25 2020-09-03 Ginkgo Bioworks, Inc. Biosynthesis of cannabinoids and cannabinoid precursors

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999016886A1 (de) * 1997-09-30 1999-04-08 Schering Aktiengesellschaft Verfahren zur herstellung von ergosterol und dessen zwischenprodukten mittels rekombinanter hefen

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999016886A1 (de) * 1997-09-30 1999-04-08 Schering Aktiengesellschaft Verfahren zur herstellung von ergosterol und dessen zwischenprodukten mittels rekombinanter hefen

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ALLEN K ET AL: "Effects of overproduction of the catalytic domain of 3-hydroxy-3-methylglutaryl coenzyme A reductase on squalene synthesis in Saccharomyces cerevisiae", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, WASHINGTON,DC, US, vol. 63, no. 9, 1 September 1997 (1997-09-01), pages 3341 - 3344, XP002094331, ISSN: 0099-2240 *
LEES N D ET AL: "BIOCHEMISTRY AND MOLECULAR BIOLOGY OF STEROL SYNTHESIS IN SACCHAROMYCES CEREVISIAE", CRITICAL REVIEWS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY, CRC PRESS, BOCA RATON, FL, US, vol. 34, no. 1, 1999, pages 33 - 47, XP000981947, ISSN: 1040-9238 *
POLAKOWSKI T ET AL: "Enhanced sterol-acyl transferase activity promotes sterol accumulation in Saccharomyces cerevisiae.", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 53, no. 1, December 1999 (1999-12-01), pages 30 - 35, XP002246057, ISSN: 0175-7598 *
TAINAKA HITOSHI ET AL: "Effects of Elevated Expression of the CYP51 (P450-14DM) Gene on the Sterol Contents of Saccharomyces cerevisiae.", JOURNAL OF FERMENTATION AND BIOENGINEERING, vol. 79, no. 1, 1995, pages 64 - 66, XP008018954, ISSN: 0922-338X *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011023298A1 (en) 2009-08-26 2011-03-03 Organobalance Gmbh Genetically modified organisms for the production of lipids
EP2292741A1 (de) 2009-08-26 2011-03-09 OrganoBalance GmbH Genetisch modifizierte Organismen zur Herstellung von Lipiden
EP2586859A1 (de) 2009-08-26 2013-05-01 OrganoBalance GmbH Genetisch modifizierte Organismen zur Herstellung von Lipiden
WO2011067144A1 (en) 2009-12-03 2011-06-09 Dsm Ip Assets B.V. Production of non-yeast sterols by yeast

Also Published As

Publication number Publication date
DE10203346A1 (de) 2003-07-31
US20060088903A1 (en) 2006-04-27
EP1472355A1 (de) 2004-11-03

Similar Documents

Publication Publication Date Title
EP1472354B1 (de) Verfahren zur herstellung von 7-dehydrocholesterol in transgenen organismen
DE4226971C2 (de) Modifizierte Pilzzellen und Verfahren zur Herstellung rekombinanter Produkte
EP0751995B1 (de) Riboflavin-biosynthesis in fungi
EP1015597B1 (de) Verfahren zur herstellung von ergosterol und dessen zwischenprodukten mittels rekombinanter hefen
WO2003064652A1 (de) Verfahren zur herstellung von zymosterol und/oder dessen biosynthetischen zwischen- und/oder folgeprodukten in transgenen organismen
DE3782560T2 (de) Hefestaemme zur expression fremder gene.
DE69635525T2 (de) Gentechnisch hergestellte hefestämme
WO1994003608A1 (de) Hypoglycosylierte recombinante glucoseoxidase
EP0582244B1 (de) Hefewirtsstämme mit Defekten in der N-Glycosylierung
EP1606390A1 (de) Verfahren zur herstellung von ergosta-5,7-dienol und/oder dessen biosynthetischen zwischen- und/oder folgeprodukten in transgenen organismen
CH690127A5 (de) Hitzeschock induzierter Promotor.
KR102207288B1 (ko) 변이형 전사조절인자 Upc2p 발현 최적화 벡터 및 이를 이용한 스테롤 전구체 과생산 방법
EP1918379B1 (de) Expressionsvektoren zur multiplen Gen-Integration und Überexpression von homologen und heterologen Proteinen in Hefen der Gattung Arxula
US20040235088A1 (en) Process for the production of ergosterol and its intermediate products using recombinant yeasts
WO2006136311A1 (de) Metabolic engineering der q10-produktion in hefen der gattung sporidiobolus
KR102185428B1 (ko) 변이형 전사조절인자 Upc2p 발현 최적화 벡터 및 이를 이용한 스테롤 전구체 과생산 방법
DE60126767T2 (de) Neuartige (r)-2-hydroxy-3-phenylpropionat (d-phenyllaktat) dehydrogenase und für diese kodierendes gen
DE69403464T2 (de) Herstellung von glycolate-oxydase in methylotrophen hefen
WO2000012748A1 (de) Organismen zur extrazellulären herstellung von riboflavin
WO2000065071A1 (de) Nukleinsäuremolekül, umfassend eine für ein polypeptid mit chorismatmutase-aktivität kodierende nukleinsäure
EP1200600A2 (de) Ein- oder mehrzellige organismen zur herstellung von riboflavin

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2003734683

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2006088903

Country of ref document: US

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 10503253

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 2003734683

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 04030193

Country of ref document: SE

WWP Wipo information: published in national office

Ref document number: 04030193

Country of ref document: SE

WWP Wipo information: published in national office

Ref document number: 10503253

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP

WWW Wipo information: withdrawn in national office

Ref document number: 2003734683

Country of ref document: EP