WO2003000274A2 - Nouvelle preparation - Google Patents

Nouvelle preparation Download PDF

Info

Publication number
WO2003000274A2
WO2003000274A2 PCT/GB2002/002879 GB0202879W WO03000274A2 WO 2003000274 A2 WO2003000274 A2 WO 2003000274A2 GB 0202879 W GB0202879 W GB 0202879W WO 03000274 A2 WO03000274 A2 WO 03000274A2
Authority
WO
WIPO (PCT)
Prior art keywords
bacteriophage
cell
pathogen
preparation
annihilation
Prior art date
Application number
PCT/GB2002/002879
Other languages
English (en)
Other versions
WO2003000274A3 (fr
Inventor
David West
Vladimir Pasechnik
Original Assignee
Phage Genomics Inc.
POLYANSKAYA, Natasha
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Phage Genomics Inc., POLYANSKAYA, Natasha filed Critical Phage Genomics Inc.
Priority to AU2002314331A priority Critical patent/AU2002314331A1/en
Publication of WO2003000274A2 publication Critical patent/WO2003000274A2/fr
Publication of WO2003000274A3 publication Critical patent/WO2003000274A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/10011—Details dsDNA Bacteriophages
    • C12N2795/10311—Siphoviridae
    • C12N2795/10332—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to the treatment of intracellular infection, in particular intracellular bacterial infection, and provides a novel preparation for use in such treatment.
  • the invention relates particularly to preparations and methods for eliminating eukaryotic cells infected with pathogens such as M. tuberculosis, Plasmodiumfalciparum, or HTV-1 virus, or indeed any pathogen which is capable of being internalised into eukaryotic cells.
  • pathogens such as M. tuberculosis, Plasmodiumfalciparum, or HTV-1 virus, or indeed any pathogen which is capable of being internalised into eukaryotic cells.
  • the invention further comprehends pharmaceutical compositions comprising such preparations, and methods for producing such preparations.
  • pathogens such as bacteria, parasites, and viruses.
  • pathogens such as bacteria, parasites, and viruses.
  • pathogens enter cells of various kinds where they are capable of multiplication and virulent action.
  • the early stages of tuberculosis see the infection of lung macrophages by inhaled bacilli, the multiplication of bacilli within infected macrophages and their transmission to uninfected macrophages and monocytes, which subsequently transport the bacilli to regional lymph nodes to initiate the next stages in tuberculosis disease progression.
  • Malaria another widespread and life- threatening disease, is characterised at its early stages by the entry of malaria parasites into macrophages, hepatocytes, and eventually erythrocytes, where the parasites multiply and mature.
  • Extracellular pathogens in a human or animal body are usually eventually detected and eliminated by elements of the non-specific/specific protective immune system.
  • pathogens may evade detection by the host immune system.
  • vaccination procedures against diseases such as tuberculosis are generally of low efficacy.
  • methods of treatment of such diseases have typically sought to target pathogens directly by means of anti- pathogen agents such as antibiotics, which are capable of entering infected cells.
  • antibiotics such as isoniazid, rifampicin, pyrazynamide, ethambutaol and streptomycin, which are used to treat M. tuberculosis infection, show a high rate of penetration into infected cells.
  • antibiotics may be associated with delivery systems such as cationic amphiphilic liposomes or microcapsules which are capable of interacting with receptors on the surface of a host cell and delivering the antibiotic into the interior of the cell.
  • an "immunotoxin” comprising the catalytic domain of a bacterial toxin such as Pseudomonas aeruginosa exotoxin A, diphtheria toxin or the plant toxin ricin, conjugated to the F ab region of an antibody immunospecific for an antigen characteristically displayed on infected cells, is administered to a cell population, and serves to target and destroy cells displaying that antigen.
  • a bacterial toxin such as Pseudomonas aeruginosa exotoxin A, diphtheria toxin or the plant toxin ricin
  • conjugated to the F ab region of an antibody immunospecific for an antigen characteristically displayed on infected cells is administered to a cell population, and serves to target and destroy cells displaying that antigen.
  • a bacteriophage preparation comprising a bacteriophage which is adapted to enter a eukaryotic cell and/or a eukaryotic cellular compartment, which bacteriophage is lytic towards at least one strain of pathogenic bacteria which may infect said cell or compartment, which bacteriophage is fused to, or linked to, or is adapted to express an annihilation moiety, which annihilation moiety is adapted when in the presence of at least one specific pathogen to cause or stimulate the death or inactivation of said cell; such that said bacteriophage preparation is capable of causing or stimulating the death or inactivation of cells which are infected with said pathogen.
  • said annihilation moiety will act to bring about the death or disablement of the cell.
  • the host for pathogenic infection will be eliminated, hence precluding further multiplication of said pathogen within said host.
  • Said bacteriophage will furthermore serve to lyse and eliminate any of said pathogenic bacteria within said cell or cellular compartment, thereby mediating a powerful dual action against the infecting agents in the cell.
  • said strain of pathogenic bacteria may be a strain which may be found within a cell that is infected by said pathogen.
  • said strain of pathogenic bacteria may be a strain which commonly infects individuals who are infected by said pathogen.
  • said pathogen may be FflN-1 virus
  • said pathogenic bacteria may be Mycobacteria tuberculosis.
  • the vulnerability of individuals infected with the HIV virus to further infection by other pathogens, such as M. tuberculosis, has rendered the development of therapeutic agents capable of treating both HIV and secondary infections an urgent priority.
  • the present invention meets this need, through the provision of a modified bacteriophage that is capable of eliminating the host for a primary pathogen (such as HTN-1), whilst destroying the microbes responsible for a secondary infection (such as M. tuberculosis).
  • said pathogen may be said pathogenic bacteria.
  • the bacteriophage preparation of the invention will be capable of achieving the destruction of both the pathogen in question and its host, hence bringing about rapid elimination of a systemic infection.
  • a pharmaceutical composition comprising a bacteriophage preparation in accordance with the present invention, which composition is formulated for administration to a patient in need thereof, which composition optionally includes one or more pharmaceutically acceptable excipients or additives.
  • a method for producing the death or inactivation of a cell infected by a pathogen comprising the step of introducing to said cell or a compartment within said cell a bacteriophage preparation in accordance with the present invention under conditions suitable for allowing said bacteriophage to be internalised within said cell or cellular compartment.
  • Said method when employed in vivo, may constitute an effective treatment or prophylaxis for a disease or condition which is mediated, caused, exacerbated or characterised by intracellular infection by said pathogen.
  • a method comprising the use of a bacteriophage preparation in accordance with the present invention in the manufacture of a pharmaceutical composition in accordance with the invention, for administration to a patient in need thereof.
  • a method comprising the use of a bacteriophage preparation in accordance with the invention in the manufacture of a pharmaceutical composition for use in the treatment and/or the prophylaxis of a disease which is mediated or characterised by intracellular infection by a pathogen, including in particular tuberculosis, AIDS, HIV infection, and malaria.
  • said bacteriophage preparation may be non-toxic or substantially non- toxic to eukaryotic cells which are not infected with said pathogen. This will ensure that the entry of said bacteriophage preparation into a eukaryotic cell or cellular compartment which is not infected with said pathogen will not result in the death or inactivation of said cell. Meanwhile, said bacteriophage preparation remains capable of causing or stimulating the death or inactivation of infected cells.
  • said bacteriophage may be adapted to express said annihilation moiety only in the presence of one or more pathogen factors, which pathogen factors are produced by or are associated with said pathogen.
  • said pathogen factors may be adapted to act as transcription factors for switching on expression of said annihilation moiety encoded within said bacteriophage.
  • said annihilation moiety may be capable of adopting respective activated and inactivated forms, said annihilation moiety being capable of causing or stimulating the death or inactivation of said cell only when in said activated form; and said annihilation moiety may be arranged to be transformed from said inactivated form to said activated form as a result of interaction between said inactivated form and said pathogen and/or said one or more pathogen factors.
  • activation of said annihilation moiety may be highly selective for the presence of said pathogen and/or said pathogen factor(s) such that where said bacteriophage is entered into a cell or cellular compartment which is not infected with said pathogen, said annihilation moiety will remain in said inactivated form, and will not therefore cause or stimulate the death or inactivation of said cell.
  • said inactivated form of the annihilation moiety will be transformed into said activated form which is capable of causing or stimulating the death or inactivation of said cell.
  • said annihilation moiety may be adapted to be transformed from said inactivated form to said activated form as a result of site-specific enzymatic modification of said inactivated form by one or more pathogen factors produced by or associated with said pathogen, such as by site-specific proteolytic cleavage, phosphorylation, dephosphorylation or by any other type of modification.
  • said inactivated form of the annihilation moiety may include or may be linked to an activation site which is susceptible to said site-specific enzymatic modification.
  • said activation site may comprise a proteolytic cleavage site which is adapted for site-specific proteolytic cleavage by one or more proteases which are produced by or associated with said pathogen, whereby said inactivated form is transformed to said activated form of the annihilation moiety.
  • said proteases capable of agonizing said activation site may be produced exclusively or at least predominantly by said pathogen.
  • said annihilation moiety may comprise a polypeptide such as an enzyme which is capable when activated of stimulating or causing the death or inactivation of a cell, for example by damaging or inhibiting cell cycle progression.
  • Said annihilation moiety may for example comprise a toxin such as anthrax toxin or other toxins known to the man skilled in the art, which when released into a cell or cellular compartment have a cytotoxic effect upon the cell.
  • This approach may have the consequence that, following the death of an infected host cell by cytotoxicity, pathogens previously contained within the host cell will typically be released unharmed into the surrounding environment. Studies have however shown that M.
  • tuberculosis infection of alveolar macrophages often results in the apoptosis of infected cells (Keane et al., J. Immunol, 2000; 164: 2016-2020); and it has been observed that, following apoptosis of bacterially infected macrophages, bacterial growth in freshly-added, uninfected macrophages is inhibited (Fratazzi et al., J. Immunol, 1997; 158: 4320-). Furthermore, virulent strains of M. tuberculosis are found to induce significantly less macrophage death than avirulent strains such as M.
  • tuberculosis H37Ra Mycob ⁇ cterium bovis bacillus Calmette-Guerin, and M.kansasii.
  • This effect has been interpreted as a bacterial self-defence mechanism against host-regulated apoptosis of alveolar macrophages during infection.
  • Another group of results demonstrate the use of apoptosis by a host as a means of self-defence against viruses (Vaux and Strasser 1996 PNAS 93: 2239-2244) which evade degradation by encoding specific inhibitors of apoptosis. When genes encoding these inhibitors are mutated, the host cells respond to infection by undergoing apoptosis and killing the pathogens.
  • baculovirus-encoded inhibitors of apoptosis were able to block the activation of apoptotic proteases within mammalian cells (Vaux and Strasser 1996 PNAS 93: 2239-2244).
  • apoptosis of infected cells constitutes a host defence against infection which serves to inhibit or prevent further bacterial growth and spreading of infection.
  • apoptotic cells are usually degraded by activated macrophages, which results in the simultaneous digestion and destruction of pathogens which may have been contained within the apoptotic cells.
  • said annihilation moiety may comprise an agent capable of causing or stimulating cellular apoptosis, such as one of the following: HIV-1, SIV-1 Vpr polypeptide or its C-terminal fragment, HFRIGCRHSRIR (Mahalingham et al., DNA and Cell Biology, 1997; 16(2): 137-143; He et al., J.
  • an agent capable of causing or stimulating cellular apoptosis such as one of the following: HIV-1, SIV-1 Vpr polypeptide or its C-terminal fragment, HFRIGCRHSRIR (Mahalingham et al., DNA and Cell Biology, 1997; 16(2): 137-143; He et al., J.
  • said inactivated form of the annihilation moiety may advantageously comprise an apoptotic proprotein, such as, for example, modified procaspase-3 or procaspase-7, which apoptotic proprotein is capable when activated within a host cell of inducing host cell apoptosis.
  • Endogenous procaspase-3 and procaspase-7 each includes a small subunit and a large subunit, linked by a peptide linker chain that includes a target activation site for intracellular proteases. Upon cleavage within a cell, the small subunit is released and mediates an apoptotic effect upon the cell.
  • a modified procaspase-3 or procaspase-7 in which the peptide linker chain is replaced with an alternative peptide linker including target proteolytic sites for one or more selected proteolytic pathogen factors, may be produced.
  • Such a modified procaspase-3 or procaspase-7 will be susceptible of activation by said one or more pathogen factors.
  • modified polypeptides in which a native cleavage site is replaced by a peptide cleavable by a selected protease of interest is a task well within the capability of the man skilled in the art, and reference is made in this regard to O'Hare et al., FEBS, 1990; 273:200-204 which describes the construction of a recombinant ricin-A-chain fusion protein which is engineered to include a trypsin-sensitive cleavage site.
  • Many pathogens including M. tuberculosis, are known to secrete proteases which are typically implicated in the virulent activity of the pathogen.
  • PCT/GBOl/05333 the contents of which are incorporated herein by reference, describe a method for screening proteins secreted by pathogens such as M. tuberculosis, in order to detect protease activity, such as to enable the identification and characterisation of pathogen proteases, and of their target proteolytic sites.
  • pathogens such as M. tuberculosis
  • protease activity such as to enable the identification and characterisation of pathogen proteases, and of their target proteolytic sites.
  • a bacteriophage in accordance with the present invention which comprises or expresses an annihilation moiety may be readily engineered such that the inactivated form of said annihilation moiety includes an activation site or sites which is susceptible of site-specific proteolysis by one or more pathogen proteases.
  • said inactivated form of the annihilation moiety may comprise an agent, which agent displays cytotoxic or preferably apoptotic activity when released in free form into a host cell or compartment, and a peptide linker for linking said agent to the surface of said bacteriophage, which peptide linker includes at least one activation site which is susceptible of proteolytic cleavage by one or more proteases produced by said pathogen, whereby said agent can be released in free form from the surface of said bacteriophage.
  • said inactivated form of the annihilation moiety may include a plurality of activation sites respectively comprising cleavage sites for a plurality of pathogen types, which may include both bacteria and viruses.
  • a bacteriophage preparation comprising a bacteriophage which (for example) comprises or expresses an annihilation moiety which includes in its inactivated form an activation site comprising the cleavage sequence for a protease expressed by HIV-1 virus, and an activation site comprising the cleavage sequence for a protease expressed by M.
  • tuberculosis may be effective for treating patients who suffer from infection by either or both of these pathogens, owing to the ability of the annihilation moiety to be activated in the presence of HIV-1 virus and/or M. tuberculosis.
  • said pathogen may comprise a parasite, bacterium or virus or other pathogenic microorganism.
  • Said pathogen and/or said pathogenic bacteria may be selected from one of the following bacterial strains: M tuberculosis including multidrug-resistant variants of M.
  • M.avium complex that is a common opportunistic infection in AIDS patients; Legionella pneumophila, a causative agent for Legionnaires' s disease; Leishmania donovani, a causative agent of leishmaniasis; Francisella tularensis, a causative agent of tularemia; Brucella abortus; Chlamydia spp. e.g. Chlamydia trachomatis; Rickettsia prowazekii; Shigella; Campylobacter; or Haemophilus influenzae type b, the major cause of bacterial meningitis in children.
  • Said pathogen may be Plasmodiumfalciparum, the causative agent of malaria; or HIV-1 virus.
  • bacteriophage preparation will also be useful for the treatment of extracellular bacterial infection, owing to the ability of the bacteriophage to lyse both intracellular and extracellular bacteria.
  • said annihilation moiety may be capable of causing or stimulating death or inactivation of said cell only following infection of said pathogenic bacteria within said cell or a compartment of said cell by said bacteriophage, and amplification of said bacteriophage within said bacteria to a physiologically relevant level. Accordingly, specificity of action against cells infected by said pathogenic bacteria may be achieved as a result of the amplification of bacteriophage only within such infected cells or compartments thereof.
  • said annihilation moiety may be adapted to be transformed from said inactivated state to said activated state as a result of interaction between said bacteriophage and one or more intracellular factors, such as enzymes.
  • said inactivated form of the annihilation moiety may comprise or may be linked to an activation sequence which includes the target sequence for one or more intracellular enzymes, such as intracellular proteases, for example cathepsin H or L which are present in early endosomes, the arrangement being such that enzymatic action of said one or more intracellular enzymes on said activation sequence will result in activation of said annihilation moiety.
  • intracellular enzymes such as intracellular proteases, for example cathepsin H or L which are present in early endosomes
  • said bacteriophage preparation further includes transport means for effecting transport of said bacteriophage into said cell and/or said cellular compartment.
  • Said transport means may, for example, comprise packaging means for packaging said bacteriophage, which packaging means is capable of transporting said packaged bacteriophage into said cell and/or said cellular compartment.
  • said transport means may comprise a transport agent which is exposed on the surface of said bacteriophage, which transport agent is adapted to mediate transport of said bacteriophage into said cell and/or said cellular compartment.
  • Said transport agent may be expressed by said bacteriophage, or may be covalently or non-covalently bound to or adsorbed on the surface of said bacteriophage.
  • said transport means may be capable of mediating transport of said bacteriophage across a plurality of cell membranes and/or cell membrane types.
  • M. tuberculosis infection is typically confined primarily to pulmonary cells of the macrophage/monocyte lineage
  • the onset worldwide of the HIV epidemic has resulted in an increase, both in relative and absolute terms, of extrapulmonary involvement in M. tuberculosis infection, with cells of the peritoneal, meningeal, skeletal, genitourinary, pleural, lymphatic abdominal and pericardial sites being affected.
  • Cells of the liver, lungs, kidneys, bone marrow, adrenals and spleen have also been found susceptible to infection by M. tuberculosis.
  • a treatment of intracellular M. tuberculosis infection should be capable of targeting any of these cell types.
  • said transport means is non-membrane- specific, such that the bacteriophage is capable of being transported into a plurality of different cells and/or cellular compartments.
  • Said transport agent may, for example, comprise a macrolide antibiotic, such as erythromycin, clindamycin, or rokitamycin.
  • Macrolide antibiotics have been shown to be capable of efficient internalisation into a range of human cells (Tasaka et al., The Jap. J. Antibiotics, 1987; XLI(7): 836-840); and are also known to be substantially non-toxic towards eukaryotic cells (Mazzei et al., J. Antimicrobial Chemotherapy, 1993; 31: Suppl C, 1-9).
  • Macrolide antibiotics are capable of being chemically cross-linked via their reactive hydroxyl side-groups to other polypeptides, according to chemical procedures well known in the art and described more particularly in Arap et al., Science, 1998; 279: 377-380; and it has been demonstrated that, when chemically linked to a polypeptide, the macrolide antibiotic doxorubicin is capable of co-transporting that polypeptide into human cells (Arap et al., ibid.) Accordingly, said bacteriophage preparation may comprise a macrolide antibiotic which is chemically cross- linked, directly or indirectly, to the surface of said bacteriophage.
  • said transport agent may comprise a cationic peptide.
  • cationic peptides The ability of cationic peptides to mediate the co-transportation across a biological membrane of polypeptides to which they are attached has recently been recognised (Derossi D et al., Trends in Cell Biol,199S; 8: 84-87), and has been attributed to temporary destabilisation of the membrane from a lipid bilayer into an inverted micelle, which permits the translocation of the cationic peptide and any associated polypeptide across the membrane. This effect is non-membrane specific.
  • the transport agent may comprise a cationic peptide which has the ability to mediate transport of said bacteriophage into a cell or cellular compartment, but which displays no effect, whether by activation or repression, on gene expression within the cell or compartment.
  • Suitable cationic peptides for this purpose includethe Tat peptide of HIV-1 (WO 91/09958, US-A-5804604) or a fragment thereof, particularly a fragment which comprises or consists of residues 49-57 thereof having the sequence RKKRRQRRR (WO 94/04686 and Fawell et al (1994) Proc. Nat'l
  • HSV-1 structural protein VP22 or a fragment thereof (Elliott et al, 1997 Cell 88:223-233); or a translocation peptide derived from Drosophila melanogaster homeodomain protein (Derossi D et al, J. Biol. Chem. 1994; 269:10444-10450); or a KALA/GALA-type peptide (Wyman et al, Biochemistry 1997; 36: 3008-3017); or a polyarginine or polylysine peptide; or a derivative of any of these peptides.
  • PTDs protein transduction domains
  • said transport means may be adapted to mediate transport of said bacteriophage into specific cells, cell types or cell compartments, such as cells, cell types or cell compartments which display particular receptors or antigens.
  • said transport agent may for example comprise a ligand, which is capable of binding to a receptor on a target cell or cell compartment surface and thereafter mediating transport of said bacteriophage into said cell or cell compartment.
  • Suitable ligands for this purpose include human transferrin, which is capable of interacting with transferrin receptor (Ali et al., J. Biol.
  • Suitable ligands furthermore include complement component C2a which is capable of interacting with complement receptors CRl and CR3 on the surface of macrophages; or the circumsporozoite (CS) protein of malaria parasite Plasmodium falciparum, which has been suggested as a potential delivery moiety into human hepatocytes (Shakibaei et al., J. Exp. Med., 1996; 184(5): 1699-1711).
  • CS circumsporozoite
  • said transport means may comprise a packaging means such as a cationic and/or amphiphilic liposome, as described in Huang et al., Non-viral vectors for gene therapy.1999, Academic Press; or a nanoparticle, as described in Tobio et al., Pharm. Res., 1998; 15: 2 270-275, which is arranged to package or protect the bacteriophage for the purposes of transportation across a biological membrane into a cell or cellular compartment.
  • a packaging means such as a cationic and/or amphiphilic liposome, as described in Huang et al., Non-viral vectors for gene therapy.1999, Academic Press; or a nanoparticle, as described in Tobio et al., Pharm. Res., 1998; 15: 2 270-275, which is arranged to package or protect the bacteriophage for the purposes of transportation across a biological membrane into a cell or cellular compartment.
  • the molecular weight of said bacteriophage may be less than the permeability cut-off point for the endosomal pore, that is less than about 40-60kDa, so as to allow ready permeability into a variety of cells and cellular compartments which may accommodate said pathogen, such as early endosomes.
  • said bacteriophage may be a mycobacteriophage such as mycobacteriophage D34, DS-6A, R51, BG1 or D29.
  • a deposit of mycobacteriophage R51, satisfying the requirements of the Budapest Treaty, has been made by the applicant at the NCTMB, 23 St Machar Drive, Aberdeen AB24 3RY, Scotland, UK on 31 October 2001 under deposit number 41119.
  • a deposit of mycobacteriophage BG1, satisfying the requirements of the Budapest Treaty, has been made by the applicant at the NCLMB, 23 St Machar Drive, Aberdeen AB24 3RY, Scotland, UK on 30 November 2001 under deposit number 41124.
  • Said bacteriophage may be selected at the panel of variants of a microbial pathogen such as M.
  • tuberculosis strain H37R mycobacterium Bovis (var BCG), and multi-drug-resistant variants of a target pathogen, such as M. tuberculosis strains W and H.
  • Anti -bacterial bacteriophage of various types are well-known and are available in the art, some examples being described and characterised in US-A-5688501 and US-A-6121036.
  • WO-A-00/61190 describes the provision of bacteriophage, including mycobacteriophage D34, which are modified so as to be capable of entering into bacterially-infected eukaryotic cells and lysing bacteria within those cells.
  • said bacteriophage may be genetically modified to express said transport agent on the phage surface.
  • said bacteriophage may be transformed with a polynucleotide encoding said transport agent, such that the polynucleotide is inserted into the genome of the bacteriophage and is arranged to be co-expressed with a phage protein such as a surface or coat protein such as a head or tail protein, such that the transport agent is exposed for interaction with the membrane of a cell or cellular compartment.
  • said bacteriophage may be adapted to bind or adsorb said transport agent on the surface thereof.
  • said transport agent may comprise a polypeptide which is adapted to enable transport of said bacteriophage into a cell or cellular compartment, which polypeptide comprises a domain that is arranged to bind a protein expressed on the surface of said bacteriophage.
  • Said domain may for example comprise the binding portion of an antibody with affinity for a bacteriophage surface epitope. Accordingly, when said polypeptide is introduced to said bacteriophage, said domain will bind to the surface of the bacteriophage such that the polypeptide is arranged to enable transport of said bacteriophage into a cell or cellular compartment.
  • said transport agent may be adapted to bind electrostatically to the surface of said bacteriophage.
  • said transport agent may comprise a cationic transport agent, such as a polyarginine peptide, which cationic transport agent is capable of binding electrostatically to a bacteriophage having a negative surface charge.
  • a cationic transport agent such as a polyarginine peptide
  • Mycobacteriophage such as mycobacteriophage R51 and D29 have been found to possess a pi (isoelectric point) which is below neutral, so that at neutral pH, as well as at physiological pH which is slightly above neutral, said mycobacteriophage have a negative surface charge and are capable of binding cationic delivery peptides electrostatically.
  • said transport agent may be covalently bound to said bacteriophage.
  • Said transport agent may be bound to the bacteriophage by way of a linker group, such as a short peptide or disulphide or other covalent linker bridge.
  • a bacteriophage preparation comprising a bacteriophage which is adapted to express a transport agent for mediating transport of said bacteriophage into a eukaryotic cell or cellular compartment, which bacteriophage is lytic to at least one strain of pathogenic bacteria and is adapted on multiplication within said pathogenic bacteria to express an annihilation moiety that is adapted for causing or stimulating the death or inactivation of said cell or cellular compartment.
  • each of said transport agent and said annihilation moiety may be as defined above.
  • said annihilation moiety may be encoded by an annihilation moiety encoding sequence in the genome of said bacteriophage, which annihilation moiety encoding sequence is arranged to be expressed independently from sequences within the genome of said bacteriophage which encode structural bacteriophage proteins. Accordingly, following expression of said annihilation moiety encoding sequence within a bacterium of said strain, said annihilation moiety will remain within the bacterial cytoplasm, and will be released on lysis of said bacterium.
  • said transport agent may be encoded by a transport agent encoding sequence in the genome of said bacteriophage, which transport agent encoding sequence is linked to one or more sequences within said genome which encode structural bacteriophage proteins, such that said transport agent is arranged to be co-expressed with said structural proteins.
  • said transport agent may be arranged to be expressed on the surface of the bacteriophage capsid, and conveniently adapted for interaction with the membrane of said cell or cellular compartment.
  • said eukaryotic cell may, for example, be a macrophage, monocyte, hepatocyte or erythrocyte cell. Such cells are susceptible to pathogenic infection.
  • Said pharmaceutical composition of the present invention may be suitable for use in the treatment or prevention of diseases including tuberculosis, ADDS and malaria.
  • Said pharmaceutical composition may be suitable for administration to a patient in need thereof by way of oral, sublingual, transdermal or parenteral administration.
  • said pharmaceutical composition may be suitable for administration by intranasal spray, or by injection into peripheral blood vessels.
  • oral or parenteral administration it is greatly preferred that the pharmaceutical composition is administered in the form of a unit-dose composition, such as a unit dose oral or parenteral composition.
  • compositions are prepared by admixture and are suitably adapted for oral or parenteral administration, and as such may be in the form of tablets, capsules, oral preparations, powders, granules, lozenges, reconstitutable powders, injectable and liquid infusible solutions or suspensions or suppositories.
  • Tablets and capsules for oral administration are usually presented in a unit dose, and contain conventional excipients such as binding agents, fillers, diluents, tabletting agents, lubricants, disintegrants, colourants, flavourings, and wetting agents.
  • the tablets may be coated according to well known methods in the art.
  • Said composition may optionally include one or more additives, such as fillers, disintegrants, lubricants, wetting agents, and/or preservatives.
  • Suitable fillers for use include cellulose, mannitol, lactose, trehalose and other similar agents.
  • Suitable disintegrants include starch, polyvinylpyrrolidone and starch derivatives such as sodium starch glycolate.
  • Suitable lubricants include, for example, magnesium stearate.
  • Suitable pharmaceutically acceptable wetting agents include sodium lauryl sulphate.
  • Suitable pharmaceutically acceptable preservatives include propyl p-hydroxybenzoate and sorbic acid.
  • solid oral compositions may be prepared by conventional methods of blending, filling or tabletting. Repeated blending operations may be used to distribute the active agent throughout those compositions employing large quantities of fillers. Such operations are, of course, conventional in the art.
  • Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups, or elixirs, or may be presented as a dry product for reconstitution with water or other suitable vehicle before use.
  • Such liquid preparations may contain conventional additives such as suspending agents, for example sorbitol, syrup, methyl cellulose, gelatin, hydroxyethylcellulose, carboxymethyl cellulose, aluminium stearate gel or hydrogenated edible fats, emulsifying agents, for example lecithin, sorbitan monooleate, or acacia; non-aqueous vehicles (which may include edible oils), for example, almond oil, fractionated coconut oil, oily esters such as esters of glycerine, propylene glycol, or ethyl alcohol; preservatives, for example methyl or propyl p-hydroxybenzoate or sorbic acid, and if desired conventional flavouring or colouring agents.
  • Oral formulations also include conventional sustained release formulations, such as tablets or granules having an enteric coating.
  • fluid unit dose forms may be prepared comprising a sterile vehicle.
  • the components of the composition can be either suspended or dissolved.
  • Parenteral solutions are normally prepared by dissolving the components of the composition in a vehicle and filter sterilising before filling into a suitable vial or ampoule and sealing.
  • adjuvants such as a local anaesthetic, preservatives and buffering agents are also dissolved in the vehicle.
  • the composition may be frozen after filling into the vial and the water removed under vacuum.
  • Parenteral suspensions are prepared in substantially the same manner except that the compound may be suspended in the vehicle instead of being dissolved and sterilised by exposure to ethylene oxide before suspending in the sterile vehicle.
  • a surfactant or wetting agent may be included in the composition to facilitate uniform distribution of the compound of the invention.
  • compositions will usually be accompanied by written or printed directions for use in the treatment concerned.
  • a method for the treatment or prophylaxis of a disease or condition which is caused, mediated or exacerbated by intracellular pathogenic infection comprising the administration to a patient in need thereof of an effective amount of a pharmaceutical composition in accordance with the invention.
  • Said effective amount of the pharmaceutical composition will depend on factors such as the nature and severity of the disorder being treated and on the weight, age and condition of the patient.
  • the library of lytic mycobacteriophages has been accumulated from different sources. They have been propagated with the use of M.smegmatis mc 155 and periodically titrated on soft agar lawns by the method known to the specialist in the art (Parish T, Stoker N. Methods in Molecular Biology Vol. 101.). For titration on agar plates containing M.tuberculosis or MDR M.tuberculosis phages were accumulated in liquid suspension of
  • Phage R51 showed the highest activity against susceptible strain H37Rv of M. tuberculosis as well as MDR strains W and H (and was also actively lytic against M.bovis BCG) has been selected for further modifications.
  • the following procedure outlines a scheme for genetically modifying mycobacteriophage and screening for modifications which both a) do not compromise phage viability, and b) modify the phage such that the recombinant epitope(s) are exposed at the surface of the phage structure.
  • the genetic modification is achieved as outlined in Figure 5.
  • a phage label is randomly cloned into the phage genome, and a library is generated in which the label is inserted at every possible position throughout the phage genome.
  • the label encodes a detection epitope (S protein in the example given) which enables immunodetection of modified phage.
  • the library can be generated in a phasmid form of the phage genome so that it can be propagated in Escherichia coli for amplification (prior to transformation of Mycobacte ⁇ um host) or storage purposes.
  • the library contains all possible combinations of phage genome containing the insert.
  • a selection procedure is required in order to identify viable modified phage and further, to identify phage displaying the required phenotype.
  • the first step in this process is the transformation of Mycobacte ⁇ um smegmatis with the phage library. This can be achieved by electroporation and plaques only arise from viable recombinant phage (and non-modified wild type phage).
  • the next step, to identify recombinant phage expressing the modifying epitope at the phage surface can be done in one of two ways: a) phage is transferred to nitrocellulose membrane by the familiar plaque lift technique, and this membrane screened for the presence of the S protein label by immunodetection. b) directly select for the required phenotype: phage could be applied directly to mammalian cells. After sufficient time for internalisation, non-internalised phage are inactivated and/or washed off and internalised phage, containing the required internalisation peptide displayed at its surface, is recovered.
  • the isolated phage are then recovered, propagated and analysed by sequencing, Southern blotting or restriction mapping, to identify the viable sites for surface modification.
  • This tag is used to identify phage genome sites which enable in-frame insertion of peptides with little or no discernible disruption to phage function and viability. These sites are also selected to ensure surface exposure and full functioning of the inserted peptide.
  • the phage label has complementary sites to facilitate the insertion of caspase, as described in further examples. Sites have been added in such a way as to keep the gene in-frame with both upstream and downstream fusions. For the N ⁇ tl and Ascl sites this means adding an additional base. These additions have been made to minimise the charge differences and/or disruptions in flexibility or hydrophobicity (eg. AAA in Notl site -small aa; RRA in Ascl site is in keeping with the charge profile of Tat 2).
  • the label contains no stop codons to facilitate fusion at both 5' and 3' ends.
  • Tatl and Tat2 peptides are indicated merely as example and other highly efficient peptides that have been identified by Regma Bio Technologies Ltd. e.g. peptide VI (see description 6), can be used in addition or instead.
  • Caspase 35 ' ATGGAGAACACTGAAAACTC (SEQ ID NO : 4) Caspase 33' GTGATAAAAATAGAGTTCTTTTG (SEQ ID NO : 5)
  • Caspase 73' TTGACTGAAGTAGAGTTCC (SEQ ID NO : 7) These can be used to amplify the caspase genes prior to the modification step below or in tandem with the NOSITE primers detailed below in a one-step RT-PCR/modification reaction.
  • Caspase 3 NOSITE 5 ' (SEQ ID NO : 9) GGTTCCGGTATCTTCCTGGAAACCTCCCTGGGTGTTGATGATGACATGGCG
  • primers when used as outlined in Figure 4, generate recombinant caspase without the native cleavage site and contain complementary sequences in bold which encode an effectively cleaved protease site; the HIVl cleavage site (GSGIFLETSL) is given only as an example.
  • each PCR reaction the above pair of primers are included in the PCR reaction with the caspase 5' and 3' primers detailed in 4a above.
  • the PCR is performed with a ten fold lower than standard concentration of the NOSITE primers. Annealing of the common sequences (i.e. the new protease site encoding sequence) eliminates and replaces the native cleavage sites and the differential concentration of primers ensures that as the reaction progresses amplification of full length caspase with the modified cleavage site is achieved, as illustrated in Figure 4.
  • Caspase 35' GAGCTCATGGAGAACACTGAAAACTC (SEQ ID NO : 12)
  • Caspase 33' GAGCTCGTGATAAAAATAGAGTTCTTTTG (SEQ ID NO : 13)
  • the restriction sites in bold enable the genes to be cloned on a Sad fragment at the 5' end of the delivery/detection moiety.
  • sequence of the above primers could be changed to enable cloning into either the N ⁇ tl or Ascl sites which are also present in the delivery/detection moiety sequence.
  • the recombinant caspase sequence generated as described above is fused to the 5' end of the delivery moiety sequence (below) to create recombinant phage (PARPh). This fusion is carried out on a strain of phage previously labelled with a tag containing the delivery moiety detailed below.
  • V2 ALGISYGRKKRRQRRRPC - AlexaFluor(18 aa) SEQ ID NO : 31
  • V3 GKRKKEMTKQMKRVAKRKLC- AlexaFluor (20 aa) SEQ ID NO : 32 V11-V12:
  • V12 DKHTTQYYSLDAQITGNRFNGTATC-AlexaFluor(2aa) SEQ ID NO : 35
  • Peptides Da-Df have been derived to test the role of small arginine-containing peptides and their oligomer forms on macrophage intemalization.
  • Peptide V12 is HTV-1 Tat peptide that have been intensively studied as a potential vehicle for intemalization of proteins (US Patent 5804604; Fawell et al. (1997), PNAS 91: 661-668) and viruses including phages ( Eguchi et al. (2001), J. Biol. Chem. 276 (28): 26204-26210).
  • Peptides VI 1 and V12 are loop forming domains from Neisseria meningitidis Tbp2 protein which were found capable to enhance phage intemalization (Renaud-Mongenie G et al., 1997 J Bacteriol. 179(20): 6400-6407; Legrain M et al., 1993 Gene 130: 73-80).
  • Peptide V13 is a conjugate between V3 and VI 1.
  • Example of peptide intemalization e.g. a comparison of dose-dependent intemalization of peptide VI 1 to V12 (HIV-1 Tat peptide is presented on Fig.3).
  • a polyarginine peptide may alternatively be used as a delivery moiety.
  • Apoptotic polypeptides including human caspase, and those from different sources e.g. cytochrome C, HIV-1 Vpr and apoptin, can be co-expressed with other phage polypeptides either in fusion or independently as described in earlier example, but without the need for modification to include protease cleavage sites.
  • a bacteriophage preparation in accordance with the invention may comprise a recombinant delivery moiety aspase fusion, expressed as a further fusion with a surface exposed phage protein.
  • An alternative strategy for caspase expression is to clone the caspase gene into the phage as an independently expressing cassette, such that the caspase gene is only expressed when exposed to the transciption/translation machinery of a host mycobacterium.
  • a mycobacteriophage phasmid a phage into whose genome has been cloned an E.coli plasmid to create a so-called phasmid.
  • a caspase promoter fusion can be cloned either in place of the cloned plasmid, or within it.
  • the promoter is one that is suitable for specific expression in mycobacterium and has a downstream mycobacterium ribosome binding site.
  • Any suitable promoter can be used for expression of caspase in the phage construct.
  • Mycobacterium spp. or mycobacteriophage promoters such as rrnA PI and PCL1 promoters or hsp ⁇ O promoter of Mycobacterium tuberculosis; P ⁇ e f t promoter from phage L5; or indeed any synthetic or natural promoter sequence containing the consensus TTGACA -35 and
  • TATAAT -10 elements can be cloned upstream of the gene. Provision of a suitable ribosome binding site is also required (eg. GGAGG at postion -12 to -8 relative to the start ATG codon). This element is cloned with the promoter sequence of naturally occurring promoters, or generated during the construction of an artificial mycobacterium promoter element.
  • a promoter element which can be regulated during phage accumulation. This may be achieved, for example, by cloning an iron- repressible promoter (eg. bfrA and mbtA promoters, regulating synthesis of M.tuberculosis siderophore and bacterioferritin respectively) upstream of caspase.
  • an iron- repressible promoter eg. bfrA and mbtA promoters, regulating synthesis of M.tuberculosis siderophore and bacterioferritin respectively
  • a repressor protein binding site e.g. IdeR site TWAGGTWAG (G/C) CTWACCTWA
  • the expression of caspase would be iron respressible. Inclusion of iron in the growth medium of M.smegmatis would minimise caspase production during phage accumulation, but the iron limitation experienced in vivo by an infecting mycobacterium would activate caspase expression upon infection
  • the following sequence details a synthetic promoter sequence for controlling caspase expression in Mycobacterium tuberculosis.
  • the key elements are highlighted.
  • the spacer sequence between the transciption site and the rbs is derived from the M.tuberculosis eis gene and represents just one example of such a spacer element.
  • the Ndel site at the start codon enables fusion with the Ndel site engineered into the caspase gene construct detailed in 5b, above.
  • the caspase: -.promoter fusion for in vivo transcription/translation may be achieved by cloning caspase into existing mycobacterium expression vectors (eg. pAL5000, ref. O'Gaora (1998) Methods Mol. Biol. 101: 261-273) and then transferring the 'expression cassette', comprising promoter, ribosome binding site and caspase gene en bloc into, or in place of, the phage genome plasmid.
  • mycobacterium expression vectors eg. pAL5000, ref. O'Gaora (1998) Methods Mol. Biol. 101: 261-273
  • a construct containing the gene with a suitably placed ribosome binding site can be cloned directly into the mycobacteriophage genome if the identified cloning site is downstream from an existing phage promoter element, such that expression from the natural phage promoter drives expression of the recombinant gene upon infection of the mycobacterium host.
  • Example 2 The following sequence is that of an expression cassette that can be inserted into the unique Xbal site of mycobacteriophage D29 to express a recombinant caspase 3 (as an example) with its natural cleavage site replaced with that of an HIV-1 protease site. Expression of this recombinant protein is driven by the M.bovis BCG hsp60 promoter upon infection of mycobacterium. The E.coli rrnB tl terminator is cloned at the 3' end of the cassette. Construction of the cassette is described after the sequence.
  • AATCCATTAA AAATTTGGAA CCAAAGATCA TACATGGAAG CGAATCAATG GACTCTGGAA 501 TATCCCTGGA CAACAGTTAT AAAATGGATT ATCCTGAGAT
  • Hsp60 promoter primers 1 - 409
  • HIV-1 protease encoding site 923 - 953 (coding sequence underlined)
  • primers when used as outlined below, generate recombinant caspase without the native cleavage site and contain complementary sequences in bold which encode an effectively cleaved HIV protease site (GSGIFLETSL).
  • GSGIFLETSL effectively cleaved HIV protease site
  • the new protease site encoding sequence eliminates and replaces the native cleavage sites and the differential concentration of primers ensures that as the reaction progresses amplification of full length caspase with the modified cleavage site is achieved, as illustrated in Figure 4 below.
  • Invitrogen TOPO-TATM cloning kit into vector pCR2.1 TOPO E.coli strain JM109 (New England Biolabs) or TOP10 (Invitrogen) are used to propagate plasmid constructs. Strain BL21(DE3) or HMS174(DE3) are used for E.coli expression using pET vectors.
  • Figure 1 show results of screening mycobacteriophages on plates with M.tuberculosis H37Rv and Mycobacterium bovis BCG
  • Cells were grown on Middlebrook 7H10 plates containing 0.05% Tween and several loopfuls of bacteria were transferred into 5ml of Middlebrook 7H9 broth to grow for 2 weeks at 37°C.
  • the cell suspension was centrifuged at 5000 rpm to pellet cells and the pellet was resuspended in 500 ⁇ l of 7H10 medium without Tween which were mixed with 4 ml of soft agar and plated.
  • Phage samples were prepared by harvesting from Lemco plates containing Mycobacterium smegmatis mc 2 155 lysed to confluence by each phage. Phage were harvested in phage buffer (lOmM Tris, pH 7.5, lOmM MgSO 4 , 70mM NaCl, ImM CaCl 2 ) at 4oC overnight and purified by filtration through a 0.22 ⁇ m filter. Samples are stored at refrigerator temperature (4-8°C).
  • FIG 2 shows the results of screening mycobacteriophages on plates with M.tuberculosis strain W and H (MDR variants)
  • M.tuberculosis strain W is MDR variant that caused a major TB outbreak in New York City and was responsible for approximately 14% of the cases occurring nationally through 1993 (Bifani PJ et al. 1996 JAMA 275: 452-457).
  • M.tuberculosis strain H is a multidrug resistant strain endemic to North America. Bacteria cells and phages were prepared as described in a footnote to Fig. 1.
  • peptide-conjugates tagged with AlexaFluor 488, have been examined for uptake into human monocyte U937 and THPl cells and primary bone marrow mouse macrophages prepared from FI CBA:C57BIJ6 mice. Uptake was measured by quantitative digital microscopy. Peptide uptake was concentration dependent and for a 24-hour uptake period all peptide conjugates demonstrated uptake in at least 40% cells (with the range 40%-77%).
  • Peptide conjugate VI has appeared most potent in murine macrophages and in U937 and THPl monocytes.
  • Cytotoxicity test with MMT assay has revealed that peptides are not toxic to cells at 10 ⁇ M over 24h period. The general trend of uptake was similar with each type of monocyte cells.
  • Figure 4 illustrates PCR mediated replacement of the caspase cleavage site.
  • 'A' primers are caspase 3/7 5' and 3' oligos
  • 'B' primers are 'NOSITE' complementary primers constituting novel protease site as 'tags' annealing to caspase sequence either side of the native protease site (grey).
  • Step 1 is early rounds of amplification; step 2 is subsequent exponential amplification.
  • Figure 5 illustrates the phage modification and screening strategy.
  • step 1 is concatamerisation of phage DNA
  • step 2 is treatment with DNAse to generate random genome size fragments
  • step 3 is cloning in of a functional peptide (internalisation element and marker) and reconcatamerisation
  • step 4 is recovery of intact genomes containing modifying insert by unique genome restriction site cut
  • step 5 is transformation of E. coli (if phasmid is employed) or M. smegmatis for library amplification and storage.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne une préparation bactériophage comprenant un bactériophage qui est conçu pour pénétrer dans une cellule eucaryote et/ou un compartiment cellulaire eucaryote, ledit bactériophage ayant une action lytique sur au moins une souche de la bactérie pathogène qui est susceptible d'infecter ladite cellule ou ledit compartiment cellulaire, ledit bactériophage fusionnant à, ou étant lié à, ou étant conçu pour exprimer un fragment d'annihilation qui est capable de provoquer ou de stimuler la mort ou l'inactivation de ladite cellule en la présence d'au moins un agent pathogène spécifique, de sorte que ladite préparation bactériophage est capable de provoquer ou de stimuler la mort ou l'inactivation de cellules qui sont infectées par ledit agent pathogène. L'invention a également pour objet une composition pharmaceutique comprenant une préparation bactériophage de ce type, formulée pour être administrée à un patient qui en a besoin, un procédé permettant de produire la mort ou l'inactivation d'une cellule infectée par un agent pathogène par administration au patient d'une préparation bactériophage de ce type, et l'utilisation d'une préparation bactériophage de ce type pour produire une composition pharmaceutique, éventuellement utilisée dans le cadre du traitement et/ou de la prévention d'une maladie qui est médiée ou caractérisée par l'infection intracellulaire par un agent pathogène, comprenant en particulier la tuberculose, le SIDA, l'infection par le VIH, et la malaria.
PCT/GB2002/002879 2001-06-22 2002-06-21 Nouvelle preparation WO2003000274A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002314331A AU2002314331A1 (en) 2001-06-22 2002-06-21 Bacteriophage preparation for the treatment of intracellular bacterial infection

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB0115385.7A GB0115385D0 (en) 2001-06-22 2001-06-22 Novel preparation
GB0115385.7 2001-06-22

Publications (2)

Publication Number Publication Date
WO2003000274A2 true WO2003000274A2 (fr) 2003-01-03
WO2003000274A3 WO2003000274A3 (fr) 2004-03-18

Family

ID=9917220

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2002/002879 WO2003000274A2 (fr) 2001-06-22 2002-06-21 Nouvelle preparation

Country Status (3)

Country Link
AU (1) AU2002314331A1 (fr)
GB (1) GB0115385D0 (fr)
WO (1) WO2003000274A2 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7491387B2 (en) 2003-09-05 2009-02-17 The University Of Nottingham Disinfection of foodstuffs
WO2009046138A1 (fr) * 2007-10-01 2009-04-09 Omnilytics, Inc. Procédés de séchage de bactériophages et compositions contenant des bactériophages, compositions sèches résultantes et procédés d'utilisation
WO2014049008A1 (fr) * 2012-09-25 2014-04-03 Fixed Phage Limited Traitement d'une infection bactérienne intracellulaire
WO2014195871A1 (fr) * 2013-06-03 2014-12-11 Warszawski Uniwersytet Medyczny Utilisation de bactériophages
WO2018170118A1 (fr) * 2017-03-14 2018-09-20 Brigham Young University Méthodes et compositions pour traiter l'obésité, l'inflammation ou des troubles métaboliques avec des bactériophages
US11986502B2 (en) 2018-05-23 2024-05-21 Optium, LLC Bacteriophage compositions and kits and related methods

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108126190B (zh) * 2017-11-02 2021-01-26 重庆医科大学附属第一医院 分枝杆菌噬菌体裂解酶Lysin-Guo1的制备与应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998005344A1 (fr) * 1996-08-05 1998-02-12 Brigham And Women's Hospital, Inc. Therapie genique a mediation par bacteriophages
WO1999010485A1 (fr) * 1997-08-29 1999-03-04 Selective Genetics, Inc. Procedes utilisant une presentation de phage pour selectionner des ligands internalisants en vue d'une administration de gene
WO2000061190A2 (fr) * 1999-04-09 2000-10-19 Microbiological Research Authority Traitement d'infections intracellulaires
WO2001015511A2 (fr) * 1999-09-01 2001-03-08 University Of Pittsburgh Of The Commonwealth System Of Higher Education Identification de peptides facilitant l'absorption et le transport cytoplasmique et/ou nucleaire de proteines, d'adn et de virus

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998005344A1 (fr) * 1996-08-05 1998-02-12 Brigham And Women's Hospital, Inc. Therapie genique a mediation par bacteriophages
WO1999010485A1 (fr) * 1997-08-29 1999-03-04 Selective Genetics, Inc. Procedes utilisant une presentation de phage pour selectionner des ligands internalisants en vue d'une administration de gene
WO2000061190A2 (fr) * 1999-04-09 2000-10-19 Microbiological Research Authority Traitement d'infections intracellulaires
WO2001015511A2 (fr) * 1999-09-01 2001-03-08 University Of Pittsburgh Of The Commonwealth System Of Higher Education Identification de peptides facilitant l'absorption et le transport cytoplasmique et/ou nucleaire de proteines, d'adn et de virus

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
H.M. ELLERBY ET AL.: "Anti-cancer activity of targeted pro-apoptotic peptides" NATURE MEDICINE, vol. 5, no. 9, 1999, pages 1032-1038, XP002186751 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7491387B2 (en) 2003-09-05 2009-02-17 The University Of Nottingham Disinfection of foodstuffs
WO2009046138A1 (fr) * 2007-10-01 2009-04-09 Omnilytics, Inc. Procédés de séchage de bactériophages et compositions contenant des bactériophages, compositions sèches résultantes et procédés d'utilisation
US8501453B2 (en) 2007-10-01 2013-08-06 Omnilytics, Incorporated Methods for drying bacteriophage and bacteriophage-containing compositions, the resulting dry compositions, and methods of use
WO2014049008A1 (fr) * 2012-09-25 2014-04-03 Fixed Phage Limited Traitement d'une infection bactérienne intracellulaire
GB2519913A (en) * 2012-09-25 2015-05-06 Fixed Phage Ltd Treatment of intracellular bacterial infection
US9278141B2 (en) 2012-09-25 2016-03-08 Fixed Phage Limited Treatment of intracellular bacterial infection
WO2014195871A1 (fr) * 2013-06-03 2014-12-11 Warszawski Uniwersytet Medyczny Utilisation de bactériophages
US9850467B2 (en) 2013-06-03 2017-12-26 Warszawski Uniwersytet Medyczny Methods of using T4 bacteriophage in treatment of adenoviral infections caused by HAdV-5
WO2018170118A1 (fr) * 2017-03-14 2018-09-20 Brigham Young University Méthodes et compositions pour traiter l'obésité, l'inflammation ou des troubles métaboliques avec des bactériophages
US11986502B2 (en) 2018-05-23 2024-05-21 Optium, LLC Bacteriophage compositions and kits and related methods

Also Published As

Publication number Publication date
AU2002314331A1 (en) 2003-01-08
WO2003000274A3 (fr) 2004-03-18
GB0115385D0 (en) 2001-08-15

Similar Documents

Publication Publication Date Title
Popescu et al. Bacteriophages and the immune system
EP3132034B1 (fr) Thérapeutiques
JP5603070B2 (ja) 改変バクテリオシン及びその使用方法
JP2013545460A (ja) 組換えｐ４バクテリオファージおよびその使用方法
PL182573B1 (pl) Sposób ekspresji białka porynowego meningokokowego grupy B błony zewnętrznej lub jego białka fuzyjnego w E.coli, szczepionka przeciw Neisseria meningitidis, szczep E.coli oraz komórka gospodarza szczepu BL21(DE3) ompA E.coli
CA2872694C (fr) Bacteriophage pour la lutte biologique contre salmonella et dans la fabrication ou le traitement d'aliments
JP7141756B2 (ja) 異なる尾繊維を有する複数宿主域のバクテリオファージ
JP2022058377A (ja) 異なる尾繊維を有する複数宿主域のバクテリオファージ
ES2768773T3 (es) Modificación de bacteriófagos
WO2003000274A2 (fr) Nouvelle preparation
Taschner et al. Selection of peptide entry motifs by bacterial surface display
US20110021414A1 (en) Chimeric Phage Tail Proteins and Uses Thereof
US6509151B1 (en) DNA molecule encoding for cellular uptake of Mycobacterium tuberculosis and uses thereof
US6224881B1 (en) DNA molecule fragments encoding for cellular uptake of Mycobacterium tuberculosis and uses thereof
US7252993B2 (en) Plasmids encoding therapeutic agents
Ojobor The Noncontractile Phage Tail-Like Bacterial Killing Nanomachines–Characterizing the Specificity Determinants of the F-Pyocins of Pseudomonas aeruginosa
US20230416694A1 (en) Modified bacteriophage
CA2284514A1 (fr) Molecule d'adn codant l'absorption cellulaire de mycobacterium tuberculosis et utilisation de cette derniere
Spilman Molecular piracy in the mobilization of Staphylococcus aureus pathogenicity island 1
US6995255B1 (en) Cellular delivery agent
McPartland The tail sheath of bacteriophage N4 is required for adsorption to the host

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 69(1) EPC, FORM 1205A, DATE OF NOTIFICATION 28.10.2004.

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP