WO2002097051A2 - Protein arrays and methods and systems for producing the same - Google Patents
Protein arrays and methods and systems for producing the same Download PDFInfo
- Publication number
- WO2002097051A2 WO2002097051A2 PCT/US2002/017005 US0217005W WO02097051A2 WO 2002097051 A2 WO2002097051 A2 WO 2002097051A2 US 0217005 W US0217005 W US 0217005W WO 02097051 A2 WO02097051 A2 WO 02097051A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- target organism
- antigen
- polypeptides
- immune response
- eliciting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1086—Preparation or screening of expression libraries, e.g. reporter assays
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B30/00—Methods of screening libraries
- C40B30/04—Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
- G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/23—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a GST-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
- C07K2319/42—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a HA(hemagglutinin)-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
- C07K2319/43—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a FLAG-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
Definitions
- the U.S. Government has a non exclusive, irrevocable, paid up license to practice the invention or to have the invention practiced throughout the world by or on behalf of the Government as provided under the terms of CRADA NCRADA-NMR-01-1037 through the Naval Medical Research Center.
- Field of the Invention The present invention relates to methods of rapidly generating and analyzing a plurality of polypeptides. More specifically, polypeptides can be assayed to determine their individual immunogenic effect. Monitoring the immunogenic effect of polypeptides allows skilled artisans to develop specific subunit vaccines. Description of the Related Art Traditional vaccine technology suffers from the problem that it often produces various degrees of reactogenicity in different hosts.
- subunit vaccines capable of inducing an appropriate immune response in the context of multiple, and genetically diverse hosts.
- This approach requires the identification of a number of specific antigenic polypeptides.
- One of the most difficult tasks in developing a vaccine, or any recombinant subunit vaccine is the identification of the antigens that can stimulate the most effective immune response against a particular pathogen, especially when the genome of the pathogen is large.
- Vaccinia virus as a Smallpox vaccine has, throughout the Smallpox eradication campaign until the cessation of vaccination in the civilian population in the 1980s, been manufactured using 25 year-old technology.
- This technology comprises the harvesting of virus-containing material from live vaccinifers.
- various degrees of reactogenicity have been reported in vaccine recipients.
- mass vaccination might be an important aim yet immunosuppressive diseases are perhaps more prevalent than ever, a vaccine without the infective properties of a live virus is more critical than ever
- An understanding of the full spectrum of a pathogen's immunostimulatory polypeptides would be a key starting point to developing more effective vaccines.
- Embodiments of the invention relate to methods of generating a library of target organism polypeptides.
- the methods can include the steps of. (a) performing a first PCR reaction using a first p ⁇ mer pair capable of amplifying a desired polynucleotide sequence from the target organism to provide an amplified coding sequence, which amplified coding sequence is not transcriptionally active; (b) providing a second PCR nucleotide primer pair capable of adding at least one nucleotide sequence that confers transcriptional activity to the amplified coding sequence, (c) performing a second PCR reaction with the second primer pair and the amplified coding sequence, thereby resulting in amplification of a transcriptionally active coding sequence; (d) expressing the polypeptide of the franscnptionally active coding sequence; and (e) repeating steps (a)-(d) at least 10 times, with different first p ⁇ mer pairs to express different polypeptides of said target organism.
- steps (a)-(d) can be repeated at least, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 266, about 300, about 350, about 400, about 450, about 500, about 550, about 600, about 650, about 700, about 750, about 800, about 850, about 900, about 950, about 1000, about 1050, about 1100, about 1150, about 1200, about 1250, about 1300, about 1350, about 1400, about 1450, about 1500, about 1600 about 1700, about 1800, about 1900, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10,000, about 1
- the methods of generating a library of target organism polypeptides can further include adding at least one polynucleotide sequence operably encoding a linker molecule to the amplified coding sequence or the franscnptionally active coding sequence, wherein the linker molecule immobilizes the polypeptide to a solid support
- expressing the franscnptionally active coding sequence and the polynucleotide sequence operably encoding a linker molecule produces a target organism polypeptide attached to a linker molecule.
- the linker molecule can be an epitope, for example, a HA epitope.
- linker molecules include, for example, a 6x, 7x, 8x, 9x, or lOx histidine tag, GST tag, fluorescent protein tag, Flag tag, and the like.
- the at least one sequence that confers transcriptional activity is a promoter sequence, a terminator sequence and the like.
- an automated system can be used to design the first primer pair, perform the first PCR reaction, perform the second PCR reaction, express the transcriptionally active coding sequence, and the like.
- Still further embodiments of the invention relate to methods of screening a library of target organism polypeptides in order to identify a target organism antigen that is capable of eliciting a humoral immune response.
- the methods can include providing a library of target organism polypeptides attached to a linker molecule; immobilizing at least about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 266, about 300, about 350, about 400, about 450, about 500, about 550, about 600, about 650, about 700, about 750, about 800, about 850, about 900, about 950, about 1000, about 1050, about 1100, about 1150, about 1200, about 1250, about 1300, about 1350, about 1400, about 1450, about 1500,
- Additional embodiments relate to methods of screening a library of target organism polypeptides in order to identify a target organism antigen that is capable of eliciting a cell- mediated immune response.
- the methods can include, for example, providing a library of target organism polypeptides; delivering at least about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 266, about 300, about 350, about 400, about 450, about 500, about 550, about 600, about 650, about 700, about 750, about 800, about 850, about 900, about 950, about 1000, about 1050, about 1100, about 1150, about 1200, about 1250, about 1300, about 1350, about 1400, about 1450, about 1500, about 1600 about 1700, about
- inventions relate to methods of developing a subunit vaccine against a target organism.
- the methods can include providing a target organism antigen that is capable of eliciting a humoral immune response; administering the antigen to a subject alone or in combination with at least one other target organism antigen that is capable of eliciting an immune response to a subject; and monitoring the generation of an immune response to the antigen or combination of the antigens in the subject.
- subunit vaccines against a target organism can also be developed by providing a target organism antigen that is capable of eliciting a cell-mediated immune response.
- Methods can include administering the antigen to a subject alone or in combination with at least one other target organism antigen that is capable of eliciting an immune response to a subject; and monitoring the generation of an immune response to the antigen or combination of the antigens in the subject.
- Still further embodiments relate to methods of developing a subunit vaccine against a target organism.
- the methods can include providing a nucleic acid sequence operably encoding a target organism antigen that has been identified as capable of eliciting a humoral immune response; introducing the nucleic acid sequence alone or in combination with at least one other nucleic acid that is capable of expressing a target organism antigen to a subject; and monitoring the generation of an immune response to the nucleic acid or combination of nucleic acids in the subject.
- Further methods of developing a subunit vaccine against a target organism can include providing a nucleic acid sequence operably encoding a target organism antigen that has been identified as capable of eliciting a cell-mediated immune response; introducing the nucleic acid sequence alone or in combination with at least one other nucleic acid that is capable of expressing a target organism antigen to a subject; and monitoring the generation of an immune response to the nucleic acid or combination of nucleic acids in the subject.
- inventions relate to arrays of at least about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 266, about 300, about 350, about 400, about 450, about 500, about 550, about 600, about 650, about 700, about 750, about 800, about 850, about 900, about 950, about 1000, about 1050, about 1100, about 1150, about 1200, about 1250, about 1300, about 1350, about 1400, about 1450, about 1500, about 1600 about 1700, about 1800, about 1900, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10,000, about 15,000, about 20,000 about
- the arrays can be used to screen target organism polypeptides in order to identify a target organism antigen that is capable of eliciting a cell-mediated immune response.
- the methods can include providing an array of target organism polypeptides; delivering at least about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 266, about 300, about 350, about 400, about 450, about 500, about 550, about 600, about 650, about 700, about 750, about 800, about 850, about 900, about 950, about 1000, about 1050, about 1100, about 1150, about 1200, about 1250, about 1300, about 1350, about 1400, about 1450, about 1500, about 1600 about 1700, about 1800, about 1900, about 2000, about 2
- FIG. 10 Further embodiments also relate to arrays of at least about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 266, about 300, about 350, about 400, about 450, about 500, about 550, about 600, about 650, about 700, about 750, about 800, about 850, about 900, about 950, about 1000, about 1050, about 1100, about 1150, about 1200, about 1250, about 1300, about 1350, about 1400, about 1450, about 1500, about 1600 about 1700, about 1800, about 1900, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10,000, about 15,000, about
- the arrays can be used to screen target organism polypeptides in order to identify a target organism antigen that is capable of eliciting a humoral immune response.
- the methods can include providing an array of target organism polypeptides attached to a linker molecule; immobilizing at least 10 of the target organism polypeptides to a solid support; and assaying the polypeptides with at least one antibody from an animal that has been immunized with one or more antigens from the target organism to identify a target organism antigen capable of eliciting a humoral immune response.
- Additional embodiments relate to arrays including a plurality of individual locations, wherein a different polypeptide from a target organism is positioned at each location, and wherein at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of all expressed polypeptides from the target organism are positioned on the array.
- Arrays can include different, expressed polypeptides from any target organism.
- Vaccinia virus is the target organism.
- the target organism can be a pathogen including for example, B. anthracis, Clost ⁇ dium botulism, Yersinia pestis, Variola major, Francisella tularensis, P.
- Polypeptides in the arrays can be positioned in numerous ways, including, for example, being suspended in solution, or bound to the array. Furthermore, the positioned polypeptides can be attached to a linker molecule, selected from the group consisting of, for example, a 6x, 7x, 8x, 9x, or lOx histidine tag, GST tag, fluorescent protein tag, or Flag tag. Positioned polypeptides with linker molecules can be bound to arrays.
- steps (a)-(c) can be repeated at least, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 266, about 300, about 350, about 400, about 450, about 500, about 550, about 600, about 650, about 700, about 750, about 800, about 850, about 900, about 950, about 1000, about 1050, about 1100, about 1150, about 1200, about 1250, about 1300, about 1350, about 1400, about 1450, about 1500, about 1600 about 1700, about 1800, about 1900, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10,000, about 1
- the target organism can be a pathogen including for example, B anthracis, Clostridium botulism, Yersinia pestis, Variola major, Francisella tularensis, P falciparum, Streptococcus, Borrelia burgdorfen, Chlamydia trachomatis, Hehcobacter pylori, Mycobactenum tuberculosis, causative pathogens of viral hemorrhagic fevers, Ebola, Marburg, pox viruses, Arenaviruses, LCM, Junm virus, Machup virus, Guana ⁇ to virus, Bunyaviruses, Hantaviruses, Flaviruses, Dengue virus, Filoviruses, Coxiella bu netti, Brucella species, Burkholderia mallei, Ricinus communis, Clostridium perfringens, Staphylococcus, Rickettsia prowazeku and other Rickettsias, Food and
- Additional methods relate to adding at least one polynucleotide sequence operably encoding a linker molecule to the nucleic acid coding sequence from the target organism, wherein the linker molecule immobilizes the expressed polypeptide to a solid support
- methods of expressing the desired nucleic acid coding sequence and the polynucleotide sequence operably encoding a linker molecule produces a target organism polypeptide attached to a linker molecule are also embodied
- Further methods relate to screening a library of target organism polypeptides in order to identify a target organism antigen that is capable of eliciting a humoral immune response, and can include providing a library of target organism polypeptides attached to a linker molecule, immobilizing at least 10 of the target organism polypeptides to a solid support, and assaying the polypeptides with at least one antibody from an animal that has been immunized with one or more antigens from the target organism to identify a target organism antigen capable of eliciting a humoral immune response
- Further embodiments relate to methods of screening a library of target organism polypeptides in order to identify a target organism antigen that is capable of eliciting a cell- mediated immune response, including providing a library of target organism polypeptides, dehvenng at least 10 of the target organism polypeptides into a plurality of antigen-presenting cells; and assaying the antigen-presenting cells with at least one T-cell from an animal that has been immunized with one or more antigens from the target organism to identify a target organism antigen capable of eliciting a cell-mediated immune response Additional methods relate to generating a library of target organism polypeptides, which can include the following steps: (a) amplifying a desired polynucleotide coding sequence from the target organism by performing PCR with a first primer pair capable of amplifying the desired polynucleotide coding sequence; (b) expressing the amplified polynucleotide coding sequence; and repeating steps (a)-(b) at least 10 times
- the PCR reaction can include: (a) performing a first PCR reaction using a first primer pair capable of amplifying a desired polynucleotide sequence from the target organism to provide an amplified coding sequence, which amplified coding sequence is not franscnptionally active; (b) providing a second PCR nucleotide pnmer pair capable of adding at least one nucleotide sequence that confers transcriptional activity to the amplified coding sequence; (c) performing a second PCR reaction with the second primer pair and the amplified coding sequence, thereby resulting m amplification of a franscnptionally active coding sequence.
- Figure 1 illustrates one method used to generate TAP Expression Fragments.
- Figure 2 displays a method of amplifying multiple genes using TAP technology, expressing said genes products, and purifying, and quantifying the resulting polypeptides.
- Figure 3. demonstrates how a plurality of polypeptides from a target organism can be assayed to determine each polypeptide's ability to elicit a humoral immune response.
- Figure 4. demonstrates how a plurality of polypeptides from a target organism can be assayed to determine each polypeptide's ability to elicit a cell mediated response.
- Figure 5. demonstrates that fluorescent proteins (goat IgG antibody) can be more effectively delivered into either NIH-3T3 cells (A&B) and human dendntic cells (C&D) with a protein delivery reagent (B&D) as opposed to without a protein delivery reagent (A&C).
- Figure 6. illustrates a humoral vaccine antigen scan.
- HA-EpiTAP fragments encoding 424 different antigens from P. falc ⁇ arum can be amplified and individually transfected into separate well of 5 96-well plates containing UM449 cells. The cells are lysed and the supernatants and lysates are transferred to another set of 96-well plates containing HA antibody bound to the surface of the plates.
- the HA antibody can capture the HA epitope tagged antibody that is present in the cell lysate. Serum from an infected individual is added to each well and the antigen in the bottom of the well can capture the anti-malaria antibody present in the serum. The bound anti-malaria antigen antibody are quantified by using an anti-human detecting antibody. Naturally immunized individuals generally may display those antigens against the blood stage organism, whereas sporozoite immunized individual generally have antibodies against the hepatic stage organism.
- Figure 7. illustrates a cellular vaccine antigen scan. TAP fragments encoding 424 different antigens from P falciparum are amplified and individually transfected into haplotype matched antigen presenting cells in 96-well plates.
- T-cells isolated from the blood of immunized individuals are mixed with the transfected cells and interferon gamma production is monitored by Elispot assay. A larger number of potential antigens contributing to the protective response in sporozoite individuals are discovered by this approach.
- Figure 8 illustrates a PCR amplification product generated from a CMV based plasmid template using 5' and 3' primers (PI and P2) that flank the promoter and terminator. This produces a PCR fragment that encodes the reporter gene flanked by full length promoter and terminator sequences.
- Figure 9 illustrates catalytic amounts of promoter and terminator fragments (FI and F2) mixed with catalytic amounts of gene specific primers (P3 and P4).
- Primers P3 and P4 also have a -20 nucleotide sequence complementary to the promoter and terminator. Excess amounts of primers PI and P2 which complementary to the 5' and 3' ends of the promoter and terminator are used to amplify the product leading to a gene fragment with flanking promoter and terminator sequences.
- Figure 10 illustrates plasmids that can be used as the source for the TAP terminator and TAP promoter fragments.
- FIG 11. illustrates the TAP Cloning Scheme.
- TAP fragments can be mixed with a linearized plasmid containing complementary ends and the mixture can be electroporated into host bacterial cells containing high recombinase activity. Most of the resulting stable colonies contain plasmid with the gene of interest directionally inserted.
- Figure 12. illustrates DNA templates encoding three antigens from the malaria parasite that were amplified using custom oligos specific to each gene with common 5' and 3' TAP ends. The second PCR reaction was carried out to append the TAP promoter and TAP terminator to each primary TAP product, adding an additional 1050 bp in size, to produce the final active TAP Expression Fragments. The samples were separated by electrophoresis on 0.8% agarose gel with the corresponding primary and final PCR products running next to each other.
- the present invention generally relates to methods of generating polypeptide libraries of a target organism, methods of monitoring the immunogenic effect of these polypeptides, methods of developing subunit vaccines, pharmaceutical compositions, and immunogenic compositions against the target organism based on the identification of antigenic polypeptides, and systems related to the same.
- this invention is directed to arrays of polypeptides that are derived from particular target organisms.
- the present invention is directed to an automated system capable of expressing polypeptides encoded by the target organism and determining the immunogenic effect of said polypeptides.
- target organism is to be construed broadly and encompasses any prokaryotic or eucaryotic organism or cell, including mammals such as humans and other primates or domestic animals, bacteria, fungus, protozoa, viruses, and the like.
- the target organism can be a pathogen with a relatively large genome.
- target organisms include Vaccinia virus, B. anthracis, Clostridium botulism, Yersinia pestis, Variola major, Francisella tularensis, P.
- This invention can also be used to analyze cells that are effected by an autoimmune disease. By understanding the polypeptides coded by cells that are effected by autoimmune diseases, more effective treatments can be developed.
- a non-exclusive list of autoimmune diseases that can be analyzed with this invention include: Hashimoto's thyroiditis. pernicious anemia. Addison's disease, diabetes, rheumatoid arthritis, systemic lupus erythematosus. dermatomvositis. Sjogren's syndrome, lupus erythematosus. multiple sclerosis, myasthenia gravis. Reiter's syndrome, or Graves disease.
- a "target organism” can include cell types that are effected by a particular autoimmune disease. Additionally, a "target organism” can encompass abnormal cell types including cancerous cells, tumor cells, and diseased cells for example.
- polypeptide is also to be construed broadly and is not limited to a specific number of amino acids in the encoded product. In some embodiments a “polypeptide” can be at least about 3, 4, 5, 6, 7, 8, or more amino acids long.
- a “polypeptide” according to the present invention encompasses, for example, naturally occurring polypeptides, recombinant polypeptides, peptides, oligopeptides, naturally occurring proteins, recombinant proteins, fragments, and variants or analogs of a polypeptide sequence and the like.
- array is to be construed broadly, and includes any arrangement wherein a plurality of different polypeptides are held, presented, positioned, situated, or supported.
- arrays can include microtiter plates, such as 48-well, 96-well, 144-well, 192-well, 240-well, 288-well, 336-well, 384-well, 432-well, 480-well, 576-well, 672-well, 768-well, 864-well, 960-well, 1056- well, 1152-well, 1248-well, 1344-well, 1440-well, or 1536-well plates, tubes, slides, chips, flasks, or any other suitable laboratory apparatus.
- arrays can also include a plurality of sub- arrays.
- a plurality of sub-arrays encompasses an array where more than one arrangement is used to position the target organism's polypeptides.
- library is likewise to be construed broadly, and includes any non-natural collection of polypeptides, whether arranged or not. A library therefore encompasses an a ⁇ ay but the two terms are not necessarily synonymous.
- Embodiments of the invention encompass methods of generating polypeptide libraries from a particular target organism.
- the invention can be used to generate a plurality of polypeptides from any given target organism, with any particular sized genome.
- the target organism can have more than 50 nucleotide coding sequences in its genome.
- the target organism can have a genome with more than: about 50, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 550, about 600, about 650, about 700, about 750, about 800, about 850, about 900, about 950, about 1000, about 1050, about 1100, about 1150, about 1200, about 1250, about 1300, about 1350, about 1400, about 1450, about 1500, about 1600 about 1700, about 1800, about 1900, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10,000, about 15,000, about 20,000 about, 25,000, about 30,000 or more nucleotide coding sequences.
- TAP Technology TAP Technology
- TAP Transcriptionally Active Polymerase Cham Reaction
- Transcriptionally active DNA fragments can be synthesized by polymerase chain reaction (PCR) amplification of any gene of interest using nested ohgonucleotide p ⁇ mers and two DNA fragments, one of which comprises an active transcription promoter sequence and one of which comprises a basic transcnption terminator element. TAP fragments and methods of making the same are described in detail in U.S. Patent No.
- methods for creating TAP fragments can incorporate the steps of: i) ohgonucleotide design ii) TAP primary fragment amplification, and iii) TAP expression fragment amplification.
- FIGURE 1 illustrates one method for generating TAP fragments.
- Creating TAP fragments involves designing custom ohgonucleotide sequences. Primers complementary to the 5' and 3' ends of the gene of interest can be synthesized.
- the term "gene of interest” encompasses any "desired polynucleotide sequence" or "coding sequence,” and can include any suitable number of nucleotides to permit amplification of the gene of interest.
- the 5'-custom ohgonucleotide can include about 41, 42, 43, 44, 45 and 46 nucleotides; of these, about 26 nucleotides comprise the 5 '-TAP end universal sequence and about 15 to 20 nucleotides make up the gene-specific sequence.
- the gene-specific sequence can be, for example, about 15, 16, 17, 18, 19, or 20 nucleotides.
- the 5' ohgonucleotide may also incorporate the Kozak consensus sequence (A/GCCAUGG) around the start codon for more efficient translation of mRNA.
- the start codon ATG can be included in the custom 5'-oligonucleotide.
- the start codon ATG can be included in the custom 5 '-ohgonucleotide when the sequence encoding the peptide of interest lacks an initiation methionine codon on its 5 ' end.
- the 3 '-custom ohgonucleotide can include any suitable number of nucleotides to permit amplification of the gene of interest.
- the 3 '-custom ohgonucleotide can preferably contain about 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, and 45 nucleotides; of these, about 20 nucleotides preferably comprise the 3 '-TAP end universal sequence and about 20 nucleotides preferably are specific to the polynucleotide, or gene-of-interest.
- a complementary stop codon sequence such as TCA, TTA, or CTA can be added to the end of the gene sequence to achieve proper translational termination of the expressed gene.
- TAP primary fragment encompasses an "amplified coding sequence,” and in one embodiment relates to a polynucleotide sequence that has been amplified but is not transcriptionally active.
- This step involves performing PCR, which generates a polynucleotide fragment that contains the gene-of-interest with the added 5'- and 3 '-TAP universal end sequences.
- These 5'- and 3 '-TAP universal end sequences are useful for adding one or more nucleotide sequences that confer transcriptional activity.
- these sequences can include TAP ExpressTM promoter and terminator fragments.
- a further step involves adding at least one polynucleotide sequence that confers transcriptional activity onto the TAP primary fragment.
- the end product of the 2 nd PCR reaction termed a TAP expression fragment, is transcriptionally active DNA that can be used directly for in vivo, or in vitro, (e.g. cell-free) expression studies.
- TAP expression fragments can be transfected into cultured cells, or injected into animals.
- TAP expression fragment encompasses the term "transcriptionally active coding sequence"
- TAP fragments is a rapid and efficient way of making a large number of polynucleotide coding sequences transcriptionally active. Accordingly, embodiments include, a plurality of different genes from a target organism can be made franscnptionally active using TAP technology.
- polynucleotide sequences that confer transcriptional activity are promoter sequences, terminator sequences, binding sites for transc ⁇ ption factors, TATA box sequences, and enhancers.
- promoter sequences can be obtained in numerous ways. For example, using restriction enzyme digestion of commercially available plasmids and cDNA molecules, or they can be synthesized using an automated DNA synthesizer using methods well known in the art.
- promoter is a DNA sequence which extends upsfream from the transcription initiation site and is involved in binding of RNA polymerase.
- the promoter may contain several short ( ⁇ 10 base pair) sequence elements that bind transcription factors, generally dispersed over >200 base pairs.
- a promoter that contains only elements recognized by general and upsfream factors is usually transcribed in any cell type.
- Such promoters may be responsible for expression of cellular genes that are constitutively expressed (sometimes called housekeeping genes).
- tissue-specific promoters limited to particular cell types, such as the human metallothionein (MT) promoter that is upregulated by heavy metal ions and glucocorticoids.
- MT human metallothionein
- the promoter can be selected based upon consideration of the desired use for the nucleic acid fragment.
- One skilled in the art can easily select an appropnate promoter according the uses of the nucleic acid fragment.
- a promoter capable of promoting transcription in mammalian cells can be selected.
- Other examples of a promoter include a promoter from a plant or a plant pathogen, such as cauliflower mosaic virus, and the like.
- the promoter can be from a mammal or a mammalian pathogen such as CMV, SV40, RSV, MMV, HIV, and the like.
- the promoter can be from a fungus such as yeast (Gal 4 promoter), and the like, while in other examples it can be from bacteria or bacterial phage, for example lambda, T3, T7, SP6, and the like.
- the promoter can also be refroviral long terminal repeats (LTR), muscle creatine kinase promoter, actm promoter, elongation factor promoter, synthetic promoters, tissue-specific promoters and the like
- terminatator encompasses a DNA sequence represented at the end of the transcript that causes RNA polymerase to terminate transc ⁇ ption. Additionaly, the term “terminator” encompasses signal sequence that cause franscnbed RNA to be processed before translation, for example, polyadenylation. This occurs at a discrete site downstream of the mature 3' end, which is generated by cleavage and polyadenylation. Any type of terminator can be used for these methods.
- the terminator sequence can be derived from a prokaryotic or a eukaryotic, for example plant source. In one embodiment, artificial mammalian transcriptional terminator elements can be used.
- terminator sequences include the SV40 transcription terminator, bovine growth hormone (BGH) terminator, synthetic terminators, rabbit beta-globm terminator, and the like. Terminators can also be a consecutive stretch of adenine nucleotides at the 3' end of a TAP fragment.
- Tap Linker Molecules As noted above, using TAP technology, genes can be amplified with additional elements such as promoter sequences, terminator sequences, binding sites for transcription factors, TATA box sequences, and enhancers In addition, genes can be amplified with additional elements that can enable more rapid screening, characterization, purification and study of the polypeptides that they encode.
- additional elements include for example, such as reporter genes, affinity tags, antibody tags, PNA binding sites, histidine tags, secretory signals, reporter genes and the like.
- additional element that can be added to the TAP primary fragment or the TAP expression fragment are polynucleotides that encode linker molecules.
- linker molecule encompasses any molecule that is capable of immobilizing the polypeptides to a solid support.
- the linker molecule can be an epitope tag.
- antibody-based experimental strategies such as Western blot, lmmunoprecipitation, and lmmunocytochemistry with the use of fluorescently-tagged antibodies.
- availability of antibodies specific for each polypeptide would be most valuable.
- development of antibodies specific for all of the recombinant polypeptides being studied in a particular lab would be an expensive, time consuming and generally unrealistic proposition. This is a particularly daunting problem when one considers the rapidly expanding number of new genes with unknown function that are being revealed as a result of worldwide sequencing efforts.
- Epitope tagging of TAP fragments is useful for rapidly and conveniently determining the intracellular distribution of the expressed product of TAP fragment, facilitating purification of polypeptides, identifying associated polypeptides, and charactenzing new polypeptides by lmmunoprecipitation.
- epitope tagging recombinant polypeptides are expressed as fusion polypeptides bearing a short ohgopeptide epitope added to the polypeptide coded by the natural gene of the target organism.
- Antibodies directed against the added epitope can then be used as tools for detection of the polypeptide in Western blot, lmmunocytochemistry, DNA band supershift experiments, fluorescence activated cell sorting (FACS) and affinity punfication of the desired fusion polypeptides
- one embodiment of this invention is to modify the basic TAP system to create a fusion of the gene of interest and a polynucleotide sequence encoding a hemagglutimn (HA) epitope tag
- the HA epitope tag is well characterized and highly immunoreactive. After fransfection of this epitope tagged TAP fragment into cells, the resulting HA-tagged polypeptides can be identified with commercially available anti-HA antibodies.
- the expressed product can include the gene product and a HA epitope site. Accordingly, this expression product can be quickly captured and/or purified using antibodies specific for the HA epitope.
- a polynucleotide sequence encoding a histidine tag can be incorporated into the TAP fragment to enable the expressed gene product to be conveniently punfied.
- the expression, purification, detection, and assay of recombinant polypeptides can be much more simple and powerful by the use of small affinity tags like the HA and the histidine tags.
- affinity tags like the HA and the histidine tags.
- the well- established QIAexpress Protein Expression and Punfication Systems are based on the remarkable selectivity and affinity of patented nickel-nitnlot ⁇ acetic acid (Ni-NTA) metal-affinity chromatography matrices for polypeptides tagged with 6 consecutive histidine residues (6xH ⁇ s tag) available from QIAGEN (Seattle, Washington).
- the QIAexpress System is based on the remarkable selectivity of Ni-NTA (mckel- nit ⁇ lot ⁇ acetic acid) for polypeptides with an affinity tag of six consecutive histidine residues — the 6xH ⁇ s tag.
- Ni-NTA nickel nit ⁇ lotnacetic
- the TAP fragment can include tags designed to simplify detection and purification
- One of the most powerful technologies for recombinant polypeptide purification is the addition of an affinity tag of six consecutive histidine residues.
- Polypeptides with a 6xH ⁇ s tag can be punfied through nickel nitrilotnacetic (Ni-NTA) resin
- Ni-NTA nickel nitrilotnacetic
- the 6xH ⁇ s tag is much smaller than most other affinity tags and is uncharged at physiological pH. It rarely alters or contributes to polypeptide immunogenicity, rarely interferes with polypeptide structure or function, does not interfere with secretion, does not require removal by protease cleavage, and is compatible with denaturing buffer systems. Accordingly, this tag is a powerful tool for expression, assaying and purification of eukaryotic genes like protein kmases some of which are extremely difficult to clone using conventional plasmid-based cloning approach.
- Oligonucleotides can be designed to include the nucleotide sequence encoding the 6xH ⁇ s epitope tag along with TAP promoter and terminator fragments from pCMVm and pTP-SV40, for example.
- a sequencing encoding histidine residues can be included along with the promoter.
- a sequencing encoding histidine residues can be included along with the terminator.
- the HA and the 6xH ⁇ s epitope embodiments are not to be construed as limiting, and are provided for illustrative purposes.
- any type of linker molecule can be attached to the expressed products such as for example, a 7x, 8x, 9x, or lOx histidine tag, GST tag, fluorescent protein tag, Flag tag, and the like.
- TAP fragment with secretory signal For many gene therapy and DNA vaccine applications it is beneficial for the gene product to be secreted from the transfected cells. For this reason a version of the TAP system and methods can be configured so that the gene product will contain a secretory signal.
- a commonly used signal peptide is the first 23 ammo acids from human tissue plasminogen activator (tPA) with the coding sequence as follows: ATG GAT GCA ATG AAG AGA GGG CTC TGC TGT GTG CTG CTG CTG TGT GGA GCA GTC TTC GTT TCG CCC AGC. (SEQ ID NO: 1) This sequence can be built into the TAP promoter fragment to create a new TAP fragment in a fashion similar to the construction of the tagged polypeptides described above. Incorporating TAP fragments into a plasmid vector
- TAP express Once the function or immunogenicity of a gene is identified by using TAP express, it can be of interest to clone it into a plasmid vector.
- TAP express is available from Gene Therapy Systems, San Diego, California. TAP cloning is a rapid and convenient way to accomplish this.
- cloning it into a plasmid vector can be desirable to facilitate further gene characterization and manipulation.
- Standard cloning techniques can involve the use of restnction enzymes to digest the plasmid and the gene fragment to be inserted. Annealing and ligation of the compatible ends can lead to insertion of the gene into the vector.
- An alternative method of restriction ends-directed cloning is to prepare a linearized plasmid with T overhangs on the 3' ends of the double-stranded DNA to accommodate DNA fragments amplified with the aid of specific polymerases through PCR. This method is sometimes called "T/A cloning".
- the TAP Cloning systems, methods, and kits can further simplify the cloning process by taking advantage of the universal 5' and 3' sequences that are present on the TAP Express fragment after the first or second PCR step. These regions overlap with the end sequences of our linearized TAP Express Cloning Vector.
- endogenous bacterial recombmase activity recombmes the two DNA fragments resulting in a plasmid with the inserted TAP Express fragment This process can replace conventional cloning with two simple PCR steps. In some embodiments it does not require cutting, pasting and hgating DNA fragments.
- this process can be highly suited for fast and convenient cloning of TAP PCR fragments without having to resort to restriction enzymes, DNA hgase, Topo-isomerase or other DNA modifying enzymes.
- All "TAP" systems, vectors and cells are readily availabe from Gene Therapy Systems, San Diego, California.
- GeneG ⁇ p PNA compatible TAP system can also be used to couple polypeptides onto DNA through PNA Dependent Gene Chemistry, which does not have the limitations of previously described methodologies.
- GeneGnp is available through Gene Therapy Systems, San Diego, California. This approach takes advantage of the property of peptide nucleic acids (PNA) to hybridize with duplex DNA in a sequence specific and very high affinity manner.
- PNA peptide nucleic acids
- PNA binding sites can be used for attaching a senes of peptides onto DNA in order to target the transfected plasmid and improve transgene expression, for example. This can allow scientists to follow a rational approach to improve the efficiency and efficacy of gene delivery by adding elements intended to increase nuclear uptake, facilitate endosomal escape, or target gene delivery to the cell surface or to intracellular receptors Incorporating a GeneGnp site into TAP enables peptide nucleic acids (PNAs) to be hybridized to the TAP gene. Ligands can then be attached to the PNA in order to improve the bioavailabihty and DNA vaccine potency of the gene. Automated system for performing TAP method
- a system can be used to perform every step involved in generating TAP fragments from a target organism. Additionally, each individual step is capable of being controlled by a system. For example, a system can design customized PCR primers, obtain said primers, perform PCR reactions utilizing TAP technology, attach promoters and terminators, and attach sequences that encode linker molecules to the primary or expression fragment. The system can be either automated or nonautomated. Expression of the TAP fragment
- Transcriptionally active amplified DNA fragments can be directly used in various expression systems in order to obtain the corresponding polypeptide for each gene in the genome.
- the invention provides simple, efficient methods for generating franscnptionally active DNA fragments that can be readily transfected into animal cells or tissues by any nucleic acid fransfection techniques. The methods can avoid the need for subcloning into expression vectors and for purification of plasmid DNA from bacteria.
- TAP fragments can be rapidly expressed using in vivo or in vitro (e.g. cell-free) expression systems.
- the amplified fragments can be directly fransfected into a eukaryotic or prokaryotic cell for expression.
- Examples of eukaryotic cells that can be used for expression include mammalian, insect (e.g. Baculovirus expression systems), yeast (e.g. Picchia pastoris), and the like.
- An example of a prokaryotic cell expression system includes E. coli.
- expression can be accomplished in cell free systems, for example, a T7 promoter system.
- Cell-free franslation systems can include extracts from rabbit reticulocytes, wheat germ and Escherichia coli. These systems can be prepared as crude extracts containing the macromolecular components (70S or 80S ribosomes, tRNAs, aminoacyl-tRNA synthetases, initiation, elongation and termination factors, etc.) required for translation of exogenous RNA.
- each exfract can be supplemented with amino acids, energy sources (ATP, GTP), energy regenerating systems (creatine phosphate and creatine phosphokinase for eukaryotic systems, and phosphoenol pyruvate and pyruvate kinase for the E. coli lysate), and other co-factors (Mg 2+ , K + , etc.).
- energy sources ATP, GTP
- energy regenerating systems creatine phosphate and creatine phosphokinase for eukaryotic systems
- phosphoenol pyruvate and pyruvate kinase for the E. coli lysate
- other co-factors Mg 2+ , K + , etc.
- TAP technology allows skilled artisans to rapidly express a plurality of genes. After a particular gene of interest becomes transcriptionally active, other different genes can also be made to be transcriptionally active according to the methods of the invention. Accordingly, in one embodiment of the invention, a plurality of genes from a target organism are amplified and expressed in order to generate a library of polypeptides. In an embodiment of the invention, a library of polypeptides can be generated by expressing a plurality of TAP fragments.
- At least about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 266, or more different genes are expressed after becoming transcriptionally active through TAP technology.
- Other embodiments of the invention relate to expressing the product of a polynucleotide that encodes a linker molecule.
- the polynucleotide encoding a linker molecule can be added to a TAP primary fragment or a TAP expression fragment. Accordingly, the linker molecule can be expressed with the gene of interest.
- the linker molecule can be an epitope tag.
- An epitope tag is useful for facilitating purification of the expression product, identifying associated polypeptides, characterizing new polypeptides by immunoprecipitation, determining subcellular localization, and the like.
- One example of a particular linker molecule is the HA epitope tag. Accordingly, expression products containing a HA epitope can be quickly captured and/or purified using antibodies specific for the HA epitope.
- Other linker molecules include, for example, a 6x, 7x, 8x, 9x, or lOx histidine tag, GST tag, fluorescent protein tag, Flag tag, and the like.
- polypeptide libraries allow skilled artisans to easily use them in subsequent research and study. For example, it is possible to organize the expressed polypeptides into an array for further analysis.
- the expressed polypeptide arrays can be screened in order to identify new vaccine and drug targets against microbial, neplastic disease and the like, for example.
- the expressed polypeptides can be used to screen antibody libraries, to develop reagents, functional proteomic studies, and the like. All of these can be rapidly accomplished at rates far exceeding traditional methods.
- Arrays made according to the methods of the invention may include about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 266, about 300, about 350, about 400, about 450, about 500, about 550, about 600, about 650, about 700, about 750, about 800, about 850, about 900, about 950, about 1000, about 1050, about 1100, about 1150, about 1200, about 1250, about 1300, about 1350, about 1400, about 1450, about 1500, about 1600 about 1700, about 1800, about 1900, bout 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10,000, about 15,000, about 20,000
- the complete human proteome, or a plurality of human polypeptides can be rapidly obtained and utilized to screen antibody libraries, for example.
- the complete human proteome can be generated in a very short time frame.
- the project can be divided into 4 steps.
- the sequence of the human genome can be easily obtained by one of skill in the art from public genetic databases. Based upon the sequence information, approximately 27,000 transcriptionally active PCR (TAP) primary fragments encoding each gene in the human genome or a plurality of human genes can be generated. It should be noted that these approximately 27,000 fragments would not necessarily account for additional products produced by alternative splicing.
- the nucleotides coding sequences for these products can also be amplified and expressed.
- the generation of approximately 27,000 fragments can require approximately 54,000 gene specific primers, which can be obtained rapidly generated by means and companies well known to those of skill in the art, Genset, for example.
- the primers Once the primers are obtained the primary TAP fragments can be rapidly amplified using PCR machines. In certain embodiments the time can be greatly reduced by using machines capable of large numbers of reaction, for example, 768 reactions / machine.
- the primary TAP fragments can then undergo subsequent PCR to generate approximately 27,000 transcriptionally active PCR (TAP) fragments.
- TAP transcriptionally active PCR
- the TAP fragments can contain a T7 promoter, to be used in in vitro transcription/translation reactions.
- the TAP fragments can be generated and analyzed just as rapidly as the TAP primary fragments.
- the primers used to generate the TAP fragments are the same for all of the genes and they can be obtained and purchased in bulk quantities.
- the amount of each TAP Express fragment generated can be sufficient for at least 10, 15, 20, 100 or more transcnption/translation reactions in 96-well plates.
- the TAP fragments can conveniently be fransfe ⁇ ed into an expression vector using "TAP Cloning," as described for example in U.S. Patent Application No. 09/836,436 entitled "Fast and Enzymeless Cloning Nucleic Acid Fragments, which as noted above.
- the cloned fragments can be saved and used for
- the approximately 27,000 TAP fragments can be used to synthesize the entire Human Proteome in a very short period of time.
- each TAP fragment can used in vitro with appropnate transcription/translation reagents in 96-well plates.
- 10 - 50 micrograms of each protein can be generated, for example.
- the polypeptide preparations generated generally do not require further purification for use in antibody screening assays, for example.
- the proteome can be displayed on microchips and used to screen recombinant antibody libraries.
- the proteome can be used in cellular screening assays, for example.
- the antibodies can then be used, for example, to develop reagents.
- the antibodies can be used to ascertain polypeptide expression in various kinds of cells and tissue, such as for example, human tumor tissue to ascertain which polypeptides are expressed therein This approach can be used to localize polypeptides in any tissue.
- the polypeptides can be screened for polypeptides involved in human disease, for example, such as immune diseases.
- TAP fragments can be generated by an automated system.
- polypeptides that are encoded by TAP fragments can be expressed using in vivo or in vitro (e.g. cell-free) expression systems. Expression products can be purified with the use of an automated system.
- adapter technology can utilize a one-step PCR reaction.
- the term "adapter technology” as used herein relates to methods of cloning a desired nucleic acid fragment into a vector by flanking a desired nucleic acid sequence, a gene of interest for example, with first and second adapter sequences The resulting fragment can be contacted with the vector having sequences homologous to the first and second adapter sequences under conditions such that the nucleic acid fragment is incorporated into the vector by homologous recombination in vivo in a host cell.
- adapter technology allows for fast and enzymeless cloning of nucleic acid fragments into vectors and can also be used for forced cloning selection for successful transformation.
- Adapter technology is described m more detail in U.S Patent Application No. 09/836,436, entitled “Fast and Enzymeless Cloning of Nucleic Acid Fragments", U.S. Patent Application No. 10/125789, entitled “Rapid and Enzymeless Cloning of Nucleic Acid Fragments", and PCT Application No. PCTUS 02/12334.
- the nucleic acid fragment can be incorporated into any vector.
- the vector that the fragment is incorporated into can be, for example, a plasmid, a cosmid, a bacterial artificial chromosome (BAC), and the like.
- the plasmid can be CoEl, PR100, R2, pACYC, and the like.
- the vector can also include a functional selection marker.
- the functional selection marker can be, for example, a resistance gene for kanamycin, ampicillin, blasticidin, carbonicillin, tetracycline, chloramphenicol, and the like.
- the vector further can include a dysfunctional selection marker that lacks a critical element, and wherein the critical element is supplied by said nucleic acid fragment upon successful homologous recombination.
- the dysfunctional selection marker can be, for example, kanamycin resistance gene, kanamycin resistance gene, ampicillin resistance gene, blasticidin resistance gene, carbonicillin resistance gene, tetracycline resistance gene, chloramphenicol resistance gene, and the like. Further, the dysfunctional selection marker can be, for example, a reporter gene, such as the lacZ gene, and the like.
- the vector can include a negative selection element detrimental to host cell growth. The negative selection element can be disabled by said nucleic acid fragment upon successful homologous recombination. The negative selection element can be inducible. The negative selection element can be, for example, a mouse GATA-1 gene.
- the vector can include a dysfunctional selection marker and a negative selection element. The vector can include a negative selection element detrimental to host cell growth.
- the negative selection element can be disabled by said nucleic acid fragment upon successful homologous recombination.
- the negative selection element can be inducible.
- the negative selection element can be, for example, a mouse GATA-1 gene.
- the vector can include a dysfunctional selection marker and a negative selection element.
- the host cell used in adapter technology can be a bacterium.
- the bacterium can be capable of in vivo recombination. Examples of bacterium include JC8679, TB1, DH ⁇ , DH%, HB101, JM101, JM109, LE392, and the like.
- the plasmid can be maintained in the host cell under the selection condition selecting for the functional selection marker.
- the first and second adapters can be any length sufficient to bind to the homologous sequences of the vector such that the desired nucleic acid sequence is incorporated into the vector.
- the first and second adapter sequences can be, for example, at least 11 bp, 12 bp, 13, bp, 14 bp, 15 bp, 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, 30 bp, 31 bp, 32 bp, 33 bp, 34 bp, 35 bp, 36 bp, 37 bp, 38 bp, 40 bp, 50 bp, 60 bp and the like.
- the first and second adapter sequences can be greater than 60 bp.
- the first and second adapter sequences further can include a functional element.
- the functional element can include a promoter, a terminator, a nucleic acid fragment encoding a selection marker gene, a nucleic acid encoding a linker molecule, a nucleic acid fragment encoding a known protein, a fusion tag, a nucleic acid fragment encoding a portion of a selection marker gene, a nucleic acid fragment encoding a growth promoting protein, a nucleic acid fragment encoding a transcription factor, a nucleic acid fragment encoding an autofluorescent protein (e.g. GFP), and the like.
- GFP autofluorescent protein
- the host cell can include the linearized empty vector so that only the nucleic acid fragment is introduced into the host cell.
- the vector can be circularized, and as used herein a vector can be either linearized or circular. The host cell is converted into an expression vector through homologous recombination. In principle this approach can be applied generally as an alternative to conventional cloning methods.
- a nucleic acid fragment having first and second adapter sequences can be generated by methods well known to those of skill in the art. For example, a gene of interest with known 5' and 3' sequences undergoes PCR along with overlapping 5' and 3' priming oligonucleotides. The priming oligonucleotides can be obtained by methods known in the art, including manufacture by commercial suppliers. A primary fragment with adapter sequences can be generated. The adapter sequences flanking the gene of interest can be homologous to sequences on a vector or to sequences from other 5 ' or 3 ' fragments to be used in a subsequent PCR.
- a particular gene of interest from a target organism can be amplified with an adapter sequence on both the 3' and 5' ends.
- adapters can be attached to a plurality of genes, for example every gene, within a target organism's genome.
- adapters can make the desired genes transcriptionally active. Once incorporated into the desired the vector, the desired gene can be rapidly replicated and expressed, such that a plurality of target organism's genes, for example every gene, is expressed.
- Pluralities of expression products can be stored in libraries or arrays and can be assayed for their immunogenic properties as will be discussed below. While most embodiments relating to the assay methodologies are discussed in terms of TAP technology, all of the following assays can be used on adapter technology expression products as well. Once the appropriate assays are conducted on the adapter technology expression products, methods of developing vaccines can be utilized. While most of the embodiments relating to developing vaccines, discussed below, pertain to TAP technology, all of the vaccine embodiments can also be used with polypeptide libraries and arrays resulting from adapter technology. Identifying Immunogenic Effect of Polypeptides
- DNA vaccines are effective vaccines that are inexpensive to manufacture, and can be widely distributed
- One of the most difficult tasks in developing a DNA vaccine (or any recombinant subunit vaccine) is the identification of the antigen that can stimulate the most effective immune response against the pathogen, particularly when the genome of the organism is large
- a comprehensive way to accomplish this is to obtain a plurality of polypeptides from a particular pathogen in the mode of a library or array. These polypeptides can be tested to determine their capability to evoke a humoral and/or a cell-mediated immune response Polypeptides that evoke immunogenic responses can be tested individually or with other antigens for effectiveness as subunit vaccines.
- nucleic acids that code for identified antigenic polypeptides can also be used alone or with other nucleic acids that encode antigens to develop a subunit vaccine for a particular pathogen
- the methods of this invention can work with any target organism.
- the target organism can be a pathogen, such as, for example, Vaccinia virus, B anthracis, Clostridium botulism, Yersinia pestis, Variola major, Francisella tularensis, Malaria, Chlamydia trachomatis, Streptococcus, Borreha burgdorfen, Hehcobacter pylori, Mycobactenum tuberculosis, causative pathogens of viral hemorrhagic fevers, Ebola, Marburg, pox viruses, Arenaviruses, LCM, Junin virus, Machup virus, Guana ⁇ to virus, Bunyaviruses, Hantaviruses, Flaviruses, Dengue virus, Filoviruses, Coxiella burnetti, Brucella species, Burkholderia mallei, Ricin
- FIGURE 2 illustrates a method of amplifying multiple genes using TAP technology, expressing the gene products, and pu ⁇ fying, and quantifying the resulting polypeptides.
- FIGURE 2 further illustrates a method of preparing polypeptides, which can be assayed to identify their ability to evoke a cell-mediated or humoral immune response.
- a plurality of Vaccinia genes can be made franscnptionally active.
- the approximately 266 expression vectors encoding each of the 266 open reading frames from Vaccinia virus genome can be made transcriptionally active using TAP technology.
- the resulting TAP fragments can be purified and expressed in vitro or in vivo according to any method known in the art.
- the expression products, which encompass polypeptides, can be assayed to determine their ability to evoke a humoral and/or a cell-mediated immunogenic response.
- Polypeptides that are identified as capable of evoking an immune response can be used to develop polynucleotide or polypeptide subunit vaccines The complete method will be described in more detail below.
- gene specific PCR pnmers are designed in order to generate a plurality of franscnptionally active genes from the Vaccinia virus
- primers are designed for every gene in the Vaccinia virus genome. In other embodiments, designing the primers allows a skilled artisan to make any given gene franscnptionally active using TAP technology
- these PCR primers can be designed by using an automated system.
- a robotic workstation can be interfaced with a dual Pentium III CPU (1 4 GHz) computer running the Linux operating system.
- a customized MySQL database can manage all the input sequence data from GeneBank and from other sources This database can track all the operations, samples and analytical data generated by the robot.
- PCR p ⁇ mers, PCR products and polypeptides can be fracked by the database.
- PCR primers, PCR products and polypeptides can be tracked by using bar coded 96-well plates While the embodiments below discuss using 96-well plates in certain embodiments, those skilled in the art can appreciate that any sized well plate can be used.
- the well plates can consist of about 48, about 96, about 144, about 192, about 240, about 288, about 336, about 384, about 432, about 480, about 576, about 672, about 768, about 864, about 960, about 1056, about 1152, about 1248, about 1344, about 1440, about 1536 or more wells.
- the PCR products and polypeptides can be fracked using any suitable receptacles, for example test tubes Custom oligonucleotides, needed for the PCR reaction, can be generated or obtained in order to perform the TAP technology.
- the Vaccinia virus genome sequence data and primer design software (Primer 3) can be used by the database to generate gene specific primers for all of the genes in the Vaccinia virus genome.
- the primers can be organized into a ⁇ ays of about 48, about 96, about 144, about 192, about 240, about 288, about 336, about 384, about 432, about 480, about 576, about 672, about 768, about 864, about 960, about 1056, about 1152, about 1248, about 1344, about 1440, about 1536 5' primers and 3' primers according ' to gene size and GC content, so that all of the optimal PCR reaction conditions can be the same for each plate.
- the gene specific primer sequences can be sent to an ohgonucleotide synthesis provider (e.g., MWG Biotech, Inc, High Point, NC.) where they can be synthesized.
- Synthesized primers can be organized and dispensed into bar-coded plates at a concentration of 100 pmole/ ⁇ l, frozen and shipped to the practitioner.
- 524 gene specific PCR primers which are capable of amplifying each of the 266 Vaccinia virus genes are designed, generated, ordered, and organized.
- the genes can be amplified.
- the primers can be organized into arrays of 96 5' primers and 96 3' primers according to gene size, and placed onto a robotic workstation.
- the robot can be programmed to generate a plate of about 48, about 96, about 144, about 192, about 240, about 288, about 336, about 384, about 432, about 480, about 576, about 672, about 768, about 864, about 960, about 1056, about 1152, about 1248, about 1344, about 1440, about 1536 PCR reactions by mixing the appropriate 5' and 3' primers with Taq polymerase and Vaccinia virus genomic DNA.
- any thermally stable polymerase can be used in the PCR reactions.
- Vent, Pfu, Tfl, Tth, and Tgo polymerases can be used.
- the robotic workstation can transfer the PCR reaction plate containing the mixed reagents to a PCR machine for amplification.
- the robotic workstation can use a robotic arm to transfer the PCR reaction plate to the PCR machine.
- the first PCR procedure can be run for any number of cycles.
- PCR machine is run for about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more cycles, for example.
- the first PCR reactions can be transferred robotically to a Millipore Montage 96-well cleanup kit, for example, when desired. Any method, kit or system can however, clean these reactions.
- a vacuum station of the robotic platform can carry out the purification step.
- an aliquot of the resulting product can be transferred robotically to an analysis plate containing the Pico-Green fluorescent probe (Molecular Probes, Eugene, OR) which reacts only with the dsDNA products.
- the plate can be transferred to an about 48, about 96, about 144, about 192, about 240, about 288, about 336, about 384, about 432, about 480, about 576, about 672, about 768, about 864, about 960, about 1056, about 1152, about 1248, about 1344, about 1440, about 1536 or more well fluorescent plate reader.
- the fluorescent signal can be compared to a standard curve to determine the amount of double stranded PCR product generated in this first PCR step. Persons with skill in the art can adjust the above methods in order to optimize their particular PCR reaction, should the need arise.
- a second PCR reaction can be performed to add at least one sequence that confers transcriptional activity to the primary transcript.
- the robot can be programmed to transfer an aliquot of each PCR reaction from the previous step into a PCR reaction containing a promoter and a terminator sequence.
- the promoter can be a T7 -histidine promoter fragment and the terminator can be a T7- histidine terminator fragment.
- any promoter or terminator sequence can be added to the primary transcript.
- any polynucleotide sequence that encodes a molecule allowing the expressed polypeptide to be detected or purified is also contemplated.
- the second PCR reaction can be run for any number of cycles. In one embodiment, the second PCR reaction is run for about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 cycles or more.
- any type of thermally stable polymerase can be used for the second PCR reaction.
- the polymerase can be Taq. In some embodiments Vent, Pfu, Tfl, Tth, and Tgo polymerases can be used.
- the resulting PCR fragments from the second PCR reaction can be cleaned by any kit, method or system. A particular kit that can be used to clean the resulting TAP fragments is a Millipore Montage 96-well cleanup kit. Additionally, as discussed above, the level of PCR product recovered can be determined using any detection agent, for example, Pico-Green.
- the resulting TAP fragments can be expressed by using any method of gene expression.
- the TAP fragments can be expressed using in vivo or in vitro (e.g. cell-free) systems.
- the fragments can be directly transfected into any eukaryotic or prokaryotic cell for expression.
- eukaryotic cells that can be used for expression include mammalian, insect, yeast, and the like.
- An example of a prokaryotic cell expression system includes E. coli.
- the TAP fragments can also be expressed by a cell free system.
- the resulting TAP fragments can be expressed in a high-throughput cell-free expression machine, such as, for example, the Roche RTS (Rapid Translation System) 100.
- the TAP fragments can be incubated in Roche RTS 100 system at 30°C for 5 hours.
- a person with skill in the art can readily appreciate the utility in following the particular cell-free translation machine's instructions. If a T7-histadine promoter or terminator fragment is added to a primary transcript, franslation of the TAP fragment can result in histidine tagged polypeptides, which can be purified as discussed below. As discussed herein, any tag can be used.
- the Vaccinia polypeptides expressed can be purified using any purification method for purifying expressed polypeptides. In one embodiment histidine tagged polypeptides can be purified with Qiagen nickel columns, such as Ni-NTA Superflow 96 Biorobot Kit.
- Qiagen nickel columns such as Ni-NTA Superflow 96 Biorobot Kit.
- Other methods that can be used to pu ⁇ fy polypeptides include ultrafilfration, extraction, and chromatography.
- the identity, quantity and purity of the purified Vaccinia polypeptides can be venfied by SDS gel electrophoresis.
- MALDI-TOF MS Microx Assisted Laser Desorption/Ionization-Time of Flight Mass Spectrometry
- ahquots of each polypeptide can be ahquoted into about 48, about 96, about 144, about 192, about 240, about 288, about 336, about 384, about 432, about 480, about 576, about 672, about 768, about 864, about 960, about 1056, about 1152, about 1248, about 1344, about 1440, about 1536 or more well plates and digested with modified trypsin.
- the resulting material can be mixed with matrix (alpha-cyano-4- hydroxycinnanuc acid (CHCA)) and spotted onto any target plate with a suitable number of spots, for example, 48, about 96, about 144, about 192, about 240, about 288, about 336, about 384, about 432, about 480, about 576, about 672, about 768, about 864, about 960, about 1056, about 1152, about 1248, about 1344, about 1440, about 1536 or more spots.
- a 384-spot "anchor chip" target plate (Bruker Daltomcs, Bille ⁇ ca, MA) can be used.
- the plate can be transferred to the sample stage of a Bruker Autoflex MALDI-TOF mass spectrometer.
- the spectrometer can be set up to automatically scan the plate and search the Mascot polypeptide database via the Internet. Accordingly, a very rapid verification system can verify purity, identity, and quantity in less than a day, for example, depending on the amount of polypeptides.
- Purified polypeptides can be placed in hbranes or organized into arrays for subsequent testing and analysis.
- Vaccinia virus polypeptide hbranes and arrays prepared, for example, according the methods above can be used to identify antigenic targets of humoral immunity in Vaccinia vaccinated animals
- a humoral immune response relates to the generation of antibodies and their ability to bind to a particular antigen.
- the humoral immune system uses white blood cells, which have the ability to recognize antigens, to generate antibodies that are capable of binding to the antigens.
- the Vaccinia polypeptides are generated according to the methods described above
- additional polynucleotide sequences that encode linker molecules are added to the TAP primary fragment or the TAP expression fragment such that the expressed product can include the gene product attached to a linker molecule
- linker molecule encompasses molecules that are capable of immobilizing the polypeptides to a solid support.
- a Vaccinia gene-of-interest is combined with a HA epitope coding sequence such that the expressed product can include the Vaccinia gene product and a HA epitope site
- a Vaccinia gene of interest is combined with a histidine coding sequence, such that the expressed product can include the Vaccinia gene product and a 6x, 7x, 8x, 9x, or lOx histidine tag.
- a Vaccinia gene is combined with a sequence that codes for a GST tag, fluorescent protein tag, or Flag tag. Using these methods it is possible to express and tag every Vaccinia virus polypeptide encoded by its genome.
- the tagged Vaccinia virus polypeptide can be attached to a solid support, such as a 96- well plate.
- the attached polypeptides can come into contact with serum or other fluid containing B lymphocytes from an animal that has been immunized with one or more antigens from a Vaccinia virus.
- a typical ELISA assay can be performed to detect the presence of antigen specific antibodies.
- tagged Vaccinia polypeptides can be bound to a solid support, such as a 96-well plate. The bound Vaccinia polypeptides can be incubated with serum from an animal that has been immunized with one or more antigens from a Vaccinia virus.
- the reaction mixture can be washed to remove any unbound serum antibodies.
- the ability of the serum antibodies to bind to the bound Vaccinia polypeptides can be detected using numerous methods.
- enzyme linked secondary antibodies can be added to detect the presence of an antigen specific antibody. Any enzyme linked secondary antibody can be used in this invention, depending on the source of the serum. For example, if vaccinated mouse serum is used to provide the primary antibody, enzyme linked anti-mouse antibody can be used as a secondary antibody. Likewise if human serum is used to provide the primary antibody, enzyme linked anti-human serum can be used as a secondary enzyme.
- any suitable assay can be used to determine the amount of bound polypeptide specific antibody.
- skilled artisans can develop the enzyme assay to determine the amount of polypeptide specific antibody that is bound.
- the readout from an assay can show the presence of different levels of antibody in each of the 96 wells.
- Vaccinia virus polypeptides can not generate any serum antibodies, other polypeptides can generate intermediate levels of antibodies, and some can generate high antibody levels.
- polypeptides that generate high antibody titers can be further researched to determine which polypeptides are present on the surface of the virus.
- polypeptides that generate high antibody titers and that are located on the surface of the virus can be good candidates for use in the development of a subunit Smallpox vaccine.
- FIGURE 3 demonstrates one embodiment of determining the humoral immune response generated by an a ⁇ ay of polypeptides.
- the HA tag may be placed at either the C-terminal or N- terminal end of the polypeptide to insure that epi topes are not concealed due to binding to the plate.
- a histidine tag can be used, and the polypeptides can be bound to nickel coated plates. For example a 6x, 7x, 8x, 9x, or lOx histidine tag can be used.
- histidine tagged polypeptides can be purified from either transfected cells or from the in vitro franscnption translation system. Purified polypeptides can be attached non-specifically to polypeptide absorbing plates such as Immulon plates, for example Cell-Mediated Immune Response
- Vaccinia virus polypeptide libraries and arrays prepared according the methods above can also be used to identify the antigenic targets of cell-mediated immunity in Vaccinia vaccinated animals
- a cell-mediated immune response relates to T-cells binding to the surface of other cells that display the antigen.
- T-cells When certain T-cells come into contact with a presented antigen, they produce and release cytokines such as interferon- ⁇ (IFN- ⁇ ) or Tumor Necrosis Factor-alpha (TNF- ⁇ ). Cytokines are cellular signals that can alter the behavior or properties of another cell.
- IFN- ⁇ interferon- ⁇
- TNF- ⁇ Tumor Necrosis Factor-alpha
- cytokines may inhibit viral replication, induce increased expression of MHC class I and peptide transporter molecules in infected cells, or activate macrophages. Accordingly, cytokines released by T-cells, associated with the binding to an antigen, can be used to identify and detect T-cell/antigen interactions. Some cells have MHC molecules on their membranes to present antigens to T-cells.
- T-cell function relies on proper recognition of the MHC-antigen complex.
- MHC molecules There are two types of MHC molecules: Class I and Class II
- the two different classes of MHC molecules bind peptides from different sources inside the cell for presentation at the cell surface to different classes of T-cells Any T-cell can be used in the present invention, and include for example both CD4 + and CD8 + T-cells.
- CD8 + cells cytotoxic T-cells
- CD4 + T-Cells which includes inflammatory CD4 T-cells and helper CD4 T-cells, bind epitopes that are part of class II MHC molecules Only specialized antigen-presenting cells express class II molecules.
- B cells There are three mam types of antigen-presentmg cells: B cells, macrophages and dend ⁇ tic cells. Each of these cell types is specialized to process and present antigens from different sources to T-cells, and two of them, the macrophages and the B cells, are also the targets of subsequent actions of armed effector T-cells These three cell types can express the specialized co-stimulatory molecules that enable them to activate naive T-cells, although macrophages and B cells express those molecules only when suitably activated by infection
- Embodiments of the present invention relate to detecting Vaccinia polypeptides capable of evoking a cell-mediated immune response in order to identify potential candidates for use in a subunit vaccine or other pharmaceutical composition.
- a polypeptide is delivered into an antigen-presenting cell where it can be presented in a manner that is recognized by antigen specific T-cells
- a transcriptionally active gene can be delivered into an antigen-presenting cell where expressed and presented in a manner that can be recognized by an antigen specific T-cells.
- Antigen specific T-cells can be acquired from numerous sources. For example, animals that have been immunized with one or more antigens from Vaccinia virus are a good source of antigen specific T-cells. For example, a human volunteer immunized with Vaccinia can be a source of antigen specific T-cells.
- a plurality of Vaccinia genes can be amplified and made transcriptionally active using TAP technology.
- about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 260, about 266 Vaccinia virus genes are made transcriptionally active using TAP technology.
- Transcriptionally active genes can be transfected into an antigen-presenting cell and expressed within the cell.
- the genes instead of transfecting the genes into an antigen-presenting cell, the genes can be expressed in an in vivo or in vitro (cell-free) expression system and the expressed polypeptide can be delivered into the antigen-presenting cell.
- the polypeptide can be delivered into the antigen-presenting cell according to any method. In one embodiment, the polypeptide can be delivered using the technology described in U.S. Patent Application No. 09/738046, entitled "Intracellular Protein Delivery Reagent" and U.S. Patent Application No.
- reagents used to deliver polypeptides into cultured cells can be a cationic lipid formulation.
- these reagents can deliver fluorescently labeled antibodies, high and low molecular weight dextrans, phycoerythrin-BSA, caspase 3, caspase 8, granzyme B, and ⁇ -galactosidase into the cytoplasm of a variety of different adherent and suspension cells.
- Caspases delivered to cells with are functional, since they can be shown to send cells into apoptosis.
- Vaccinia polypeptides are delivered into dendritic cells using these reagents.
- an assay can be performed to identify T- cell interaction with the MHC-antigen complex. In one embodiment, it can be determined if T-cells obtained from an animal that was immunized with Vaccinia can bind to a particular antigen presented by an antigen-presenting cell. For example, an EliSpot assay can be performed to identify antigen specific T-cells. Similar immunoassays can be performed to identify Vaccinia antigens (presented by an antigen-presenting cells) that stimulate T-cells from Vaccinia immunized individuals.
- One method of detecting a T-cell/antigen interaction is to measure the amount of a particular cytokine released by the T-cell when it interacts with a MHC-antigen complex.
- the skilled artisan can appreciate that other cellular signals can be used to indicate a cell-mediated immune response.
- the levels of IFN- ⁇ released by T-cells can indicate whether a particular peptide is capable of evoking a cell-mediated immune response.
- an antibody specific for IFN- ⁇ can be coated onto a solid support. Unbound antibodies can be washed away and IFN- ⁇ obtained from the supernatant containing T-cells plus antigen-presenting cells or antigen transduced antigen-presenting cells, can be added to the wells.
- a biotinylated secondary antibody specific for IFN- ⁇ can be added. Excess secondary antibody can be removed and Streptavidin-Peroxidase can be added to the mixture. Sfreptavidin-Peroxidase is capable of binding to the biotinylated antibody to complete the four-member immunoassay "sandwich.” Excess or unbound Sfreptavidin-Peroxidase is easily removed from the mixture. In order to detect amount of bound Sterptavidin-Peroxidase, a substrate solution can be added which reacts with the Streptavidin-Peroxidase to produce color. The intensity of the colored product is directly proportional to the concentration of IFN- ⁇ present in the T-cell/antigen-presenting cell supernatant.
- Kits for performing these types of immunoassay are readily available from many commercial suppliers or the necessary reagents composing such kits can be purchased separately or produced in-house.
- processed and presented Vaccinia polypeptide that evokes T-cells to produce a high level of IFN- ⁇ can be considered a strong candidate for use in developing a subunit vaccine.
- T- cell/Antigen interactions include bead based assays, flow-based assays, RT-PCR based assays, cytokine ELISAs, lymphoproliferation assays, cytotoxic T cell assays, or any other assay that can detect the interaction of a T-cell with a responder cell (e.g. macrophage).
- a responder cell e.g. macrophage
- Plasmodium falciparum embodiment are applicable to any given target organism or cell. Accordingly, this embodiment is not provided as a limitation on the present invention, but rather as a working example of a particular target organism.
- Malaria is the most important parasitic disease of man. Its resistance to chemoprophylactic and chemotherapeutic agents is increasing, and the development of an efficacious Malaria vaccine is recognized as an international public health priority. Progress toward development of a Malaria vaccine has been hindered in part by the complex life cycle of the parasite. The parasite develops in numerous intracellular and extracellular environments and it has a large 26 megabase genome that contains over 5000 genes Many of these genes are expressed in different stages of the life cycle and they vary extensively between strains.
- Plasmodium falciparum the parasite responsible for Malaria
- the genome of Plasmodium falciparum is predicted to encode more than 5,000 polypeptides, each of which is a potential antigen useful for a DNA or polypeptide vaccine
- the time and expense of expressing and screening every Plasmodium falciparum polypeptide is greatly reduced using the methods of the current invention. It is now possible to identify the most efficacious antigens for a DNA or polypeptide vaccine, as well as provide the foundation for establishing stage specific expression and subcellular localization and functional activity of these antigens. Two types of immunization have been found to be effective for achieving protection against
- the systems, methods, kits and arrays of the present invention can be used to systematically assay to quantify the humoral and cellular immune responses against each individual antigen in the Malana genome from people exposed to Malana. This information can be used to identify new target antigens for the next generation of Malaria DNA vaccines.
- the systems, methods, kits and polypeptide arrays can be used as an alternative approach for the development of an effective Malaria vaccine based on the presumption that duplicating the protection induced by whole organism vaccination may require a vaccine as complex as the whole organism itself.
- a new vaccine according to this invention incorporates a sufficient number of antigenic epitopes and induces an appropriate immune response m the context of diverse host genetics. This entails the identification of an unprecedented number of parasite- derived polypeptide antigens and the development of vaccine delivery system(s) based on those antigens, in order to reproduce the breadth and multiplicity of the whole organism induced protective immunity. Accordingly, the present invention can capitalize on the genomic sequence data derived from the Malana genome project to identify antigenic targets expressed in the two different routes of effective immunization.
- TAP franscnptionally active PCR
- the resulting immune responses directed primarily against liver stage antigens, are sufficient to protect immunized individuals from a subsequent challenge with infectious P falciparum sporozoites.
- the protection induced in individuals by natural exposure to Malana is mediated primarily by antibodies directed against parasite polypeptides expressed during the erythrocytic stage of the parasite's life cycle.
- a third relevant group of individuals is a subgroup of those that are naturally exposed to Malaria that are chronically parasitemic but clinically asymptomatic. For reasons that are unclear, these patients are typically asymptomatic although they may periodically develop clinical symptoms. Fluctuations in the immune response to certain antigens may account for this cycle of remission and clinical disease.
- a goal of this invention is to develop a rapid, high throughput approach to identify and catalog all of the Malaria polypeptides responsible for generating protective cellular and humoral immune responses in man, and to compare the responses induced by irradiated sporozoite immunization with the responses induced by natural exposure to Malaria.
- This rapid vaccine antigen scanning system can be used to characterize the immune responses in different populations of Malana-exposed individuals including those with mild disease, severe disease, cerebral Malaria, maternal infections (pregnancy), and asymptomatic parasitemia. Since clinical disease and acquired immunity are also influenced by the age of the individual, the immune responses in infants, children and adults can be monitored. The immune responses in clinically symptomatic and asymptomatic patients will be compared to identify immune responses against specific antigens that that are capable of keeping the clinical disease in check. These antigens will be particularly appropriate candidates for prophylactic vaccine development and can also be useful in the context of a therapeutic vaccine to treat the asymptomatic parasitemic population to reduce the frequency of clinically symptomatic episodes
- FIGURES 6 & 7 The rapid vaccine antigen scanning approach of the present invention is illustrated in FIGURES 6 & 7 As mentioned earlier, these approaches can be applied to any type of organism or cell. Illustrated is an approach for scanning the Malaria genome, as an example An exemplary procedure is detailed below For the Humoral Antigen Scan (FIGURE 6), HA-Epitope TAP fragments encoding each of the Malaria antigens are individually amplified One microgram of each fragment is mixed with two micrograms of the fransfection reagent, such as the GenePORTER reagent (Gene Therapy Systems, San Diego, CA) and the mixture is transferred to 96-well plates containing CHO-K1 or UM449 cells.
- the fransfection reagent such as the GenePORTER reagent (Gene Therapy Systems, San Diego, CA)
- the fransfection continues for 48 hours, the cells are lysed, and the supernatant and lysate are transfe ⁇ ed to another set of 96-well plates that are coated with anti-HA antibody. Since each of the HA-EpiTAP fragments contain the HA epitope, some of the HA epitope tagged polypeptide in the lysate bind to the HA antibody coated plates. In another embodiment, the cells are not lysed in order to capture the expression product.
- the cells themselves as opposed to their lysate can be used to capture the expression product using an appropriate assay.
- the capture assay can take place in the same plate or plates that the transfection took place in.
- cell-free transcription and translation systems for example, a T7 promoter system.
- Cell-free translation systems can include extracts from rabbit reticulocytes, wheat germ and Escherichia coli.
- each extract can be supplemented with amino acids, energy sources (ATP, GTP), energy regenerating systems (creatine phosphate and creatine phosphokinase for eukaryotic systems, and phosphoenol pyruvate and pyruvate kinase for the E. coli lysate), and other co-factors (Mg 2+ , K + , etc.).
- ATP energy sources
- GTP energy regenerating systems
- Creatine phosphate and creatine phosphokinase for eukaryotic systems and phosphoenol pyruvate and pyruvate kinase for the E. coli lysate
- co-factors Mg 2+ , K + , etc.
- HA-epitope tag approach In order to ensure that certain Malaria epitopes are not masked by binding of the polypeptide to HA antibody, two versions of the HA-epitope tag approach can be used; one version has the HA epitope fused to the C-terminal end of the Malaria polypeptide and the other to the N- terminal end. In this way the Plasmodium proteome can be displayed on the surface of 96-well microtiter plates.
- the HisTAP method, system, and kit can be used instead of the HA-EpiTAP approach.
- the T7 in vitro transcription/translation approach is one example of a system and method for expressing the genes, rather than a cell based system or in conjunction therewith.
- the assay can be set up so that the level of intensity of the alkaline phosphatase signal will be proportional to the amount of antibody against a given antigen that is present in the serum.
- TAP fragments (without the HA tag) encoding each of the Malaria antigens are individually amplified. Again, Malaria and the P. falciparum genome are used to illustrate application to one scenario. However, one of skill in the art will understand that the systems, methods, and kits can be applied to any organism or cell.
- One microgram of each fragment can be mixed with two micrograms of the GenePORTER transfection reagent and the mixture is transferred to 96-well plates containing haplotype specific antigen presenting cells. The transfection continues for 48 hours.
- These TAP transfected cells can serve as the target cells for the cellular immune assay, and can be transfe ⁇ ed to standard ELIspot plates precoated with anti- IFN- ⁇ (Thl type response) or ant ⁇ l-IL-4 (Th2 type response) mAbs.
- T-cells from sporozoite immunized or naturally exposed individuals are transferred to each well containing the fransfected antigen presenting cells, and are cultured for 24 hours, and subsequently processed as per a conventional ELIspot assay.
- the spot forming cells (SFCs) are enumerated using a computerized ELIspot counting machine. The number of cytokine producing cells indicates that the individual has T-cells directed against the TAP fragment that was transfected in the antigen presenting cells for that individual well.
- the supernatant from the cultures can be stored at -70C for assay by conventional cytokine ELISA assays, if necessary.
- All of the gene specific p ⁇ mers used to generate EpiTAP fragments for the Humoral Vaccine Antigen Scan can be applicable for the generation of the TAP fragments required for the Cellular Vaccine Antigen Scan, so it is not necessary to generate any new primers.
- the complete genome can be scanned in period time that was impossible with traditional techniques Further, multiple individuals can be screened who express different HLA alleles represented in high frequencies in most racial and ethnic populations (e.g. HLA-A2, Al, A3, B7)
- the development of methods for utilizing genomic data to screen for candidate vaccine antigens can be limited by the ability to validate that the appropriate recall immune responses can be induced against identified targets.
- the present invention includes a system for monitoring T cell and antibody responses, which allows surveying of the cellular and humoral immune responses from Malaria exposed individuals in order to ensure adequate immune recall. Identification of the stage-specific expression of target antigens can be important IFN- ⁇ can be used as the primary marker of cellular lmmunogenicity because the protective immunity against pre-erythrocytic stage Malaria induced by immunization with irradiated sporozoites is mediated by IFN- ⁇ . Professional antigen presenting cells can also be exploited, specifically HLA-transfected B cell lines.
- the screening assay can rely on the use of samples from immune volunteers who have been immunized with radiation-attenuated P falciparum sporozoites or semi-immune individuals naturally exposed to Malaria, since the entire repertoire of protective T cell specificities will be represented in these individuals.
- the IFN- ⁇ levels in the mixed cultured can be measured by using an Ehspot assay, similar to that disclosed in Example 3 for the Vaccinia Virus
- Embodiments of the present invention include methods and systems for scanning the humoral and cellular immune responses against genes from P. falciparum genome for recognition by PBMCs and sera from immune individuals experimentally immunized with irradiated P. falciparum sporozoites or semi-immune individuals naturally exposed to Malaria.
- One outcome of this scan is the identification of those antigens that are expressed by irradiated sporozoites in hepatocytes (targets of protective T cell immune responses) and those antigens expressed by blood stage parasites (targets of protective antibody responses).
- a particular peptide that has been identified to elicit either a humoral or cell-mediated immune response can be further explored to determine its ability to be used in a subunit vaccine, pharmaceutical composition, or immunogenic composition.
- subunit vaccine pharmaceutical composition
- immunogenic composition encompass vaccines that are comprised of polypeptides, nucleic acids or a combination of both.
- Further exploration of a polypeptide candidate includes testing the polypeptide or nucleic acid encoding said polypeptide in a large percentage of patients.
- surface antigens can be studied closely because of the likelihood that they can inhibit virus infectivity.
- every polypeptide encoded by the Vaccinia genome is assayed to determine its immunogenic effect.
- Polypeptides that elicit an immune response can be more closely studied to determine potential use alone or in conjunction with other polypeptides and genes as a subunit vaccine, pharmaceutical composition, or immunogenic composition. Suitable methodologies for electing and ddetecting an immune response are well established in the art.
- Example 1 Procedure of generating histidine tagged TAP express fragments
- a detailed procedure that was used to produce tagged T7-TAP Express fragments is as follows: 96 different genes were amplified from a mixture of plasmid templates. A first PCR reaction was run with customized 5' and 3' primers. The 5' primers contained between 43-48 bases. In particular, the T-7-His TAP ends contained 28 bases while the gene-specific component contained between 15-20 bases. The 3' primers contained between 45-50 bases. Specifically, the T7-terminator TAP ends contained 30 bases while the gene specific component contained between 15-20 bases.
- the reaction temperature and times for the first PCR reaction were: 94 °C for 2 minutes, followed by 28 cycles of: 94 °C for 20 seconds, 58 °C for 35 seconds, and 70 °C for 2 minutes (for genes that contained more than 2kb, 1 minute was added for each kb).
- each PCR reaction from the previous step was transferred into a PCR reaction containing the T7-histidine promoter fragment and T7 terminator fragment.
- the T7 promoter primer contained 25 bases
- the T7-promoter- His tag fragment contained a 104 base EcoRV Bglll fragment.
- the T7-terminator fragment was a 74 base ohgonucleotide.
- the reaction temperature and times for the second PCR reaction were: 94 °C for 2 minutes, followed by 30 cycles of. 94 °C for 20 seconds, 60 °C for 35 seconds, and 70 °C for 2 minuets (for genes that contained more than 2kb, 1 minute was added for each kb).
- Vaccinia virus proteome to identify the antigenic targets of humoral immunity in Vaccinia vaccinated mice and humans.
- the following is a method used to systematically screen and identify all of the antigens in Vaccinia virus that give nse to a protective humoral immune response.
- every gene of the Vaccinia genome is amplified
- the PCR reactions are performed such that a nucleotide sequence encoding an HA epitope is attached to these amplified franscnptionally active genes.
- the resulting HA- tagged TAP fragments are expressed to produce all 266 Vaccinia virus polypeptides containing the HA epitope tag.
- the 266 HA tagged polypeptides are placed in different HA-antibody coated wells in a 96-well plate.
- Serum from Vaccinia immunized humans is added to each of the 266 different wells. The reaction is incubated and washed to remove unbound serum polypeptides. Antibodies specific for the polypeptides attached to the plates remain bound to the plates. Enzyme linked anti-human antibody (for detecting polypeptide specific antibodies from human sera) is added to each well. The wells are incubated and washed to remove unbound antibody. A substrate is added to quantify the polypeptide specific antibody that is bound to the plate.
- Example 3 Using the Vaccinia virus proteome to identify the antigenic targets of cell-mediated immunity in Vaccinia vaccinated mice and humans.
- the following is a method that is used to systematically screen and identify all of the antigens in Vaccinia virus that give rise to a protective cell-mediated immune response.
- every gene of the Vaccinia genome is amplified.
- the PCR reactions are performed such that every gene becomes franscnptionally active.
- the resulting TAP fragments are expressed to produce all 266 Vaccinia virus polypeptides.
- Each of the polypeptides are delivered into dendritic cells, located in 96-well plates, using a polypeptide delivery reagent. Serum from Vaccinia immunized humans is added to each of the 266 different wells
- Millipore 96-well multi-screen filtration plates (Millipore, Bedford,
- Anti-IFN-g purified MAb (Clone 1-D1K) (MABTECH #3420-3) (Mabtech, Naka, Sweden)
- Biotinylated MAb (Clone 7-B6-1) (MABTECH #3420-6) (Mabtech, Naka, Sweden) Streptavidin- Alkaline Phosphatase (MABTECH #3310-8) (Mabtech, Naka, Sweden) Alkaline Phosphate Substrate Kit (BIO-RAD #170-6432) (Bio-Rad, Hercules, CA) Carbonate Buffer pH 9.6 (0 2 ⁇ M stenle filtered) RPMI-1640 Medium (GIBCO #22400-089) (Gibco, Grand Island, N.Y.) Fetal Bovine Serum (Sigma #F4135-500mL) (Sigma, St.
- IX PBS Prepared from 10X PBS DIGENE #3400-1010 (DIGENE, Gaithersburg, MD) Tween® 20 (J.T. Baker #X251-07) (J.T. Baker, Phillipsburg, NJ) METHOD:
- 96-well plates are coated with Coating Antibody (anti-IFN-g Clone 1-D1K) at 10-15 ⁇ g/mL (100 ⁇ L/well) and incubated at 4°C overnight.
- Coating Antibody anti-IFN-g Clone 1-D1K
- plates are flicked to remove Coating Antibody and washed 6 times with RPMI-1640. Plates are blocked with lOO ⁇ L/well of RPMI-1640 + 10% FBS (or Human AB serum) for 1-2 hours at room temperature. Plates are flicked to remove blocking buffer and lOO ⁇ L/well of antigen specific or control peptides are added at a final concentration of lO ⁇ g/well.
- Peripheral blood lymphocytes are added at 4xl05/well and lxl05/well. Plates are incubated at 37°C/5% C0 2 for 36 hours. Plates are flicked to remove cells and washed 6 times with PBS + 0.05% Tween® 20 at 200-250 ⁇ L/well. Plates are blot dried on paper towels. Biotinylated antibody (anti-IFN-g Clone 7-B6-1) diluted 1:1,000 in IX PBS at lOO ⁇ L/well is added. The resulting solution is incubated for 3 hours at room temperature.
- Plates are flicked to remove biotinylated antibody and washed 6 times with PBS + 0.05% Tween® 20 at 200- 250 ⁇ L/well. Plates are blot dried on paper towels. Sfreptavidin alkaline phosphatase is added at lOO ⁇ L/well diluted 1: 1,000 in IX PBS. The plates are incubated for 1 hour at room temperature. Plates are flicked to remove the sfreptavidin alkaline phosphatase and washed 6 times with 0.05% Tween® 20 at 200-250 ⁇ L/well. The plates are washed again 3 times with IX PBS at 200- 250 ⁇ L/well. The plates are blot dried on paper towels.
- Substrate is added at lOO ⁇ L/well for 10-15 minutes at room temperature.
- the substrate is prepared according to manufacturer's protocol.
- the 25X subsfrate buffer is diluted in dH20 to a IX concentration.
- Reagent A & B are each diluted 1 :100 in the IX substrate buffer.
- Example 4 Cellular Vaccine Antigen Screen A human volunteer was immunized with i ⁇ adiated sporozoites from P. falciparum, the infectious agent responsible for Malaria. Dendritic cells from the volunteer were isolated and cultured. Recombinant CSP polypeptide from P. falciparum was delivered to dendritic cells with or without polypeptide delivery reagents described in U.S. Patent Application No. 09/738046, entitled
- T-cells isolated from the immunized volunteer were added to the cultures.
- the EliSpot assay identified 120 CSP antigen specific T-cells out of 250,000 T-cells that were added to the culture when CSP was added to the culture together with said delivery reagents. When CSP was added without said delivery reagents, the signal was barely above background.
- mice DNA Immunization of mice
- mice Experiments are set up with five animals per group, consisting of four week old BALB/c female mice, averaging 40 animals per experiment. These mice are immunized IM in each tibialis anterior muscle with 50 ⁇ g plasmid DNA or transcriptionally active PCR fragment encoding selected Vaccinia virus antigens, 3 times at 3 week intervals.
- Sera is collected 10 days after each immunization for antibody studies. Blood samples (-50 ul) are collected from the mice by orbital bleed with a sterilized pasture pipette. The mice are bled about once a week at a volume of approximately 50 ⁇ l.
- Splenocytes are harvested at 14 days after the 3rd immunization and pooled for T-cell studies such as IFN- ⁇ ELIspot assays. Tissue collections are done on animals euthanized via CO 2
- the experiments can be five animals/group, averaging 40 animals/experiment x 4 experiments for a total of 160 mice.
- Vaccinia virion DNA is used as a PCR template. Crude-stock Vaccinia is used to infect 10 liters of HeLa cell spinner culture. 2 - 3 days after infection, cells are harvested by centrifugation and broken by ounce in 10 mM Tris-HCl (pH 9.0) on ice. Nuclei is pelleted, washed and re-pelleted after which supematants are combined, trypsinized, and layered onto a 36% sucrose cushion. After centrifugation, the pelleted viruses are dispersed and trypsinized, and overlaid onto a continuous 5 -
- Vaccinia DNA is eluted with 0.7 M KCl, ethanol precipitated and redissolved in TE buffer.
- Dendritic cells were ordered from Allcells: Cat # PB002 (NPB-Mononuclear Cells). The cells were in 50mL buffer. The cells were counted immediately, the total number was 3l2.5x 10 6 .
- the cells were pelleted, and resuspended in 25mL RPMI-1640 containing DNAse. This solution (30 ⁇ g /mL) was incubated for 5 minutes at room temperature. The cells were washed twice with complete medium. The cells were resuspended at 10xl0 6 cells/3mL. Twelve 10mm dishes containing lOmL complete medium in each dish were used. The cells were incubated at 37°C for 3 hours. The non-adherent cells were removed by gently shaking plates and aspirating supernatant. Afterwards, the dishes containing adherent cells were washed 3 times with lOmL of RPMI-1640 containing 2% Human Serum.
- Cells were taken from the bones of one mouse (2 femur and 2 tibiae without removing the macrophages).
- the red blood cells were obtained from the bone marrow and lysed.
- the cells were counted (51 x 10 6 cells, total) and cultured in a growth medium (2.5 x 10 6 cells/plate, lOmL/plate) for 8 days before transfection. On day 4 another lOmL of growth medium was added. On day 6, lOmL of the old medium was taken from each plate and the cells were pelleted.
- the cells were resuspended in lOmL medium with lOng/mL GM-CSF and 2.5ng/mL IL-4. The cells were placed back into the culture.
- the cells were cultured until transfection on day 8. On the day of fransfection, 2.5 x 10 6 cells were harvested from each dish.
- the growth medium for mbmDC contained DMEM Iscove, 10% FCS, 50uM ⁇ -mercaptoethanol, lx Penicillin/Streptomycin, 2mM L-Glutamme, 10 mM Hepes, lx Non-essential ammo acids, 20ng/mL rmGM-CSF, and 5ng/mL rmIL-4 Example 9
- Ohgos are designed using TAP promoter and terminator fragments from pCMVm and pTP- SV40, respectively, and adding the nucleotide sequence encoding the HA epitope tag.
- Promoter 5 ' CCGCCATGTTGACATTG (SEQ ID NO: 2)
- Promoter 3 ' GGCAGATCTGGGAGGCTAGCGTAATCCGG AAC ATCGTATGGG TACATTGTTAAGTCGACGGTGC (SEQ ID NO: 3)
- Terminator 5' GATCCCGGGTACCCATACGATGTTCCGGATTACGCTTAGGGG AGATCTCAGACATG (SEQ ID NO: 4)
- Terminator 3 ' CAGGATATCATGCCTGCAGGACGACTCTAGAG (SEQ ID NO: 5) The method includes:
- PCR is used to amplify a new HA-promoter utilizing pCMVm as a template and a new HA- terminator utilizing pTP-SV40 as a template.
- the resulting PCR products are gel purified using QIAGEN QIAquick Gel Extraction Kit (Qiagen, Seattle, WA).
- the PCR products and both plasmids (pCMVm & pTP-SV40) are digested with EcoRV and Bglll restriction enzymes. All digested products are gel purified using QIAquick Gel Extraction Kit.
- the HA-promoter and HA- terminator are ligated separately into the digested pCMVm and pTP-SV40 plasmids.
- Plasmids are digested using EcoRV and Bglll. Digests are run on a gel to identify clones containing plasmid with insert of correct size. The plasmids are sequenced to confirm inserts are correct. A prep culture is grown, plasmids are isolated, plasmids are digested with EcoRV and Bglll, and promoter and terminator fragments are gel purified. Epi-TAP-5'HA and Epi-TAP-3'HA kits are used.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Medicinal Chemistry (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Oncology (AREA)
- Virology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP02729318A EP1402064A4 (en) | 2001-05-30 | 2002-05-29 | PROTEIN ARRAYS AND METHOD AND SYSTEMS FOR THEIR PRODUCTION |
| JP2003500220A JP2005515754A (ja) | 2001-05-30 | 2002-05-29 | タンパク質アレイ、ならびにそれらを生産する方法およびシステム |
| AU2002259316A AU2002259316A1 (en) | 2001-05-30 | 2002-05-29 | Protein arrays and methods and systems for producing the same |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US29473901P | 2001-05-30 | 2001-05-30 | |
| US60/294,739 | 2001-05-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2002097051A2 true WO2002097051A2 (en) | 2002-12-05 |
| WO2002097051A3 WO2002097051A3 (en) | 2003-08-28 |
Family
ID=23134731
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2002/017005 Ceased WO2002097051A2 (en) | 2001-05-30 | 2002-05-29 | Protein arrays and methods and systems for producing the same |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US7319012B2 (enExample) |
| EP (1) | EP1402064A4 (enExample) |
| JP (1) | JP2005515754A (enExample) |
| AU (1) | AU2002259316A1 (enExample) |
| WO (1) | WO2002097051A2 (enExample) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2006134188A (ja) * | 2004-11-08 | 2006-05-25 | Japan Science & Technology Agency | オリゴヌクレオチドデータ管理装置、オリゴヌクレオチドデータ管理システム、オリゴヌクレオチドデータ管理プログラムおよび記録媒体 |
| US9709558B2 (en) | 2009-06-19 | 2017-07-18 | Arizona Board Of Regents On Behalf Of Arizona State University | Compound arrays for sample profiling |
| US10758886B2 (en) | 2015-09-14 | 2020-09-01 | Arizona Board Of Regents On Behalf Of Arizona State University | Conditioned surfaces for in situ molecular array synthesis |
| US11371990B2 (en) | 2016-11-11 | 2022-06-28 | Cowper Sciences Inc. | Methods for identifying candidate biomarkers |
| US11747334B2 (en) | 2016-06-20 | 2023-09-05 | Cowper Sciences Inc. | Methods for differential diagnosis of autoimmune diseases |
| US11774446B2 (en) | 2016-06-20 | 2023-10-03 | Cowper Sciences Inc. | Methods for diagnosis and treatment of autoimmune diseases |
| US11971410B2 (en) | 2017-09-15 | 2024-04-30 | Arizona Board Of Regents On Behalf Of Arizona State University | Methods of classifying response to immunotherapy for cancer |
| US11976274B2 (en) | 2019-10-02 | 2024-05-07 | Arizona Board Of Regents On Behalf Of Arizona State University | Methods and compositions for identifying neoantigens for use in treating and preventing cancer |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1761662A4 (en) * | 2004-07-01 | 2010-02-03 | Univ California | PROTEOMICS WITH HIGH THROUGHPUT |
| US20080171666A1 (en) * | 2007-01-11 | 2008-07-17 | Council Of Scientific And Industrial Research | Method for developing a tissue proteome library |
| CA2571904A1 (en) * | 2006-02-15 | 2007-08-15 | Fio Corporation | System and method of detecting pathogens |
| JP7049756B2 (ja) * | 2015-09-10 | 2022-04-07 | 国立大学法人埼玉大学 | 機能性ペプチドをコードするdnaの探索方法及び機能性ペプチドの調製方法 |
Family Cites Families (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4965188A (en) | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4976958A (en) * | 1987-02-26 | 1990-12-11 | Scripps Clinic And Research Foundation | Mycobacterial recombinants and peptides |
| US5733731A (en) * | 1991-10-16 | 1998-03-31 | Affymax Technologies N.V. | Peptide library and screening method |
| US6291665B1 (en) | 1994-11-08 | 2001-09-18 | Syngenta Participations Ag | Fungal target genes and methods |
| US5874409A (en) * | 1995-06-07 | 1999-02-23 | La Jolla Pharmaceutical Company | APL immunoreactive peptides, conjugates thereof and methods of treatment for APL antibody-mediated pathologies |
| US5888736A (en) | 1995-12-22 | 1999-03-30 | Visible Genetics, Inc. | Method, compositions and kit for detection and identification of microorganisms |
| US6083695A (en) * | 1996-04-15 | 2000-07-04 | The University Of Houston | Optimized primer library for gene sequencing and method of using same |
| US6043045A (en) * | 1996-09-12 | 2000-03-28 | The Scripps Research Institute | Screening methods for the identification of novel antibiotics |
| DE19637339A1 (de) | 1996-09-13 | 1998-03-19 | Hoechst Ag | Verfahren zur Amplifikation von Nukleinsäuren |
| DE1073771T1 (de) | 1998-04-30 | 2002-06-13 | Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. | Neue methode zur selektion von klonen einer expressionsbibliothek mittels "rearraying" |
| FR2786787B1 (fr) | 1998-12-08 | 2002-04-19 | Proteus | Methode d'analyse in vitro d'un phenotype connu a partir d'un echantillon d'acides nucleiques |
| EP1163359A4 (en) * | 1999-03-24 | 2005-01-26 | Gene Therapy Systems Inc | PROCESS FOR PRODUCING TRANSCRIPTIONALLY ACTIVE DNA FRAGMENTS |
| AU5951201A (en) * | 2000-05-04 | 2001-11-12 | Univ Yale | High density protein arrays for screening of protein activity |
| WO2001094944A2 (en) | 2000-06-02 | 2001-12-13 | Memorial Sloan-Kettering Cancer Center | Artificial antigen presenting cells and methods of use thereof |
| DE10108626A1 (de) | 2001-02-22 | 2002-09-05 | Sahin Ugur | Verfahren zur Identifizierung biologisch aktiver Strukturen mikrobieller Erreger |
| US20020165175A1 (en) | 2001-04-17 | 2002-11-07 | Xiaowu Liang | Fast and enzymeless cloning of nucleic acid fragments |
-
2002
- 2002-05-29 AU AU2002259316A patent/AU2002259316A1/en not_active Abandoned
- 2002-05-29 US US10/159,428 patent/US7319012B2/en not_active Expired - Fee Related
- 2002-05-29 WO PCT/US2002/017005 patent/WO2002097051A2/en not_active Ceased
- 2002-05-29 JP JP2003500220A patent/JP2005515754A/ja active Pending
- 2002-05-29 EP EP02729318A patent/EP1402064A4/en not_active Withdrawn
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2006134188A (ja) * | 2004-11-08 | 2006-05-25 | Japan Science & Technology Agency | オリゴヌクレオチドデータ管理装置、オリゴヌクレオチドデータ管理システム、オリゴヌクレオチドデータ管理プログラムおよび記録媒体 |
| US9709558B2 (en) | 2009-06-19 | 2017-07-18 | Arizona Board Of Regents On Behalf Of Arizona State University | Compound arrays for sample profiling |
| EP2443459B1 (en) * | 2009-06-19 | 2018-12-26 | The Arizona Board of Regents, A Body Corporate Of the State of Arizona acting for and on behalf Of Arizona State University | Compound arrays for sample profiling |
| US10422793B2 (en) | 2009-06-19 | 2019-09-24 | Arizona Board Of Regents On Behalf Of Arizona State University | Compound arrays for sample profiling |
| US10758886B2 (en) | 2015-09-14 | 2020-09-01 | Arizona Board Of Regents On Behalf Of Arizona State University | Conditioned surfaces for in situ molecular array synthesis |
| US11747334B2 (en) | 2016-06-20 | 2023-09-05 | Cowper Sciences Inc. | Methods for differential diagnosis of autoimmune diseases |
| US11774446B2 (en) | 2016-06-20 | 2023-10-03 | Cowper Sciences Inc. | Methods for diagnosis and treatment of autoimmune diseases |
| US11371990B2 (en) | 2016-11-11 | 2022-06-28 | Cowper Sciences Inc. | Methods for identifying candidate biomarkers |
| US11971410B2 (en) | 2017-09-15 | 2024-04-30 | Arizona Board Of Regents On Behalf Of Arizona State University | Methods of classifying response to immunotherapy for cancer |
| US12025615B2 (en) | 2017-09-15 | 2024-07-02 | Arizona Board Of Regents On Behalf Of Arizona State University | Methods of classifying response to immunotherapy for cancer |
| US11976274B2 (en) | 2019-10-02 | 2024-05-07 | Arizona Board Of Regents On Behalf Of Arizona State University | Methods and compositions for identifying neoantigens for use in treating and preventing cancer |
| US12018252B2 (en) | 2019-10-02 | 2024-06-25 | Arizona Board Of Regents On Behalf Of Arizona State University | Methods and compositions for identifying neoantigens for use in treating cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2005515754A (ja) | 2005-06-02 |
| EP1402064A4 (en) | 2005-08-24 |
| EP1402064A2 (en) | 2004-03-31 |
| WO2002097051A3 (en) | 2003-08-28 |
| US20030082579A1 (en) | 2003-05-01 |
| AU2002259316A1 (en) | 2002-12-09 |
| US7319012B2 (en) | 2008-01-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7370861B2 (ja) | Hlaに基づく方法および組成物ならびにそれらの使用 | |
| JP2024170434A (ja) | ペプチド-mhc compact | |
| KR20220098379A (ko) | 공유 네오항원을 표적으로 하는 항원-결합 단백질 | |
| US20080260763A1 (en) | High Throughput Proteomics | |
| US7319012B2 (en) | Protein arrays and methods and systems for producing the same | |
| WO2004015395A2 (en) | Method for identifying mhc-presented peptide epitopes for t cells | |
| US6951742B1 (en) | Methods and vectors for generating antibodies in avian species and uses therefor | |
| WO2001088162A2 (en) | Methods and vectors for generating antibodies in avian species and uses therefor | |
| US20180016299A1 (en) | Methods for making arrays for high throughput proteomics | |
| JP2010540674A5 (enExample) | ||
| KR20200090186A (ko) | 비-구조 단백질들을 포함하는 지카 바이러스 키메라 폴리에피토프 및 이의 면역원성 조성물로의 용도 | |
| US20100112008A1 (en) | Tuberculosis nucleic acids, polypeptides and immunogenic compositions | |
| JP2003533175A (ja) | Ny−eso−1ペプチド誘導体およびその使用 | |
| US20060224329A1 (en) | Protein arrays and methods and systems for producing the same | |
| JP4287633B2 (ja) | オルガネラ局在タンパク質の解析方法と解析材料 | |
| CN101124335B (zh) | 高通量蛋白组学 | |
| US20230287390A1 (en) | Compositions and methods for identifying epitopes | |
| WO2006073627A2 (en) | Vaccinia virus nucleic acids, polypeptides, and immunogenic compositions | |
| WO2007108829A2 (en) | Tuberculosis nucleic acids, polypeptides and immunogenic compositions | |
| RU2650872C1 (ru) | Искусственный ген MEL-TCI, кодирующий полиэпитопный белок-иммуноген MEL-TCI, рекомбинантная плазмидная ДНК pMEL-TCI, обеспечивающая экспрессию искусственного гена MEL-TCI и искусственный белок-иммуноген MEL-TCI, содержащий CTL- и Th-эпитопы антигенов меланомы, рестриктированные множественными аллелями HLA I и II класса | |
| RU2774820C2 (ru) | Основанные на hla способы и композиции и их применение | |
| US20020106688A1 (en) | Identification of gene sequences and gene products and their specific function and relationship to pathologies in a mammal | |
| JP2025184923A (ja) | Hlaに基づく方法および組成物ならびにそれらの使用 | |
| HK40024525A (en) | Hla-based methods and compositions and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ CZ DE DE DK DK DM DZ EC EE EE ES FI FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SK SL TJ TM TN TR TT TZ UA UG UZ VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2003500220 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002729318 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2002729318 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |