Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
  • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
  • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/70—Vectors or expression systems specially adapted for E. coli
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

• the invention relates to vectors, which at least partly remains resistant to methylation upon transfer into a receiver host cell.
• the receiver host cell is different from the donor host cell.
• the invention also relates to methods for the production of such vectors and the use of the vectors in industry as well as in medicine.
• Methylation of DNA in eukaryotic organisms is one important mechanism of gene regulation. Methylation of DNA is a mechanism to control the expression of genes located within the genome of eukaryotic cells as well a to downregulate the expression of foreign nucleotide sequences which enters into the eukaryotic cell. The phenomenon has been investigated in both animal cells as well as in plants, and the methylation is identified to occur on the 5-position in the pyrimidine ring of cytosine located in a stretch of CpG.
• Silencing of a gene or a cluster of genes may be the result of methylation of CpG motifs located in the nucleotide sequence of the gene or cluster of genes as well as methylation of regulatory sequences such as promoters and responsive elements for transcription factors.
• the degree of methylation influences the degree of silencing and in general a low degree of methylation result in a minor decrease in expression and a higher degree of methylation result in complete silencing of the expression of a gene.
• Methylation effects the expression of polypeptides located within expression vectors. When a stretch of foreign DNA enters the nucleus of a cell, it is likely that the stretch of foreign DNA become methylated. The degree of methylation of stretch of foreign DNA will affect the level of expression from that particular DNA.
• the introduced DNA can also be integrated into the chromosomal DNA of a dividing cell by recombination. If that particular DNA becomes methylated prior to integration into the chromosomal DNA and cell division it will probably become methylated during subsequent cell divisions. If a high level of expression is desired then methylation of the DNA in expression vectors is a problem.
• DNA vaccine is most often in the form of a plasmid DNA expression vector produced in bacteria and then purified and delivered to muscle or skin.
• DNA vaccines have been demonstrated to show efficacy against numerous viral, bacterial and parasitic disorders in animal models.
• the level of methylation of such DNA will affect the level of expression of antigenic proteins essential for the induction of immune response against the antigen.
• the same problem also applies to the use of DNA vectors in gene therapy.
• optimised vectors which do not undergo methylation upon transfer into an eukaryotic cell for use in both industry as well as in medicine.
• the industry will have lesser problems in obtaining constant and higher expression of genes of interest in eukaryotic cells.
• the medicine will be provided with improved vectors that do not undergo methylation upon transfer into a receiver host cell and the expression of the nucleotide sequences located within the vectors are maintained, which is useful both in vaccination and in gene therapy as well as all in other treatments in which expression vectors are used.
• the invention relates to vectors which has been modified in such a way that methylation of the vector is substantially reduced upon transfer of the vector into a receiver host cell. Thereby, the expression of the nucleotide sequence of the vector within a receiver host cell is maintained at an acceptable level. A level which maintain the expected functions of the nucleotide sequences and/or the polypeptides encoded by the nucleotide sequences.
• the invention also relates to methods for the production of said vectors and the use of the vectors in industry as well as in pharmaceuticals, e.g., therapy and/or diagnostics.
• the invention relates to a vector comprising a nucleotide sequence wherein one or two cytosines in at least one CpG motif has been replaced with a cytosine analogue resistant to methylation.
• the invention relates to a donor host cell comprising a vector with a nucleotide sequence wherein one or two cytosines in at least one CpG motif has been replaced with a cytosine analogue resistant to methylation.
• the invention relates to nucleotide sequence being part of a vector obtained from a donor host cell and/or a polypeptide produced by a donor host cell.
• the invention relates to a pharmaceutical composition
• a pharmaceutical composition comprising a vector and/or a donor host cell and/or a nucleotide sequence and/or a polypeptide and a pharmaceutically acceptable diluent, carrier, adjuvant or excipient.
• the invention relates to a method of reducing methylation of CpG motifs in a vector in a receiver host, which method comprises replacing at least one cytosine in a CpG motif with a cytosine analogues.
• the invention relates to a kit comprising a vector and/or a donor host cell.
• the invention relates to a method of transferring a vector, a nucleotide sequence, a polypeptide or a pharmaceutical composition into a receiver host cell, the method being selected from the list consisting of electroporation, microprojectile bombardment and liposome mediated delivery.
• the invention relates to a vector, a donor host cell, a nucleotide sequence, a polypeptide or a pharmaceutical composition for use in therapy and/or in diagnostics.
• the invention relates to the use of a vector, a donor host cell, a nucleotide sequence, a polypeptide or a pharmaceutical composition for the manufacture of a medicament for use in therapy and/or in diagnostics.
• the invention provides completely novel vectors in which cytosine in CpG motifs has been replaced with a cytosine analogue.
• the cytosine analogue being resistant against methylation.
• Said cytosine analogue replaces at least the 5-position of the pyrimidine ring of cytosine in the CpG motif.
• Such a replacement results in an improved vector, which upon transfer into a receiver host cell, such as an eukaryotic cell maintain the activity/expression of the nucleotide sequence of the vector.
• the invention further provides methods for the production of such vectors and the use of such vectors in, e.g., industry as well as in medicine.
• Fig 1 shows the structure of 5-azadeoxycytidine.
• Fig 2 shows an example of a general structure of a cytidine derivative.
• nucleotide sequence is intended to mean a sequence of two or more nucleotides.
• the nucleotides may be of genomic DNA, cDNA, RNA, semisynthetic or synthetic origin or a mixture thereof.
• the term includes circular, linear, single and double stranded forms of DNA or RNA.
• vector is intended to mean a nucleotide sequence, usually being a circular duplex of DNA having the ability to multiplicate independently of chromosomal DNA into numbers of copies in a host, i.e., having a start of replication.
• the vector may also be a vector, which integrate into the genome of the receiver host cell.
• the vector is stably maintained and/or produced in the host during the multiplication, such as by the use of a selectable marker in the vector.
• the vector may be a bacteriophage, plasmid, phagemid, viral vector, plant transformation vector, insect vector or yeast artificial chromosome. Additionally, the vector may be a nucleotide sequence useful as antisense or to form aptameres.
• start of replication is intended to mean a nucleotide sequence at, which DNA synthesis for replication of the vector begins. Start of replication may occur at one or more points within the vector dependent on the vector being used, such as at one point in a plasmid vector or at several points in an adenovector.
• the start of replication is generally termed origin of replication (abbreviated ori site) in a plasmid vector.
• selectable marker is intended to mean, e.g., a gene encoding a polypeptide which confers resistance to a drug, e.g., ampicillin, kanamycin, tetracyclin, chloramphenicol, neomycin, hygromycin or methotrexate.
• control sequence or "control sequences” is intended to mean nucleotide sequences involved in control of a response of action. This includes nucleotide sequences and/or proteins involved in regulating, controlling or affecting the expression of structural genes, or the replication, selection or maintenance of a plasmid or a viral vector. Examples include attenuators, silencers, enhancers, operators, terminators and promoters.
• CpG motif is intended to mean a double stranded nucleotide sequence having a cytosine followed by a guanine linked by a phosphate bond, i.e., the CpG motif has two cytosines, one located in each strand of the double stranded nucleotide sequence.
• methylation or "methylated CpG motif is intended to mean that cytosine is methylated on the pyrimidine ring, usually occuring at the 5-position of the pyrimidine ring.
• One or more methylated CpG motifs in a nucleotide sequence might result in complete silencing of the expression of the nucleotide sequence. If the methylated CpG motifs are located within a nucleotide sequence encoding a polypeptide or within other nucleotide sequences involved in the expression of a specific nucleotide sequence, e.g., a control sequence as defined above substantial or complete reduction of the expression of said nucleotide sequence is obtained.
• resistant against methylation is intended to mean absence of methylation of one or both of the 5-position on the pyrimidine rings located within the CpG motif.
• One or more CpG-motifs may be unmethylated within a vector resistant against methylation. The resistance against methylation is achieved by replacement of an existing cytosine with a cytosine analogue.
• receiver host cell is intended to mean a cell, which is different compared to the donor host cell.
• a vector becomes methylated at the CpG motifs since the receiver host cell initiate methylation of CpG motifs at nucleotide sequences which are different as compared to the nucleotide sequence of the receiver host cell. This may occur when the receiver host cell, receive a vector which has been produced/multiplied in a donor host cell. The methylation of the vector result in a reduced or complete silencing of the vector.
• cytosine analogue replaces an existing cytosine in a CpG motif as defined above being replaced by a cytosine analogue.
• the cytosine analogue replaces at least the 5-position of the pyrimidine ring of cytosine.
• the cytosine analogue being resistant against methylation.
• the cytosine analogue may replace cytosine partly or completely. Cytosine is replaced with a cytosine analogue during replication of the vector.
• cytidine derivative is intended to mean a cytidine derivative able to replace cytosine in a CpG motif without influencing the activity of the nucleotide sequence harbouring the replaced cytidine derivative, e.g., the activity of the nucleotide sequence is the same as prior replacement of cytosine with a cytidine derivative.
• a nucleotide sequence encoding a polypeptide will after replacement of one or more cytosines with cytidine derivatives still be active and express the polypeptide.
• the cytidine derivative is a derivative, which is unable to undergo methylation at the 5-position of the pyrimidine ring present in the cytidine derivative. Examples of cytidine derivatives are found in Fig 1 and 2.
• the term "maintain expression” is intended to mean expression of the nucleotide sequence encoding a polypeptide and harbouring one or more cytosine analogues, i.e, maintain the expression to at least an acceptable level.
• the level being higher than the unmethylated form of the nucleotide sequence.
• the maintained expression may be within a range, which is higher than the expression of the methylated form of the same nucleotide sequence or the expression may be as high as the expression of the unmethylated form of the same nucleotide sequence.
• donor host cell is intended to mean a cell used for the production/multiplication of the vector. During growth or multiplication of the donor host cell, the copy number of the vector increase and at the same time cytosine in CpG motifs is replaced with a cytidine analogue, when the cytosine analogue is added in a sufficient amount to the growth medium used for growth of the donor host cell.
• the donor host cell is different as compared to the receiver host cell, such as the donor cell being a bacterial cell or a viral particle and the receiver host cell being an animal or a plant cell.
• the vector according to the invention is a vector comprising a nucleotide sequence in which one or two cytosines in at least one CpG motif has been replaced with a cytosine analogue, the cytosine analogue being resistant against methylation.
• cytosine is replaced with a cytosine analogue which replaces the 5-position in the pyrimidine ring of cytosine located in the CpG motif.
• the cytosine analogue may be N, O or C-X.
• X in C-X may be a low or non-electrophilic group, such as ethyl or methoxy.
• cytosine may be replaced by a cytidine derivative, such as 5-azacytidine and/or 5- azadeoxy cytidine.
• 5 -azadeoxy cytidine may also be named s-Triazin-2(lH)-one, 4- amino-l-(2-deoxy-.beta.-D-erythro-pentofuranosyl- (8CI), 1,3, 5-Triazin-2(lH)-one, 4-amino- 1 -(2-deoxy-.beta.-D-erythro-pentofuranosyl)- (9CI), 5-Aza-2'- deoxycytidine or Decitabine (USAN).
• the number and the distribution of the cytosin analogues within CpG motifs of the vector inhibits methylation of the 5-position of the pyrimidine ring resulting in maintenance of the expression of the nucleotide sequence encoding polypeptides located within the vector.
• An increased number of integrated cytosine analogous within a nucleotide sequence region encoding a polypeptide of the vector result in an increased possibility of maintaining the expression of the nucleotide sequences present in that region of nucleotide sequences.
• Increased number of integrated cytosine analogous within other regions of the vector may indirectly influence the maintenance of a nucleotide sequence region encoding a polypeptide.
• Examples of nucleotide sequence regions, which indirectly influence other nucleotide sequence regions are control sequences such as promoters.
• a CpG motif includes two cytosines having the ability of being replaced by a cytosine analogue. Either one or both of them may be replaced. In the case several cytosine analogues are integrated into the vector. The cytosine analogues may either be integrated in one and the same strand or both strands. The cytosine analogues are integrated into the vector during replication of that vector.
• the number of cytosine analogues and the their distribution result in resistance against methylation of said cytosine analogues.
• the presence of said cytosine analogues maintain the expression of nucleotide sequences including cytosine analogues to an acceptable level.
• cytosine analogues such as 5% (e.g. 5-10%), 10% (e.g. 10-20%), 20% (e.g.20- 30%), 30% (e.g. 30-40%), 40% (e.g. 40-50%), 50% (e.g. 50-60%).
• cytosine analogues such as from 1 to about 100% of the cytosines are replaced by cytosine analogues, such as from 1 to about 95% or from about 5 to about 95%.
• the cytosine analogues being integrated either in one or in both strands of the nucleotide sequence of the vector.
• the vector may comprise at least one gene or part of one gene.
• a potential gene candidate may be one which give rise to an immune response against influenza and useful for the purpose of vaccination of human beings.
• the vector may comprise one or more control sequences. Control sequences, which enable the possibility to maintain and multiplicate the vector within a suitable donor host and/or control sequences which enable the possibility to maintain and/or multiplicate the vector within the receiver host cell. Additional control sequences may be present, which enable the possibility to express a gene and/or part of a gene, within a receiver host cell at a suitable level of expression. The choice of control sequences is dependent on the desired level of expression of the gene or part of the gene and a person skilled in the art will be able to identify such control sequences.
• the vector may be a nucleotide sequence as defined above which may also be used therapeutically as anti-sense DNA. Concerns are taken in the production of such DNA and CpG di-nucleotides are omitted, if possible, in the contructs.
• Antisense DNA is used, for example, to interfere with the nuclear DNA and triple helix motifs are formed. Such triple helix structures are impaired in transcriptional activity or the interfering DNA can be coupled to strand breaking activities.
• Anti sense DNA can also be used to bind mRNA in such a way so that the translation of the mRNA is impaired and so that RNase H activity is induced and the mRNA is degraded.
• the vector may be a nucleotide sequence as defined above, which may form aptameres.
• Aptameres are rather short linear DNA, that binds in a specific manner to different biological molecules such as specific protein motifs, carbohydrates, and steroids.
• the aptameres can thereby block the activity of certain biological molecules.
• the vector may be any vector as long as the vector is capable to multiply within a host (receiver and/or donor), i.e, having a start of replication. It should be understood that not all vectors and control sequences function equally well to express a nucleotide sequence of interest. Neither will a host function equally well with the same expression system. However, a person skilled in the art will be able to make a selection among these vectors, control sequences and hosts without undue experimentation. For example, in selecting a vector, the host must be considered because the vector must replicate in the donor and/or the receiver host cell or be able to integrate into the chromosome of the receiver host cell.
• the vector's copy number, the ability to control the copy number, and the expression of any other proteins encoded by the vector, such as selectable markers, should also be considered.
• a control sequence a variety of factors should be considered. These include, for example, the relative strength of the sequence, its controllability, and its compatibility with the nucleotide sequence encoding the polypeptide of interest, particularly as regards potential secondary structures.
• Hosts should be selected by consideration of their compatibility with the chosen vector, the toxicity of the polypeptide encoded by the nucleotide sequence, their secretion characters, their ability to fold the polypeptide correctly, their fermentation or culture requirements, and ease of purification of the products encoded by the nucleotide sequence.
• the vector may be an autonomously replicating vector, i.e, a vector, which exists as an extra chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid.
• the vector is one which, integrate into the receiver host cell genome and replicate together with the chromosome(s) into which it has been integrated.
• a vector which integrate into the genome of the receiver host cell may be advantageous to use, when a certain gene and/or part of a gene and/or control sequence are in the need to be protected against future possible methylation problems. Methylation might occur upon replication of the genome into which the vector has been integrated.
• Another example is when there is a need of removing a certain gene and/or part of a gene and/or control sequence present in a genome.
• the expression of the gene and/or part of the gene and/or the control sequence may be reduced due to methylation and replacement of such a methylated gene and/or part of a gene and/or control sequence with an unmethylated form may increase the pre-existing expression level.
• the replacement may be performed using methods such as homologous recombination using linear DNA.
• the gene and/or part of a gene and/or control sequence may by such replacements be up or down regulated.
• a vector comprising one or more cytidine analogues which is integrated into a genome may upon replication of the genome give rise to new copies of the genome comprising said vector without one or more cytidine analogous.
• the new copy of the genome harbouring a vector may anyway be resistant against methylation even if no cytidine analogue is present within the new copy of the vector located in the new copy of the genome.
• the vector may be an expression vector, in which the nucleotide sequence encoding the polypeptide of the invention is operably linked to additional segments required for transcription of the nucleotide sequence.
• the vector is typically derived from plasmid or viral DNA.
• suitable expression vectors for expression in the host cells mentioned herein are commercially available or described in the literature.
• Useful expression vectors for eukaryotic hosts include, for example, vectors comprising control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalo virus.
• yeast cells include the 2 ⁇ plasmid and derivatives thereof, the POT1 vector (US 4,931,373), the pJSO37 vector described in Okkels, Ann. New York Acad. Sci. 782, 202-207, 1996, and pPICZ A, B or C (Invitrogen).
• Useful vectors for insect cells include pVL941, pBG311 (Cate et al, "Isolation of the Bovine and Human Genes for Mullerian Inhibiting Substance and Expression of the Human Gene in Animal Cells", Cell, 45, pp. 685-98 (1986), pBluebac 4.5 and pMelbac (both available from Invitrogen).
• Useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from E.
• coli including pBR322, pET3a and pET12a (both from Novagen Inc., WI, USA), wider host range plasmids, such as RP4, phage DNAs, e.g., the numerous derivatives of phage lambda, e.g., NM989, and other DNA phages, such as M13 and filamentous single stranded DNA phages.
• suitable viral vectors are Adenoviral vectors, Adeno associated viral vectors, retroviral vectors, lentiviral vectors, herpes vectors and cytomegalo viral vectors.
• Other vectors for use in this invention include those that allow the nucleotide sequence encoding the polypeptide to be amplified in copy number.
• amplifiable vectors are well known in the art. They include, for example, vectors able to be amplified by DHFR amplification (see, e.g., Kaufman, U.S. Pat. No. 4,470,461, Kaufman and Sharp, "Construction Of A Modular Dihydrafolate Reductase cDNA Gene: Analysis Of Signals Utilized For Efficient Expression", Mol. Cell. Biol., 2, pp. 1304-19 (1982)) and glutamine synthetase ("GS”) amplification (see, e.g., US 5,122,464 and EP 338,841).
• the recombinant vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
• a DNA sequence enabling the vector to replicate in the host cell in question.
• An example of such a sequence is the SV40 start of replication.
• suitable sequences enabling the vector to replicate are the yeast plasmid 2 ⁇ replication genes REP 1-3 and start of replication.
• the vector may also comprise a selectable marker, e.g., a gene the product of which complements a toxin related deficiency in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or the Schizosaccharomyces pombe TPI gene (described by P.R. Russell, Gene 40, 1985, pp. 125-130), or one which confers resistance to a drug, e.g., ampicillin, kanamycin, tetracyclin, chloramphenicol, neomycin, hygromycin or methotrexate.
• selectable markers include ura3 and leu2.
• selectable markers include amdS, pyrG, arcB, niaD and sC.
• control sequences is defined herein to include all components, which are necessary or advantageous for the expression of the polypeptide of the invention.
• Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide.
• control sequences include, but are not limited to, a leader sequence, polyadenylation sequence, propeptide sequence, promoter (inducible or constitutive), enhancer or upstream activating sequence, signal peptide sequence, and transcription terminator.
• the control sequences include a promoter.
• a wide variety of control sequences may be used in the present invention.
• control sequences include the control sequences associated with structural genes of the foregoing expression vectors as well as any sequence known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.
• suitable control sequences for directing transcription in mammalian cells include the early and late promoters of SV40 and adenovirus, e.g.
• the adenovirus 2 major late promoter the MT-1 (metallothionein gene) promoter, the human or rodent cytomegalovirus immediate-early gene promoter (CMV), the human elongation factor l ⁇ (EF-l ⁇ ) promoter, the Drosophila minimal heat shock protein 70 promoter, the Rous Sarcoma Virus (RSV) promoter, the human ubiquitin C (UbC) promoter, the human growth hormone terminator, SV40 or adenovirus Elb region polyadenylation signals and the Kozak consensus sequence (Kozak, M. J Mol Biol 1987 Aug 20;196(4):947-50).
• CMV cytomegalovirus immediate-early gene promoter
• EF-l ⁇ human elongation factor l ⁇
• EF-l ⁇ Drosophila minimal heat shock protein 70 promoter
• RSV Rous Sarcoma Virus
• UbC human ubiquitin C
• the human growth hormone terminator SV40 or adenovirus
• a synthetic intron may be inserted in the 5' untranslated region of the nucleotide sequence encoding the polypeptide.
• An example of a synthetic intron is the synthetic intron from the plasmid pCI-Neo or from the ⁇ -globin gene (available from Promega Corporation, WI, USA).
• an IRES element might be included.
• suitable control sequences for directing transcription in insect cells include the polyhedrin promoter, the P10 promoter, the Autographa californica polyhedrosis virus basic protein promoter, the baculovirus immediate early gene 1 promoter and the baculovirus 39K delayed-early gene promoter, and the SV40 polyadenylation sequence.
• suitable control sequences for use in yeast host cells include the promoters of the yeast ⁇ -mating system, the yeast triose phosphate isomerase (TPI) promoter, promoters from yeast glycolytic genes or alcohol dehydrogenase genes, the ADH2-4c promoter, and the inducible GAL promoter.
• suitable control sequences for use in filamentous fungal host cells include the ADH3 promoter and terminator, a promoter derived from the genes encoding Aspergillus oryzae TAKA amylase triose phosphate isomerase or alkaline protease, ⁇ . A. niger ⁇ -amylase, A. niger ox A. nidulans glucoamylase, A.
• nidulans acetamidase acetamidase, Rhizomucor miehei aspartic proteinase or lipase, the TPI1 terminator and the ADH3 terminator.
• suitable control sequences for use in bacterial host cells include promoters of the lac system, the trp system, the TAC or TRC system, and the major promoter regions of phage lambda.
• the presence or absence of a signal peptide will, e.g., depend on the expression host cell used for the production of the polypeptide to be expressed (whether it is an intracellular or extracellular polypeptide) and whether it is desirable to obtain secretion.
• the signal peptide may conveniently be derived from a gene encoding an Aspergillus sp. amylase or glucoamylase, a gene encoding a Rhizomucor miehei lipase or protease or a Humicola lanuginosa lipase.
• the signal peptide is preferably derived from a gene encoding A oryzae TAKA amylase, A.
• the signal peptide may conveniently be derived from an insect gene (cf. WO 90/05783), such as the
• Lepidopteran manduca sexta adipokinetic hormone precursor (cf. US 5,023,328), the honeybee melittin (Invitrogen), ecdysteroid UDPglucosyltransferase (egt) (Murphy et al., Protein Expression and Purification 4, 349-357 (1993) or human pancreatic lipase (hpl) (Methods in Enzymology 284, pp. 262-272, 1997).
• a preferred signal peptide for use in mammalian cells is that of hG-CSF or the murine Ig kappa light chain signal peptide (Coloma, M (1992) J. Imm. Methods 152:89- 104).
• suitable signal peptides have been found to be the ⁇ - factor signal peptide from S. cereviciae (cf. US 4,870,008), a modified carboxypeptidase signal peptide (cf. L.A. Vails et al, Cell 48, 1987, pp. 887-897), the yeast BARl signal peptide (cf. WO 87/02670), the yeast aspartic protease 3 (YAP3) signal peptide (cf. M. Egel-Mitani et al, Yeast 6, 1990, pp. 127-137), and the synthetic leader sequence TA57 (WO98/32867).
• Any suitable donor host cell may be used for the maintenance and production of the vector of the invention, such as an eukaryotic or procaryotic cell, for example bacteria, fungi (including yeast), plant, insect, mammal, or other appropriate animal cells or cell lines, as well as transgenic animals or plants.
• the donor host cell may be a donor host cell belonging to a GMP (Good Manufacturing Practice) certified cell-line, such as a mammalian cell-line.
• GMP Good Manufacturing Practice
• bacterial donor host cells include grampositive bacteria such as strains of Bacillus, e.g. B. brevis or B. subtilis, Pseudomonas or Streptomyces, or gramnegative bacteria, such as strains of E.
• suitable filamentous fungal donor host cells include strains of Aspergillus, e.g. A. oryzae, A. niger, o A. nidulans, Fusarium or Trichoderma.
• suitable yeast donor host cells include strains of Saccharomyces, e.g. S. cerevisiae, Schizosaccharomyces, Klyveromyces, Pichia, such as P. pastoris or P. methanolica, Hansenula, such as H. Polymorpha or Yarrowia.
• suitable insect donor host cells include a Lepidoptora cell line, such as Spodoptera frugiperda Sf9 or Sf21) or T choplusioa ni cells (High Five) (US 5,077,214).
• suitable mammalian donor host cells include Chinese hamster ovary (CHO) cell lines, (e.g. CHO-K1 ; ATCC CCL-61), Green Monkey cell lines (COS) (e.g. COS 1 (ATCC CRL-1650), COS 7 (ATCC CRL-1651)); mouse cells (e.g. NS/O), Baby Hamster Kidney (BHK) cell lines (e.g. ATCC CRL-1632 or ATCC CCL-10), and human cells (e.g. HEK 293 (ATCC CRL-1573)), as well as plant cells in tissue culture. Additional suitable donor cell lines are known in the art and available from public depositories such as the American Type Culture Collection, Rockville, Maryland.
• the invention relates to a nucleotide sequence obtained from a donor host harbouring the nucleotide sequence being part of the vector.
• the vector and the donor host are a vector and a donor host as described above.
• the nucleotide sequence may be a transcriptional unit comprising a promoter a nucleotide sequence, such as a gene or part of a gene and polyadenylation site.
• the nucleotide sequence may be a gene and/or part of a gene and/or one or more control sequences as mentioned above.
• gene or genes of interest are genes encoding nuclear core proteins, such as the influenza nuclear core protein encoding genes which may be used for vaccination.
• genes encoding tyrosin hydroxylase which may be useful for the treatment of Parkinsons disease.
• genes encoding factor X or VIII involved in the blood clotting complex or interferon gamma are gene candidates useful to be used according to the invention, such as thymidin kinase from Herpes Simplex Virus (HSV).
• HSV Herpes Simplex Virus
• the nucleotide sequence may be used as antisense.
• Antisense DNA is used, for example, to interfere with the nuclear DNA so that triple helix motifs are formed. Such triple helix structures are impaired in transcriptional activity or the interfering DNA can be coupled to strand breaking activities.
• Anti sense DNA can also be used to bind mRNA in such a way so that the translation of the mRNA is impaired and so that RNase H activity is induced and the mRNA is degraded.
• the nucleotide sequence may be used as aptameres, which is short stretches of nucleotide sequences that binds in a specific manner to different biological molecules such as specific protein motifs, carbohydrates, steroids etc.
• a cytosine base analogue such as aza-deoxy-cytidine, that cannot be methylated, can lower the immunogenicity of unmethylated DNA and thereby reduce the immunostimulatory side effects.
• the vector and/or the nucleotide sequence such as transcriptional units amplified by PCR may be used to transfect cells.
• the vector may be linearized and, e.g., prokaryotic parts can be left out by digestion with restriction enzymes.
• DNA can be used for, e.g. for immunization or in gene therapy, ex vivo or in vivo.
• the invention relates to a polypeptide produced by the donor host cell, the polypeptide is encoded by a nucleotide sequence being part of the vector according to the invention and described above.
• the invention in another embodiment relates to a pharmaceutical composition
• a pharmaceutical composition comprising the above described vector and/or the donor host and/or a nucleotide sequence obtained from the vector and/or a polypeptide and a pharmaceutically acceptable diluent, carrier, adjuvant or excipient.
• the vector, nucleotide sequence, polypeptide or a pharmaceutical composition as described above may be transferred into a receiver host cell by the use of a suitable transformation method such as electroporation, microprojectile bombardment or liposome mediated delivery.
• the vector, nucleotide sequence, polypeptide or a pharmaceutical composition as described above may be used in therapy and/or in diagnostic.
• the vector, nucleotide sequence, polypeptide or a pharmaceutical composition as described above may be used for the manufacture of a medicament for use in therapy and/or in diagnostic.
• One embodiment of the invention relates to a method, which reduce methylation of CpG motifs in a vector in a receiver host, which method comprises replacing at least one cytosine in a CpG motif with a cytosine analogous, the vector being described above.
• the method may be a cultivation method or a method, which amplifies the vector, such as by PCR.
• the method comprising the steps of; providing a vector; transferring the vector into a donor host cell; growing the donor host cell harbouring the vector in a growth medium consisting of a suitable amount of cytosine analogous and harvesting the multiplied vector comprising of incorporated cytosine analogous in one or two cytosines in at least one one CpG motifs.
• the vector being a vector as described above and the donor host being a donor host as described above.
• the vector and the donor host is chosen dependent upon the purpose of creating that specific vector with incorporated cytosine analogous and a person skilled in the art may perform that selection.
• the vector is transferred (introduced) into the donor host using a suitable method dependent on which donor host has been selected.
• the introduction of a vector into a bacterial donor host cell may, for instance, be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using competent cells (see, e.g., Young and Spizizin, 1961, Journal of Bacteriology 81 : 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of ' Molecular Biology 56: 209-221), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).
• protoplast transformation see, e.g., Chang and Cohen, 1979, Molecular General Genetics 168: 111-115
• competent cells see, e.g., Young and Spizizin, 1961, Journal of Bacteriology 81 : 823-8
• Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and US 5,679,543. Suitable methods for transforming Fusarium species are described by Malardier et al, 1989, Gene 78: 147-156 and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N.
• Methods for introducing exogeneous DNA into mammalian donor host cells include calcium phosphate-mediated transfection, electroporation, DEAE-dextran mediated transfection, liposome- mediated transfection, viral vectors and the transfection method described by Life Technologies Ltd, Paisley, UK using Lipofectamin 2000. These methods are well known in the art and e.g., described by Ausbel et al. (eds.), 1996, Current Protocols in Molecular Biology, John Wiley & Sons, New York, USA. In the production methods of the present invention, the cells are cultivated in a growth medium suitable for maintenance and/or production of the vector using methods known in the art.
• the cell may be cultivated by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermenters performed in a suitable medium and under conditions allowing the vector, nucleotide sequence or polypeptide to be expressed and/or isolated.
• the vector, nucleotide sequence or the polypeptide may be used in the chemical or in the pharmaceutical industry.
• the cultivation takes place in a suitable growth medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection).
• the cultivation of mammalian donor cells are conducted according to established methods, e.g., as disclosed in (Animal Cell Biotechnology, Methods and Protocols, Edited by Nigel Jenkins, 1999, Human Press Inc, Totowa, New Jersey, USA and Harrison MA and Rae IF, General Techniques of Cell Culture, Cambridge University Press 1997).
• the cytosine analogue as described above are added to the growth medium in a suitable amount, which is sufficient to obtain a vector having a sufficiently amount of cytosine analogous incorporated into the nucleotide sequence to yield a desired the expression the nucleotide sequences encoding polypeptides.
• the amount of cytosine analogue is dependent on several factors including the size of the vector, the amount of CpG motifs and the host cell. For example in eukaryotic cells often lO ⁇ M of 5-azacytidine and/or 5 -azadeoxy cytidine is used.
• the cytosine analogue may be added either prior to cultivation or during the cultivation step.
• the donor host After cultivation the donor host is harvested by for example centrifugation and the vector recovered by methods known in the art. Examples of methods are those mentioned in Maniatis et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbour Press) (1989) and Qiagen Inc..
• the amount and distribution of cytosine analogous present in the vector after production in a suitable donor host may be determined by for example using labelled 5-azacytidine and/or 5 -azadeoxy cytidine, HPLC, GC or TC.
• the vector as defined above may be produced by amplification, such as by the use of PCR.
• amplification such as by the use of PCR.
• a transcriptional unit by PCR
• the vector of the invention such as a plasmid vector for transfection.
• the vector may be linearized and, e.g., prokaryotic parts can be left out by digestion with restriction enzymes.
• PCR all sites, which may be replaced by a cytosine analogue can be replaced due to the absence of dCTP during the amplification reaction.
• the amplified vector may be used for immunisation or in gene therapy, ex vivo or in vivo.
• One example is transfection of a mammalian cell line with a transcriptional unit, including a promoter, a cDNA and a polyadenylation site, which may be done to produce a protein encoded by the cDNA that will be secreted from the cells in a fermentor.
• a transcriptional unit including a promoter, a cDNA and a polyadenylation site
• Kit of the invention of the invention.
• the invention relates to a kit comprising a vector as described above and/or a donor host cell as described above including a description how to use the vector and/or the vector and the donor host cell.
• the kit may further comprise a growth medium suitable for the donor host cell for the ability to grow (multiply) the vector.
• the kit may be used for the production of a polypeptide in industry or in a method for the treatment of a mammal suffering from a disorder or in need of vaccination.
• disorders are influenza and cancer.
• the vector, donor host, nucleotide sequence, polypeptide or the pharmaceutical composition according to the invention may be used for several applications including vaccination and gene therapy.
• the nucleotide sequences creating the vector are nucleotide sequences (e.g., start of replication and control sequences) which maintain their activity such as express a polypeptide within the reciever host, i.e. the cells of the patient.
• a promoter is used upstream of the nucleotide sequence encoding a polypeptide that give rise to the immune response, i.e, the promoter is active in a human cell.
• the promoter may be inducible and/or constitutive. In the case of using an inducible promoter it may be inducible by an agent either administered together or subsequently with the vector and/ or the donor host. The promoter may further be induced by an agent produced within the patient either locally or systemically.
• plasmids encoding insulin are introduced intramusculary by electroportation, then this plasmid will express insulin for a while and thereafter the expression diminishes.
• a methylation resistant plasmid on the other hand, will probably have a constant expression for a long period of time. If such a plasmid have a tetracycline-inducible promoter the insulin production could be controlled by oral administration of tetracycline.
• This type of gene therapy could be applicable for patients with insulin deficient type diabetis or if the gene to be expressed is a missing coagulation factor by hemophilic patients.
• the vector/donor host, nucleotide sequence, polypeptide or the pharmaceutical composition according to the invention is used for the manufacture of a medicament for treatment of disorders or vaccination, such as cancer.
• cancer therapy of today there is a focus on therapies other than the classical radiotherapy and chemotherapy.
• Anti-angiogenic therapy as well as immunotherapy against cancer being two promising fields.
• Both therapies can utilise gene therapy for the production of anti-angiogenic agents or for the production of immunostimulatory or toxic agents.
• These types of therapy can be optimised by the use methylation resistants vectors, both as pure plasmids or as viral vectors made resistant against methylation.
• a genetically modified adenovirus which express the gene for Herpes Simplex Thymidine kinase may be produced in the presence of a described cytosine analogue. Then the DNA of the adenovirus will contain this analogue and upon infection the adenovirus will express higher levels of HSV-TK for a longer period of time compared to an adenovirus not having methylation resistant DNA. The tumor cells can then be killed by a herpes virus drug. The killing is correlated with the production of HSV-TK, i.e., the higher the concentration of HSV-TK the more sensitive will the tumor cell be for the drug.
• HSV-TK Herpes Simplex Thymidine kinase
• the vector/donor host, nucleotide sequence, polypeptide or the pharmaceutical composition according to the invention is used in a method for treating a mammal having a disorder or in need of vaccination.
• Vaccination has traditionally been performed by the use of mutated or killed pathogenic viruses.
• DNA vaccination makes use of proteins encoded by the DNA of the pathogen.
• Such a gene or genes are cloned in a plasmid or another vector.
• Plasmids encoding pathogenic protein(s) can be injected, e.g., intramusculary.
• the plasmid will express the pathogenic protein(s) that are recognised by the immune system of that individual. This type of immunisation then protects against subsequent infection of the pathogen.
• the strength of the immune reaction depends on the production of the pathogenic protein. A too low production of the pathogenic protein(s) might not be recognised by the immune system. Hence, immunisation of both humans and animals with methylation resistant vectors will improve the efficiency.
• compositions of the vector/donor host, nucleotide sequence, polypeptide of the invention are typically administered in a composition that includes one or more pharmaceutically acceptable carriers or excipients.
• Such pharmaceutical compositions may be prepared in a manner known in the art that is sufficiently storage stable and suitable for administration to humans and animals.
• the pharmaceutical composition may be lyophilised.
• “Pharmaceutically acceptable” means a carrier or excipient that at the dosage and concentrations employed does not cause any unwanted effects in the patients to whom it is administered.
• Such pharmaceutically acceptable carriers or excipients are well-known in the art (see Remington's Pharmaceutical Sciences, 18th edition, A.R Gennaro, Ed., Mack Publishing Company (1990) and handbook of Pharmaceutical Excipients, 3rd edition, A. Kibbe, Ed ., Pharmaceutical Press (2000).
• the pharmaceutical compostion may be admixed with adjuvants such as lactose, sucrose, starch powder, cellulose esters of alkanoic acids, stearic acid, talc, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulphuric acids, acacia, gelatin, sodium alginate, polyvinyl-pyrrolidine, and/or polyvinyl alcohol, and tableted or encapsulated for conventional administration.
• adjuvants such as lactose, sucrose, starch powder, cellulose esters of alkanoic acids, stearic acid, talc, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulphuric acids, acacia, gelatin, sodium alginate, polyvinyl-pyrrolidine, and/or polyvinyl alcohol, and tableted or encapsulated for conventional administration.
• adjuvants such as lactose, sucrose, starch powder, cellulose est
• the carrier or diluent may include time delay material, such as glyceryl monostearate or glyceryl distearate alone or with a wax, or other materials well known in the art.
• compositions may be subjected to conventional pharmaceutical operations such as sterilisation and/or may contain conventional adjuvants such as preservatives, stabilisers, wetting agents, emulsifiers, buffers, fillers, etc., e.g., as disclosed elsewhere herein.
• adjuvants such as preservatives, stabilisers, wetting agents, emulsifiers, buffers, fillers, etc., e.g., as disclosed elsewhere herein.
• the pharmaceutical composition according to the invention may be administered locally or systemically such as topically, intravenously, orally, parenterally or as implants, and even rectal use is possible.
• Suitable solid or liquid pharmaceutal preparation forms are, for example granules, powders, tablets, coated tablets, (micro) capsules, suppositories, syrups, emulsions, suspensions, creams, aerosols, drops or injectable solution in ampule form and also preparations with protracted release of active compounds, in whose preparation excipients, diluents, adjuvants or carriers are customarily used as described above.
• the pharmaceutical composition will be administered to a patient in a pharmaceutically effective dose.
• pharmaceutically effective dose is meant a dose that is sufficient to produce the desired effects in relation to the condition for which it is administered.
• the exact dose is dependent on the, activity of the compound, manner of administration, nature and severity of the disorder, age and body weight of the patient different doses may be needed.
• the administration of the dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administration of subdivided doses at specific intervals. For example vaccination.
• the pharmaceutical composition of the invention may be administered alone or in combination with other therapeutic agents. These agents may be incorporated as part of the same pharmaceutical composition or may be administered separately.
• the "patient” for the purposes of the present invention includes both humans and other mammal. Thus the methods are applicable to both human therapy and veterinary applications.
• the culture is incubated in a shaker (200 rpm) over night at 37 °C. 3.
• the over night culture is then used to inoculate a 500 ml LB medium in a 2 liter culture flask.
• the flask is incubated at 37 °C in a shaker until the growth of the bacteria reaches OD(650) of 0,5 to 0,8.
• the culture is incubated at 37 °C on a shaker as above over night.
• the bacteria is pelleted by conventional centrifugation and plasmid DNA is isolated according to a standard Qiagen Inc. Maxiprep protocol.
• the aza-cytdine molecule can be separated by means of HPLC from cytidine.
• the isolated DNA is treated with DNAse I so that a high concentration of free nucleotides is generated.
• the samples is injected in a suitable HPLC column and the nucleotides is separated into cytidine, thymidine, guanine, adenine and 5'azacytdine respectively.
• the concentration of aza-cytidine in relation to cytidine is measured.
• a transcriptional unit containing a CMV promoter, the gene encoding green fluorescent protein (GFP) and an HSV-TK polyadenylation site framed by two insulators in the opposite direction was cloned in a plasmid.
• the opposite directions of the two chicken beta globin insulators was used so that if recombination occurs, the orientation of the transcriptional unit was only inverted and not lost.
• the purpose is to amplify the transcriptional unit with base analogues that make it methylation resistant and to introduce the unit into human glioma cells.
• 10 ng of the cloned gene construct in the shuttle vector pAd-easy was mixed in a reaction tube containing a buffer for pfii DNA polymerase with 5 mM of MgCl 2 , 100 mM Tris at pH 7,4, deoxy-nucleotide triphosphate mixture containing 250 micromolar of dATP, dGTP and dTTP.
• the reaction mixture also contained a mixture between 5 '-aza-2-deoxy cytidine triphosphate and 2 '-deoxy cytidine triphosphate in the following ratios; 100:0, 75:25, 50:50, 25:75, and 0: 100 so that the final concentration is 250 micromolar of the two cytidines together.
• the reaction mixture also contains two primers, froward primer is CAGGACTCTGATGGAACCAGG and the reverse primer is CCCTACCATTAGATGGATCAG.
• the reaction mixture contains 250 ng of each primer and the reaction volume is 50 micro
• the GFP positive cells were diluted to 0,5 cells per 100 microliter and 100 microliter were put into 96 replicate wells for each of the ten different cultures.
• One-cell clones that originated from this cloning were measured for long term expression of GFP.
• Competent cells of Agrobacterium tumefaciens were subjected to transfection with the plasmid pRTlOl in which the gene for green fluorescent protein were cloned in the Eco RI site of the plasmid and was under the control of the Cauliflower mosaic virus promoter (CaMV).
• the bacteria were grown in YM broth (0.04% yeast extract, 1% mannitol, 1.7 mM NaCl, 0.8 mM MgSO4-7H20, 2.2 mM K2HPO4-3H20, (pH 7.0)) and at and OD of 0,1 the medium was supplemented with 100 micromolar of 5' -aza-2'-deoxy cytidine.
• the plasmid DNA was isolated using standard technique with a kit from Qiagene Inc.
• the plasmid DNA isolated was used for electroporation of callus cells from barley (Hordeum vulgare). As a control the same plasmid not containing aza-cytidine was used.
• the transformation frequency was followed under an inverted fluorescent microscope and stable clones from both natural plasmid transfection as well as those transformed with plasmids containing aza-cytidine were subjected to differentiation and plants were developed from both categories.
• the expression of the jelly-fish protein (GFP) over long term in the two groups were studied.

Landscapes

• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• General Health & Medical Sciences (AREA)
• Microbiology (AREA)
• Plant Pathology (AREA)
• Molecular Biology (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• Physics & Mathematics (AREA)
• Cell Biology (AREA)
• Diabetes (AREA)
• Animal Behavior & Ethology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Pharmacology & Pharmacy (AREA)
• General Chemical & Material Sciences (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Medicinal Chemistry (AREA)
• Emergency Medicine (AREA)
• Crystallography & Structural Chemistry (AREA)
• Endocrinology (AREA)
• Hematology (AREA)
• Obesity (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Peptides Or Proteins (AREA)

Priority Applications (4)

Applications Claiming Priority (2)

Publications (1)

Family

ID=20284952

Family Applications (1)

Country Status (6)

Cited By (6)

Families Citing this family (1)

Family Cites Families (5)

• 2001
  • 2001-07-27 SE SE0102627A patent/SE0102627L/sv not_active IP Right Cessation
• 2002
  • 2002-07-08 JP JP2003517286A patent/JP2004536616A/ja active Pending
  • 2002-07-08 MX MXPA04000651A patent/MXPA04000651A/es not_active Application Discontinuation
  • 2002-07-08 EP EP02741568A patent/EP1419257A1/en not_active Withdrawn
  • 2002-07-08 CA CA002453372A patent/CA2453372A1/en not_active Abandoned
  • 2002-07-08 WO PCT/SE2002/001121 patent/WO2003012112A1/en active Application Filing

Non-Patent Citations (6)

Also Published As

Similar Documents

Legal Events