WO2003054016A2 - Method for cloning of variable domain sequences - Google Patents
Method for cloning of variable domain sequences Download PDFInfo
- Publication number
- WO2003054016A2 WO2003054016A2 PCT/EP2002/014662 EP0214662W WO03054016A2 WO 2003054016 A2 WO2003054016 A2 WO 2003054016A2 EP 0214662 W EP0214662 W EP 0214662W WO 03054016 A2 WO03054016 A2 WO 03054016A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- igvd
- primer
- sequences
- polynucleotide sequences
- variable domain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
Definitions
- the present invention relates to the cloning of variable domain polynucleotide sequences derived from immunoglobulins.
- Immunoglobulin (Ig) chains are divided into a number of domains. At the N-terminal end of an Ig chain is a variable domain.
- the variable domains on the heavy and light chains fit together to form a binding site designed to receive a particular antigen.
- the variable domains are so called because their amino acid sequences vary particularly from one molecule to another. This variation in sequence enables the molecules to recognise an extremely wide variety of targets.
- Each variable domain comprises a number of areas of relatively conserved sequence and also three areas of hypervariable sequence. The three hypervariable areas are known as complementarity determining regions (CDRs).
- IGVDs immunoglobulin variable domains
- HCVDs heavy chain variable domains
- Ig molecules can be used in many of the ways as are Ig molecules or fragments thereof.
- Ig molecules are currently used in therapy, in diagnosis, in vaccination, in modulation of activities of hormones or growth factors, in detection, in biosensors and even in catalysis.
- the small size of the IGVDs may confer some advantages over complete antibodies, for example, in neutralising the activity of low molecular weight drugs and allowing their filtration from the kidneys with drug attached, in penetrating tissues and tumours, in neutralising viruses by binding to small conserved regions on the surfaces of viruses, in high resolution epitope mapping of proteins and in vaccination by IGVDs which mimic antigens. It is said that a mixture of all or most of the IGVDs derived from an individual forms a repertoire. Repertoire cloning of variable domains is described in the art. The latter method is fully described in European Patent number 0 368 684.
- said method for repertoire cloning employs the polymerase chain reaction and needs two species-specific primers, annealing on conserved DNA sequences flanking the variable domains, for cloning. Cloning into a suitable vector is facilitated by the incorporation of a restriction enzyme site into the two species specific primers.
- Patent application number WO 99/23221 granted patent numbers EP 0 368 684 and US 6,291 ,161 , Van der Linden et al (J. Immunol Methods, 240, p185 to 195) and Larrick JW et al (Progress in Biotechnology, 5, p231 to 246) disclose methods for isolating genes encoding IGVDs and cite the use of two species specific primers which flank the IGVD region. Using two species-specific primers requires fore-knowledge of the sequences of the regions flanking both ends of the IGVD for every species. For some species, for example, llama, IgG sequence information is not readily available.
- primers that are not precisely complementary for that species are commonly used, so leading to less efficient primer annealing and a consequently smaller repertory diversity.
- the use of primers not precisely complementary to the target results in forced mutations in the repertory library so produced. It has been shown that forced mutations influence the functionality of the IGVDs, therefore, a method that reduces the number of primer-forced mutations would significantly increase the size of a functional repertory library. See for example Kipriyanov SM ef al, Two amino acid mutations in an anti-human CD3 single chain Fv antibody fragment that affect the yield on bacterial secretion but not the affinity, Protein Eng.
- de Haard H, et al Vernier zone residue 4 of mouse subgroup II kappa light chains is a critical determinant for antigen recognition, Immunotechnology, (1999), 4(3-4), p203-15; de Haard HJ, et al, Absolute conservation of residue 6 of immunoglobulin heavy chain variable regions of class MA is required for correct folding, Protein Eng (1998),1 1 (12), p1267-76; Honegger A, Pluckthun A.J, The influence of the buried glutamine or glutamate residue in position 6 on the structure of immunoglobulin variable domains, Mol Biol (2001), 309(3), p687-99; Jung S, et al, The importance of framework residues H6, H7 and H10 in antibody heavy chains: experimental evidence for a new structural subclassification of antibody V(H) domains, J Mol Biol (2001 ), 309(3), p701 -16; Langedijk AC, et al, The nature of antibody
- Patent application number WO 01/79481 discloses a method for constructing a library of VH genes using a method to amplify the product of a poly-dT-primed cDNA synthesis.
- a species-specific primer that anneals to the constant region is used.
- a synthetic tail is added to the start of the gene by using RT Cap Extension. Subsequent steps are required to remove the non-coding regions and to create restriction enzyme sites required for cloning.
- the method uses several consecutive DNA polymerizations which are known to introduce unwanted mutations and to decrease the yield of library diversity.
- the method of the present invention is an alternative method for repertory cloning of IGVDs and starts from a sample comprising messenger RNA.
- This novel method uses only one species-specific primer which anneals to a sequence located at or adjacent to the 3' end of the antisense strand of the IGVD sequence after first strand cDNA synthesis from mRNA.
- the double stranded DNA so produced encompasses the IGVD sequence and all of the constant region.
- the method also represents a significant cost-time saving over methods of the art because the need to optimise the annealing of the 3'-end primer for every species is obviated, and the number of procedural steps is appreciably reduced.
- the present invention relates to an efficient method for the cloning of immunoglobulin variable domain (IGVD) sequences.
- IGVD immunoglobulin variable domain
- VH immunoglobulin variable domain
- heavy chains are encoded by a "rearranged" gene which is built from three gene segments: an "unrearranged" VH gene (encoding the N-terminal three framework regions, first two complete CDRs and the first part of the third CDR), a diversity (DH)segment (encoding the central portion of the third GDR) and a joining segment (JH) (encoding the last part of the third CDR and the fourth framework region).
- VH immunoglobulin variable domain
- each unrearranged VH gene is linked to one DFI gene and one JH gene.
- the rearranged gene corresponds to VH-DHJH.
- This rearranged gene is linked to a gene which encodes the constant portion of the Ig chain.
- a repertoire of IGVD consisting of at least part of the variable heavy domain of a molecule from the immunoglobin superfamily is an end product of processes involving methods according to the present invention.
- a repertoire of IGVD consisting of at least part of the light chain variable domain of a molecule from the immunoglobin superfamily is an end product of processes involving methods according to the present invention.
- a repertoire of IGVD consists of at least part of the heavy chain variable domain of a molecule from the immunoglobin superfamily and at least part of the variable light domain of a molecule from the immunoglobin superfamily.
- the term "repertoire" in relation to immunoglobins means a range of differing antibody specificities which approximates to or resembles that seen in an animal.
- the invention provides a method for cloning IGVD polynucleotide sequences, said method comprises: (a) providing a sample comprising mRNA, (b) carrying out a first strand cDNA synthesis, (c) producing double stranded DNA by use of a first primer that is capable of hybridizing to a site at or adjacent to the start of the IGVD on the antisense strand, (d) cleaving said double stranded DNA with a restriction enzyme specific for a restriction site positioned such that cleavage with the restriction enzyme directed thereto produces double stranded DNA encoding a functional IGVD fragment (e) cloning the resulting IGVD sequences into a vector.
- a IGVD polynucleotide sequence is a heavy chain variable domain (HCVD) polynucleotide sequence or a light chain variable domain (LCVD) polynucleotide sequence.
- a repertoire of IGVD polynucleotide sequences comprises HCVD polynucleotide sequences and/or light chain variable domain polynucleotide sequences.
- the fragment of IGVD double stranded DNA generated according to the cleaving of step (d) may contain less, more or exactly the number of nucleotide residues of full length IGVD, however, in all cases the fragment generated is capable of binding to antigen.
- a method of the present invention can start from isolated mRNA.
- mRNA may be isolated in a known manner from a cell or cell line which is preferentially known to produce immunoglobulins.
- mRNA may be separated from other RNA by oligo-dT chromatography or other methods known in the art.
- a complementary strand of cDNA may then be synthesized on the mRNA template, using reverse transcriptase and a suitable primer (called herein a "universal primer”), to yield a cDNA/mRNA heteroduplex.
- a suitable universal primer comprises an oligo-dT or alternatively can comprise a set of random primers.
- the species specific primer can be a single species-specific primer, or a mixture of species-specific primers.
- the species-specific primer anneals to a sequence located at or adjacent to the 3' end of the antisense strand of the IGVD sequence.
- the term "at or adjacent” means that the primer anneals to a polynucleotide sequence that encodes the N-terminal end of the IGVD sequence. Ideally the primer anneals "at" the 3' end of the anti-sense strand of the IGVD sequence.
- the primer anneals "adjacent" to the 3' end of the anti-sense strand of the HCVD sequence, meaning that extra DNA, not belonging to the IGVD sequence is also cloned at the 5'-end of the sense strand. Annealing of said primer(s) occurs under conditions which allow said primer(s) to hybridise to the nucleic acid.
- the term "species-specific” means here that the primers are designed to anneal with sequences at or adjacent to the 3' end of the anti-sense strand of the IGVD sequences of one particular species, e.g. mouse, human, camelid- species.
- said species-specific primer may be one single primer having a consensus polynucleotide sequence derived from all the families of heavy chain variable region genes but may also consist of a plurality of primers having a variety of sequences designed to be complementary to the various families of IGVD sequences known. Since the primers may not have a sequence exactly complementary to the target sequence to which it is to be annealed, for instance because of nucleotide variations or because of the introduction of a restriction enzyme recognition site, it may be necessary to adjust the conditions in the annealing mixture to enable the primers to anneal to the double stranded nucleic acid. This procedure is well known to the person skilled in the art.
- the species-specific primer comprises a sequence including a restriction enzyme recognition site.
- the sequence recognized by the restriction enzyme does not need to be in the part of the primer which anneals to the double stranded nucleic acid, but may be provided as an extension which does not anneal.
- the use of a primer or a combination of primers with one or more restriction sites has the advantage that the DNA can be cut with at least one restriction enzyme which can leave 3' or 5' overhanging nucleotides or blunted ends.
- An important element of the present invention is that the isolation of IGVD sequences occurs with only one species specific primer.
- the double stranded cDNA produced using a species-specific primer according to the invention comprises the region between the species-specific primer and the site used to prime cDNA synthesis from mRNA. It thus comprises at least the IGVD and all of the constant region.
- the double stranded cDNA so produced may be used for cloning as described below. Alternatively, it may be amplified prior to cloning using the species specific primer, and a second primer that binds to a site downstream from the 3' end of the sense strand of the IGVD sequence and that is not species-specific.
- the second primer can comprise a sequence that anneals to a consensus region downstream of the 3' end of the sense strand of the IGVD sequence, and that is present across all species (i.e.
- the second primer comprises the sequence that is used to prime the synthesis of cDNA from mRNA (the universal primer) according to the invention. Where cDNA synthesis is primed using a set of random primers, the second primer comprises a mixture of said random primers. Alternatively, the second primer is a sequence that comprises oligo-dT.
- the double stranded cDNA may be amplified according to methods known in the art.
- the amplification method comprises the following steps: (a) denaturing the sample comprising cDNA to separate the two strands, (b) annealing to said sample the species-specific primer and a second primer, under conditions which allow said primers to hybridise to the nucleic acid, (c) adding to the annealed sample a DNA polymerase enzyme in the presence of deoxynucleoside thphosphates under conditions which cause primer extension to take place and (d) denaturing the sample under conditions such that the extended primers become separated from the sequence.
- the method further includes step (e) wherein steps (b) to (d) are repeated a plurality of times.
- the denaturing step (d) may for example be carried out by heating the sample, by use of chaotropic agents, such as urea or guanidine, or by the use of changes in ionic strength of pH.
- denaturing is carried out by heating since this is readily reversible.
- heating it will be usual to use a thermostable DNA polymerase since this will not need to be replenished at each cycle.
- the product, double stranded cDNA may be separated from the mixture by for instance gel electrophoresis using agarose gels. Alternatively the double stranded cDNA may be used without purification and cloned according to the methods described below.
- the double stranded cDNA produced using a specific-specific primer and a second primer according to the invention comprises at least IGVD and part of the constant region.
- the double stranded cDNA is made from the cDNA/mRNA heteroduplex by a DNA amplification step.
- the template for the amplification is the cDNA/mRNA duplex formed after first strand cDNA synthesis from a suitable universal primer.
- the primers used to amplify the template are the species-specific primer and the second primer as described above.
- the cDNA/mRNA heteroduplex may be amplified according to methods known in the art or according to the example described above.
- the double stranded cDNA produced using a specific-specific primer and a second primer according to the invention comprises at least IGVD and part of the constant region.
- the inventors have surprisingly found that when the unique restriction site present (in a rearranged IGVD) at the junction of the IGVD and constant region (more precisely at the 3'- end of the framework IV (4) region) is utilized for cloning, the diversity of the library so produced is a significant advancement on the prior art.
- a suitable restriction site has been found to be the SsEII-recognition site.
- the double stranded cDNA produced according to the invention may be cleaved using appropriate restriction enzymes, for example, SsEII in the case of humans and camelids, and the restriction enzyme that is encoded by the species-specific primer.
- the resulting restriction fragments can be separated and isolated by agarose gel electrophoresis, for example.
- the choice of the restriction site is such that the double stranded cDNA can be conveniently cloned into an expression vector, such that the functional IGVD can be expressed.
- An example of a suitable restriction site is Ss , as described above.
- Other restriction sites may be used according to the invention. Sites may be screened by persons skilled in the art using known techniques. For example, a repertory library of double stranded DNA generated according to the invention may be screened for suitable restriction sites using a binding assay and a collection of restriction enzymes. The fragments generated after digestion are cloned and tested for binding. The presence of one or more suitably located restriction sites are indicated by a cleavage product which expresses a functional IGVD fragment.
- the restriction site is located towards the 3' end of the IGVD, preferably at the junction between the IGVD and constant region.
- the fragment of IGVD double stranded DNA generated after cleavage by said restriction site may contain less, more or exactly the number of nucleotide residues of full length IGVD, however, in all cases the fragment generated is capable of binding to antigen.
- the method of the present invention for repertoire cloning of IGVDs can be carried out starting from a sample comprising cDNA.
- Said cDNA is preferentially derived from lymphocytes.
- Methods for making cDNA from mRNA are well known to the person skilled in the art.
- the reverse transcription of the first (antisense) strand can be performed in any manner with any suitable universal primer. See, for example, de Haard HJ, et al (1999), A large non-immunized human Fab fragment phage library that permits rapid isolation and kinetic analysis of high affinity antibodies J Biol Chem 274,18218-18230.
- the cDNA may be amplified using species-specific primers and a second primer, such as a universal primer as described previously.
- the product may be separated from the mixture by gel electrophoresis, for example. Alternatively, it may be used without purification and inserted directly into a suitable cloning vector. Either way, use is made of the unique restriction between the IGVD and the constant region as described previously.
- a species specific primer can be omitted.
- synthetic sequences also called adaptor sequences
- RT CapExtension is only one example and is described in patent application number WO 01/179481 which is herein incorporated by reference.
- the synthetic sequences or adaptor sequences comprise one or more restriction sites that can be used for cloning. In this way a repertoire of, for example, human or camelid variable heavy chains can be isolated by cleavage with BstEW (which resides in framework 4) and a restriction enzyme which is encoded by the adaptor ligated to the cDNA.
- an alternative method provides a technique for cloning human or camelid immunoglobulin IGVD sequences comprising (1) providing a sample comprising mRNA, (2) carrying out a cDNA synthesis, (3) ligating an adaptor sequence comprising at least one restriction enzyme to the 5' end of the DNA, (3a) optionally amplifying the sequence using the adapter sequence and the universal sequence as primers, (4) cleaving the resulting DNA with Ss/EII and a restriction enzyme encoded by said adaptor and (5) cloning the resulting human or camelid IGVD sequences into a vector.
- a "vector” as mentioned herein is any genetic element, e.g. a plasmid chromosome, a virus, behaving either as an autonomous unit of polynucleotide replication within a cell (i.e. capable of replication under its own control) or being rendered capable of replication by insertion into a host cell chromosome, having attached to it another polynucleotide segment, so as to bring about the replication and/or expression of the attached segment.
- Suitable vectors include, but are not limited to, plasmids, bacteriophages and cosmids.
- “Expression vectors” may contain polynucleotide sequences which are necessary to effect ligation or insertion of the vector into desired host cell and to effect the expression of the attached segment.
- expression vectors may be capable of directly expressing gene products, such as a repertoire of variable heavy chain products encoded therein without ligation or integration of the vector into host cell DNA sequences.
- mRNA can comprise peripheral blood cells, bone marrow cells, spleen cells or lymph node cells (such as B-lymphocytes or plasma cells), patients suffering from at least one autoimmune disorder or cancer, patients suffering from autoimmune diseases such as systemic lupus erythematosus, systemic sclerosus, rheumatoid arthritis, antiphospholipid syndrome or vasculitis.
- autoimmune disorders such as systemic lupus erythematosus, systemic sclerosus, rheumatoid arthritis, antiphospholipid syndrome or vasculitis.
- first strand cDNA synthesis that forms part of the method of the present invention can be carried out via random priming or via oligo-dT-priming. Both priming methods are well known in the art and do not need further explanation.
- the species-specific primer encodes for at least one restriction enzyme.
- at least one restriction enzyme site can be encoded by a sequence comprising the primer, wherein said restriction enzyme site(s) does not need to anneal with the 3' end on the anti-sense strands of each of the IGVD sequences.
- the IGVD can be derived from animals of the camelid family.
- immunoglobulins devoid of light polypeptide chains are found.
- IGVD sequences derived from camelids are therefore HCVDs and are designated as VHH's.
- "Camelids" comprise old world camelids (Camelus bact anus and Camelus dromaderius) and new world camelids (for example Lama paccos, Lama glama, Llama guanacoe and Lama vicugna).
- European Patent number 0 656 946 describes the isolation and uses of camelid immunoglobulins and is incorporated herein by reference.
- the method of the present invention provides an expression library comprising a repertoire of IGVD polynucleotide sequences.
- said IGVD polynucleotide sequences are HCVD polynucleotide sequences.
- said IGVD polynucleotide sequences are LCVD polynucleotide sequences.
- said IGVD polynucleotide sequences are HCVD polynucleotide sequences and LCVD polynucleotide sequences.
- hydrophobic residues which would normally be at the interface of the IGVD with the light chain variable domain could be mutated to more hydrophilic residues to improve solubility; residues in the CDR loops could be mutated to improve antigen binding; residues on the other loops or parts of the beta-sheet could be mutated to introduce new binding activities.
- Mutations could include single point mutations, multiple point mutations or more extensive changes and could be introduced by any of a variety of recombinant DNA methods, for example gene synthesis, site directed mutagenesis or the polymerase chain reaction.
- the method of the present invention may be used to make variations in the sequences encoding the IGVDs.
- this may be achieved by using mutagenic nucleotide triphosphates during the amplification step such that point mutations are scattered throughout the target region.
- point mutations are introduced by performing a large number of cycles of amplification, as errors due to the natural error rate of the DNA polymerase are amplified, particularly when using high concentrations of nucleoside triphosphates.
- the basic techniques for manipulating Ig molecules by recombinant DNA technology are extensively described in the art (see for example: Antibody Engineering, A practical approach, ed. J. McCafferty, H.R. Hoogenboom and D.J. Chiswell).
- One embodiment of the present invention is a method for cloning polynucleotide sequences encoding immunoglobulin variable domains (IGVD):
- Another embodiment of the present invention is a method as defined above wherein the double stranded DNA produced in step (c) is subsequently amplified using said first primer and said universal primer.
- step (c) is an amplification step comprising use of said first primer and said universal primer, and the product of step (b) as the template.
- Another embodiment of the present invention is a method as defined above wherein the universal primer comprises the sequence of oligo-dT.
- Another embodiment of the present invention is a method as defined above wherein the universal primer comprises the sequence of a set of random primers.
- Another embodiment of the present invention is a method as defined above, wherein said first primer encodes for at least one enzyme restriction site.
- Another embodiment of the present invention is a method as defined above wherein said sample comprises mRNA derived from lymphocytes.
- Another embodiment of the present invention is a method as defined above wherein the restriction site of step (d) is Ss/EII.
- Another embodiment of the present invention is a method as defined above, wherein said mRNA is derived from humans.
- Another embodiment of the present invention is a method as defined above, wherein said mRNA is derived from camelids.
- Another embodiment of the present invention is a method as defined above wherein said vector is an expression vector able to express at least part of IGVD polynucleotide sequences.
- Another embodiment of the present invention is a method as defined above wherein said IGVD polynucleotide sequences are heavy chain variable domain polynucleotide sequences.
- Another embodiment of the present invention is a method as defined above wherein said IGVD polynucleotide sequences are light chain variable domain polynucleotide sequences.
- Another embodiment of the present invention is a method as defined above wherein said IGVD polynucleotide sequences are heavy chain variable domain and light chain variable domain polynucleotide sequences.
- Another embodiment of the present invention is an expression library obtainable by a method as defined above comprising a repertoire of IGVD polynucleotide sequences.
- Another embodiment of the present invention is an expression library obtained by a method as defined above comprising a repertoire of IGVD polynucleotide sequences.
- Another embodiment of the present invention is an IGVD polynucleotide obtainable according to the methods as defined above.
- Another embodiment of the present invention is an IGVD polynucleotide obtained according to the methods as defined above.
- Another embodiment of the present invention is a diagnostic assay based on the use of an expression library as defined above, or an IGVD polynucleotide as defined above.
- Another embodiment of the present invention is a diagnostic report obtained from the diagnostic assay as defined above.
- Another embodiment of the present invention is a use of a polypeptide obtained after expression of one of the cloned sequences as defined above for the manufacture of a medicament.
- Figure 1 Comparison of the titres of phage prepared using a single species-specific primer, and using two species specific primer, according to Example 2. Key: — — two IgG derived primers; —A— experimental blank, two primer method; — ⁇ — a single IgG primer combined with oligo-dT; — ⁇ — experimental blank, one primer method.
- FIG. 1 Agarose electophoresis gel showing the amplification of two fragments (1650 and 1300) resulting from a VHH cDNA repertoire according to Example 2.
- Figure 3. Agarose electophoresis gel showing the results of a restriction digest with BstEII. Over 90% of amplified fragments contain an internal Ss site according to Example 2.
- VHH Creating a repertoire library of anti - potyvirus Y coat protein VHH a. Immunisation Potyvirus Y coat protein, carboxyterminally linked to a hexahistidine peptide (PVYCP-His 8 ) was recombinantly expressed in Esche chia coli. At day 1 , dromedary '48' was injected with 1 mg of PVYCP-His 6 in Freund's complete adjuvant. At days 8, 15, 22, 29, and 36 a dose of 1 mg PVYCP-His 6 in Freund's incomplete adjuvant was injected. One week after the last PVYCP-His 6 boost, 50 ml of blood was collected from the immunised dromedary. b.
- PVYCP-His 8 carboxyterminally linked to a hexahistidine peptide
- mRNA and cDNA preparation Peripheral blood lymphocytes (PBL's) were isolated on UNI-SEP MAXI tubes (Wak Chemie Medica) according to the manufacturer's protocol, divided into aliquots of 10 7 cells, and stored at -80°C. mRNA was isolated from 10 7 PBL's using the Quickprep Micro mRNA Purification Kit (Amersham Pharmacia Biotech). This mRNA was used as a template in a RT-PCR using primer oligo-dT to synthesise the first strand of cDNA (Ready-To-Go Kit, Amersham Pharmacia Biotech).
- the Expand High Fidelity PCR System (Roche) was used in all following PCR amplifications and each time a 'hot start' was performed by adding the polymerase during the third minute of the first three minutes of denaturing. To amplify the VHH repertoire, three consecutive PCR amplifications were performed. In a first PCR (PCR1) with primers L3b (5'- GGCTGAGCTCGGTGGTCCTGGCT-3' (SEQ ID NO: 1), annealing to the IgG leader sequence) and oligo-dT (annealing to the polyA sequence which is located downstream of the IgG coding sequences), 2 ⁇ l of the synthesised dromedary cDNA was used as template.
- L3b primers L3b
- oligo-dT annealing to the polyA sequence which is located downstream of the IgG coding sequences
- VHHs were separated from VHs by 1.2% agarose gel electrophoresis. The fragments corresponding to VHHs (expected size of 1.2-1.3 kb) were excised from gel, purified with the Qiaquick Gel Extraction Kit (Qiagen) and the DNA concentration was determined.
- SMI8 (5'-CCAGCCGGCCATGGCTCAGGTGCAGCTGGTGGAGTCTGG-3') (SEQ ID NO:3) as the upstream primers and ologo-dT as the downstream primer.
- the template was denatured for 3 minutes at 94°C, followed by 25 cycles of 20 seconds at 94 °C, 1 minute at 48 °C and 3 minutes at 72 °C.
- the amplification was completed with an additional elongation step at 72 °C for 10 minutes.
- the amplified 1.2-1.3 kb 20 fragments were gel-purified (Qiaquick Gel Extraction Kit) and the DNA concentration was determined.
- PCR3 To introduce a Sfi ⁇ restriction site (bold in primer sequence) at the 5' end, a third PCR (PCR3) was performed, with A4short (5'-
- CATGCCATGACTCGCGGCCCAGCCGGCCATGGC-3' (SEQ ID NO: 4) as the upstream primer and oligo-dT using 5 ⁇ g of the PCR2 purified as the template.
- the experimental conditions for this PCR were identical as for PCR2.
- the amplified fragments resulting from PCR3 were purified with the Qiaquick PCR purification Kit (Qiagen). Approximately 5 pg of PCR3 amplification product was doubly digested with Sfi ⁇ and SsrEII, the latter restriction site being present in framework 4 of the dromedary VHHs.
- Restriction fragments were separated by agarose gel electrophoresis and fragments with an approximate size of 380 bp were excised and purified with the Qiaquick Gel Extraction Kit.
- Approximately 350 ng of Sffl-SsEII digested VHH repertoire was ligated into 1200 ng of the corresponding restriction sites of phagemid pHEN4 (Ghahroudi et at. 1997), using 2 ⁇ l of the highly concentrated T4 DNA ligase (20 units/ ⁇ l, Promega) in a total volume of 500 ⁇ l. After an overnight incubation at 14°C, the ligation reaction was purified by a double phenol and a subsequent chloroform extraction.
- DNA was precipitated by adding 0.1 volume of 5M LiCI and 2.5 volume of cold 100% ethanol followed by a 30-minute -20°C incubation. DNA was pelleted and washed with 70 % ethanol. The DNA pellet was air-dried and dissolved in 80 ⁇ l of water. Twelve transformations were performed in 0.1 cm cuvettes using the E. coli pulser (Biorad) at 2.5 M ⁇ and 1.8 kV with 5 ⁇ l (each containing an equivalent of 50 ng of vector) of purified ligated construct mixed with freshly prepared TG1 electrocompetent cells (Sambrook and Russell 2001 Molecular Cloning A laboratory manual third edition, Cold spring harbor Laboratory press Cold spring harbor, New York, Page 1.120-1.121).
- llama (Llama glama) was immunized with the human targets IgE, carcinoembryonic antigen (CEA), von Willebrand factor (vWF) and interleukin-6 (IL-6).
- the targets were formulated as an emulsion with an appropriate, animal-friendly adjuvant (Specoll, CEDI Diagnostics B.V.).
- the antigen cocktail was administered by double-spot injections intramuscularly in the neck.
- the animal received 6 injections of the emulsion, containing between 100 and 25 ⁇ g of each antigen at weekly intervals.
- 10 ml blood samples were collected from the animal and sera were prepared.
- HcAbs conventional and heavy-chain antibodies
- Peripheral blood lymphocytes as the genetic source of the llama heavy chain immunoglobulins, were isolated from the 150 ml blood sample using a Ficoll-Paque gradient (Amersham Biosciences) yielding 5x10 8 PBLs.
- the maximal diversity of antibodies is expected to be equal to the number of sampled B- lymphocytes, which is about 10% of the number of PBLs (5x10 7 ).
- the fraction of heavy-chain antibodies in llama is up to 20% of the number of B-lymphocytes. Therefore, the maximal diversity of HcAbs in the 150 ml blood sample is calculated as 10 7 different molecules.
- RNA (around 400 ⁇ g) was isolated from these cells using an acid guanidinium thiocyanate extraction (Chomczynski P and Sacchi N (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162. 156-159.).
- cDNA was prepared on 100 ⁇ g total RNA with M-MLV Reverse Transcriptase (Gibco BRL) and a hexanucleotide random primer (Amersham Biosciences) as described before (de Haard et al., 1999).
- the cDNA was purified with a phenol/chloroform extraction combined with an ethanol precipitation and subsequently used as template to specifically amplify the VHH repertoire.
- the repertoire was amplified in a hinge-dependent approach using two IgG specific oligonucleotide primers.
- FR1 degenerated frameworkl (FR1) primer ABL013 (5'-GAGGTBCARCTGCAGGASTCYGG-3') was combined with a short (5'- AACAGTTAAGCTTCCGCTTGCGGCCGCGGAGCTGGGGTCTTCGCTGTGGTGCG-3') or long (5'-AACAGTTAAGCTTCCGCTTGCGGCCGCTGGTTGTGGTTTTGGTGTCTTGGGTT- 3') hinge primer known to be specific for the amplification of heavy-chain variable region gene segments.
- the ligation mixture was desalted on a Microcon filter (YM-50, Millipore) and electroporated into E. coli TG1 cells to obtain a library containing 1.8x10 7 clones.
- the transformed cells were grown overnight at 37°C on a single 20x20 cm plate with LB containing 100 ⁇ g/ml ampicillin and 2% glucose. The colonies were scraped from plates using 2xTY medium and stored at -80°C in 20 % glycerol.
- As quality control the percentage of insert-containing clones was verified on 24 clones for each library by PCR using a combination of vector based primers. This analysis revealed that 95% of the clones contained a VHH encoding insert.
- oligo-dT primed cDNA was prepared on 100 ⁇ g of total RNA (de Haard et al., 1999).
- the VHH repertoire was amplified in three consecutive PCR amplifications as described in Example 1.
- PCR1 using oligo-dT and the primer that anneals to the immunoglobulin signal sequence results in the amplification of two fragments of 1650 bp and 1300 bp, the latter being the product derived from the CH1 -deleted HcAb genes (see Figure 2).
- This fragment was excised from gel and used for re-amplification with the oligo-dT primer, and a FR1 primer which introduced a ⁇ /col-restriction site.
- the reamplified 1300 bp fragment was excised from gel and used in a third reamplification (PCR3) with the oligo-dT primer, and primer A4short which introduced a Sfil-restriction site.
- PCR3 third reamplification
- Approximately 10 ⁇ g of amplified VHH- harbohng fragments were doubly digested with Sfi ⁇ -BslE ⁇ .
- Sfi ⁇ -BslE ⁇ Sfi ⁇ -BslE ⁇ .
- agarose gelelectrophoresis we estimated that more than 90% of the PCR3 product contained an internal Ss/EII restriction site (see Figure 3).
- a single degenerated FR1 primer ABL013 was used in combination with the oligo-dT primer to amplify the llama VHH repertoire.
- Single step PCR amplifications to recover the llama VHH repertoire were performed as described in PCR1 of example 1.
- the gel purified PCR products were digested with Sffl (or Pstt when ABL013 was used) and SsEII.
- Ss/EII-site frequently occurs within the FR4 of heavy-chain derived VHH encoding DNA-fragments as >90% of the purified PCR product was internally digested with BstEW.
- 300 ng of S/vl-Ss/EII digested fragments was ligated in the phagemid vector pAX004.
- the ligation reaction was incubated for 16 hours at room temperature using 10 units of T4 DNA ligase (Promega) in a total reaction volume of 300 ⁇ l. After adding two extra ligase units and subsequent incubation for 2 more hours at room temperature, the ligation mixture was purified with a double phenol and a chloroform extraction followed by an ethanol precipitation. The precipitated DNA was additionally washed with 70 % ethanol, air-dried and dissolved in 50 ⁇ l HPLC-grade water.
- the purified ligation mix was divided in five equal aliquots and independently electroporated into 200 ⁇ l of electrocompetent E. coll TG1 cells with the micropulser (Biorad) at 1.8 kV using five 0.2 cm cuvettes.
- the transformed cells in each cuvette were recovered with 1 ml of 2xTY.
- Selection of pAX004-containing TG1 cells was performed on a single 20x20 cm plate with LB medium containing 100 ⁇ g/ml ampicillin and 2% glucose to yield a library with 1.4x10 7 clones.
- the same type of quality control was performed as in section i), showing that 100% of the clones contained an insert of the appropriate size and confirmed the presence of a diverse repertoire.
- the titer of phages was determined by infection of logarithmic TG1 cells followed by plating on selective medium.
- the titers of antigen-specific VHH fragments isolated from both libraries were compared by phage ELISA. Phages were applied to antigen coated (1 ⁇ g/ml) Maxisorp ELISA plates in duplo dilutions starting at 2x10 10 phages/ml. Bound phages were detected by incubation with an anti-M13 horse radish peroxidase conjugate and subsequent development. For all antigens tested, antigen specific phage titers were significantly higher when phages were rescued from the library expressing the repertoire amplified with a single IgG specific primer ( Figure 1).
- phages were rescued as described in section c.
- Antigen-specific binders were selected using the principle of phage display and a single round of biopanning on solid phase coated TNF ⁇ , vWF, CEA or IL-6 at concentrations of 5 ⁇ g/ml (Marks JD, et al (1991) By-passing immunization. Human antibodies from V-gene libraries displayed on phage. J. Mol. Biol. 222, 581-597., 1991 ; Hawkins RE, et al (1992) Selection of phage antibodies by binding affinity. Mimicking affinity maturation.
- the conditions of the amplification reaction were identical to PCR2 (Example 1) using the appropriate (set of) FR1 primers and an IgG- (5'-GTCCACCTTGGTGTTGCTGGGCTT-3') or IgM-specific primer (5'-TGGAAGAGGCACGTTCTTTTCTTT-3') that anneals to the CH1 domain.
- an IgG- 5'-GTCCACCTTGGTGTTGCTGGGCTT-3'
- IgM-specific primer 5'-TGGAAGAGGCACGTTCTTTTCTTT-3'
- the presence of a unique SsEII restriction site in 5 of the 6 human J-genes indicates that the 1.6 and 2.1 kb fragments correspond to IgG and IgM, respectively. Based on the amount of undigested fragment, we estimate that >90% of the IgG or IgM amplification products carry an internal SsEII restriction site, making it a suitable candidate for VH repertoire cloning.
- the VH repertoire can be reamplified with oligo-dT combined with a set of FR1 primers introducing a unique restriction site such as SfH that can be used for VH repertoire cloning.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Immunology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Pulmonology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2003554732A JP4323317B2 (ja) | 2001-12-21 | 2002-12-20 | 可変領域配列のクローニング方法 |
| EP02795255A EP1456237A2 (en) | 2001-12-21 | 2002-12-20 | Method for cloning of variable domain sequences |
| US10/499,500 US20050037358A1 (en) | 2001-12-21 | 2002-12-20 | Method for cloning of variable domain sequences |
| CA002471116A CA2471116A1 (en) | 2001-12-21 | 2002-12-20 | Method for cloning of variable domain sequences |
| AU2002360068A AU2002360068B2 (en) | 2001-12-21 | 2002-12-20 | Method for cloning of variable domain sequences |
| NO20043066A NO20043066L (no) | 2001-12-21 | 2004-07-19 | Fremgangsmate for kloning av variabel-domene sekvenser |
| US11/519,750 US20070009527A1 (en) | 2001-12-21 | 2006-09-12 | Method for cloning of variable domain sequences |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP01205100 | 2001-12-21 | ||
| EP01205100.9 | 2001-12-21 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/519,750 Continuation US20070009527A1 (en) | 2001-12-21 | 2006-09-12 | Method for cloning of variable domain sequences |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2003054016A2 true WO2003054016A2 (en) | 2003-07-03 |
| WO2003054016A3 WO2003054016A3 (en) | 2004-02-19 |
| WO2003054016A8 WO2003054016A8 (en) | 2004-09-30 |
Family
ID=8181517
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2002/014662 Ceased WO2003054016A2 (en) | 2001-12-21 | 2002-12-20 | Method for cloning of variable domain sequences |
Country Status (7)
| Country | Link |
|---|---|
| US (2) | US20050037358A1 (enExample) |
| EP (1) | EP1456237A2 (enExample) |
| JP (2) | JP4323317B2 (enExample) |
| AU (1) | AU2002360068B2 (enExample) |
| CA (1) | CA2471116A1 (enExample) |
| NO (1) | NO20043066L (enExample) |
| WO (1) | WO2003054016A2 (enExample) |
Cited By (162)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006106331A3 (en) * | 2005-04-06 | 2007-03-29 | Ucb Sa | Mouse primers |
| WO2006106336A3 (en) * | 2005-04-06 | 2007-03-29 | Ucb Sa | Rat primers |
| EP1900753A2 (en) | 2002-11-08 | 2008-03-19 | Ablynx N.V. | Method of administering therapeutic polypeptides, and polypeptides therefor |
| FR2924440A1 (fr) * | 2007-12-04 | 2009-06-05 | Pierre Fabre Medicament Sa | Nouveau procede de generation et de criblage d'une banque d'anticorps |
| WO2009138519A1 (en) | 2008-05-16 | 2009-11-19 | Ablynx Nv | AMINO ACID SEQUENCES DIRECTED AGAINST CXCR4 AND OTHER GPCRs AND COMPOUNDS COMPRISING THE SAME |
| WO2010010119A1 (en) | 2008-07-22 | 2010-01-28 | Ablynx Nv | Amino acid sequences directed against multitarget scavenger receptors and polypeptides |
| WO2010100135A1 (en) | 2009-03-05 | 2010-09-10 | Ablynx N.V. | Novel antigen binding dimer-complexes, methods of making/avoiding and uses thereof |
| EP2251357A1 (en) | 2003-11-07 | 2010-11-17 | Ablynx N.V. | Camelidae single domain antibodies VHH directed against epidermal growth factor receptor and uses therefor |
| EP2267032A2 (en) | 2002-11-08 | 2010-12-29 | Ablynx N.V. | Method of administering therapeutic polypeptides, and polypeptides therefor |
| WO2011003622A1 (en) | 2009-07-10 | 2011-01-13 | Ablynx N.V. | Method for the production of variable domains |
| DE112009000507T5 (de) | 2008-03-05 | 2011-02-10 | Ablynx Nv | Neue Antigen-bindende Dimerkomplexe, Verfahren zu ihrer Herstellung und ihre Verwendung |
| WO2011026945A1 (en) | 2009-09-03 | 2011-03-10 | Ablynx N.V. | Stable formulations of polypeptides and uses thereof |
| EP2308514A2 (en) | 2007-03-23 | 2011-04-13 | to-BBB Holding B.V. | Conjugates for targeted drug delivery across the blood-brain barrier |
| WO2011067160A1 (en) | 2009-12-01 | 2011-06-09 | Ablynx Nv | Von willebrand factor specific binding agents and uses thereof |
| WO2011073180A1 (en) | 2009-12-14 | 2011-06-23 | Ablynx N.V. | Single variable domain antibodies against ox40l, constructs and therapeutic use |
| WO2011083140A1 (en) | 2010-01-08 | 2011-07-14 | Ablynx Nv | Immunoglobulin single variable domain directed against human cxcr4 |
| WO2011095545A1 (en) | 2010-02-05 | 2011-08-11 | Ablynx Nv | Peptides capable of binding to serum albumin and compounds, constructs and polypeptides comprising the same |
| WO2011098518A2 (en) | 2010-02-11 | 2011-08-18 | Ablynx Nv | Delivery of immunoglobulin variable domains and constructs thereof |
| WO2011098520A1 (en) | 2010-02-10 | 2011-08-18 | Novartis Ag | Agonist dr5 binding polypeptides |
| WO2011098552A2 (en) | 2010-02-11 | 2011-08-18 | Ablynx Nv | Methods and compositions for the preparation of aerosols |
| WO2011144749A1 (en) | 2010-05-20 | 2011-11-24 | Ablynx Nv | Biological materials related to her3 |
| WO2011161263A1 (en) | 2010-06-25 | 2011-12-29 | Ablynx Nv | Pharmaceutical compositions for cutaneous administration |
| EP2444424A1 (en) | 2005-05-20 | 2012-04-25 | Ablynx N.V. | Improved nanobodies TM for the treatment of aggregation-mediated disorders |
| WO2012056000A1 (en) | 2010-10-29 | 2012-05-03 | Ablynx Nv | Method for the production of immunoglobulin single variable domains |
| US8217140B2 (en) | 2008-04-17 | 2012-07-10 | Ablynx N.V. | Peptides capable of binding to serum proteins and compounds, constructs and polypeptides comprising the same |
| EP2479191A2 (en) | 2005-05-18 | 2012-07-25 | Ablynx N.V. | Improved nanobodiesTM against tumor necrosis factor-alpha |
| WO2012130872A1 (en) | 2011-03-28 | 2012-10-04 | Ablynx Nv | Method for producing solid formulations comprising immunoglobulin single variable domains |
| EP2514767A1 (en) | 2006-12-19 | 2012-10-24 | Ablynx N.V. | Amino acid sequences directed against a metalloproteinase from the ADAM family and polypeptides comprising the same for the treatment of ADAM-related diseases and disorders |
| WO2012152823A1 (en) | 2011-05-09 | 2012-11-15 | Ablynx Nv | Method for the production of immunoglobulin single variable domains |
| WO2012156219A1 (en) | 2011-05-05 | 2012-11-22 | Ablynx Nv | Amino acid sequences directed against il-17a, il-17f and/or il17-a/f and polypeptides comprising the same |
| WO2012163887A1 (en) | 2011-05-27 | 2012-12-06 | Ablynx Nv | Inhibition of bone resorption with rankl binding peptides |
| WO2012166906A1 (en) | 2011-05-31 | 2012-12-06 | Massachusetts Institute Of Technology | Cell-directed synthesis of multifunctional nanopatterns and nanomaterials |
| WO2012175740A1 (en) | 2011-06-23 | 2012-12-27 | Ablynx Nv | Immunoglobulin single variable domains directed against ige |
| EP2557090A2 (en) | 2006-12-19 | 2013-02-13 | Ablynx N.V. | Amino acid sequences directed against GPCRs and polypeptides comprising the same for the treatment of GPCR-related diseases and disorders |
| EP2650311A2 (en) | 2007-11-27 | 2013-10-16 | Ablynx N.V. | Amino acid sequences directed against heterodimeric cytokines and/or their receptors and polypeptides comprising the same |
| WO2013174537A1 (en) | 2012-05-24 | 2013-11-28 | Vib Vzw | Anti-macrophage mannose receptor single variable domains for targeting and in vivo imaging of tumor-associated macrophages |
| EP2698166A2 (en) | 2006-10-10 | 2014-02-19 | Regenesance B.V. | Complement inhibition for improved nerve regeneration |
| WO2014087010A1 (en) | 2012-12-07 | 2014-06-12 | Ablynx N.V. | IMPROVED POLYPEPTIDES DIRECTED AGAINST IgE |
| WO2014118297A1 (en) | 2013-01-30 | 2014-08-07 | Vib Vzw | Novel chimeric polypeptides for screening and drug discovery purposes |
| WO2014122183A1 (en) | 2013-02-05 | 2014-08-14 | Vib Vzw | Muscarinic acetylcholine receptor binding agents and uses thereof |
| WO2014140376A1 (en) | 2013-03-15 | 2014-09-18 | Vib Vzw | Anti-macrophage mannose receptor single variable domains for use in cardiovascular diseases |
| WO2014177595A1 (en) | 2013-04-29 | 2014-11-06 | Agrosavfe N.V. | Agrochemical compositions comprising antibodies binding to sphingolipids |
| WO2014184352A1 (en) | 2013-05-17 | 2014-11-20 | Ablynx Nv | Stable formulations of immunoglobulin single variable domains and uses thereof |
| EP2883883A1 (en) | 2013-12-16 | 2015-06-17 | Cardio3 Biosciences S.A. | Therapeutic targets and agents useful in treating ischemia reperfusion injury |
| EP2947097A1 (en) | 2008-04-07 | 2015-11-25 | Ablynx N.V. | Amino acid sequences directed against the Notch pathways and uses thereof |
| WO2015193452A1 (en) | 2014-06-18 | 2015-12-23 | Ablynx Nv | Kv1.3 binding immunoglobulins |
| WO2016016021A1 (en) | 2014-07-29 | 2016-02-04 | Vrije Universiteit Brussel | Radio-labelled antibody fragments for use in the prevention and/or treatment of cancer |
| EP2982690A1 (en) | 2009-04-30 | 2016-02-10 | Ablynx N.V. | Method for the production of domain antibodies |
| WO2016071438A2 (en) | 2014-11-05 | 2016-05-12 | Agrosavfe Nv | Transgenic plant comprising a polynucleotide encoding a variable domain of heavy-chain antibody |
| WO2016097313A1 (en) | 2014-12-19 | 2016-06-23 | Ablynx N.V. | Cysteine linked nanobody dimers |
| US9556273B2 (en) | 2010-03-29 | 2017-01-31 | Vib Vzw | Anti-macrophage mannose receptor single variable domains for targeting and in vivo imaging of tumor-associated macrophages |
| WO2017182603A1 (en) | 2016-04-22 | 2017-10-26 | Université Libre de Bruxelles | A new biomarker expressed in pancreatic beta cells useful in imaging or targeting beta cells |
| WO2017182605A1 (en) | 2016-04-22 | 2017-10-26 | Université Libre de Bruxelles | A new biomarker expressed in pancreatic beta cells useful in imaging or targeting beta cells |
| WO2017191108A1 (en) | 2016-05-02 | 2017-11-09 | Ablynx Nv | Treatment of rsv infection |
| WO2018007442A1 (en) | 2016-07-06 | 2018-01-11 | Ablynx N.V. | Treatment of il-6r related diseases |
| WO2018029182A1 (en) | 2016-08-08 | 2018-02-15 | Ablynx N.V. | Il-6r single variable domain antibodies for treatment of il-6r related diseases |
| US9913920B2 (en) | 2010-03-29 | 2018-03-13 | Vib Vzw | Targeting and in vivo imaging of tumor-associated macrophages |
| WO2018050833A1 (en) | 2016-09-15 | 2018-03-22 | Ablynx Nv | Immunoglobulin single variable domains directed against macrophage migration inhibitory factor |
| EP3311837A1 (en) | 2011-09-23 | 2018-04-25 | Ablynx NV | Prolonged inhibition of interleukin-6 mediated signaling |
| WO2018091606A1 (en) | 2016-11-16 | 2018-05-24 | Ablynx Nv | T cell recruiting polypeptides capable of binding cd123 and tcr alpha/beta |
| WO2018099968A1 (en) | 2016-11-29 | 2018-06-07 | Ablynx N.V. | Treatment of infection by respiratory syncytial virus (rsv) |
| WO2018158335A1 (en) | 2017-02-28 | 2018-09-07 | Vib Vzw | Means and methods for oral protein delivery |
| WO2018192974A1 (en) | 2017-04-18 | 2018-10-25 | Université Libre de Bruxelles | Biomarkers and targets for proliferative diseases |
| WO2018206734A1 (en) | 2017-05-11 | 2018-11-15 | Vib Vzw | Glycosylation of variable immunoglobulin domains |
| WO2018220234A1 (en) | 2017-06-02 | 2018-12-06 | Merck Patent Gmbh | Adamts binding immunoglobulins |
| WO2018220236A1 (en) | 2017-06-02 | 2018-12-06 | Merck Patent Gmbh | Polypeptides binding adamts5, mmp13 and aggrecan |
| WO2018220225A1 (en) | 2017-06-02 | 2018-12-06 | Ablynx Nv | Aggrecan binding immunoglobulins |
| WO2018220235A1 (en) | 2017-06-02 | 2018-12-06 | Merck Patent Gmbh | Mmp13 binding immunoglobulins |
| EP3424526A1 (en) | 2008-06-05 | 2019-01-09 | Ablynx NV | Immunoglobulin single variable domains binding to the g envelope protein of rabies virus and uses thereof for the treatment and prevention of rabies |
| WO2019016237A1 (en) | 2017-07-19 | 2019-01-24 | Vib Vzw | AGENTS FOR CONNECTING TO SERUM ALBUMIN |
| US10214588B2 (en) | 2007-07-03 | 2019-02-26 | Ablynx N.V. | Providing improved immunoglobulin sequences by mutating CDR and/or FR positions |
| US10233241B2 (en) | 2014-01-30 | 2019-03-19 | Vib Vzw | Opioid receptor binding agents and uses thereof |
| EP3470425A2 (en) | 2008-12-19 | 2019-04-17 | Ablynx N.V. | Immunoglobulins against cell-associatd antigens such as p2x7 |
| WO2019086548A1 (en) | 2017-10-31 | 2019-05-09 | Vib Vzw | Novel antigen-binding chimeric proteins and methods and uses thereof |
| WO2019155041A1 (en) | 2018-02-12 | 2019-08-15 | Vib Vzw | Gβγ COMPLEX ANTIBODIES AND USES THEREOF |
| WO2019166622A1 (en) | 2018-03-01 | 2019-09-06 | Vrije Universiteit Brussel | Human pd-l1-binding immunoglobulins |
| WO2019180204A1 (en) | 2018-03-23 | 2019-09-26 | Université Libre de Bruxelles | Wnt signaling agonist molecules |
| WO2019185723A1 (en) | 2018-03-27 | 2019-10-03 | Umc Utrecht Holding B.V. | Targeted thrombolysis for treatment of microvascular thrombosis |
| US10641779B2 (en) | 2014-07-22 | 2020-05-05 | Vib Vzw | Methods to select for agents that stabilize protein complexes |
| WO2020221888A1 (en) | 2019-04-30 | 2020-11-05 | Vib Vzw | Cystic fibrosis transmembrane conductance regulator stabilizing agents |
| WO2020221768A1 (en) | 2019-04-29 | 2020-11-05 | Confo Therapeutics N.V. | Chimeric proteins and methods to screen for compounds and ligands binding to gpcrs |
| WO2020239934A1 (en) | 2019-05-28 | 2020-12-03 | Vib Vzw | Cd8+ t-cells lacking plexins and their application in cancer treatment |
| WO2020239945A1 (en) | 2019-05-28 | 2020-12-03 | Vib Vzw | Cancer treatment by targeting plexins in the immune compartment |
| WO2021078786A1 (en) | 2019-10-21 | 2021-04-29 | Vib Vzw | Nanodisc-specific antigen-binding chimeric proteins |
| WO2021095031A2 (en) | 2019-11-11 | 2021-05-20 | Ibi-Ag Innovative Bio Insecticides Ltd. | Insect control nanobodies and uses thereof |
| WO2021105438A1 (en) | 2019-11-27 | 2021-06-03 | Vib Vzw | Positive allosteric modulators of the calcium-sensing receptor |
| WO2021116252A1 (en) | 2019-12-12 | 2021-06-17 | Vib Vzw | Glycosylated single chain immunoglobulin domains |
| WO2021123360A1 (en) | 2019-12-20 | 2021-06-24 | Vib Vzw | Nanobody exchange chromatography |
| WO2021140205A1 (en) | 2020-01-10 | 2021-07-15 | Confo Therapeutics N.V. | Methods for generating antibodies and antibody fragments and libraries comprising same |
| WO2021156490A2 (en) | 2020-02-06 | 2021-08-12 | Vib Vzw | Corona virus binders |
| WO2021170540A1 (en) | 2020-02-25 | 2021-09-02 | Vib Vzw | Leucine-rich repeat kinase 2 allosteric modulators |
| WO2021198396A1 (en) | 2020-03-31 | 2021-10-07 | Biotalys NV | Anti-fungal polypeptides |
| WO2021213435A1 (zh) | 2020-04-22 | 2021-10-28 | 迈威(上海)生物科技股份有限公司 | 一种靶向人程序性死亡配体1(pd-l1)的单可变域抗体及其衍生物 |
| WO2021229104A1 (en) | 2020-05-15 | 2021-11-18 | Université de Liège | Anti-cd38 single-domain antibodies in disease monitoring and treatment |
| EP3932945A1 (en) | 2015-11-27 | 2022-01-05 | Ablynx NV | Polypeptides inhibiting cd40l |
| WO2022003156A1 (en) | 2020-07-02 | 2022-01-06 | Oncurious Nv | Ccr8 non-blocking binders |
| WO2022023584A1 (en) | 2020-07-31 | 2022-02-03 | Biotalys NV | Methods of increasing recombinant protein yields |
| WO2022063947A1 (en) | 2020-09-24 | 2022-03-31 | Vib Vzw | Combination of p2y6 inhibitors and immune checkpoint inhibitors |
| WO2022063957A1 (en) | 2020-09-24 | 2022-03-31 | Vib Vzw | Biomarker for anti-tumor therapy |
| WO2022063984A1 (en) | 2020-09-25 | 2022-03-31 | Ablynx Nv | Polypeptides comprising immunoglobulin single variable domains targeting il-13 and ox40l |
| US11298433B2 (en) | 2015-07-17 | 2022-04-12 | Vrije Universiteit Brussel | Radiolabelled antibody fragments for use in treating cancer |
| WO2022117572A2 (en) | 2020-12-02 | 2022-06-09 | Oncurious Nv | An ltbr agonist in combination therapy against cancer |
| WO2022117569A1 (en) | 2020-12-02 | 2022-06-09 | Oncurious Nv | A ccr8 antagonist antibody in combination with a lymphotoxin beta receptor agonist antibody in therapy against cancer |
| WO2022129572A1 (en) | 2020-12-18 | 2022-06-23 | Ablynx Nv | Polypeptides comprising immunoglobulin single variable domains targeting il-6 and tnf-alpha |
| WO2022136647A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Human ccr8 binders |
| WO2022136650A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Murine cross-reactive human ccr8 binders |
| WO2022136685A1 (en) | 2020-12-23 | 2022-06-30 | Vib Vzw | Antibody compositions for treatment of corona virus infection |
| WO2022136649A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Non-blocking human ccr8 binders |
| WO2022167666A1 (en) | 2021-02-05 | 2022-08-11 | Vib Vzw | Sarbecovirus binders |
| WO2022178255A2 (en) | 2021-02-19 | 2022-08-25 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Single domain antibodies that neutralize sars-cov-2 |
| WO2022175532A1 (en) | 2021-02-19 | 2022-08-25 | Vib Vzw | Cation-independent mannose-6-phosphate receptor binders |
| WO2022175392A1 (en) | 2021-02-17 | 2022-08-25 | Vib Vzw | Inhibition of slc4a4 in the treatment of cancer |
| WO2022199804A1 (en) | 2021-03-24 | 2022-09-29 | Vib Vzw | Nek6 inhibition to treat als and ftd |
| WO2022238550A1 (en) | 2021-05-12 | 2022-11-17 | Vib Vzw | Pan-specific corona virus binders |
| WO2022242892A1 (en) | 2021-05-17 | 2022-11-24 | Université de Liège | Anti-cd38 single-domain antibodies in disease monitoring and treatment |
| WO2022268993A1 (en) | 2021-06-23 | 2022-12-29 | Vib Vzw | Means and methods for selection of specific binders |
| WO2023274183A1 (zh) | 2021-06-29 | 2023-01-05 | 江苏先声药业有限公司 | Cd16抗体及其应用 |
| WO2023006040A1 (zh) | 2021-07-30 | 2023-02-02 | 江苏先声药业有限公司 | 抗pvrig/抗tigit双特异性抗体和应用 |
| WO2023016828A2 (en) | 2021-07-30 | 2023-02-16 | Vib Vzw | Cation-independent mannose-6-phosphate receptor binders for targeted protein degradation |
| WO2023057601A1 (en) | 2021-10-06 | 2023-04-13 | Biotalys NV | Anti-fungal polypeptides |
| US11660356B2 (en) | 2014-07-29 | 2023-05-30 | Vrije Universiteit Brussel | Radio-labelled antibody fragments for use in the prognosis, diagnosis of cancer as well as for the prediction of cancer therapy response |
| WO2023098846A1 (zh) | 2021-12-03 | 2023-06-08 | 江苏先声药业有限公司 | 抗bcma纳米抗体及其应用 |
| WO2023111266A1 (en) | 2021-12-17 | 2023-06-22 | Ablynx Nv | POLYPEPTIDES COMPRISING IMMUNOGLOBULIN SINGLE VARIABLE DOMAINS TARGETING TCRαβ, CD33 AND CD123 |
| WO2023125888A1 (zh) | 2021-12-31 | 2023-07-06 | 山东先声生物制药有限公司 | 一种gprc5d抗体及其应用 |
| WO2023135198A1 (en) | 2022-01-12 | 2023-07-20 | Vib Vzw | Human ntcp binders for therapeutic use and liver-specific targeted delivery |
| WO2023148397A1 (en) | 2022-02-07 | 2023-08-10 | Vib Vzw | Engineered stabilizing aglycosylated fc-regions |
| WO2023148291A1 (en) | 2022-02-02 | 2023-08-10 | Biotalys NV | Methods for genome editing |
| WO2023198848A1 (en) | 2022-04-13 | 2023-10-19 | Vib Vzw | An ltbr agonist in combination therapy against cancer |
| WO2023213751A1 (en) | 2022-05-02 | 2023-11-09 | Umc Utrecht Holding B.V | Single domain antibodies for the detection of plasmin-cleaved vwf |
| WO2023222825A1 (en) | 2022-05-18 | 2023-11-23 | Vib Vzw | Sarbecovirus spike s2 subunit binders |
| WO2023236889A1 (zh) | 2022-06-06 | 2023-12-14 | 山东先声生物制药有限公司 | 靶向bcma、gprc5d和t细胞的多特异性抗体及其应用 |
| WO2024008755A1 (en) | 2022-07-04 | 2024-01-11 | Vib Vzw | Blood-cerebrospinal fluid barrier crossing antibodies |
| WO2024068744A1 (en) | 2022-09-27 | 2024-04-04 | Vib Vzw | Antivirals against human parainfluenza virus |
| WO2024083843A1 (en) | 2022-10-18 | 2024-04-25 | Confo Therapeutics N.V. | Amino acid sequences directed against the melanocortin 4 receptor and polypeptides comprising the same for the treatment of mc4r-related diseases and disorders |
| WO2024105091A1 (en) | 2022-11-15 | 2024-05-23 | Imec Vzw | Method and system for droplet manipulation |
| WO2024126805A1 (en) | 2022-12-15 | 2024-06-20 | Aarhus Universitet | Synthetic activation of multimeric transmembrane receptors |
| WO2024133937A1 (en) | 2022-12-22 | 2024-06-27 | Biotalys NV | Methods for genome editing |
| WO2024141645A1 (en) | 2022-12-30 | 2024-07-04 | Biotalys N.V. | Agglomerate |
| WO2024141641A2 (en) | 2022-12-30 | 2024-07-04 | Biotalys NV | Secretion signals |
| WO2024145551A1 (en) | 2022-12-29 | 2024-07-04 | Biotalys NV | Agrochemical compositions |
| WO2024141638A1 (en) | 2022-12-30 | 2024-07-04 | Biotalys NV | Self-emulsifiable concentrate |
| WO2024156881A1 (en) | 2023-01-27 | 2024-08-02 | Vib Vzw | CD8b-BINDING POLYPEPTIDES |
| WO2024156888A1 (en) | 2023-01-27 | 2024-08-02 | Vib Vzw | Cd163-binding conjugates |
| WO2024165710A1 (en) | 2023-02-09 | 2024-08-15 | Seni-Preps B.V. | Immunoglobulin single variable domains that inhibit urease and use thereof |
| WO2024175787A1 (en) | 2023-02-24 | 2024-08-29 | Vrije Universiteit Brussel | Anti-inflammatory pannexin 1 channel inhibitors |
| WO2024189171A1 (en) | 2023-03-14 | 2024-09-19 | Aarhus Universitet | Genetically altered nfr5 receptor kinases |
| WO2024208816A1 (en) | 2023-04-03 | 2024-10-10 | Vib Vzw | Blood-brain barrier crossing antibodies |
| WO2024231348A1 (en) | 2023-05-11 | 2024-11-14 | Vib Vzw | Slc4a4/nbce1 inhibitors |
| WO2024240162A1 (en) | 2023-05-23 | 2024-11-28 | Shanghai Allygen Biologics Co., Ltd. | Pd-l1 and trop-2 targeting conjugates comprising effector molecules and uses thereof |
| WO2024261344A1 (en) | 2023-06-23 | 2024-12-26 | Vib Vzw | Novel binders targeting the multi-drug resistant pathogen acinetobacter baumannii |
| EP4483951A1 (en) | 2023-06-30 | 2025-01-01 | Université de Liège | Single-domain antibody for inhibition of neutrophil elastase activity |
| WO2025078605A1 (en) | 2023-10-12 | 2025-04-17 | Synapse Research Institute | Molecules for reversing anti-coagulant activity of direct oral anticoagulants |
| WO2025093683A1 (en) | 2023-11-03 | 2025-05-08 | Neuvasq Biotechnologies Sa | Wnt7 signaling agonists |
| WO2025109176A1 (en) | 2023-11-22 | 2025-05-30 | Exevir Bio Bv | Optimized sarbecovirus spike s2 subunit binders and compositions comprising the same |
| WO2025125577A1 (en) | 2023-12-14 | 2025-06-19 | Vib Vzw | Antibodies against influenza b virus |
| EP4574981A1 (en) | 2023-12-22 | 2025-06-25 | Biotalys NV | Anti-fungal vhh antibodies |
| WO2025154056A1 (en) | 2024-01-21 | 2025-07-24 | Ibi-Ag Innovative Bio Insecticides Ltd. | Anti-insect cda nanobodies and uses thereof |
| WO2025154058A1 (en) | 2024-01-21 | 2025-07-24 | Ibi-Ag Innovative Bio Insecticides Ltd. | Anti-insect hsp70 nanobodies and uses thereof |
| WO2025181155A1 (en) | 2024-02-26 | 2025-09-04 | Vib Vzw | Human beta-glucocerebrosidase binders and uses thereof |
| WO2025196308A1 (en) | 2024-03-22 | 2025-09-25 | Vib Vzw | Means and methods for displaying fc-containing proteins on cells and selection thereof |
| WO2025219231A1 (en) | 2024-04-15 | 2025-10-23 | Vib Vzw | Computer-implemented means and methods for the de novo design of antibodies targeting a specific epitope |
| WO2025238157A1 (en) | 2024-05-15 | 2025-11-20 | Katholieke Universiteit Leuven | Multispecific binding agent suitable for use in cancer immune therapy |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1999147A1 (en) * | 2006-03-27 | 2008-12-10 | Ablynx N.V. | Medical delivery device for therapeutic proteins based on single domain antibodies |
| CA2660592C (en) * | 2006-05-26 | 2016-07-12 | Macrogenics, Inc. | Humanized fc.gamma.riib-specific antibodies and methods of use thereof |
| CA2657763C (en) * | 2006-08-03 | 2016-05-31 | Vaccinex Inc. | Anti-il-6 monoclonal antibodies and uses thereof |
| EP2088432A1 (en) * | 2008-02-11 | 2009-08-12 | MorphoSys AG | Methods for identification of an antibody or a target |
| NZ596603A (en) | 2009-05-29 | 2013-07-26 | Morphosys Ag | A collection of antibodies or fragments having properties relevant to developability |
| DK2640742T3 (en) | 2010-11-19 | 2018-12-03 | Morphosys Ag | COLLECTION OF ANTIBODY SEQUENCES AND THEIR APPLICATIONS |
| US11339208B1 (en) | 2012-05-31 | 2022-05-24 | United States Of America As Represented By The Secretary Of The Air Force | Camelidae single-domain antibodies against Yersinia pestis and methods of use |
| US9938522B2 (en) | 2014-09-25 | 2018-04-10 | Genewiz, Inc. | High throughput sequencing of end regions of long linear DNAs |
Family Cites Families (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1990005144A1 (en) * | 1988-11-11 | 1990-05-17 | Medical Research Council | Single domain ligands, receptors comprising said ligands, methods for their production, and use of said ligands and receptors |
| US6291161B1 (en) * | 1989-05-16 | 2001-09-18 | Scripps Research Institute | Method for tapping the immunological repertiore |
| GB9015198D0 (en) * | 1990-07-10 | 1990-08-29 | Brien Caroline J O | Binding substance |
| EP0592626B1 (en) * | 1992-03-11 | 2003-01-29 | Dana-Farber Cancer Institute, Inc. | METHODS TO CLONE mRNA |
| EP0656946B2 (en) * | 1992-08-21 | 2010-03-31 | Vrije Universiteit Brussel | Immunoglobulins devoid of light chains |
| US5580726A (en) * | 1994-04-29 | 1996-12-03 | Geron Corporation | Method and Kit for enhanced differential display |
| AU6808194A (en) * | 1993-05-31 | 1994-12-20 | Chugai Seiyaku Kabushiki Kaisha | Reconstructed human antibody against human interleukin-6 |
| WO1997002479A2 (en) * | 1995-06-30 | 1997-01-23 | Yale University | Human monoclonal anti-tumor antibodies |
| US6114119A (en) * | 1997-08-29 | 2000-09-05 | Wisconsin Alumni Research Foundation | Transglutaminase and gene encoding same |
| BR9813276A (pt) * | 1997-10-27 | 2000-08-22 | Unilever Nv | Proteìna multivalente de ligação de antìgeno, sequências de nucleotìdeos, vetor de expressão, célula hospedeira, processo para preparação de proteìna multivalente de ligação de antìgeno, e, uso da mesma |
| JP4213586B2 (ja) * | 2001-09-13 | 2009-01-21 | 株式会社抗体研究所 | ラクダ抗体ライブラリーの作製方法 |
| AU2002351896A1 (en) * | 2001-12-11 | 2003-06-23 | Ablynx N.V. | Method for displaying loops from immunoglobulin domains in different contexts |
-
2002
- 2002-12-20 AU AU2002360068A patent/AU2002360068B2/en not_active Expired - Fee Related
- 2002-12-20 JP JP2003554732A patent/JP4323317B2/ja not_active Expired - Fee Related
- 2002-12-20 WO PCT/EP2002/014662 patent/WO2003054016A2/en not_active Ceased
- 2002-12-20 EP EP02795255A patent/EP1456237A2/en not_active Withdrawn
- 2002-12-20 US US10/499,500 patent/US20050037358A1/en not_active Abandoned
- 2002-12-20 CA CA002471116A patent/CA2471116A1/en not_active Abandoned
-
2004
- 2004-07-19 NO NO20043066A patent/NO20043066L/no not_active Application Discontinuation
-
2006
- 2006-09-12 US US11/519,750 patent/US20070009527A1/en not_active Abandoned
-
2009
- 2009-03-13 JP JP2009060673A patent/JP2009171975A/ja active Pending
Cited By (210)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2284192A2 (en) | 2002-11-08 | 2011-02-16 | Ablynx N.V. | Camelidae antibodies for sublingual administration |
| EP1900753A2 (en) | 2002-11-08 | 2008-03-19 | Ablynx N.V. | Method of administering therapeutic polypeptides, and polypeptides therefor |
| EP2267027A2 (en) | 2002-11-08 | 2010-12-29 | Ablynx N.V. | Method of administering therapeutic polypeptides, and polypeptides therefor |
| EP2267032A2 (en) | 2002-11-08 | 2010-12-29 | Ablynx N.V. | Method of administering therapeutic polypeptides, and polypeptides therefor |
| EP2258392A1 (en) | 2002-11-08 | 2010-12-08 | Ablynx N.V. | Method of administering therapeutic polypeptides |
| EP2301967A2 (en) | 2002-11-08 | 2011-03-30 | Ablynx N.V. | Single domain antibodies for nasal administration |
| EP2251357A1 (en) | 2003-11-07 | 2010-11-17 | Ablynx N.V. | Camelidae single domain antibodies VHH directed against epidermal growth factor receptor and uses therefor |
| WO2006106331A3 (en) * | 2005-04-06 | 2007-03-29 | Ucb Sa | Mouse primers |
| WO2006106336A3 (en) * | 2005-04-06 | 2007-03-29 | Ucb Sa | Rat primers |
| EP2949668A1 (en) | 2005-05-18 | 2015-12-02 | Ablynx N.V. | Improved nanobodiestm against tumor necrosis factor-alpha |
| EP3613767A1 (en) | 2005-05-18 | 2020-02-26 | Ablynx N.V. | Improved nanobodiestm against tumor cecrosis factor-alpha |
| EP2479191A2 (en) | 2005-05-18 | 2012-07-25 | Ablynx N.V. | Improved nanobodiesTM against tumor necrosis factor-alpha |
| EP2444424A1 (en) | 2005-05-20 | 2012-04-25 | Ablynx N.V. | Improved nanobodies TM for the treatment of aggregation-mediated disorders |
| EP3415535A1 (en) | 2005-05-20 | 2018-12-19 | Ablynx N.V. | Improved nanobodies tm for the treatment of aggregation-mediated disorders |
| EP3243839A1 (en) | 2005-05-20 | 2017-11-15 | Ablynx N.V. | Improved nanobodies tm for the treatment of aggregation-mediated disorders |
| EP3028716A1 (en) | 2006-10-10 | 2016-06-08 | Regenesance B.V. | Complement inhibition for improved nerve regeneration |
| EP2698166A2 (en) | 2006-10-10 | 2014-02-19 | Regenesance B.V. | Complement inhibition for improved nerve regeneration |
| EP3804755A1 (en) | 2006-10-10 | 2021-04-14 | Regenesance B.V. | Complement inhibition for improved nerve regeneration |
| EP2557090A2 (en) | 2006-12-19 | 2013-02-13 | Ablynx N.V. | Amino acid sequences directed against GPCRs and polypeptides comprising the same for the treatment of GPCR-related diseases and disorders |
| EP2514767A1 (en) | 2006-12-19 | 2012-10-24 | Ablynx N.V. | Amino acid sequences directed against a metalloproteinase from the ADAM family and polypeptides comprising the same for the treatment of ADAM-related diseases and disorders |
| EP2308514A2 (en) | 2007-03-23 | 2011-04-13 | to-BBB Holding B.V. | Conjugates for targeted drug delivery across the blood-brain barrier |
| US10214588B2 (en) | 2007-07-03 | 2019-02-26 | Ablynx N.V. | Providing improved immunoglobulin sequences by mutating CDR and/or FR positions |
| EP2650311A2 (en) | 2007-11-27 | 2013-10-16 | Ablynx N.V. | Amino acid sequences directed against heterodimeric cytokines and/or their receptors and polypeptides comprising the same |
| US9862759B2 (en) | 2007-12-04 | 2018-01-09 | Pierre Fabre Medicament | Method for generating and screening an antibody library |
| FR2924440A1 (fr) * | 2007-12-04 | 2009-06-05 | Pierre Fabre Medicament Sa | Nouveau procede de generation et de criblage d'une banque d'anticorps |
| WO2009080461A1 (fr) * | 2007-12-04 | 2009-07-02 | Pierre Fabre Medicament | Nouveau procédé de génération et de criblage d'une banque d'anticorps |
| DE112009000507T5 (de) | 2008-03-05 | 2011-02-10 | Ablynx Nv | Neue Antigen-bindende Dimerkomplexe, Verfahren zu ihrer Herstellung und ihre Verwendung |
| EP2947097A1 (en) | 2008-04-07 | 2015-11-25 | Ablynx N.V. | Amino acid sequences directed against the Notch pathways and uses thereof |
| US8217140B2 (en) | 2008-04-17 | 2012-07-10 | Ablynx N.V. | Peptides capable of binding to serum proteins and compounds, constructs and polypeptides comprising the same |
| WO2009138519A1 (en) | 2008-05-16 | 2009-11-19 | Ablynx Nv | AMINO ACID SEQUENCES DIRECTED AGAINST CXCR4 AND OTHER GPCRs AND COMPOUNDS COMPRISING THE SAME |
| EP3424526A1 (en) | 2008-06-05 | 2019-01-09 | Ablynx NV | Immunoglobulin single variable domains binding to the g envelope protein of rabies virus and uses thereof for the treatment and prevention of rabies |
| WO2010010119A1 (en) | 2008-07-22 | 2010-01-28 | Ablynx Nv | Amino acid sequences directed against multitarget scavenger receptors and polypeptides |
| EP3470425A2 (en) | 2008-12-19 | 2019-04-17 | Ablynx N.V. | Immunoglobulins against cell-associatd antigens such as p2x7 |
| WO2010100135A1 (en) | 2009-03-05 | 2010-09-10 | Ablynx N.V. | Novel antigen binding dimer-complexes, methods of making/avoiding and uses thereof |
| EP2982690A1 (en) | 2009-04-30 | 2016-02-10 | Ablynx N.V. | Method for the production of domain antibodies |
| EP3828201A1 (en) | 2009-04-30 | 2021-06-02 | Ablynx N.V. | Method for the production of domain antibodies |
| WO2011003622A1 (en) | 2009-07-10 | 2011-01-13 | Ablynx N.V. | Method for the production of variable domains |
| WO2011026945A1 (en) | 2009-09-03 | 2011-03-10 | Ablynx N.V. | Stable formulations of polypeptides and uses thereof |
| WO2011026948A1 (en) | 2009-09-03 | 2011-03-10 | Ablynx N.V. | Stable formulations of polypeptides and uses thereof |
| EP3725330A1 (en) | 2009-09-03 | 2020-10-21 | Ablynx N.V. | Stable formulations of polypeptides and uses thereof |
| EP3438126A1 (en) | 2009-09-03 | 2019-02-06 | Ablynx N.V. | Stable formulations of polypeptides and uses thereof |
| EP2805731A2 (en) | 2009-09-03 | 2014-11-26 | Ablynx N.V. | Stable formulations of polypeptides and uses thereof |
| WO2011067160A1 (en) | 2009-12-01 | 2011-06-09 | Ablynx Nv | Von willebrand factor specific binding agents and uses thereof |
| WO2011073180A1 (en) | 2009-12-14 | 2011-06-23 | Ablynx N.V. | Single variable domain antibodies against ox40l, constructs and therapeutic use |
| EP3309176A1 (en) | 2009-12-14 | 2018-04-18 | Ablynx N.V. | Immunoglobulin single variable domain antibodies against ox40l, constructs and therapeutic use |
| WO2011083140A1 (en) | 2010-01-08 | 2011-07-14 | Ablynx Nv | Immunoglobulin single variable domain directed against human cxcr4 |
| WO2011095545A1 (en) | 2010-02-05 | 2011-08-11 | Ablynx Nv | Peptides capable of binding to serum albumin and compounds, constructs and polypeptides comprising the same |
| WO2011098520A1 (en) | 2010-02-10 | 2011-08-18 | Novartis Ag | Agonist dr5 binding polypeptides |
| EP3501499A1 (en) | 2010-02-11 | 2019-06-26 | Ablynx NV | Methods and compositions for the preparation of aerosols |
| WO2011098552A2 (en) | 2010-02-11 | 2011-08-18 | Ablynx Nv | Methods and compositions for the preparation of aerosols |
| WO2011098518A2 (en) | 2010-02-11 | 2011-08-18 | Ablynx Nv | Delivery of immunoglobulin variable domains and constructs thereof |
| US9556273B2 (en) | 2010-03-29 | 2017-01-31 | Vib Vzw | Anti-macrophage mannose receptor single variable domains for targeting and in vivo imaging of tumor-associated macrophages |
| US9913920B2 (en) | 2010-03-29 | 2018-03-13 | Vib Vzw | Targeting and in vivo imaging of tumor-associated macrophages |
| EP3546483A1 (en) | 2010-05-20 | 2019-10-02 | Ablynx N.V. | Biological materials related to her3 |
| WO2011144749A1 (en) | 2010-05-20 | 2011-11-24 | Ablynx Nv | Biological materials related to her3 |
| WO2011161263A1 (en) | 2010-06-25 | 2011-12-29 | Ablynx Nv | Pharmaceutical compositions for cutaneous administration |
| WO2012056000A1 (en) | 2010-10-29 | 2012-05-03 | Ablynx Nv | Method for the production of immunoglobulin single variable domains |
| EP4458858A2 (en) | 2010-10-29 | 2024-11-06 | Ablynx NV | Method for the production of immunoglobulin single variable domains |
| EP3279214A1 (en) | 2010-10-29 | 2018-02-07 | Ablynx NV | Method for the production of immunoglobulin single variable domains |
| WO2012130872A1 (en) | 2011-03-28 | 2012-10-04 | Ablynx Nv | Method for producing solid formulations comprising immunoglobulin single variable domains |
| EP3363815A1 (en) | 2011-05-05 | 2018-08-22 | Merck Patent GmbH | Amino acid sequences directed against il-17a, il-17f and/or il17-a/f and polypeptides comprising the same |
| EP4105231A1 (en) | 2011-05-05 | 2022-12-21 | Merck Patent GmbH | Amino acid sequences directed against il-17a, il-17f and/or il17-a/f and polypeptides comprising the same |
| WO2012156219A1 (en) | 2011-05-05 | 2012-11-22 | Ablynx Nv | Amino acid sequences directed against il-17a, il-17f and/or il17-a/f and polypeptides comprising the same |
| EP3590950A1 (en) | 2011-05-09 | 2020-01-08 | Ablynx NV | Method for the production of immunoglobulin single varible domains |
| WO2012152823A1 (en) | 2011-05-09 | 2012-11-15 | Ablynx Nv | Method for the production of immunoglobulin single variable domains |
| WO2012163887A1 (en) | 2011-05-27 | 2012-12-06 | Ablynx Nv | Inhibition of bone resorption with rankl binding peptides |
| WO2012166906A1 (en) | 2011-05-31 | 2012-12-06 | Massachusetts Institute Of Technology | Cell-directed synthesis of multifunctional nanopatterns and nanomaterials |
| WO2012175740A1 (en) | 2011-06-23 | 2012-12-27 | Ablynx Nv | Immunoglobulin single variable domains directed against ige |
| EP3311837A1 (en) | 2011-09-23 | 2018-04-25 | Ablynx NV | Prolonged inhibition of interleukin-6 mediated signaling |
| WO2013174537A1 (en) | 2012-05-24 | 2013-11-28 | Vib Vzw | Anti-macrophage mannose receptor single variable domains for targeting and in vivo imaging of tumor-associated macrophages |
| WO2014087010A1 (en) | 2012-12-07 | 2014-06-12 | Ablynx N.V. | IMPROVED POLYPEPTIDES DIRECTED AGAINST IgE |
| US9593157B2 (en) | 2013-01-30 | 2017-03-14 | Vib Vzw | Chimeric polypeptides comprising G protein-coupled receptors and VHH antibodies |
| WO2014118297A1 (en) | 2013-01-30 | 2014-08-07 | Vib Vzw | Novel chimeric polypeptides for screening and drug discovery purposes |
| EP3590578A1 (en) | 2013-02-05 | 2020-01-08 | VIB vzw | Muscarinic acetylcholine receptor binding agents and uses thereof |
| WO2014122183A1 (en) | 2013-02-05 | 2014-08-14 | Vib Vzw | Muscarinic acetylcholine receptor binding agents and uses thereof |
| US9617339B2 (en) | 2013-03-15 | 2017-04-11 | Vib Vzw | Method of imaging a cardiovascular disease with an anti-macrophage mannose receptor immunoglobulin single variable domain |
| WO2014140376A1 (en) | 2013-03-15 | 2014-09-18 | Vib Vzw | Anti-macrophage mannose receptor single variable domains for use in cardiovascular diseases |
| WO2014177595A1 (en) | 2013-04-29 | 2014-11-06 | Agrosavfe N.V. | Agrochemical compositions comprising antibodies binding to sphingolipids |
| US11028154B2 (en) | 2013-04-29 | 2021-06-08 | Biotalys NV | Agrochemical compositions comprising antibodies binding to sphingolipids |
| EP3597758A1 (en) | 2013-04-29 | 2020-01-22 | AgroSavfe nv | Agrochemical compositions comprising polypeptides |
| US10400033B2 (en) | 2013-04-29 | 2019-09-03 | Agrosavfe N.V. | Agrochemical compositions comprising antibodies binding to sphingolipids |
| WO2014191146A1 (en) | 2013-04-29 | 2014-12-04 | Agrosavfe N.V. | Agrochemical compositions comprising antibodies binding to sphingolipids |
| US9803003B2 (en) | 2013-04-29 | 2017-10-31 | Agrosavfe N.V. | Agrochemical compositions comprising antibodies binding to sphingolipids |
| WO2014184352A1 (en) | 2013-05-17 | 2014-11-20 | Ablynx Nv | Stable formulations of immunoglobulin single variable domains and uses thereof |
| EP3511018A1 (en) | 2013-05-17 | 2019-07-17 | Ablynx NV | Stable formulations of immunoglobulin single variable domains and uses thereof |
| EP2883883A1 (en) | 2013-12-16 | 2015-06-17 | Cardio3 Biosciences S.A. | Therapeutic targets and agents useful in treating ischemia reperfusion injury |
| US10233241B2 (en) | 2014-01-30 | 2019-03-19 | Vib Vzw | Opioid receptor binding agents and uses thereof |
| US11352422B2 (en) | 2014-01-30 | 2022-06-07 | Vib Vzw | Opioid receptor binding agents and uses thereof |
| WO2015193452A1 (en) | 2014-06-18 | 2015-12-23 | Ablynx Nv | Kv1.3 binding immunoglobulins |
| US10641779B2 (en) | 2014-07-22 | 2020-05-05 | Vib Vzw | Methods to select for agents that stabilize protein complexes |
| EP3718574A1 (en) | 2014-07-29 | 2020-10-07 | Vrije Universiteit Brussel | Radio-labelled antibody fragments for use in the prevention and/or treatment of cancer |
| US11660356B2 (en) | 2014-07-29 | 2023-05-30 | Vrije Universiteit Brussel | Radio-labelled antibody fragments for use in the prognosis, diagnosis of cancer as well as for the prediction of cancer therapy response |
| WO2016016021A1 (en) | 2014-07-29 | 2016-02-04 | Vrije Universiteit Brussel | Radio-labelled antibody fragments for use in the prevention and/or treatment of cancer |
| US10858666B2 (en) | 2014-11-05 | 2020-12-08 | Biotalys | Transgenic plants expressing a variable domain of a heavy chain antibody (VHH) that binds to a sphingolipid of a fungus |
| WO2016071438A2 (en) | 2014-11-05 | 2016-05-12 | Agrosavfe Nv | Transgenic plant comprising a polynucleotide encoding a variable domain of heavy-chain antibody |
| WO2016097313A1 (en) | 2014-12-19 | 2016-06-23 | Ablynx N.V. | Cysteine linked nanobody dimers |
| US11298433B2 (en) | 2015-07-17 | 2022-04-12 | Vrije Universiteit Brussel | Radiolabelled antibody fragments for use in treating cancer |
| US12440586B2 (en) | 2015-07-17 | 2025-10-14 | Vrije Universiteit Brussel | Radiolabelled antibody fragments for use in treating cancer |
| EP3932945A1 (en) | 2015-11-27 | 2022-01-05 | Ablynx NV | Polypeptides inhibiting cd40l |
| WO2017182603A1 (en) | 2016-04-22 | 2017-10-26 | Université Libre de Bruxelles | A new biomarker expressed in pancreatic beta cells useful in imaging or targeting beta cells |
| WO2017182605A1 (en) | 2016-04-22 | 2017-10-26 | Université Libre de Bruxelles | A new biomarker expressed in pancreatic beta cells useful in imaging or targeting beta cells |
| WO2017191108A1 (en) | 2016-05-02 | 2017-11-09 | Ablynx Nv | Treatment of rsv infection |
| WO2018007442A1 (en) | 2016-07-06 | 2018-01-11 | Ablynx N.V. | Treatment of il-6r related diseases |
| WO2018029182A1 (en) | 2016-08-08 | 2018-02-15 | Ablynx N.V. | Il-6r single variable domain antibodies for treatment of il-6r related diseases |
| WO2018050833A1 (en) | 2016-09-15 | 2018-03-22 | Ablynx Nv | Immunoglobulin single variable domains directed against macrophage migration inhibitory factor |
| WO2018091606A1 (en) | 2016-11-16 | 2018-05-24 | Ablynx Nv | T cell recruiting polypeptides capable of binding cd123 and tcr alpha/beta |
| WO2018099968A1 (en) | 2016-11-29 | 2018-06-07 | Ablynx N.V. | Treatment of infection by respiratory syncytial virus (rsv) |
| WO2018158335A1 (en) | 2017-02-28 | 2018-09-07 | Vib Vzw | Means and methods for oral protein delivery |
| WO2018192974A1 (en) | 2017-04-18 | 2018-10-25 | Université Libre de Bruxelles | Biomarkers and targets for proliferative diseases |
| WO2018206734A1 (en) | 2017-05-11 | 2018-11-15 | Vib Vzw | Glycosylation of variable immunoglobulin domains |
| WO2018220235A1 (en) | 2017-06-02 | 2018-12-06 | Merck Patent Gmbh | Mmp13 binding immunoglobulins |
| EP4272822A2 (en) | 2017-06-02 | 2023-11-08 | Merck Patent GmbH | Adamts binding immunoglobulins |
| WO2018220225A1 (en) | 2017-06-02 | 2018-12-06 | Ablynx Nv | Aggrecan binding immunoglobulins |
| WO2018220236A1 (en) | 2017-06-02 | 2018-12-06 | Merck Patent Gmbh | Polypeptides binding adamts5, mmp13 and aggrecan |
| WO2018220234A1 (en) | 2017-06-02 | 2018-12-06 | Merck Patent Gmbh | Adamts binding immunoglobulins |
| WO2019016237A1 (en) | 2017-07-19 | 2019-01-24 | Vib Vzw | AGENTS FOR CONNECTING TO SERUM ALBUMIN |
| EP4635987A2 (en) | 2017-10-31 | 2025-10-22 | Vib Vzw | Novel antigen-binding chimeric proteins and methods and uses thereof |
| WO2019086548A1 (en) | 2017-10-31 | 2019-05-09 | Vib Vzw | Novel antigen-binding chimeric proteins and methods and uses thereof |
| WO2019155041A1 (en) | 2018-02-12 | 2019-08-15 | Vib Vzw | Gβγ COMPLEX ANTIBODIES AND USES THEREOF |
| US11858960B2 (en) | 2018-03-01 | 2024-01-02 | Vrije Universiteit Brussel | Human PD-L1-binding immunoglobulins |
| WO2019166622A1 (en) | 2018-03-01 | 2019-09-06 | Vrije Universiteit Brussel | Human pd-l1-binding immunoglobulins |
| EP4163295A1 (en) | 2018-03-23 | 2023-04-12 | Université Libre de Bruxelles | Wnt signaling agonist molecules |
| WO2019180204A1 (en) | 2018-03-23 | 2019-09-26 | Université Libre de Bruxelles | Wnt signaling agonist molecules |
| WO2019185723A1 (en) | 2018-03-27 | 2019-10-03 | Umc Utrecht Holding B.V. | Targeted thrombolysis for treatment of microvascular thrombosis |
| WO2020221768A1 (en) | 2019-04-29 | 2020-11-05 | Confo Therapeutics N.V. | Chimeric proteins and methods to screen for compounds and ligands binding to gpcrs |
| WO2020221769A1 (en) | 2019-04-29 | 2020-11-05 | Confo Therapeutics N.V. | Screening methods and assays for use with transmembrane proteins, in particular with gpcrs |
| WO2020221888A1 (en) | 2019-04-30 | 2020-11-05 | Vib Vzw | Cystic fibrosis transmembrane conductance regulator stabilizing agents |
| WO2020239934A1 (en) | 2019-05-28 | 2020-12-03 | Vib Vzw | Cd8+ t-cells lacking plexins and their application in cancer treatment |
| WO2020239945A1 (en) | 2019-05-28 | 2020-12-03 | Vib Vzw | Cancer treatment by targeting plexins in the immune compartment |
| WO2021078786A1 (en) | 2019-10-21 | 2021-04-29 | Vib Vzw | Nanodisc-specific antigen-binding chimeric proteins |
| WO2021095031A2 (en) | 2019-11-11 | 2021-05-20 | Ibi-Ag Innovative Bio Insecticides Ltd. | Insect control nanobodies and uses thereof |
| WO2021105438A1 (en) | 2019-11-27 | 2021-06-03 | Vib Vzw | Positive allosteric modulators of the calcium-sensing receptor |
| WO2021116252A1 (en) | 2019-12-12 | 2021-06-17 | Vib Vzw | Glycosylated single chain immunoglobulin domains |
| WO2021123360A1 (en) | 2019-12-20 | 2021-06-24 | Vib Vzw | Nanobody exchange chromatography |
| WO2021140205A1 (en) | 2020-01-10 | 2021-07-15 | Confo Therapeutics N.V. | Methods for generating antibodies and antibody fragments and libraries comprising same |
| WO2021156490A2 (en) | 2020-02-06 | 2021-08-12 | Vib Vzw | Corona virus binders |
| WO2021170540A1 (en) | 2020-02-25 | 2021-09-02 | Vib Vzw | Leucine-rich repeat kinase 2 allosteric modulators |
| EP4438733A2 (en) | 2020-03-31 | 2024-10-02 | Biotalys NV | Anti-fungal polypeptides |
| WO2021198396A1 (en) | 2020-03-31 | 2021-10-07 | Biotalys NV | Anti-fungal polypeptides |
| WO2021213435A1 (zh) | 2020-04-22 | 2021-10-28 | 迈威(上海)生物科技股份有限公司 | 一种靶向人程序性死亡配体1(pd-l1)的单可变域抗体及其衍生物 |
| WO2021229104A1 (en) | 2020-05-15 | 2021-11-18 | Université de Liège | Anti-cd38 single-domain antibodies in disease monitoring and treatment |
| WO2022003156A1 (en) | 2020-07-02 | 2022-01-06 | Oncurious Nv | Ccr8 non-blocking binders |
| WO2022023583A1 (en) | 2020-07-31 | 2022-02-03 | Biotalys NV | Expression host |
| WO2022023584A1 (en) | 2020-07-31 | 2022-02-03 | Biotalys NV | Methods of increasing recombinant protein yields |
| WO2022063957A1 (en) | 2020-09-24 | 2022-03-31 | Vib Vzw | Biomarker for anti-tumor therapy |
| WO2022063947A1 (en) | 2020-09-24 | 2022-03-31 | Vib Vzw | Combination of p2y6 inhibitors and immune checkpoint inhibitors |
| WO2022063984A1 (en) | 2020-09-25 | 2022-03-31 | Ablynx Nv | Polypeptides comprising immunoglobulin single variable domains targeting il-13 and ox40l |
| WO2022117569A1 (en) | 2020-12-02 | 2022-06-09 | Oncurious Nv | A ccr8 antagonist antibody in combination with a lymphotoxin beta receptor agonist antibody in therapy against cancer |
| WO2022117572A2 (en) | 2020-12-02 | 2022-06-09 | Oncurious Nv | An ltbr agonist in combination therapy against cancer |
| WO2022129572A1 (en) | 2020-12-18 | 2022-06-23 | Ablynx Nv | Polypeptides comprising immunoglobulin single variable domains targeting il-6 and tnf-alpha |
| US11897951B2 (en) | 2020-12-18 | 2024-02-13 | Ablynx N.V. | Polypeptides comprising immunoglobulin single variable domains targeting IL-6 and TNF-α |
| WO2022136685A1 (en) | 2020-12-23 | 2022-06-30 | Vib Vzw | Antibody compositions for treatment of corona virus infection |
| WO2022136647A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Human ccr8 binders |
| WO2022136650A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Murine cross-reactive human ccr8 binders |
| WO2022136649A1 (en) | 2020-12-24 | 2022-06-30 | Oncurious Nv | Non-blocking human ccr8 binders |
| WO2022167666A1 (en) | 2021-02-05 | 2022-08-11 | Vib Vzw | Sarbecovirus binders |
| WO2022175392A1 (en) | 2021-02-17 | 2022-08-25 | Vib Vzw | Inhibition of slc4a4 in the treatment of cancer |
| WO2022178255A2 (en) | 2021-02-19 | 2022-08-25 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Single domain antibodies that neutralize sars-cov-2 |
| WO2022175532A1 (en) | 2021-02-19 | 2022-08-25 | Vib Vzw | Cation-independent mannose-6-phosphate receptor binders |
| WO2022199804A1 (en) | 2021-03-24 | 2022-09-29 | Vib Vzw | Nek6 inhibition to treat als and ftd |
| WO2022238550A1 (en) | 2021-05-12 | 2022-11-17 | Vib Vzw | Pan-specific corona virus binders |
| WO2022242892A1 (en) | 2021-05-17 | 2022-11-24 | Université de Liège | Anti-cd38 single-domain antibodies in disease monitoring and treatment |
| WO2022268993A1 (en) | 2021-06-23 | 2022-12-29 | Vib Vzw | Means and methods for selection of specific binders |
| WO2023274183A1 (zh) | 2021-06-29 | 2023-01-05 | 江苏先声药业有限公司 | Cd16抗体及其应用 |
| WO2023016828A2 (en) | 2021-07-30 | 2023-02-16 | Vib Vzw | Cation-independent mannose-6-phosphate receptor binders for targeted protein degradation |
| WO2023006040A1 (zh) | 2021-07-30 | 2023-02-02 | 江苏先声药业有限公司 | 抗pvrig/抗tigit双特异性抗体和应用 |
| WO2023057601A1 (en) | 2021-10-06 | 2023-04-13 | Biotalys NV | Anti-fungal polypeptides |
| WO2023098846A1 (zh) | 2021-12-03 | 2023-06-08 | 江苏先声药业有限公司 | 抗bcma纳米抗体及其应用 |
| WO2023111266A1 (en) | 2021-12-17 | 2023-06-22 | Ablynx Nv | POLYPEPTIDES COMPRISING IMMUNOGLOBULIN SINGLE VARIABLE DOMAINS TARGETING TCRαβ, CD33 AND CD123 |
| WO2023125888A1 (zh) | 2021-12-31 | 2023-07-06 | 山东先声生物制药有限公司 | 一种gprc5d抗体及其应用 |
| WO2023135198A1 (en) | 2022-01-12 | 2023-07-20 | Vib Vzw | Human ntcp binders for therapeutic use and liver-specific targeted delivery |
| WO2023148291A1 (en) | 2022-02-02 | 2023-08-10 | Biotalys NV | Methods for genome editing |
| WO2023148397A1 (en) | 2022-02-07 | 2023-08-10 | Vib Vzw | Engineered stabilizing aglycosylated fc-regions |
| WO2023198848A1 (en) | 2022-04-13 | 2023-10-19 | Vib Vzw | An ltbr agonist in combination therapy against cancer |
| WO2023213751A1 (en) | 2022-05-02 | 2023-11-09 | Umc Utrecht Holding B.V | Single domain antibodies for the detection of plasmin-cleaved vwf |
| WO2023222825A1 (en) | 2022-05-18 | 2023-11-23 | Vib Vzw | Sarbecovirus spike s2 subunit binders |
| WO2023236889A1 (zh) | 2022-06-06 | 2023-12-14 | 山东先声生物制药有限公司 | 靶向bcma、gprc5d和t细胞的多特异性抗体及其应用 |
| WO2024008755A1 (en) | 2022-07-04 | 2024-01-11 | Vib Vzw | Blood-cerebrospinal fluid barrier crossing antibodies |
| WO2024068744A1 (en) | 2022-09-27 | 2024-04-04 | Vib Vzw | Antivirals against human parainfluenza virus |
| WO2024083843A1 (en) | 2022-10-18 | 2024-04-25 | Confo Therapeutics N.V. | Amino acid sequences directed against the melanocortin 4 receptor and polypeptides comprising the same for the treatment of mc4r-related diseases and disorders |
| WO2024105091A1 (en) | 2022-11-15 | 2024-05-23 | Imec Vzw | Method and system for droplet manipulation |
| WO2024126805A1 (en) | 2022-12-15 | 2024-06-20 | Aarhus Universitet | Synthetic activation of multimeric transmembrane receptors |
| WO2024133937A1 (en) | 2022-12-22 | 2024-06-27 | Biotalys NV | Methods for genome editing |
| WO2024145551A1 (en) | 2022-12-29 | 2024-07-04 | Biotalys NV | Agrochemical compositions |
| WO2024141641A2 (en) | 2022-12-30 | 2024-07-04 | Biotalys NV | Secretion signals |
| WO2024141638A1 (en) | 2022-12-30 | 2024-07-04 | Biotalys NV | Self-emulsifiable concentrate |
| WO2024141645A1 (en) | 2022-12-30 | 2024-07-04 | Biotalys N.V. | Agglomerate |
| WO2024156888A1 (en) | 2023-01-27 | 2024-08-02 | Vib Vzw | Cd163-binding conjugates |
| WO2024156881A1 (en) | 2023-01-27 | 2024-08-02 | Vib Vzw | CD8b-BINDING POLYPEPTIDES |
| WO2024165710A1 (en) | 2023-02-09 | 2024-08-15 | Seni-Preps B.V. | Immunoglobulin single variable domains that inhibit urease and use thereof |
| WO2024175787A1 (en) | 2023-02-24 | 2024-08-29 | Vrije Universiteit Brussel | Anti-inflammatory pannexin 1 channel inhibitors |
| WO2024189171A1 (en) | 2023-03-14 | 2024-09-19 | Aarhus Universitet | Genetically altered nfr5 receptor kinases |
| WO2024208816A1 (en) | 2023-04-03 | 2024-10-10 | Vib Vzw | Blood-brain barrier crossing antibodies |
| WO2024231348A1 (en) | 2023-05-11 | 2024-11-14 | Vib Vzw | Slc4a4/nbce1 inhibitors |
| WO2024240162A1 (en) | 2023-05-23 | 2024-11-28 | Shanghai Allygen Biologics Co., Ltd. | Pd-l1 and trop-2 targeting conjugates comprising effector molecules and uses thereof |
| WO2024261344A1 (en) | 2023-06-23 | 2024-12-26 | Vib Vzw | Novel binders targeting the multi-drug resistant pathogen acinetobacter baumannii |
| EP4483951A1 (en) | 2023-06-30 | 2025-01-01 | Université de Liège | Single-domain antibody for inhibition of neutrophil elastase activity |
| WO2025003495A1 (en) | 2023-06-30 | 2025-01-02 | Université de Liège | Single-domain antibody for inhibition of neutrophil elastase activity |
| WO2025078605A1 (en) | 2023-10-12 | 2025-04-17 | Synapse Research Institute | Molecules for reversing anti-coagulant activity of direct oral anticoagulants |
| WO2025093683A1 (en) | 2023-11-03 | 2025-05-08 | Neuvasq Biotechnologies Sa | Wnt7 signaling agonists |
| WO2025109176A1 (en) | 2023-11-22 | 2025-05-30 | Exevir Bio Bv | Optimized sarbecovirus spike s2 subunit binders and compositions comprising the same |
| WO2025125577A1 (en) | 2023-12-14 | 2025-06-19 | Vib Vzw | Antibodies against influenza b virus |
| EP4574981A1 (en) | 2023-12-22 | 2025-06-25 | Biotalys NV | Anti-fungal vhh antibodies |
| WO2025133390A1 (en) | 2023-12-22 | 2025-06-26 | Biotalys NV | Anti-fungal vhh antibodies |
| WO2025154056A1 (en) | 2024-01-21 | 2025-07-24 | Ibi-Ag Innovative Bio Insecticides Ltd. | Anti-insect cda nanobodies and uses thereof |
| WO2025154058A1 (en) | 2024-01-21 | 2025-07-24 | Ibi-Ag Innovative Bio Insecticides Ltd. | Anti-insect hsp70 nanobodies and uses thereof |
| WO2025181155A1 (en) | 2024-02-26 | 2025-09-04 | Vib Vzw | Human beta-glucocerebrosidase binders and uses thereof |
| WO2025196308A1 (en) | 2024-03-22 | 2025-09-25 | Vib Vzw | Means and methods for displaying fc-containing proteins on cells and selection thereof |
| WO2025219231A1 (en) | 2024-04-15 | 2025-10-23 | Vib Vzw | Computer-implemented means and methods for the de novo design of antibodies targeting a specific epitope |
| WO2025238157A1 (en) | 2024-05-15 | 2025-11-20 | Katholieke Universiteit Leuven | Multispecific binding agent suitable for use in cancer immune therapy |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2002360068B2 (en) | 2009-09-03 |
| AU2002360068A1 (en) | 2003-07-09 |
| NO20043066L (no) | 2004-09-21 |
| JP4323317B2 (ja) | 2009-09-02 |
| EP1456237A2 (en) | 2004-09-15 |
| US20050037358A1 (en) | 2005-02-17 |
| US20070009527A1 (en) | 2007-01-11 |
| WO2003054016A3 (en) | 2004-02-19 |
| WO2003054016A8 (en) | 2004-09-30 |
| CA2471116A1 (en) | 2003-07-03 |
| JP2009171975A (ja) | 2009-08-06 |
| JP2005524391A (ja) | 2005-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2002360068B2 (en) | Method for cloning of variable domain sequences | |
| EP2281837B1 (en) | Antigen binding domains from fish | |
| JP3344584B2 (ja) | 組換えライブラリースクリーニング法 | |
| AU2020244368A1 (en) | Generation of binding molecules | |
| US20050214857A1 (en) | Method for displaying loops from immunoglobulin domains in different contexts | |
| US10472411B2 (en) | Recombinant antibody and uses thereof | |
| WO2017197667A1 (zh) | 抗人pd-l1人源化单克隆抗体及其应用 | |
| JP2015524404A (ja) | 高度に保存された標的に対するラクダ科動物由来の配列を含む抗体 | |
| JPH06510671A (ja) | キメラ抗体の製造−組合せアプローチ | |
| US10336816B2 (en) | Phage-displayed single-chain variable fragment library | |
| US20100069262A1 (en) | Method for Cloning Avian-Derived Antibodies | |
| US12378697B2 (en) | Method for preparing phage library | |
| Marks | V-Gene Repertoires Expressed on Bacteriophage | |
| EP3209699A1 (en) | Vh scaffold | |
| US20180371451A1 (en) | Method and Kit for Generating High Affinity Binding Agents | |
| KR100341827B1 (ko) | 아미노-rna에 대한 항체 및 이의 제조방법 | |
| JP2004350502A (ja) | 部分ヒストンテイル型イムノポーター | |
| GB2616707A (en) | Methods | |
| WO2006074765A1 (en) | Molecular biology method | |
| JPH1189576A (ja) | 抗HBsモノクローナル抗体 | |
| WO2002046435A2 (en) | Engineered plasmids and their use for in situ production of genes | |
| HK1154026A (en) | Antigen binding domains from fish | |
| HK1078110A1 (en) | Target binding polypeptide comprising an ig-like vl domain linked to an ig-like vh domain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE SI TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2002360068 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2471116 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003554732 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002795255 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2002795255 Country of ref document: EP |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 10499500 Country of ref document: US |
|
| CFP | Corrected version of a pamphlet front page | ||
| CR1 | Correction of entry in section i |
Free format text: IN PCT GAZETTE 27/2003 UNDER (84) ADD "BG, CZ, EE, SK" |