WO2003018754A2 - Neural regeneration peptide and methods for their use in treatment of brain damage - Google Patents

Neural regeneration peptide and methods for their use in treatment of brain damage Download PDF

Info

Publication number
WO2003018754A2
WO2003018754A2 PCT/US2002/026782 US0226782W WO03018754A2 WO 2003018754 A2 WO2003018754 A2 WO 2003018754A2 US 0226782 W US0226782 W US 0226782W WO 03018754 A2 WO03018754 A2 WO 03018754A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nrp
neuronal
tissue
migration
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2002/026782
Other languages
English (en)
French (fr)
Other versions
WO2003018754A3 (en
Inventor
Frank Sieg
Paul Hughes
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Neuronz Ltd
NEURONZ BIOSCIENCES Inc
Original Assignee
Neuronz Ltd
NEURONZ BIOSCIENCES Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Neuronz Ltd, NEURONZ BIOSCIENCES Inc filed Critical Neuronz Ltd
Priority to EP02770419A priority Critical patent/EP1572887A4/en
Priority to JP2003523605A priority patent/JP4399260B2/ja
Priority to AU2002335657A priority patent/AU2002335657A1/en
Publication of WO2003018754A2 publication Critical patent/WO2003018754A2/en
Anticipated expiration legal-status Critical
Publication of WO2003018754A3 publication Critical patent/WO2003018754A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/4756Neuregulins, i.e. p185erbB2 ligands, glial growth factor, heregulin, ARIA, neu differentiation factor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • This invention is directed to compositions and methods for the use of peptides that promote neuronal migration, proliferation, survival and/or neurite outgrowth. More specifically, this invention is directed to the use of such peptides in the treatment of brain injury and neurodegenerative disease.
  • TBI traumatic brain injury
  • focal or global ischemia can result in significant neuronal cell loss and loss of brain function within a short time period after the insult.
  • Treatments available at present for chronic neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease and Multiple Sclerosis only target symptoms. No drugs are currently available to intervene in the disease process or prevent cell death.
  • calbindin-ir calbindin immunoreactive
  • a feature of the developing nervous system is the wide-ranging migration of precursor cells to their correct three-dimensional spatial position. These migrations promote differentiation of an array of phenotypes and the arrangement of immature neurons into the vertebrate brain. To achieve the correct wiring of approximately 100 billion neurons, construction of a cellular organisation like the formation of laminar structures in higher cortical regions is necessary (see Hatten and Heintz, 1999 for a review).
  • a cellular correlate for the direction of movement of a migrating neuron may be the frequency and amplitude of transient Ca 2+ changes within a single migrating cell (Gomez and Spitzer, 1999) although the triggering of initiation and/or commitment of neuronal cell migration by membrane-bound or diffusible molecules remains elusive.
  • Plasma membrane molecules belonging to the integrin receptor family interact with extracellular matrix ligands, like laminin, to initiate neuronal adhesion to the substratum (Liang and Crutcher, 1992; De Curtis and Reichardt, 1993).
  • extracellular matrix ligands like laminin
  • the control of integrm expression affects a wide range of developmental and cellular processes, including the regulation of gene expression, cell adhesion, neurite outgrowth and cell migration.
  • Other ligands which promote cell migration are cell adhesion molecules (i.e.
  • collaps ⁇ n-1 acts as a chemoattractant for guiding cortical apical dend ⁇ tes in neocortical areas (Polleux et al., 2000). Similar chemorepulsive as well as chemoattractive effects on axonal guidance are displayed by slit- 1 , a diffusible protein (Brose et al., 2000).
  • SDF-1 chemokine stromal-de ⁇ ved factor
  • NRPs neural regeneration peptides
  • NRPs include homologs, paralogs and/or analogs (together, termed "NRP compounds”).
  • An NRP compound can either be administered alone or in conjunction with one or more other NRP compounds or with other types of agents to promote neural outgrowth, neural migration, neural survival and/or neural proliferation.
  • NRPs and related peptides generally have certain amino acid sequences present, which confer desirable biological properties on the molecule.
  • NRP peptides Some embodiments of NRP peptides are shown in Table 1 below.
  • NRP-1 Y D P E A A S - A P G S G N P - - - - C H
  • NRP-2 K D P E A R R - A P G S L H P - - - - C - A A S C S A
  • NRP-3 S D S F K S Q - A R G Q V P P F G G V G C P W F
  • NRP-5 R E - - G R R D A P G R A - - G G G G - - - - - - A A R S V S P
  • NRP- 7 S E P E A R R - A P G R K - - - - G G V V C A S A A D W
  • NRP-8 S E V D A R R - A K K S L H - - - - - - - - C - I L S - D T S H P
  • NRP-2 NRP human chromosome 13 NRP-3 NRP human chromosome 3 NRP-4 NRP human coromosome 15 NRP-5 NRP human chromosome 7 NRP- 7 NRP mouse frameshift NRP- 8: NRP mouse ortholog 2
  • NRPs generally comprise a chain length of between about 8 to about 25 amino acids and having molecular weights between about 0.8 and about 2.7 kDa. Additionally, in other embodiments, an NRP can have an isoelectric point between about 6.5 and about 10.0, and having at least one biological property promoting an outcome selected from neuronal survival, neurite outgrowth, neuronal proliferative and neuronal migration. Additionally, an NRP may have one or more domains, as indicated in bold in Table 1 above.
  • an NRP may have a [A]PG[R,S] domain in combination with a PE-domain (e.g., NRP-1 and NRP- 2), or alternatively, without a PE-domain (e.g., NRP-5, NRP-7).
  • a PE-domain e.g., NRP-1 and NRP- 2
  • NRP-5, NRP-7 e.g., NRP-5, NRP-7
  • the presence of a [A]PG[R,S] domain is desirable for NRP biological activity.
  • NRPs can have a first domain selected from the group consisting of a [A]PG[R,S] domain, an [A,G]RR domain and an ARG domain have desirable biological activity.
  • an NRP can have, in addition to a first domain as described above, a second domain different from the first domain.
  • a second domain can be a PE domain or an [A,G]RR domain.
  • NRP s can have a third domain of those described above.
  • NRPs have a [A]PG[R,S] domain alone, other NRP can have an ARG domain alone, still other NRPs can have an [G,A]RR domain alone. Still other NRPs have a [A]PG[R,S] domain and a PE domain, and still other NRP have a [A]PG[R,S] domain and a [G,A]RR domain. Still other NRPs can have a [A]PG[R,S] domain, an [A,G]RR domain and a PE domain.
  • NRP family members contain at least a CAAT-Box or a TATA-Box, or both in promoter regions .
  • embodiments of this invention provide methods of treatment for damaged areas of the brain as a consequence of head injury or chronic neurodegenerative disease by administering one or more NRPs, NRP analogs (including peptides with structural similarities) and/or NRP prodrugs (including pro- NRP peptides) to promote neuronal or neuroblast migration, proliferation, survival and/or neurite outgrowth.
  • This method of treatment may be particularly useful but in no way limited to, patients suffering from moderate to severe traumatic brain injury (TBI) that involves neocortical damage as well as injuries to subcortical areas.
  • TBI moderate to severe traumatic brain injury
  • NRP -2 is encoded by a nucleic acid sequence localised on human chromosome 13 within the genomic clone bA87Gl (Sanger Sequencing Centre) on the reverse complement strand between base pairs 77232-76768. This peptide has functions similar to those of rat NRP-1 concerning the regulation of neuronal proliferation and migration-induction as well as neurite outgrowth and neuronal survival-promoting activities.
  • NRP-3 is encoded by a nucleic acid sequence localized on the reverse complement strand of chromosome 3 in the human genome, between base pairs 34764-33003 according to Double Twist annotation. This NRP also exhibits neuronal survival-promoting and proliferative activities, as well as migration inducing and neurite outgrowth activity.
  • NRP -4 is encoded by a nucleic acid sequence located between base pairs 21970003-21972239 on the forward strand of human chromosome 15, according to the NCBI human genome annotation project. Peptides translated from that nucleic acid sequence also belongs to the human gene family of NRPs. Peptides encoded by this sequence exhibits neurite outgrowth and survival- promoting functions as well as neuronal migration and proliferation-inducing properties.
  • a still further embodiment includes NRP-5, which isencoded by a nucleic acid sequence localized on the reverse complement strand of human chromosome 7, in the region between base pairs 15047153-14824042, as denoted by the NCBI annotation. Peptides encoded by this sequence demonstrates neuronal survival-promoting functions, as well as proliferation-inducing activity, neurite outgrowth stimulation and migration inducing properties.
  • Another embodiment of an NRP has been annotated, with a DNA sequence from the human genome located in the region 116668725-116667697 on the reverse complement strand of chromosome 6 (region according to NCBI human genome annotation project). The resulting peptide induces neuronal proliferation and migration, as well as neurite outgrowth and survival.
  • NRPs are found in rodents.
  • One mouse NRP is encoded by a nucleic acid sequence located within the arachne contig_191157 of NCBI consisting of 339 nucleic acids using reading frame 1.
  • Within an overlapping region there is a second ORF of 198 nucleic acids starting at position 29 of an annotated NRP using frame 3.
  • This ORF codes for a protein with high identity to a truncated human DNA repair protein.
  • the resulting peptide NRP-7 induces neuronal proliferation and migration, neurite outgrowth and neuronal survival.
  • a still further embodiment includes NRP-8, which is also a mouse peptide, and is encoded by a nucleic acid sequence located within the genomic clone bM344E9 of the mouse Sanger database on the reverse complement strand.
  • the protein coding sequence has been annotated and is located between base pairs 5609-4052.
  • This peptide can increase neuronal proliferation and migration as well as neurite outgrowth and neuronal survival.
  • the invention includes embodiments for in vitro bioassays for evaluating proliferative and migration-inducing activity. Until recently, there were few in vitro neuronal migration assays available that could detect migrating untagged neurons over a prolonged time-period.
  • One of these bioassays monitors olfactory peripheric placode cells organized as OTCs during a 5 day time course (Fueshko and Wray, 1994).
  • OTCs adult thalamocortical organotypic tissue cultures
  • putative NRPs can be evaluated for their ability to induce migration, proliferation, survival and/or neurite outgrowth.
  • the thalamocortical OTC assay includes the advantages of revealing both kind of neuronal migration, namely radial migration within the cortex and the induced tangential migration within the thalamus.
  • in vitro bioassays that involve cerebellar microexplants adhered to substrates. These embodiments can be used to provide data regarding patterns of neuronal migration, including quantifying the numbers of migrating neurons and the distance of migration in respect ofthe microexplant.
  • a developing migration-chain consisting of small neurons (such as inhibitory granule cells) as well as an overall enhancement of cell migration can be observed after as little as 2-3 days of cultivation. This assay result resembles the cell chain induction within thalamocortical OTCs.
  • embodiments of another aspect of the invention include the use of NRPs to treat neurodegenerative diseases and brain injuries.
  • NRPs are particularly suitable for use in brain regions lacking quiescent neuronal stem cells near the area of injury or disease.
  • NRP compounds are capable of initiating neuronal proliferation, migration, survival and neurite outgrowth within postnatally differentiated neural tissue. These properties can be exploited in treatment strategies aimed at improving or repairing neuronal circuits within impaired areas of patients with moderate to severe TBI, including diffuse axonal injury, hypoxic-ischemic encephalopathy and other forms of craniocerebral trauma. NRP compounds can be used to treat infections of the nervous system, such as common bacterial meningitis, and to treat common causes of strokes including, ischemic infarction, embolism, and haemorrhage such as hypotensive haemorrhage.
  • NRP compounds can be useful for the treatment of neurodegenerative diseases including Alzheimer's Disease, Lewy Body Dementia, Parkinson's disease (PD), Huntington's disease (HD), metabolic disorders of the nervous system including glycogen storage diseases, and other conditions where neurons are damaged or destroyed.
  • neurodegenerative diseases including Alzheimer's Disease, Lewy Body Dementia, Parkinson's disease (PD), Huntington's disease (HD), metabolic disorders of the nervous system including glycogen storage diseases, and other conditions where neurons are damaged or destroyed.
  • Figure 1 is a depiction of an arrangement of an in vitro bioassay of this invention, comprising thalamocortical co-cultures on a substrate and the subsequent generation of a thalamic cell bridge after 3-4 days of exposure to purified NRP-1. There was a preference for migration induction within the habenula nucleus a part of the limbic system within the dorsal thalamus.
  • Figure 2 depicts a schematic diagram of methods used to quantify neuronal migration within cerebellar microexplants.
  • a transparent overaly comprising ten consecutive rings of 100 ⁇ m diameter was laid around a microexplant.
  • To calculate the percentage of migrating cells all cells within a respective consecutive ring were counted and divided by the total number of cells distributed in rings 1 to 10.
  • Figure 3 depicts photomicrographs of formation of neuronal cell bridges between thalamic and cortical tissues within thalamocortical OTCs after 4 days of incubation in vitro. At the commencement of incubation, cultures were supplemented with 300 ng/ml NRP (as total protein of the hydroxy apatite chromatography).
  • Figure 3 A shows an overview of two migrating cell chains. The upper neuronal cell chain had completed its way to the cortex while the lower one had reached half way to the cortical tissue. The neuronal origin of the cell chain was verified by the MAP-2 expression pattern of the migrating cells, as shown in Figures 3 B to 3D. Double arrows in A/B point to the same location.
  • Figures 3C and 3D the micrograph of the migrating cell chain was taken near the cortical tissue. Bars: 500 ⁇ m (Figure 3A); 100 ⁇ m ( Figures 3B to 3D).
  • Figure 4 shows a photomicrograph demonstrating tissue specificity of the originating cell chain within the thalamocortical system. The migrating cell chain / cell stream originates from the thalamic tissue ( Figure 4A). At the concentration producing the greatest effect was 3 nM NRP-1. Cortical migration chains occurred and are shown in Figure 4B. Greater magnification reveals that the migrating MAP-2-positive neurons are interconnected by neurite structures (arrow in Figure 4C). In Figure 4D the onset of migration of thalamic cells can be observed. The black arrows indicate nuclei while the white arrows point to the leading process ofthe migrating cells. Bars: 500 ⁇ m ( Figures 4A and 4B); 100 ⁇ m ( Figure 4C); 80 ⁇ m ( Figure 4D).
  • Figure 5 shows a phase contrast micrograph of the thalamic region of a NRP-1 supplemented OTC (3 nM highly purified cation exchange eluate) 24 hours after the start of incubation.
  • the black line indicates the original margin of the habenula nucleus (open arrow). There was massive "tissue spreading" of the habenula nucleus.
  • the white arrows indicate a cell chain that is in the migration process. A number of neurites originated from the migrating cell chain and project to the cortical tissue (black arrow). Bar: 1000 ⁇ m.
  • Figure 6 depicts a graph of a dose-response relationship for NRP-1 in thalamocortical OTCs.
  • homogenously purified (cation exchanger) protein was administered to the thalamocortical OTCs at the start of incubation.
  • concentrations of 2, 4, 6, 20, 60 and 600 ng/ml of NRP-1 were tested.
  • concentrations of 2, 4, 6, 20, 60 and 600 ng/ml of NRP-1 were tested.
  • concentrations of 2, 4, 6, 20, 60 and 600 ng/ml of NRP-1 were tested.
  • concentrations of 2, 4, 6, 20, 60 and 600 ng/ml of NRP-1 were tested.
  • concentrations of 2, 4, 6, 20, 60 and 600 ng/ml of NRP-1 were tested.
  • concentrations of 2, 4, 6, 20, 60 and 600 ng/ml of NRP-1 were tested.
  • concentrations of 2, 4, 6, 20, 60 and 600 ng/ml of NRP-1 were tested.
  • Figure 7 shows production of a thalamocortical cell bridge after 4 days in vitro. Co-cultures were supplemented with 3 nM highly purified NRP-1.
  • Figure 7 A shows that two thalamocortical connections (arrows) have been established revealing MAP2- positive cells. The square indicates the greater magnification shown in Figure 7B.
  • Figure 7B shows the cell stream having bipolar-shaped parvalbumin-positive neurons migrating in a track-like arrangement.
  • Figure 7C shows MAP2 -positive neurons close to the origin of the thalamic cell stream. The cell stream is characterized by highly ordered positioning of the neuronal soma. The primary neurites project to the axonal layer in the middle of the cell-bridge (small arrows).
  • Figure 7D shows BrdU-positive proliferating cells (arrows) located in the habenula, the generated thalamocortical cell bridge, and within cortical layers. The circles indicate regions of high proliferation.
  • Figure 7E shows BrdU-positive cells within the cell-bridge. A subpopulation (arrows) is co-localised with parvalbumin (arrows in Figurd 7F). Bars: 500 ⁇ m ( Figures 7A and 7D); 100 ⁇ m ( Figures 7B, 7E and 7F); 50 ⁇ m ( Figure 7C).
  • Figure 8 is a photomicrograph showing enhancement of cellular expression of MAP-2 and correlation to the migration process. Strong MAP-2 expression can be observed within the apical neurite of the migrated cortical neuron, which was the leading process at the initiation of migration.
  • the white arrow indicates the location of cortical layer I is about 500 ⁇ m. Note the existence of secondary and tertiary dendrites (arrowheads). Bar: 40 ⁇ m.
  • Figure 9 is a series of photomicrographs showing proliferation and migration of parvalbumin-ir thalamic neurons inbetween the thalamic and cortical tissue of the thalamocortical co-cultures.
  • Thalamocortical OTCs were supplemented with 3 nM of highly purified NRP-1 and BrdU for 24 hours and fixed following 4DIV.
  • Figure 9A shows a confocal image revealing that the migrating cell stream contains proliferating neuronal cells positive for parvalbumin and BrdU (indicated by thick white arrows). Some neurons are only positive for parvalbumin (thin arrows). The long white arrow points to the location of the thalamic tissue.
  • Figures 9B and 9C show that most of parvalbumin-ir cells (Figure 9B) within the migrating stream are of proliferating ( Figure 9C; arrows). Note the immunoreactivity of the fibres once again confirming that the neurons "travel" along neuronal fibres. Bars: 100 ⁇ m ( Figure 9A); 50 ⁇ m ( Figures 9B and 9C).
  • Figure 10 depicts a graph showing quantitative analysis of proliferation initiation within thalamic parvalbumin-ir neurons.
  • BrdU and 3 nM NRP-1 were administered at the start of co-culturing. The medium was changed after 24 hours. Co- localisation of parvalbumin and BrdU was estimated after 5 days in vitro within the thalamic tissue, which included the habenula nucleus, the lateral geniculate nucleus, the nucleus reticularis thalami and thalamic midline nuclei. 6.8% of the total parvalbumin- ir thalamic population was of proliferative character. NRP-1 induced strong proliferation induction compared to the vehicle. N represents the number of assessed thalamic tissues.
  • Figure 11 depicts quantification of proliferative parvalbumin-ir cells within thalamic tissue. 5 days after NRP-1 administration there was a distinct induction of proliferation (white arrows) within parvalbumin-ir cells within central areas of the thalamus. The majority of parvalbumin expressing cells remained non-proliferative (arrow heads in Figure 11 A). Inside the habenula nucleus, only a minority of parvalbumin expressing cells are double labelled with BrdU ( Figure I IB). In vehicle treated cultures double-labelled parvalbumin expressing cells were found very rarely (arrow in Figure 11C). In Figure 11D there was a migrated calretinin/BrdU-positive cell near the cortical layer VI indicated. Bar: 50 ⁇ m.
  • Figure 12 depicts the specificity of the proliferation induced by NRP-1. We tested the proliferation status of astroglia by monitoring the expression patterns for GFAP and BrdU-incorporation. Thalamocortical OTCs were supplemented with 3 nM highly purified migration-inducing factor and fixed following 4 days in vitro.
  • Figure 12A depicts non-proliferative GFAP-positive astrocytes (white arrows) accompanying the neuronal migration stream with only a subpopulation of astrocytes of proliferative character (Figure 12B; white arrow heads). Approximately 30% of the astrocytes in close vicinity to the neuronal migration stream were of proliferative character. Bar: 50 ⁇ m.
  • Figure 13 depicts quantification of induction of cerebellar migration. Two days after NRP-1 administration there was a massive induction in cerebellar cell migration. Most of the cells were distributed between 200-300 ⁇ m from the cerebellar margin. A significant population of cells was distributed about 500-600 ⁇ m away from the margin. Cells from vehicle-treated cultures revealed a maximal distribution of 300 ⁇ m. The experimental data was derived from nine evaluated microexplants originating from three different cultures.
  • Figure 14 depicts neuronal migration within cerebellar microexplants.
  • the microexplants were supplemented with 75 nM purified NRP-1 after 3 h settling time on cover slips.
  • NRP-1 was added at a final concentration of 3 nM.
  • Figure 14A shows that there was massive migration of mostly small cells (10-15 ⁇ m in diameter) and neurite outgrowth originating from the microexplant. Migrating cells over 15 ⁇ m in diameter are indicated by arrowheads.
  • Small inhibitory neurons migrate as a migrating cell stream ( Figures 14 A, 14B and 14C) or more or less loosely arranged on a neuritic network (Figure 14D) interconnecting microexplants.
  • Figures 14E and 14F MAP-2 expression is shown. Arrows in Figure 14F indicate migrating neurons.
  • Figure 15 depicts results of a survival assay with NRP-2 segment KG (human chromosome 13) using a pre-incubation method. Cerebellar microexplants were pre- incubated for 15hrs with NRP-2 segment KG and subsequently injured by 3- NP/glutamate for 9hrs. After 72 hrs neuronal survival was evaluated by counting cells displaying neurite outgrowth. Using between 5-lOOnM NRP he 13 fully reversed the effect of the injury. 5, 10 and lOOnM concentrations of NRP-2 segment KG he 13 induced proliferation ofthe cultured neurons.
  • Figure 16 depicts results of a survival assay with NRP-2 segment KG.
  • FIG. 17 depicts results of proliferation induction without injury using NRP-2 segment KG and rat NRP-1. Peptides were administered 24hrs after start of cultivation to decrease interference in the assay due to initial neuronal survival or adherence effects. The cultures were fixed after 3 days in vitro. There was massive neuronal proliferation seen at 300pM of NRP-2 segment KG.
  • Figure 18 depicts results of a haptotactic migration assay using NRP-2 segment KS.
  • the NRP-2 segment KS (O.Ol ⁇ g/ml and O.l ⁇ g/ml) was diluted in O ⁇ g/ml BSA or lO ⁇ g/ml human transferrin, respectively.
  • the coated NRP-2 segment KS was subsequently followed by lOO ⁇ g/ml PDL coating. Striatal cells were seeded into PDL- coated inserts and migration behaviour was measured after 48hrs. There was massive migration induction of striatal neurons when culture dishes were coated with 150ng of NRP 2 segment KS.
  • Figure 19 depicts results of a survival study with human NRP-4 segment GQ.
  • NRP-4 segment GQ human chromosome 15
  • Figure 20 depicts results of studies on proliferation induction under injury condition using NRP-4 segment GQ. Cerebellar microexplants were injured by 3- NP/glutamate. NRP-4 segment and BrdU were administered simultaneously for 24hrs. After 72hrs BrdU-positive nuclei were counted within four microscopic fields for each culture. Proliferation induction was observed at a lOnM concentration ofthe peptide.
  • Figure 21 depicts results of a survival assay with NRP-3 segment SQ (human chromosome 3). Cerebellar microexplants were injured by 3-NP/glutamate and simultaneously rescued by NRP-3 segment SQ. After 48hrs neuronal survival was evaluated by counting cells displaying neurite outgrowth. Maximal biological activity of NRP-3 for survival was between lOOpM and InM.
  • Figure 22 depicts results of a survival assay with mouse NRP-7 segment SW.
  • Figure 24 depicts results of studies of proliferation induction under injury conditions using NRP-7 segment SW mouse peptide. Cerebellar microexplants were injured by 3-NP/glutamate. NRP and BrdU were administered simultaneously for 24hrs. After 72hrs BrdU-positive nuclei were counted within four microscopic fields for each culture. There was massive proliferation induction by O.lpM and lOOpM of mouse NRP-7. No proliferation differences between injured and non-injured cerebellar cells were observed. This indirectly indicates very low numbers of injury-induced proliferative astrocytes within the cerebellar microexplant system.
  • Figure 25 depicts results of studies of the haptotactic migration assay using NRP-7 segment SW.
  • NRP-7 O.l ⁇ g/ml and l ⁇ g/ml
  • NRP-7 was diluted in lO ⁇ g/ml BSA and coated followed by 50 ⁇ g/ml PDL coating.
  • Cortical cells were seeded into PDL-coated inserts and lpg/ml 24mer peptide was added in solution. Cell counting was done after 1 day in vitro.
  • Figure 26 depicts a flow chart of steps used to purify NRP-1.
  • Figure 27 depicts results of a cation exchange purification step to obtain homogenously purified NRP-1. Purification was carried out on High S (Biorad) cation exchanger using a low pressure chromatography unit from Biorad. 80% acetone- precipitated bioactive peak from gel filtration chromatography, extensively desalted against 10 mM citrate (pH 4), is chromatographed (1 ml/min) in 0.01 M citrate (pH 4). The column was eluted using IM NaCl in 0.01 M citrate (pH 4.5). Migration- promoting activity eluted between 43-53 ml elution volume. Absorbance was measured at 254 nm wavelength. Purity of the resulting NRP was verified by N- terminal amino acid sequencing, which produced unambiguous results.
  • Figure 28 depicts results of an analysis of NRP-1 by MALDI-TOF mass spectrometry. Purity and mass (M + H + ) of the major peptide from the cation exchange purification was confirmed by MALDI-TOF MS. The single charged peptide NRP-1 that represents the major peak has a molecular mass of 2046. DETAILED DESCRIPTION Definitions
  • homolog includes one or more genes whose gene sequences are significantly related because of an evolutionary relationship, either between species (ortholog) or within a species (paralog). Homolog also includes genes related by descent from a common ancestral DNA sequence. Homolog also includes a relationship between genes separated by a speciation event, or to a relationship between genes by the event of genetic duplication (see paralog). As used herein, the term “homolog” also includes gene products related to each other by way of an evolutionary relationship. NRPs having conserved amino acid sequence domains are examples of homologs.
  • paralog includes one of a set of homologous genes that have diverged from each other as a consequence of genetic duplication.
  • the mouse alpha globin and beta globin genes are paralogs.
  • the term "paralog” also includes gene products related to each other by way of an evolutionary relationship. Human NRPs having conserved amino acid sequence domains are examples of paralogs.
  • ortholog includes one of a set of homologous genes that have diverged from each other as a consequence of speciation.
  • alpha globin genes of mouse and chick are orthologs.
  • ortholog also includes gene products related to each other by way of an evolutionary relationship. Human and mouse NRPs having conserved amino acid sequence domains are examples of homologs.
  • paralog peptide includes a peptide encoded by a paralog nucleotide sequence.
  • peptide and protein include polymers made of amino acids.
  • prodrug includes molecules, including pro-peptides which, following enzymatic, metabolic or other processing, result in an active NRP, an active NRP analog or a NRP paralog.
  • NRP compound includes NRPs, NRP homologs, NRP paralogs,
  • NRP neuronal regeneration peptides having functions including neural or neuroblast migration, proliferation, survival and/or neurite outgrowth, regardless of evolutionary relationship.
  • Amino acids are represented by the standard symbols where alanine is represented by “A” or “Ala”, arginine by “R” or “Arg”, asparagine by “N” or “Asn”, aspartic acid by “D” or “Asp”, cysteine by “C” or “Cys", glutamic acid by “E” or “Glu”, glutamine by "Q” or “Gin”, glycine by “G” or “Gly”, histidine by “H” or “His”, isoleucine by "I” or “He”, leucine by "L” or “Leu”, lysine by "K” or “Lys", methionine by "M” or “Met”, phenylalanine by “F” or “Phe”, proline by “P” or “Pro”, serine by “S” or “Ser”, threonine by “T” or Thr”, tryptophan by "W” or “Trp", tyrosine by “Y” or “Ty
  • Nucleic acids comprise nudeotides including adenine, which is represented by “a”; thymine, which is represented by “t”; cytosine, which is represented by “c” and guanine, which is represented by “g.”
  • a nucleotide which can be either guanine or adenine is represented by "r”
  • a nucleotide which can be either thymine or cytosine is represented by "y”
  • a nucleotide which can be either guanine, adenine, cytosine, or thymine is represented by "n”.
  • Polynucleotides may be DNA or RNA, and may be either single stranded or double stranded. Where the polynucleotide is a RNA polynucleotide, uracil "u” may be substituted for thymine.
  • Embodiments of this invention include compositions and methods for the treatment of brain damage, encompassing a neuronal migration-inducing, neurite outgrowth and proliferation-promoting factor (NRPs, NRP analogs and/or NRP prodrugs, and peptides encoded by NRP paralogs, including human and mouse paralogs, homologs and orthologs).
  • NRPs neuronal migration-inducing, neurite outgrowth and proliferation-promoting factor
  • NRPs neuronal migration-inducing, neurite outgrowth and proliferation-promoting factor
  • NRPs neuronal migration-inducing, neurite outgrowth and proliferation-promoting factor
  • NRPs neuronal migration-inducing, neurite outgrowth and proliferation-promoting factor
  • NRPs neuronal migration-inducing, neurite outgrowth and proliferation-promoting factor
  • nucleotide sequence SEQ ID NO: 1
  • amino acid sequence SEQ ID NO: 2
  • nucleic acid sequences may encode for the same amino acid sequence.
  • SEQ ID NO: 2 Each of these variations can be translated into SEQ ID NO: 2, and thus, all of these variations are included within the scope of this invention.
  • multiple nucleic acid sequences including the nucleic acid sequence listed in SEQ ID NO: 1, encode for the rat NRP-1 amino acid sequence.
  • the invention further comprises variants of the nucleotide sequence of SEQ ID NO: 1, including variants which preserve the amino acid sequence encoded by the nucleic acid sequences, as well as nucleic acid sequences which encode for rat NRP-1 analogs and NRP-1 orthologs and or paralogs.
  • RNA as well as DNA may encode the peptides of the invention, and that where a nucleic acid is a RNA nucleic acid, uracil may be substituted for thymine.
  • a human gene was annotated using the human cachexia cDNA (US Patent No: 5,834,192) as a template.
  • a survival-promoting peptide has more than 96% identity to a survival-promoting peptide (Cunningham et al., 1998) and rat NRP-1 has 100% identity to the cachexia proetin and is the only NRP-1 homologue with known respective cDNA.
  • Human cachexia protein is localised on chromosome 12 within the region of base pairs 621841-625428 and consists of 5 exons.
  • NRP-2 The nucleotide and amino acid sequences relating to NRP-2 are:
  • the underlined nucleotide sequence denotes the signal peptide.
  • the protein coding DNA sequence consists of 4 exons as predicted by splice site analysis taking the sequence of the paralog form of the human cachexia gene (cDNA from US patent 5,834,192) on chromosome 12 as a template.
  • the chromosome map of the genomic clone bA87Gl is considered as the basis for the exact exon localisation.
  • Exon 1 is located between bp 77232-77170.
  • Exon 2 is located between bp 77088-77046.
  • Exon 3 is located between bp 77036-76824.
  • Exon 4 is located between base pairs 76778-76768 followed by the translation stop codon TAA.
  • the translated protein consists of 110 amino acids, is identical in length to the human cachexia protein, and has 24.5% overall identity to human cachexia protein. Sequence comparison of the signal peptides for extracellular localisation (amino acids 1-19) of both proteins reveals 31.6% identity. Significantly, comparison of the first 30 amino acids of the mature (cleaved) peptide reveals 46.7% amino acid identity. Furthermore this peptide has similar neuronal migration, proliferation, survival and neurite outgrowth activities as NRP-1 (see Figures 16, 17 and 18).
  • a second ortholog of NRP-1 has been annotated, and is encoded by a DNA sequence from the human genome located between the base pairs 34764-33003 on the reverse complement strand of chromosome 3 (region according the Double Twist human genome annotation project).
  • the protein coding sequence consists of 5 exons with the following locations: exon 1: 34764-34743; exon 2: 34729-34700; exon 3: 33745-33596; exon 4: 33498-33459; exon 5: 33043-33003.
  • the nucleotide sequence (SEQ ID NO: 6) has 333 nudeotides and the amino acid sequence (SEQ ID NO: 7; herein termed NRP-3) has 111 amino acids, as denoted below.
  • NRP-3 This sequence belongs to the human gene family of NRP's, and it is herein termed NRP-3.
  • the sequence has 50% identity and 62.7% similarity to the human cachexia-associated protein.
  • the peptide encoded by this nucleotide sequence has similar properties to NRP- 1.
  • a third NRP-1 ortholog has been annotated is contained in the DNA sequence from the human genome located between the region 21970003-21972239 on the forward strand of human chromosome 15 (region according NCBI human genome annotation project).
  • the protein coding sequence consists of 6 exons with the following locations: exon 1: 21970003-21970031; exon 2: 21970515-21970545; exon 3: 21970571-21970644; exon 4: 21970818-21970861; exon 5: 21971526-21971731; exon 6: 21972189-21972239.
  • the sequence consists of 435 nucleic acids that encode 145 amino acids.
  • the nucleotide sequence (SEQ ID NO: 8) and amino acid sequence (SEQ ID NO: 9; herein termed NRP-4) are:
  • This sequence belongs to the human gene family NRP's. This sequence has 45% amino acid similarity to the NRP encoded by a nucleic acid sequence located on human chromosome 13. Triplet 244-246 (amino acid position 82); triplet 391-393 (amino acid position 131) and triplet 421-423 (amino acid position 141) encode potential N-glycosylation sites. Amino acid position 118 has an x because of uncertainty within the nucleic acid sequence.
  • the peptide, NRP-4 exhibits neural proliferation promoting activity, neurite outgrowth and neuronal survival promoting activities.
  • NRP-5 Another human ortholog of rat NRP-1 is encoded by the DNA sequence located within the Homo sapiens chromosome 7 working draft (NCBI: ref/NT_007933.9/Hs7_8090) of the NCBI database on the reverse complement strand.
  • the protein coding sequence has been annotated and consists of 3 exons with 798 nucleic acids in total length coding for 266 amino acids. The exact locations for the protein coding exons are the following: exon 1: 15047153-15046815; exon 2: 14897885-14897772; exon 3: 14824386-14824042.
  • exon 1 15047153-15046815
  • exon 2 14897885-14897772
  • exon 3 14824386-14824042.
  • the entire protein NRP-5 consists of 266 amino acids.
  • the annotated translated NRP amino acid sequence NRP-5 has 76% similarity to a human calcium dependent activator protein of secretion (GenBankXP_036915) located on chromosome 3. Furthermore, exon 1 (339 nucleic acids) of the translated human chromosome 7 NRP-5 has 95.5% homology to a translated mouse 5' EST (RQ ENBB632392). This protein shares domains present in NRP-1 and other NRPs that exhibit biological properties of neurite outgrownth, neuronal survival, neuronal proliferation and neuronal migration.
  • NRP-6 consists of 234 nucleic acids that encode 78 amino acids. This sequence belongs to the human gene family of NRPs.
  • the highest homology found to human ESTs presents identity from nucleic acids 59-234 compared to the human cDNA clone GenBankCS0DK001YI19 isolated from human placental tissue. This clone was sequenced from the 3 '-prime end and consists of 924 nucleic acids. Because our homologue form ends with the stop codon TGA after 234 nucleic acids we are not dealing with the same gene product.
  • the nucleotide sequence (DEQ ID NO: 12) encoding for an NRP, and the amino acid sequence (SEQ ID NO: 12; NRP- 6) for the peptide is:
  • NRP-6 has 14.1% identity and 44.9% similarity to the annotated NRP paralog on human chromosome 13, NRP-2.
  • This protein shares domains present in NRP-1 and other NRPs (e.g., NRPs 2-5) that have biological properties of neurite outgrowth, neuronal survival, neuronal proliferation and neuronal migration.
  • NRP-1 ortholog has been identified, a mouse NRP family member.
  • the mouse NRP family member (here indicated as protein 2, SEQ ID NO: 17; herein termed NRP-7) is located within the arachne contig_191157 of NCBI consisting of 339 nucleic acids using reading frame 1.
  • This 5 '-generated mouse EST has the accession number GenBankAK012518 and the following sequence (SEQ ID NO: 14): 5'ggcagcctcgagatggggaagatggcggctgctgtggcttcattagccacgctggctgcagagcccagagaggatgctt tccgga agcttttccgcttctaccggcagagccggcggggacagcggacctgggagccgtcatcgacttctcagaggcgcacttgg ctcgg agcccgaagcccggcgtgcccaggtaggaaaggaggaggagtagtgtgtgccagcctagcggccgactgggccacccgag actgg gccgctccgcggctttggagggaagcccctgggccctg
  • ID NO: 15 This sequence has 82% homology (identity and chemical similarity) of amino acid sequence to the human alkylated DNA repair protein with the GenBank accession number Q13686.
  • the mouse form is C-terminal truncated and has only 66 of the 389 amino acids ofthe human DNA repair protein.
  • the protem coding sequence consists of two exons with an overall length of 339 nucleic acids coding for 113 amino acids.
  • exon 1 The location of exon 1 is: 23970-23990, and for exon 2 it is: 24057-24374.
  • NRP-9 of this mouse NRP ortholog of rat NRP-1 are:
  • the entire expressed ammo acid sequence of NRP-9 contains 113 ammo acids.
  • the protem function program tool SMART predicts a signal peptide sequence consisting of 28 amino acids.
  • the protein has 13.6% identity and 23.6% similarity towards the NRP ortholog on human chromosome 13, and has neuronal survival, migration, proliferation and outgrowth activity similar to NRP-1.
  • a second mouse NRP family member is located withm the genomic clone bM344E9 ofthe mouse Sanger database on the reverse complement strand.
  • search program tBLASTN using the biologically active NRP peptide sequence: KDPEARRAPGSLHPCLAASCSAAG (SEQ ID NO: 18) we obtained an area of similanty in the genomic mouse Sanger database within the genomic clone bM344E9.
  • the protein coding sequence has been annotated and consists of 5 exons and is 423 nucleic acids in total length coding for 141 ammo acids.
  • the locattons for the coding exons are the following: exon 1 : 5609-5596; exon 2: 5502-5489; exon 3: 5398-5283; exon 4: 5243-5229; exon 5: 5215-4952.
  • the coding nucleotide sequence (SEQ ID NO: 19) and the amino acid sequence (SEQ ID NO:20)of the mouse ortholog of rat NRP-1 (herein termed NRP-10) is-
  • the expressed amino acid sequence of NRP-10 contains 141 amino acid residues.
  • the asparagine residue at position 112-114 is putatively N-glycosylated according to the occurrence of an N-glycosylation consensus sequence.
  • the new mouse NRP-1 ortholog NRP-10 has 35.5% homology to the human NRP ortholog located on chromosome 13 (NRP-2) and 28.9% homology to the mouse NRP-1 ortholog located on the arachne contig from NCBI.
  • this peptide comprises amino acid sequence domains similar to those present in NRP-1 or other NRP peptides and this peptide has biological properties including neuronal migration, proliferation, survival and/or neurite outgrowth.
  • NRP-like peptide domains genes having NRP-like peptide domains, that also can be useful for expressing NRPs. These include genes from mycobacteria and tumor cells.
  • a recently published paper has disclosed a PE multigene family of Mycobacterium tuberculosis containing a consensus sequence (PE PGRS) which is similar to our proposed sequence (PGR/S). They also mention that these proteins are released in the host, by the bacterium, to promote bacterial survival. Here are the examples they provided in the paper, where the PE_PGRS consensus sequence was found.
  • NRP-1 - NRP 10 need not be used. Rather, peptide fragments of about 8 amino acids can be used according to embodimentsof this mvention. Given the consensus sequence domains herein identified, one can fashion synthetic peptides or can truncate naturally occurring NRPs to obtain portions of peptides that are biologically active. Methods of truncation (e.g., using synthetic DNA) or enzymatic modification of expressed peptides are known in the art.
  • the invention includes embodiments which relate to NRPs, peptides encoded by NRP-1, homologs, orthologs or paralogs of NRP-1, analogs of NRP-1, and prodrugs of NRP-1, where a prodrug of NRP-1 is a molecule that may be enzymatically, metabolically or otherwise modified to become NRP-1, a NRP homolog, NRP paralog, an NRP ortholog or an NRP analog.
  • NRP compounds may be encoded for by nucleotide sequences, which may be DNA or RNA and which may be single stranded or double stranded.
  • NRP-1 and related NRPs can induce neurons and neuroblasts to proliferate and migrate. Proliferation and migration of neural cells into areas of damage caused by acute brain injury or chronic neurodegenerative disease can result in improvement in neural functioning.
  • NRP compounds may be used to treat a variety of disorders and conditions where brain tissue degenerates or has died.
  • NRP compounds can be of benefit include: Infections of the central nervous system including bacterial, fungal, spirochetal, parasitic and sarcoid including pyrogenic infections, acute bacterial meningitis, leptomeningitis;
  • Cerebrovascular diseases including stroke, ischemic stroke, atherosclerotic thrombosis, lacunes, embolism, hypertensive haemorrhage, ruptured aneurysms, vascular malformations, transient ischemic attacks, intracranial haemorrhage, spontaneous subarachnoid haemorrhage, hypertensive encephalopathy, inflammatory diseases of the brain arteries, decreased perfusion caused by, for example, cardiac insufficiency (possibly resulting from coronary bypass surgery) and other forms of cerebrovascular disease; Craniocerebral trauma including basal skull fractures and cranial nerve injuries, carotid-cavernous fistula, pneumocephalus, aerocele andrhinorrhea, cerebral contusion, traumatic intracerebral haemorrhage, acute brain swelling in children;
  • Demyelinating diseases including neuromyelitis optica, acute disseminated encephalomyelitis, acute and subacute necrotizing haemorrhagic encephalitis, diffuse cerebral sclerosis of Schilder and multiple sclerosis in conjunction with peripheral neuropathy;
  • Degenerative diseases of the nervous system including syndrome of one or more of progressive dementia, diffuse cerebral atrophy, diffuse cortical atrophy of the non- Alzheimer type, Lewy body dementia, Pick's disease, frontotemporal dementia, thalamic degeneration, non-Huntingtonian types of Chorea and dementia, cortico- spinal degeneration (Jakob), the dementia-Parkinson-amyotrophic lateral sclerosis complex (Guamanina and others); Acquired metabolic disorders of the nervous system including metabolic diseases presenting as a syndrome comprising one or more of confusion, stupor or coma-ischemia-hypoxia, hypoglycae ia, hyperglycemia, hypercapnia, hepatic failure and Reye syndrome, metabolic diseases presenting as a progressive extrapyramidal syndrome, metabolic diseases presenting as cerebellar ataxia, hyperthermia, celiac- sprue disease, metabolic diseases causing psychosis or dementia including Cushing disease and steroid encephalopathy, thyroid psychos
  • compositions and methods of the invention can find use in the treatment of human neural injury and disease. Still more generally, the compositions and methods of the invention find use in the treatment of human patients suffering from neural damage as the result of acute brain injury, including but not limited to diffuse axonal injury, perinatal hypoxic-ischemic injury, traumatic brain injury, stroke, ischemic infarction, embolism, and hypertensive haemorrhage; exposure to CNS toxins, infections of the central nervous system, such as, bacterial meningitis; metabolic diseases such as those involving hypoxic-ischemic encephalopathy, peripheral neuropathy, and glycogen storage diseases; or from chronic neural injury or neurodegenerative disease, including but not limited to Multiple Sclerosis, Lewy Body Dementia, Alzheimer's disease, Parkinson's disease and Huntington's disease. Patient's suffering from such diseases or injuries may benefit greatly by a treatment protocol able to initiate neuronal proliferation and migration, as well as neurite outgrowth.
  • the invention has application in the induction of neuronal and neuroblast migration into areas of damage following insult in the form of trauma, toxin exposure, asphyxia or hypoxia-ischemia.
  • NRP compounds including NRP-1, its orthologs, analogs, paralogs and prodrugs containing the identified NRP peptide domains, can be used to promote neuronal and neuroblast migration. Most conveniently, this can be effected through direct administration of NRP compounds to the patient. However, while NRPs can be advantageously used, there is no intention to exclude administration of other forms of NRP compounds. For example, human paralog forms or peptide fragments of NRP can be administered in place of NRP.
  • the effective amount of NRP in the CNS can be increased by administration of a pro-drug form of NRP that comprises NRP and a carrier, NRP and the carrier being joined by a linkage that is susceptible to cleavage or digestion within the patient. Any suitable linkage can be employed which will be cleaved or digested to release NRP following administration.
  • NRP levels to be increased through an implant that is or includes a cell line that is capable of expressing NRP or analogs, paralogs or pro-peptides of an NRP in an active form within the central nervous system ofthe patient.
  • NRP can be administered as part of a medicament or pharmaceutical preparation. This can involve combining NRP compounds with any pharmaceutically appropriate carrier, adjuvant or excipient. Additionally an NRP compound can be used with other non-NRP neuroprotective, proliferative, or other agent. The selection of the carrier, adjuvant or excipient will of course usually be dependent upon the route of administration to be employed.
  • the administration route can vary widely.
  • An NRP may be administered in different ways: intraperitoneal, intravenous or intracerebroventricular.
  • the peripheral application may be the way of choice because then there is no direct interference with the central nervous system.
  • peripheral route of administration known in the art can be employed. These can include parenteral routes for example injection into the peripheral circulation, subcutaneous, intraorbital, ophthalmic, intraspinal, intracistemal, topical, infusion (using eg. slow release devices or minipumps such as osmotic pumps or skin patches), implant, aerosol, inhalation, scarification, intraperitoneal, intracapsular, intramuscular, intranasal, oral, buccal, pulmonary, rectal or vaginal.
  • the compositions can be formulated for parenteral administration to humans or other mammals in therapeutically effective amounts (eg. amounts which eliminate or reduce the patient's pathological condition) to provide therapy for the neurological diseases described above.
  • One route of administration includes subcutaneous injection (e.g., dissolved in 0.9% sodium chloride) and oral administration (e.g., in a capsule).
  • NRP compounds may on occasion be desirable to directly administer NRP compounds to the CNS of the patient.
  • This can be achieved by any appropriate direct administration route. Examples include administration by lateral cerebro ventricular injection or through a surgically inserted shunt into the lateral cerebro ventricle of the brain of the patient.
  • an effective amount of an NRP to be administered is within the skill of one of ordinary skill in the art, and will be routine to those persons skilled in the art.
  • the amount of an NRP to be used can be estimated by in vitro studies using an assay system as described herein.
  • the final amount of an NRP to be administered will be dependent upon the route of administration, upon the NRP used and the nature of the neurological disorder or condition that is to be treated.
  • a suitable dose range may for example, be between about 0.01 mg to about 1 mg per 100 g of body weight, alternatively about 0.06 ⁇ g to about 0.6 mg of NRP-1 per lOOg of body weight where the dose is administered centrally.
  • NRP can be directly synthesized by conventional methods such as the stepwise solid phase synthesis method of Merryfield et al., 1963 (J. Am. Chem. Soc. 15:2149-2154).
  • stepswise solid phase synthesis method of Merryfield et al., 1963 (J. Am. Chem. Soc. 15:2149-2154).
  • Such methods of peptide synthesis are known in the art, and are described, for example, in Fields and Colowick, 1997, Solid Phase Peptide Synthesis (Methods in Enzymology, vol. 289), Academic Press, San Diego, CA.
  • Alternatively synthesis can involve the use of commercially available peptide synthesizers such as the Applied Biosystems model 430 A.
  • the total pharmaceutically effective amount of NRP-1 administered parenterally per dose will be in a range that can be measured by a dose response curve.
  • One range is between about 0.06 mg and about 0.6 mg per 100 g body weight.
  • NRP-1 in the blood can be measured in body fluids of the mammal to be treated to determine dosing.
  • the amount of NRP-1 to be employed can be calculated on a molar basis based on these serum levels of NRP- 1.
  • one method for determining appropriate dosing of the compound entails measuring NRP levels in a biological fluid such as a body or blood fluid. Measuring such levels can be done by any means, including RIA and ELISA. After measuring NRP levels, the fluid is contacted with the compound using single or multiple doses. After this contacting step, the NRP levels are re-measured in the fluid. If the fluid NRP levels have fallen by an amount sufficient to produce the desired efficacy for which the molecule is to be administered, then the dose of the molecule can be adjusted to produce maximal efficacy. This method can be carried out in vitro or in vivo.
  • This method can be carried out in vivo, for example, after the fluid is extracted from a mammal and the NRP levels measured, the compound herein is administered to the mammal using single or multiple doses (that is, the contacting step is achieved by administration to a mammal) and then the NRP levels are remeasured from fluid extracted from the mammal.
  • NRP compounds are suitably administered by a sustained-release system.
  • sustained-release compositions include semi-permeable polymer matrices in the form of shaped articles, for example, films, or microcapsules.
  • Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919; EP 58,481), poly(2-hydroxyethyl methacrylate) (Langer et al, 1981), ethylene vinyl acetate (Langer et al, supra), or poly-D-(-)-3-hydroxybutyric acid (EP 133,988).
  • Sustained- release compositions also include a liposomally associated compound.
  • Liposomes containing the compound are prepared by methods known to those of skill in the art, as exemplified by DE 3,218,121; Hwang et al, 1980; EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. Appln. 83-1 18008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324.
  • liposomes are of the small (from or about 200 to 800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the most efficacious therapy. All U.S. parents referred to herein, both supra and infra, are hereby incorporated by reference in their entirety.
  • PEGylated peptides having a longer life than non-PEGylated peptides can also be employed, based on, for example, the conjugate technology described in WO 95/32003 published November 30, 1995.
  • doses may be between about 0.01 to about 1 mg per lOOg of body weight, alternatively about 0.06 ⁇ g to 0.6 mg of NRP compound per lOOg body weight.
  • the compound can be formulated generally by mixing each at a desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically, or parenterally, acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides. It can be appreciated that the above doses are not intended to be limiting.
  • formulations can be prepared by contacting a compound uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if desired, the product can be shaped into the desired formulation.
  • the carrier is a parenteral carrier, alternatively, a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, a buffered solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein.
  • the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
  • additives such as substances that enhance isotonicity and chemical stability.
  • Such materials are desirably non-toxic to recipients at the dosages and concentrations employed, and include, by way of example only, buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; glycine; amino acids such as glutamic acid, aspartic acid, histidine, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, mannose, trehalose, or dextrins; chelating agents such
  • NRP compound can be desirably formulated in such vehicles at a pH of from about 4.5 to about 8. It will be understood that use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of salts of the compound.
  • the final preparation may be a stable liquid or lyophilized solid.
  • adjuvants can be used.
  • Typical adjuvants which may be incorporated into tablets, capsules, and the like are a binder such as acacia, corn starch, or gelatin; an excipient such as microcrystalline cellulose; a disintegrating agent like corn starch or alginic acid; a lubricant such as magnesium stearate; a sweetening agent such as sucrose or lactose; a flavoring agent such as peppermint, wintergreen, or cherry.
  • a binder such as acacia, corn starch, or gelatin
  • an excipient such as microcrystalline cellulose
  • a disintegrating agent like corn starch or alginic acid
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose or lactose
  • a flavoring agent such as peppermint, wintergreen, or cherry.
  • the dosage form is a capsule, in addition to the above materials, it may also contain a liquid carrier such as a
  • a syrup or elixir may contain the active compound, a sweetener such as sucrose, preservatives like propyl paraben, a coloring agent, and a flavoring agent such as cherry.
  • a sweetener such as sucrose
  • preservatives like propyl paraben a coloring agent
  • a flavoring agent such as cherry.
  • Sterile compositions for injection can be formulated according to conventional pharmaceutical practice. For example, dissolution or suspension of the active compound in a vehicle such as water or naturally occurring vegetable oil like sesame, peanut, or cottonseed oil or a synthetic fatty vehicle like ethyl oleate or the like may be desired. Buffers, preservatives, antioxidants, and the like can be incorporated according to accepted pharmaceutical practice.
  • an NRP compound to be used for therapeutic administration may be sterile. Sterility can be readily accomplished by filtration through sterile filtration membranes (e.g., membranes having pore size of about 0.2 micron). Therapeutic compositions generally can be placed into a container having a sterile access port, for example an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • an NRP compound can be stored in unit or multi-dose containers, for example, sealed ampules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
  • a lyophilized formulation 10-mL vials are filled with 5 ml of sterile-filtered 0.01% (w/v) aqueous solution of compound, and the resulting mixture is lyophilized.
  • the infusion solution can be prepared by reconstituting lyophilized compounds using bacteriostatic water or other suitable solvent.
  • therapeutic methods include gene therapy for treating an organism, using a nucleic acid encoding an NRP compound.
  • gene therapy can be used to increase (or overexpress) NRP levels in the organism.
  • nucleotide sequences include SEQ ID NOs: 1, 3, 4, 6, 8, 10, 12, 14, 16 or 19, or portions thereof that encode peptides having the consensus domains and biological properties of NRP. It can be appreciated that other sequences can be used to encode a pro-NRP, which, upon cleavage, can result in a biologically active NRP.
  • any suitable approach for transfecting an organism with a sequence encoding an NRP can be used.
  • in vivo and ex vivo methods can be used.
  • a nucleic acid either alone or in conjunction with a vector, liposome, precipitate etc. is injected directly into the organism, for example, a human patient, and in some embodiments, at the site where the expression of an NRP compound is desired.
  • ex vivo treatment an organism's cells are removed, the nucleic acid is introduced into these cells, and the modified cells are administered to the organism either directly or, for example, encapsulated within porous membranes which are implanted into the patient. See, e.g. U.S. Pat. Nos. 4,892,538 and 5,283,187.
  • nucleic acids there are a variety of techniques available for introducing nucleic acids into viable cells. The techniques vary depending upon whether the nucleic acid is transferred into cultured cells in vitro, or in vivo in the cells of the intended host. Techniques suitable for the transfer of nucleic acid into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, DEAE- dextran, the calcium phosphate precipitation method, etc. A commonly used vector for ex vivo delivery ofthe gene is a retrovirus.
  • in vivo nucleic acid transfer techniques include transfection with viral vectors (such as adenovirus, Herpes simplex I virus, or adeno- associated virus) and lipid-based systems (useful lipids for lipid-mediated transfer of the gene are N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA), dioleoylphatidylethanolamine (DOPE) and 3- ⁇ [N-(N',N'- dimethylamionethane)carbomoyl]cholesterol (DC-Choi), for example.
  • viral vectors such as adenovirus, Herpes simplex I virus, or adeno- associated virus
  • lipid-based systems useful lipids for lipid-mediated transfer of the gene are N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA), dioleoylphat
  • nucleic acid source with an agent that directs the nucleuc acid-containing vector to target cells.
  • target molecules include antibodies specific for a cell-surface membrane protem or the target cell, a ligand for a receptor on the target cell, etc.
  • proteins which bind to a cell-surface membrane protein associated with endocytosis may be used for targeting and/or to facilitate uptake. Examples of such proteins include capsid proteins and fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, and proteins that target intracellular localization and enhance intracellular half-life.
  • receptor- mediated endocytosis can be used.
  • Kits are also contemplated within the scope of this invention.
  • a typical kit can comprise a container, in some embodiments a vial, for the NRP formulation comprising one or more NRP compounds in a pharmaceutically acceptable buffer and instructions, such as a product insert or label, directing the user to utilize the pharmaceutical formulation.
  • NRPs within the human and mouse genome. These new NRP genes were annotated using the following methods.
  • This sequence encodes a peptide having striking homology to the cachexia-related protein fragment having amino acids 1-30 (cachexia protein without signal sequence). These methods were also used to identify other human NRP orthologs, as well as mouse NRP orthologs. A program for multiple or pairwise alignment of protein or nucleic acid sequences, ClustalW, was used to perform alignment analysis. In order to identify the protein-coding exons of the newly annotated NRP gene on human chromosome 13, (SEQ ID NO: 4) the protein encoding nucleotide sequences of the cachexia protein were compared with the region around the ORF of chromosome 13. The non-coding 5' region of cachexia DNA was used to determine exon 1 of the NRP ortholog.
  • annotation we mean to include processes for identifying DNA sequences containing protein encoding information, splice sites to create new exons, and for predicting the existence and structures, including specific amino acid, peptide or protein domains suitable for identification of NRPs having desirable biological or other properties.
  • hexamer human consensus sequences for splice sites of the splicosomes were aligned to the respective chromosome 13 NRP sequence (SEQ ID NO: 4) to identify exon-intron boundaries in order to determine the number of exons present in the protein-coding sequence of a newly annotated NRP gene sequence.
  • SEQ ID NO: 4 For identification of mouse splice sites, publications from Baldwin et al. and Wagener et al. were used as templates.
  • human splice site identification publications from van der Flier et al. and Guth et al. were used.
  • NRPs exist in a newly recognized gene family of neural regeneration peptides, having related amino acid domains and having similar biological properties.
  • Members of the NRP gene family include peptides derived from human, rat, mouse and bacterial origin. NRPs of this family can be used to treat a variety of neurological conditions or injury to neural tissue in which neural repair is needed.
  • Neocortical tissue areas 17-18 according to the Paxinos rat atlas of the developing rat brain
  • thalamic tissue from the dorsal thalamus (visual areas) were extracted. These areas represent the visual axis.
  • the dorsal thalamus was accessed by an intersection cut to remove the hypothalamus.
  • the thalamus was sliced frontally using a Mclllwain tissue chopper into 350 ⁇ m thick slices.
  • the habenula nucleus served as a landmark to select only dorsal thalamic areas.
  • Cortical tissues were cut using two sagittal and two frontal intersections in order to obtain areas 17-18 of the occipital cortex. Before the last frontal cut was made, the hippocampal formation was removed.
  • cortical tissues were sliced by a Mclllwain tissue chopper into 350 ⁇ m thick frontal slices and was incubated in Gey's balanced salt solution (GBSS) plus 0.65 % D(+)glucose, and tissues were kept at 4°C for at least 30-40 minutes for recovery.
  • GBSS Gey's balanced salt solution
  • a glass substrate e.g., a cover slip; Figure 1
  • a plasma clot was adhered to the substrate using a plasma clot and the tissues were subsequently cultured (cultivated) at 36°C in a roller tube incubator as organotypic cultures using BME/HBSS (Invitrogen) medium supplemented with 25% heat-inactivated horse serum (Gaehwiler, 1981).
  • BME/HBSS Invitrogen
  • HSA heat-inactivated horse serum
  • a 712.5 ⁇ l sample of prepared medium was supplemented with 37.5 ⁇ l purified rat NRP-1 (in concentrated or diluted form) in 0.01 M sodium phosphate (pH 7.3) or phosphate alone (control).
  • the peptide was concentrated 4 times by speed vacuum centrifugation. The medium was changed every three days. After each study was completed, the tissues were fixed using conventional fixatives, and migrating neurons were analysed by immunocytochemistry.
  • NRPs including rat NRP-1 and human and mouse orthologous NRPs induced one or more thalamocortical cell bridge(s) over a long distance, for example, about 3-5 mm within a time of only 3 to 4 days of cultivation (see Figure 1).
  • NRPs can be identified and/or quantified.
  • NRPs amounts can be standardized, forming a basis for therapeutic application of NRPs to treat neurological diseases or conditions.
  • Figure 3 depicts formation of cell bridges induced by rat NRP-1 harvested from hippocampal OTC supernatant.
  • the NRP-1 was administered to the thalamocortical OTCs at cultivation start (see Figure 3). Under these conditions, the formation of cell bridges comprising both proliferating and differentiated neurons takes place.
  • cell bridges originated from the thalamic tissue (see Figures 3 and Figures 4A and 4D), and only at a single dose of NRP, a cell bridge originated from cortical tissue as well ( Figure 4B).
  • Figure 4B One possible reason for this observation could be the different anatomy of thalamic and cortical tissue, respectively.
  • Neocortical tissue possesses a basal lamina that can hinder migrating thalamic cells from penetrating into the cortical tissuse, whereas the thalamus lacks such a basal lamina.
  • an interconnecting neurite network between the respective tissues was formed within the first 36 hours after cultivation had started in NRP-1 supplemented thalamocortical co-cultures (see Figure 5). The first migrating cells were observed between 30 and 48 hours after cultivation began (see Figure 4D).
  • a dose-response curve revealed that an applied concentration of 6 ng/ml (3 nM- 1/500 diluted 3 ⁇ g/ml homogenously purified NRP-1) established a cell bridge of 2500+240 ⁇ m length between the thalamic and cortical tissues.
  • the concentration range for biological activity range within the in vitro system was between about 1 and 10 nM.
  • the concentration of 3 ⁇ g/ml NRP-1 was estimated from the absorbance value of 0.003 measured at the UV wavelength of 280 nm.
  • NRP-1 induces neuronal migration in postnatal explant thalamocortical brain slices.
  • the migrating cell chains overbridge gap regions between thalamic and cortical tissue.
  • NRPs can be used to promote neuronal cell migration.
  • the ability of NRPs to induce neuronal migration indicates an application for NRP-1 in restoring neuronal networks, which degenerate in neurodegenerative diseases and injuries.
  • Example 3 Migrating Cells are of Neuronal Origin and Adopt a Differentiated Phenotype
  • OTCs were then incubated for 5 min in 1% H 2 0 2 followed by a treatment of 0.4% Triton 100 and 10% normal goat serum (blocking solution) for 3 h (Sigma chemicals).
  • Primary antibodies anti-parvalbumin IgG; anti-calretinin IgG; anti-MAP-2 IgG were incubated with 0.4% Triton; 2% BSA; 2% normal goat serum in PBS over night at 4°C.
  • biotyinylated secondary antibody followed by streptavidin-Cy2 and a goat anti-mouse IgG coupled to Cy2 (1/150) were used. OTCs were rinsed for 3x15 min between incubation steps.
  • Peroxidase reactivity was developed with 0.05% diaminobenzidine (DAB) and 0.009% H 2 0 2 in 50 mM Tris buffer (pH 7.4) for 10 min. Subsequent treatments included dehydration, clearance, and coversliping of co-cultures with DePeX ® (Serva, Heidelberg, Germany) for DAB- treated OTCs, or Fluoromount ® (BDH Lab, Poole, England).
  • DAB diaminobenzidine
  • Migrating cells within the thalamocortical cell bridge were found to be of neuronal origin.
  • Figure 7C shows that MAP-2-ir cells formed a highly ordered structure at the thalamic origin.
  • a row of MAP-2 -ir neurons formed the margin of the cell stream that was different from the single cell chain migration observed in Figure 7.
  • the neurons at the margin projected with their apical dendrite towards the middle of the migrating cell stream accompanied by neurite structures (Figure 7C.
  • the neurons of the regenerated cell bridge possess high levels of MAP-2 protein.
  • MAP-2 was strongly expressed within the leading apical neurite ( Figure 8) of a migrating neocortical neuron.
  • Parvalbumin is a late postnatal marker of neuronal differentiation in the thalamus and can detect inhibitory cells of the thalamic reticular formation as well as excitatory thalamic projection neurons (Sieg et al., 1998).
  • Figures 7E and 7F revealed that proliferative cells within the cell bridge are partially co- localized with parvalbumin. This finding indicates that NRP-1 stimulates early differentiation of parvalbumin-positive neurons in the thalamic cell bridge. Thus, the proliferating cells were of neuronal origin and the NRP stimulated neuronal proliferation and differentiation.
  • Example 4 In Vitro Assay for Evaluating Migration-Inducing Activity II
  • Another assay of this invention includes embodiments comprising cerebellar microexplants.
  • Laminated cerebellar cortices of the two hemispheres were explanted from a P4 Long Evans rat, cut into small pieces in GBSS with 0.65% D(+)glucose solution, and triturated by a 0.4 mm gauge needle and subsequently pressed through a 125 ⁇ m pore size sieve.
  • the obtained microexplants were centrifuged (200 X g) 2 times for a medium exchange into serum-free BSA-supplemented START V-medium (Biochrom). Finally, the microexplants were reconstituted in 500 ⁇ l STARTV- medium.
  • cerebellar microexplants were fixed after 2-3 days in culture after the following regime: microexplants were fixed by 2-minute, serial treatment with 0.4%; 1.2%; 3% paraformaldehyde/ 0.25% glutaraldehyde, respectively, followed by a 5 min incubation in 4% paraformaldehyde/ 0.25% glutaraldehyde in 0.1 M sodium phosphate (pH 7.4).
  • MAP-2 was detected using the biotin-streptavidin/Cy3 detection system as described under the immunohistochemistry section of the thalamocortical OTCs.
  • Microexplants having a diameter between 100-120 ⁇ m were chosen for statistical analysis.
  • an optical device having 10 consecutive rings of 100 ⁇ m diameter was applied over the microexplants. All neurons that had migrated after 48 h of culture were counted. Neurons located between circles 1 to 10 (0.1-1 mm) around the margin of the respective microexplant (see Figure 2) were counted, and each circle was expressed as a percentage of total migrating cells. The unpaired Student's t-test was used for significance analysis. Results were given as mean values +/- standard deviation.
  • Results Induction of Cerebellar Cell Migration Within a Microexplant System A concentration of 3 nM of purified NRP-1 was sufficient to induce a significantly enhanced migration of neurons within the cerebellar microexplant system.
  • the number of migrating cells was in the range of 30 and 140 cells measured up to a distance of 1000 ⁇ m away from the margins of explants having diameters of from 100- 120 ⁇ m.
  • a highly significant (pO.OOl) population of 7.3+2.8% of migrating cerebellar cells were distributed between 400-500 ⁇ m, and 13.2+13.9% of migrating cerebellar cells were distributed between 500-600 ⁇ m away from the microexplant margin after 2 days of culture with NRP-1 (see Figures 13 and 14).
  • the vehicle-treated (0.01 M sodium phosphate) controls revealed neuronal migration to a certain extent (not significantly better than factor-treated samples over 200 ⁇ m migration distance). This relatively minor migration may be because in early postnatal cerebellar tissue, the final migration process to form the cerebellar granule cell layer had not been completed. Therefore the granule cells of P4 animals revealed some intrinsic neuronal migration activity when cultured. Nevertheless, we found that purified NRP-1 caused a substantial increase in both the number of migrating cells as well as the distance travelled.
  • Similar cerebellar granule cell migration has been induced by activation of AT 2 receptor of angiotensin II that is highly expressed in early postnatal cerebellar neurons (Cote et al., 1999). After AT 2 receptor activation using the highly effective agonist CGP42112 the longest migration distances were around 550 ⁇ m measured 96 hours after start of cultivation.
  • the migration-inducing factor confers similar migration distances to the cerebellar microexplants although there exist two major differences to the angiotensin II-induced migration pattern. First, angiotensin does not induce neuronal chain migration like NRP-1 does and secondly the whole process of neuronal migration is considerably slower when induced by angiotensin II.
  • NRP-1 -induces neuronal migration a separate, novel mechanism, and not by way of angiotensin II receptors.
  • the ability of NRP-1 to induce neuronal migration indicates an application for NRPs in restoring neuronal networks damaged by neurodegenerative diseases and injuries.
  • OTCs Thalamocortical OTCs from rats, as described above in Examples 3 and 4 were incubated at the start of cultivation with 2 ⁇ M of BrdU that was removed after 24 hours of cultivation time.
  • OTCs were fixed in 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). Blocking was done in 0.4% Triton and 10% normal goat serum in PBS for 30 minutes. Subsequently the cultures were treated for 30 minutes in 2N HCl at 37°C and neutralized by 0.1 M Na 2 B 4 0 7 for 2x5 minutes. Internal peroxidase activity was prevented by 5 minute treatment of the OTCs in 1% H 2 0 2 (only in case of the PAP reaction). Primary antibody (mouse anti-BrdU 1/50-Sigma) reaction was done overnight in 0.4% Triton, 2% BSA in PBS.
  • Biotinylated goat anti-mouse IgG was applied (1/200 for 2 h) with the subsequent application of the avidin biotin horseradish peroxidase system and the final DAB-detection (0.05%); 0.009% H 2 0 2 enhanced by 0.025% cobalt chloride and 0.02% nickel ammonium sulphate. BrdU-positive nuclei become black stained. After three PBS washes, the rabbit anti-parvalbumin IgG (1/1000) was applied overnight at room temperature in 0.4% Triton; 2% BSA in PBS followed by the goat anti-rabbit (1/100) in the same buffer.
  • the number of parvalbumin expressing neurons in the thalamus was between 500 and 700 cells within control and factor treated tissue. Double-staining experiments using anti-parvalbumin antiserum and anti-BrdU antibody revealed that NRP-treated thalamic areas have 6.8+1.3% (p ⁇ 0.01) of their parvalbumin-ir neurons co-localised with BrdU, whereas controls (medium only) revealed only 2.7+0.7% of parvalbumin-ir neurons in a proliferative state after 5 days in culture (see Figures 10 and 11). The control value of 2.7% proliferating parvalbumin expressing neurons represented the basal level of these neurons after the traumatic event of the initial cultivation.
  • NRP-1 3 nM
  • thalamocortical OTCs enhanced proliferation of parvalbumin expressing neurons within the thalamic tissue up to 150% compared to controls treated with defined medium alone.
  • a more pronounced proliferation rate was observed within the newly formed (migrated) cell bridge where the majority of parvalbumin expressing neurons were of a proliferative state ( Figures 7 E and F and Figure 9).
  • NRP-1 preferably induces neuronal proliferation but does not induce asfroglial division.
  • NRPs are effective agents and can cause neurons to proliferate.
  • the results also indicate applications for NRPs and paralogs or fragments in the treatment of neurological conditions and spinal cord injuries in which neural tissue is damaged or has degenerated, for example Huntington's disease, Parkinson's disease and paraplegia.
  • the results further indicate that NRPs have an application in improving outcomes of neural replacement therapies, such as in transplantation.
  • NRPs were supplied by Auspep (Australia). They were supplied with an amidated C- terminus, and were more than 95% pure as analyzed by MALDI-MS spectrum analysis.
  • the mouse NRP (arachne contig 191157 mouse; SEQ ID NO: 17; SEQ ID NO: 18) was 91% pure.
  • the peptides were stored lyophilized at -80°C under argon until usage. They were reconstituted in PBS, alternatively in lOO ⁇ g/ml human fransferrin PBS or in other embodimens in lOO ⁇ g/ml BSA/PBS and further diluted in PBS having lO ⁇ g/ml of BSA or transferrin before further use within the different assays.
  • Toxicological and drug administration experiments were designed such that 1/100 parts of toxin and neuroprotective drug were administered simultaneously to the freshly prepared cerebellar microexplants derived from P4 or P8 rats.
  • Glutamate was prepared as a 50mM stock solution in MilliQ water while 50mM 3-nifropropionic acid was pH-adjusted (pH 6.8-7.2) in MilliQ water.
  • the concentration of the oxidative stress inducing toxin, 3-nitropropionic acid (3-NP), and the excitotoxin, glutamate, in the assay were 0.5mM each.
  • Lyophilized peptides were reconstituted in PBS or lOO ⁇ g/ml human transferrin as a lO ⁇ M stock solution.
  • Cerebellar microexplants were cultivated for 48-72 hours at 34°C, 5% C0 in air and 100% humidity before they were fixed by increasing amounts of paraformaldehyde (0.4%, 1.2%, 3% and 4% - each treatment 2-3min).
  • cerebellar explants were exposed for 24 hours, at the beginning of culturing to dilutions of NRP and O.l ⁇ M BrdU.
  • 80%) of the medium was changed without addition of new toxins and NRP's.
  • the cerebellar cultures were fixed as described above after 3 days in vitro. The detection of the incorporated BrdU level was performed as described previously. Under these conditions, over 99% of the cerebellar cell population were neurons. Therefore any increase in cell number after NRP administration was most likely due to neuronal cell proliferation.
  • Neuronal Survival and Proliferation Assays For statistical analysis of survival, four fields (each field having an area of 0.65 mm 2 ) of each fixed cerebellar culture with the highest cell densities were chosen, and cells displaying neurite outgrowth were counted. Statistical significance was measured by Student's t-test. For statistical analysis of proliferation four fields (each field having an area of 0.65 mm 2 ) of each fixed cerebellar culture displaying highest density of BrdU-positive nuclei were chosen, and BrdU-positive nuclei were counted. Statistical significance was measured by Student's t-test.
  • the inserts were coated with PDL (O.lmg/ml in PBS - cell culture tested grade from Sigma) for 15 minutes at room temperature.
  • the culture dishes were first coated with NRP-1 compounds.
  • NRP-1 compounds For this purpose a 19mer form (NRP-11;
  • DPEARRAPGSLHPCLAAS SEQ ID NO: 23) of the annotated human NRP encoded by a nucleotide sequence located on chromosome 13 (SEQ ID NO:4) and a 24mer form of NRPmfs (NRP-12; SEPEARRAPGRKGGVVCASLAADW: SEQ ID NO:24:) ofthe annotated mouse arachne contig_191157 gene NRP ortholog (SEQ ID NO: 16) were chosen.
  • the lyophilised peptides were reconstituted in lOO ⁇ g/ml human transferrin or bovine serum albumin (BSA) in PBS and further NRP dilutions were made in the presence of lO ⁇ g/ml of the respective proteins.
  • Peptide concentrations between 0.01- 1 ⁇ g/ml were used as well as blank transferrin and BSA controls.
  • the final amount of the NRPs were between 15 and 1500ng/l 10mm 2 .
  • the peptide coating was carried out for 2hrs at 37°C. After a PBS wash the culture dishes were subsequently coated with PDL (O.lmg/ml) for 2hrs at 37°C followed by a PBS wash.
  • For seeding striatal cells 1.5ml of Neurobasal/B27 medium was put into the culture dishes and 0.5ml of Neurobasal/B27 medium was put into the insert.
  • the assay was ready for cell seeding.
  • 50% of Neurobasal/B27 medium and 50% of asfrocyte conditioned medium were added to culture dishes and inserts before the seeding ofthe cells.
  • striatal tissue For the preparation of striatal tissue from rat E18/E19 embryos, the dam was sacrificed by C0 2 -treatment in a chamber for up to 4 minutes, and was then prepared for caesarean section. After surgery the embryos were removed from their amniotic sacs, decapitated and the heads were put on ice in DMEM/F12 medium for striatum and PBS plus 0.65% D(+)-glucose for cortex preparation. The whole brain was removed from the skull with the ventral side facing upwards in DMEM/F12 (Invitrogen) medium. The striatum was extracted under a stereoscopic microscope, by dissecting out the striatum from both hemispheres, which was then placed into the Falcon tube on ice.
  • DMEM/F12 Invitrogen
  • the striatal dissection for both hemispheres was performed as follows; the embryonic brain was placed ventral side down, rostral end forward. Along the midline one hemisphere was gently pulled open using fine forceps. A frontal rostral cut was performed to expose the inner region (the striatum) that was located rostral-centre within the cortical cavity. The striatum was pinched out using the forceps and taking care not to avoid the underlying cortex. Tissue pieces were placed into aFalcon tube on ice. The collected striatal tissue was triturated using a PI 000 pipettor in 1ml of medium.
  • the cells were triturate by gently pipetting the solution up and down into the pipette tip about 15 times, using shearing force on alternate outflows.
  • the tissue pieces settled to the bottom of the Falcon tube within 30 seconds, and subsequently the supernatant was transferred to a new sterile Falcon tube on ice.
  • the supernatant contained a suspension of dispersed, dissociated cells.
  • the tissue pieces were exposed to a second round of trituration by adding 1 ml of ice-cold DMEM/F12 medium to the tissue pieces in the first tube and triturating as before. In so doing, we did not excessively damage cells already dissociated.
  • the tissues pieces were allowed settle and the supernatant removed to a new sterile Falcon tube on ice.
  • the cells were centrifuged at 250g for 5 minutes at 4°C. The resuspended cell pellet was used for cell counting.
  • cortical hemisphere was used from PI rats and collected into 4ml of DMEM. Trituration was done with a 5ml glass pipette and subsequently through an 18- gauge needle. Afterwards, the cells were passed through a lOO ⁇ m cell strainer and then washed in 50ml DMEM, followed by centrifugation for 5 min at 250g. The sediment was resuspended into 20ml DMEM+10% fetal calf serum. 10 ml each were added into two 25cm 2 flasks. They were cultivated at 37°C and 10% C0 2 with a medium change twice weekly. After cells reached confluence they were washed three times with PBS and adjusted to Neurobasal/B27 and incubated for another 3 days. The supernatant was frozen at -80° C for transient storage until use.
  • cortical tissue was extracted from E18/19 rat embryos.
  • the two cortical hemispheres were carefully removed by a spatula from the whole brain with the ventral side facing upwards into a PBS +0.65% D(+)-glucose containing petri dish.
  • Forceps were put into the rostral part (near B. olfactorius) of the cortex for fixing the tissue and two lateral - sagittal oriented cuttings were done to remove the paraform and entorhinal cortices.
  • the next cut involved a frontal oriented cut at the posterior end to remove the hippocampal formation.
  • a final frontal cut was done a few millimeters away from the last cut in order to get hold of area 17/18 ofthe visual cortex.
  • the collected cortices were placed on ice in PBS+0.65% D(+)-glucose and centrifuged at 350g for 5min. The supernatant was removed and trypsin/EDTA (0.05%/0.53mM) was added for 8min at 37°C. The reaction was stopped by adding an equal amount of DMEM+10% fetal calf serum. The supernatant was removed by centrifugation followed by two subsequent washes in Neurobasal/B27 medium. Cells were triturated once with a glass Pasteur pipette in 1 ml of Neurobasal/B27 medium and subsequently twice more using a 1ml syringe having a 22-gauge needle. The cell suspension was passed through a lOO ⁇ m cell strainer and subsequently rinsed in 1ml of Neurobasal/B27 medium. Cells were counted and were ready for plating for the haptotactic migration assay.
  • NRP-2 KG is located between amino acids 20-43 of the annotated NRP amino acid sequence (SEQ ID NO:5), and produces the peptide: KDPEARRAPGSLHPCLAASCSAAG (NRP-2KG; SEQ ID NO:25), and the 19mer form (NRP-2KS: SEQ DD NO:26) is located between amino acid positions 20-38 in SEQ ID NO:5.
  • Rat NRP-1 and NRP-2KS were tested for neuronal proliferation inducing activity (see Figure 19).
  • NRP-2KS was administered 24hrs after the start of cultivation.
  • Rat NRP-1 has specific effects on neuronal proliferation, (see Figures 7, 9 and 10).
  • Neuronal proliferation induced by NRP-2KS occurred within a range of about 0.3-30nM using un-injured cerebellar microexplants (verified by counting cells displaying neurite outgrowth). The highest activity was observed at a concentration of 300pM, which produced increased neuronal cell proliferation, or 117.5% greater than vehicle-treated controls.
  • Rat NRP-1 had its greatest effect at 3nM with 81.2% up regulation of neuronal cell proliferation (see Figure 17).
  • a haptotactic migration assay (Lu et al., 2001) was applied.
  • the human NRP-2KG was coated on Transwell ® culture dishes in the presence of BSA or transferrin followed by PDL-coating. Seeded embryonic striatal cells migrated from the culture dish insert over a distance of 1mm to the bottom of the culture dish.
  • NRP-2KG was reconstituted in BSA, the migration inducing activity was non-significant, whereas NRP-2KG reconstituted in human transferrin and subsequent immobilization of 150ng NRP-2KG caused 466.0% more neurons to migrate to the culture dish bottom after 2 days in vitro compared to transferrin control alone (see Figure 18).
  • NRP-13 l lmer peptide
  • SDSWKSQARGQ SEQ ID NO:26
  • NRP-14 Biological activities of the human NRP located on chromosome 15 (SEQ ID NO: 8) were tested using an 1 lmer form of the peptide (NRP-14: GTPGRAEAGGQ: SEQ ID NO:26), located between amino acids 22-32 of the annotated NRP protein encoding sequence.
  • NRP-14 conferred maximal biological activity between 10-lOOnM as measured in the cerebellar microexplant neurotoxicity assay. After 48hrs, lOOnM NRP-14 produced recovery from oxidative/excitotoxic injury by an average of 46.3% (see Figure 19).
  • NRP-14 was also tested for neuronal proliferation inducing activity. Neuronal proliferation inducing activity of NRP-14 was observed at a concentration of lOnM, and produced an up regulation of 132.2% in the proliferation rate compared to injured cerebellar microexplants (see Figure 20). There was no difference between injured and non-injured (vehicle treatment) microexplants concerning the proliferation rate, which indicated that the 24hr injury protocol did not produce reactive astrocytes.
  • Neuronal proliferation inducing activity for the mouse 24mer NRP could be seen at O.lpM and lOOpM of mouse NRP with an up regulation of averages of 252.6% and 123.7%, respectively, of the proliferation rate observed for injured cerebellar microexplants (see Figure 24). There was no difference between injured and non- injured (vehicle treatment) microexplants concerning the proliferation rate.
  • a 24mer NRP was tested for chemoattractive activity using a haptotactic migration assay.
  • the mouse 24mer NRP was coated on Transwell ® culture dishes in the presence of BSA followed by PDL-coating. Subsequently mouse NRP was given at lpg/ml directly into the medium. Seeded embryonic cortical cells migrated from the culture dish insert over a distance of 1mm to the bottom of the culture dish. If mouse NRP was reconstituted in BSA followed by subsequent immobilization of 15ng of the 24mer mouse NRP, 49.8% more neurons migrated to the culture dish bottom after 1 day in vitro compared to BSA control alone (see Figure 25).
  • NRP-1 derived from hippocampal OTC supernatant with a molecular mass of 2046 induces neuronal proliferation and neuronal migration in the differentiated cultivated postnatal thalamus. Furthermore, NRP-1 induced neocortical neuronal migration by passing the barrier of the cortical basal lamina. The activity of NRP-1 is not tissue specific since cerebellar cells demonstrate strongly enhanced migratory behaviour in response to NRP-1 administration. The results indicate an application for NRP-1 in inducing the proliferation and migration of neurons particularly in neurodegenerative diseases in which discrete areas degenerate and so a replenishment of new neurons is desired, eg.
  • dopaminergic neuronal loss in the substantia nigra in Parkinson's disease the cholinergic neuronal loss in the basal forebrain in Alzheimer's disease and GABAergic neuronal loss in the caudate nucleus and striatum in Huntington's disease.
  • the disclosed rat, human and mouse NRPs possess similar activities. These peptides confer neuronal proliferation and migration-inducing activities as well as neurite outgrowth and neuronal survival-promoting activities to neurons.
  • NRP compounds can be useful in situations in which neural repair is desirable. Such situations include diseases and injuries where neurons are damaged or have degenerated. Certain neurological diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease and others can be treated using the peptides of embodiments of this invention. Moreover, any type of neural damage, such as spinal cord or other central nervous system injuries can be freated using NRPs of this mvention. Such injuries can be caused by trauma (blunt force or penetrating), hypoxia, such as caused by stroke, infarction, hypotension, or high altitude exposure.
  • the new assay systems described herein are an effective method for detecting and measuring activities of NRPs from any source, including human and murine sources. Because human and rodent NRPs share common peptide domains, embodiments of these assays is predictive of effects of NRPs in humans as well as other species that share at least one of characterisitc peptide domains identified herein.
  • Rat NRP-1 was purified from hippocampal OTCs. Sagittally cut slices 350 ⁇ m thick from the hippocampal formation of P0 Long Evans rats were prepared in oxygenated, protein-free minimal essential medium "MEM" followed by a 30 min recovery period at 4°C. Subsequently, the slices were put on 0.4 ⁇ m interface membranes and were cultured in protein-free MEM under an atmosphere of 1% C0 2 in air as an air-liquid interface culture according to methods described by Stoppini (Stoppini et al., 1991) for 7 to 14 days. Every three days, the cell culture supernatant was harvested and stored at -20°C until usage.
  • MEM minimal essential medium
  • Rat NRP-1 was purified from samples of 100 ml protein-free (BME-medium + HBSS) medium obtained after culture of cultivated hippocampal OTCs for from about 5 to 14 days (DIV). Supernatant from the samples was dialysed against 200 volumes of binding buffer (0.05 M potassium phosphate - pH 7). (See flowchart Figure 26).
  • Chromatography was carried out at a flow rate of about 1 ml/min of the dialysed supernatant on a 5ml column of HiTrap Blue Sepharose (Amersham/Pharmacia). Elution was done by a stepwise gradient using KC1, until a final concentration of 1.5 M KC1 in binding buffer was used.
  • the resulting eluate was dialysed against 0.01 M sodium phosphate (pH 7) and subsequently was precipitated by 80% (v/v) acetone at — 20 °C for 3 hours. Centrifuged precipitate was reconstituted in 200 ⁇ l of 0.2 M NaCl, 0.05% (v/v) Tween 80, 0.02 M sodium phosphate (pH 7).
  • NRP-1 elutes between 0.5-0.6 M NaCl with an absorption maximum of 0.04 measured at 254nm (see Figure 27).
  • NRP-1 was homogenously purified after cation exchange chromatography ( Figure 15) as revealed by MALDI-TOF MS analysis (see Figure 28).
  • the mass spectrum revealed a main peak/abundance at a mass of 2046.
  • the first 16 N-terminal amino acids have been sequenced, and resulted in unambiguous identification of those amino acids, indicating that the NRP-1 was substantially free of protein or peptide contaminants.
  • Purified protein was stored lyophilised at -80°C.
  • NRP-1 can be isolated and purified sufficiently to permit therapeutic use. Because NRP-1 can be purified, it can be administered to treat a neurological condition or nervous system injury in which neural repair is needed.
  • UNC-6 a laminin-related protein, guides cell and pioneer axon migrations in C. elegans. Neuron 9: 873-881.
  • Ephrin- ⁇ reverse signalling is mediated by a novel PDZ-RGS protein and selectively inhibits G-protein coupled in chemoattraction.
  • Semaphorin3A is a chemoattractant for cortical dendrites. Nature 404: 567-573.
  • Embodiments of the genes of this invention are useful for use as compositions for therapy or for manufacture of medicaments for the treatment of neurological conditions in which increased neuron survival, neuronal migration, neural outgrowth and/or neural proliferation are desired.
  • neurological conditions include a variety of neurodegenerative diseases including Parkinson's Disease and Alzheimer's Disease.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Psychology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2002/026782 2001-08-24 2002-08-22 Neural regeneration peptide and methods for their use in treatment of brain damage Ceased WO2003018754A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP02770419A EP1572887A4 (en) 2001-08-24 2002-08-22 NERVE REGENERATING PEPTIDE AND METHOD FOR THEIR USE IN THE TREATMENT OF A BRAIN DAMAGE
JP2003523605A JP4399260B2 (ja) 2001-08-24 2002-08-22 神経再生ペプチドおよび脳損傷治療におけるその使用方法
AU2002335657A AU2002335657A1 (en) 2001-08-24 2002-08-22 Neural regeneration peptide and methods for their use in treatment of brain damage

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US31495201P 2001-08-24 2001-08-24
US60/314,952 2001-08-24

Publications (2)

Publication Number Publication Date
WO2003018754A2 true WO2003018754A2 (en) 2003-03-06
WO2003018754A3 WO2003018754A3 (en) 2007-11-15

Family

ID=23222205

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/026782 Ceased WO2003018754A2 (en) 2001-08-24 2002-08-22 Neural regeneration peptide and methods for their use in treatment of brain damage

Country Status (5)

Country Link
US (2) US7767786B2 (https=)
EP (2) EP1572887A4 (https=)
JP (1) JP4399260B2 (https=)
AU (1) AU2002335657A1 (https=)
WO (1) WO2003018754A2 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006004201A1 (ja) * 2004-07-01 2006-01-12 Eisai R & D Management Co., Ltd. 神経再生促進剤
EP1655307A4 (en) * 2003-07-09 2006-07-26 Shionogi & Co ATOPIC DERMATITIS INDUCTOR
JP2007511210A (ja) * 2003-10-31 2007-05-10 ニューレン ファーマシューティカルズ リミテッド 神経再生ペプチド及び脳損傷治療におけるそれらの使用方法
EP1888635A4 (en) * 2005-05-06 2010-01-13 Neuren Pharmaceuticals Ltd NERVE-GENERATING PEPTIDES AND METHOD FOR THEIR USE
EP2212349A4 (en) * 2007-10-17 2010-09-29 Neuren Pharmaceuticals Ltd SYNTHETIC ANALOGUE OF NEURAL REGENERATIVE PEPTIDES
WO2015054006A2 (en) 2013-10-11 2015-04-16 Tarix Pharmaceuticals Ltd. Novel peptide compositions

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE435852T1 (de) 2001-05-24 2009-07-15 Neuren Pharmaceuticals Ltd Gpe-analoga und peptidomimetika
US20070004641A1 (en) * 2001-05-24 2007-01-04 Neuren Pharmaceuticals Limited Cognitive enhancement and cognitive therapy using glycyl-L-2-methylprolyl-L-glutamate
US7605177B2 (en) * 2001-05-24 2009-10-20 Neuren Pharmaceuticals Limited Effects of glycyl-2 methyl prolyl glutamate on neurodegeneration
US7714020B2 (en) 2001-05-24 2010-05-11 Neuren Pharmaceuticals Limited Treatment of non-convulsive seizures in brain injury using G-2-methyl-prolyl glutamate
US9259432B1 (en) 2011-01-31 2016-02-16 Parminder J. S. Vig Composition and methods for targeted delivery of a therapeutic compound to the brain or spinal cord of a subject for treatment of neurodegenerative diseases
US20140018299A1 (en) * 2012-07-10 2014-01-16 Banyan Biomarkers, Inc. Method and device to detect, monitor and promote neural regeneration and improvement of cognitive function in a subject suffering from neural injury
CN119080877B (zh) * 2024-10-11 2025-09-23 完美(广东)日用品有限公司 一种低聚肽及其在制备减脂制品中的应用

Family Cites Families (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3773919A (en) 1969-10-23 1973-11-20 Du Pont Polylactide-drug mixtures
US4263428A (en) 1978-03-24 1981-04-21 The Regents Of The University Of California Bis-anthracycline nucleic acid function inhibitors and improved method for administering the same
EP0052322B1 (de) 1980-11-10 1985-03-27 Gersonde, Klaus, Prof. Dr. Verfahren zur Herstellung von Lipid-Vesikeln durch Ultraschallbehandlung, Anwendung des Verfahrens und Vorrichtung zur Durchführung des Verfahrens
IE52535B1 (en) 1981-02-16 1987-12-09 Ici Plc Continuous release pharmaceutical compositions
US4485045A (en) 1981-07-06 1984-11-27 Research Corporation Synthetic phosphatidyl cholines useful in forming liposomes
JPS58118008A (ja) 1982-01-06 1983-07-13 Nec Corp デ−タ処理装置
DE3374837D1 (en) 1982-02-17 1988-01-21 Ciba Geigy Ag Lipids in the aqueous phase
DE3218121A1 (de) 1982-05-14 1983-11-17 Leskovar, Peter, Dr.-Ing., 8000 München Arzneimittel zur tumorbehandlung
EP0102324A3 (de) 1982-07-29 1984-11-07 Ciba-Geigy Ag Lipide und Tenside in wässriger Phase
US4544545A (en) 1983-06-20 1985-10-01 Trustees University Of Massachusetts Liposomes containing modified cholesterol for organ targeting
HUT35524A (en) 1983-08-02 1985-07-29 Hoechst Ag Process for preparing pharmaceutical compositions containing regulatory /regulative/ peptides providing for the retarded release of the active substance
DE3483949D1 (de) 1983-09-26 1991-02-21 Udo Dr Med Ehrenfeld Mittel und erzeugnis fuer die diagnose und therapie von tumoren sowie zur behandlung von schwaechen der zelligen und humoralen immunabwehr.
EP0143949B1 (en) 1983-11-01 1988-10-12 TERUMO KABUSHIKI KAISHA trading as TERUMO CORPORATION Pharmaceutical composition containing urokinase
US5283187A (en) 1987-11-17 1994-02-01 Brown University Research Foundation Cell culture-containing tubular capsule produced by co-extrusion
US4892538A (en) 1987-11-17 1990-01-09 Brown University Research Foundation In vivo delivery of neurotransmitters by implanted, encapsulated cells
EP0646178A1 (en) 1992-06-04 1995-04-05 The Regents Of The University Of California expression cassette with regularoty regions functional in the mammmlian host
WO1995006662A1 (en) * 1993-09-01 1995-03-09 Start Technology Partnership Neuron regulatory factor for promoting neuron survival
AU2601895A (en) 1994-05-24 1995-12-18 Amgen Boulder Inc. Modified insulin-like growth factors
US5834192A (en) 1996-04-05 1998-11-10 Incyte Pharmaceuticals, Inc. Human cachexia associated protein
WO1998011136A1 (en) 1996-09-09 1998-03-19 Novo Nordisk A/S A cDNA AND PEPTIDE WITH RELATION TO CANCER AND WEIGHT LOSS
CN1309720A (zh) * 1997-11-25 2001-08-22 综合医院公司 毒性相关核酸序列及其应用
WO1999051736A1 (en) * 1998-04-03 1999-10-14 Mcp Hahnemann University Neuron regulatory factor comprising a small peptide for promoting neuron survival
US7563862B2 (en) * 2001-08-24 2009-07-21 Neuren Pharmaceuticals Limited Neural regeneration peptides and methods for their use in treatment of brain damage

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1655307A4 (en) * 2003-07-09 2006-07-26 Shionogi & Co ATOPIC DERMATITIS INDUCTOR
US8129507B2 (en) 2003-07-09 2012-03-06 Shionogi & Co., Ltd. Atopic dermatitis inducer
JP2007511210A (ja) * 2003-10-31 2007-05-10 ニューレン ファーマシューティカルズ リミテッド 神経再生ペプチド及び脳損傷治療におけるそれらの使用方法
EP1685151A4 (en) * 2003-10-31 2009-04-22 Neuren Pharmaceuticals Ltd PEPTIDES FOR THE REGENERATION OF NERVES AND METHOD FOR THEIR APPLICATION IN THE TREATMENT OF BRAIN DAMAGES
WO2006004201A1 (ja) * 2004-07-01 2006-01-12 Eisai R & D Management Co., Ltd. 神経再生促進剤
EP1888635A4 (en) * 2005-05-06 2010-01-13 Neuren Pharmaceuticals Ltd NERVE-GENERATING PEPTIDES AND METHOD FOR THEIR USE
EP2212349A4 (en) * 2007-10-17 2010-09-29 Neuren Pharmaceuticals Ltd SYNTHETIC ANALOGUE OF NEURAL REGENERATIVE PEPTIDES
US9650418B2 (en) 2007-10-17 2017-05-16 Curonz Holdings Company Limited Synthetic analogues of neural regeneration peptides
WO2015054006A2 (en) 2013-10-11 2015-04-16 Tarix Pharmaceuticals Ltd. Novel peptide compositions
EP3054967A4 (en) * 2013-10-11 2017-04-19 Tarix Pharmaceuticals Ltd. Novel peptide compositions

Also Published As

Publication number Publication date
EP1572887A2 (en) 2005-09-14
AU2002335657A1 (en) 2003-03-10
US7767786B2 (en) 2010-08-03
JP4399260B2 (ja) 2010-01-13
JP2005511015A (ja) 2005-04-28
US20030211990A1 (en) 2003-11-13
US20110306557A1 (en) 2011-12-15
EP2382982A3 (en) 2012-02-22
WO2003018754A3 (en) 2007-11-15
EP2382982A2 (en) 2011-11-02
EP1572887A4 (en) 2008-12-24
AU2002335657A8 (en) 2008-01-10

Similar Documents

Publication Publication Date Title
US7563862B2 (en) Neural regeneration peptides and methods for their use in treatment of brain damage
US20110306557A1 (en) Neural regeneration peptides and methods for their use in treatment of brain damage
ES2353490T3 (es) Factores de estimulación de la supervivencia neuronal dopaminérgica y sus utilizaciones.
JP5026083B2 (ja) 神経再生ペプチド及び脳損傷治療におけるそれらの使用方法
AU758011B2 (en) Persephin and related growth factors
JP2000507813A (ja) ペルセフィン及び関連成長因子
WO2004052922A2 (en) Peptides, antibodies thereto, and their use in the treatment of central nervous system damage
US20050069537A1 (en) Survical promoting ncam binding and ncam ligand binding compounds
JP4988711B2 (ja) 神経再生ペプチド及びそれを含む処方物
US7749758B2 (en) Human and mammalian stem cell-derived neuron survival factors
EP1476179A2 (en) Methods of preventing or treating brain ischemia or brain injury
JP5019206B2 (ja) 神経突起伸長制御タンパク質
US20070116702A1 (en) Survival promoting NCAM binding and MCAM ligand binding compounds
US20030113869A1 (en) Human FGF gene and gene expression products
CA2372559A1 (en) Neurite outgrowth and guidance by tenascin-c
WO1997040155A1 (en) Protein mediating neuronal-glial interaction, dna encoding the same, and methods of use thereof
HK1092477B (en) Neurotrophic growth factor
HK1092477A1 (en) Neurotrophic growth factor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG UZ VN YU ZA ZM ZW

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BY BZ CA CH CN CO CR CU CZ DE DM DZ EC EE ES FI GB GD GE GH HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MN MW MX MZ NO NZ OM PH PL PT RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG UZ VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2003523605

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2002770419

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2002770419

Country of ref document: EP