WO2002059331A1 - Mutation in vivo et recombinaison dans des champignons filamenteux - Google Patents

Mutation in vivo et recombinaison dans des champignons filamenteux Download PDF

Info

Publication number
WO2002059331A1
WO2002059331A1 PCT/DK2002/000050 DK0200050W WO02059331A1 WO 2002059331 A1 WO2002059331 A1 WO 2002059331A1 DK 0200050 W DK0200050 W DK 0200050W WO 02059331 A1 WO02059331 A1 WO 02059331A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
interest
vector
polynucleotide
mismatch repair
Prior art date
Application number
PCT/DK2002/000050
Other languages
English (en)
Inventor
Jesper Vind
Original Assignee
Novozymes A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes A/S filed Critical Novozymes A/S
Publication of WO2002059331A1 publication Critical patent/WO2002059331A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/38—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from Aspergillus

Definitions

  • the mismatch repair system is a system within cells which recognises mismatches in newly synthesised duplex polynucleotides.
  • the mismatch repair system may correct nucleotide mismatches e.g. by using the methylated "old" strand as template, or alternatively the system may mediate degradation of the double-stranded DNA sequences that comprise the mismatches. Independently of the precise mechanism, the end result will be that the mismatch repair system will limit the genetic diversity within a cell, diversity here being represented as duplex DNA sequences which comprise mismatches.
  • a duplex DNA sequence comprising a single mismatch represents a diversity of two, since there are two different DNA sequences within the cell. If the mismatch repair system corrects the single mismatch the result is a diversity of only one.
  • duplex DNA sequences comprising mismatches represent a DNA library of interest
  • the diversity of this library may be limited when transformed (introduced) into cells having an active mismatch repair system.
  • a function of the mismatch repair system in a living cell is to maintain genetic stability by minimizing the number of mutations arising e.g. from errors in DNA replication.
  • the cause of the disease can be mutations in the mismatch repair protein encoding msh2 genes (Alas M., Bruin R., Eyck L.T., Los G., Howell S. (1998) Faseb journal vol. 12 p. 653-663).
  • the cancer may occur when a msh2 mutant is expressed in cells, even if there is a functional wildtype msh2 gene present as well.
  • the MSH2 protein binds to the MSH6 protein forming a MSH-complex, which in turn binds to mismatch containing DNA heteroduplexes, the MSH-complex then becomes active in repairing the DNA, utilizing ATP in the process.
  • a dominant negative mutant MSH2 protein may bind to the MSH6 protein creating an inactive MSH-complex, which does not bind to heteroduplex DNA. The binding of the mutant MSH2 protein to MSH6 protein thus leaves less free MSH6 protein to form active MSH- complex with wildtype MSH2 protein.
  • Another dominant negative MSH2 protein may likewise create an inactive MSH-complex, which does bind to the heteroduplex DNA but remains inactive e.g. due to reduced ATPase activity.
  • WO 97/37011 describes yeast cells wherein the mismatch repair system is inactivated.
  • WO 97/05268 describes mice cells wherein the mismatch repair system is inactivated.
  • the problem to be solved by the present invention is to provide means and method suitable for the efficient making of diverse polynucleotide libraries in filamentous fungal cells.
  • a filamentous fungal cell population comprising a polynucleotide library may be used to select a polynucleotide encoding a polypeptide of interest.
  • Polynucleotides with particular properties may also be selected, such as promoters, terminators and other regulatory elements with changed/improved properties.
  • the solution is based on the present inventors demonstrating herein that expression of a gene encoding a dominant negative mutant of a mismatch repair protein in a wildtype filamentous fungal cell reduces the mismatch repair repair efficiency in said cell to "mutator phenotype" level.
  • the mismatch repair gene that was mutated and expressed herein was previously cloned and identified by the present inventors (WO 00/50567) as encoding the protein MSH2, this was the first gene cloned which is involved in the mismatch repair system of a filamentous fungal cell.
  • the present invention relates to a filamentous fungal cell
  • mutant negative mutant of a protein in the present context means a mutant protein which, when expressed in a cell wherein a wildtype of the same protein is also is expressed, dominates the wildtype protein and effectively renders the cell having a mutant phenotype.
  • expression of a dominant negative msh2 mutant in a wildtype cell will result in a cell having a MSH2 mutant phenotype.
  • dominant negative MSH2-mutants are given in the examples herein (G648A, K649A, and S650A).
  • Other dominant negative repair protein mutants are known in the art see: (Studamire et al., vide
  • mismatch repair protein herein means a protein involved in nucleotide mismatch repair of heteroduplex polynucleotides such as DNA.
  • mismatch repair proteins and genes encoding such proteins are given below and include MutS, MutL, MutH, MSH2, MSH3, MSH6, MLH1 , MLH3, PMS1 , MutM, MutY, MutT, MutH, HexA, HexB, and
  • reduced mismatch repair efficiency is used synonymously herein with the terms “mutator phenotype” and "increased mutation rate/frequency".
  • a reduced mismatch repair efficiency in a cell results in a build-up within the cell of mismatch mutations that constantly occur in all cells e.g. during replication.
  • the actual overall mutation frequency may be the same in a wildtype cell and in a mutated cell having a reduced mismatch repair efficiency, for all practical purposes in the present context, the observed phenotype of the mutant cell will appear to be that of an increased frequency of mutation.
  • the frequency of mutation can be determined by performing an assay if necessary.
  • Genomic integration of the gene encoding the dominant negative mutant is one way.
  • Another way is to introduce into the filamentous fungal cell a stably maintained extrachromosomal genetic element, such as a plasmid, which comprises at least one copy of the gene encoding the dominant negative mutant. More copies may provide a further advantage.
  • the present invention also provides an extrachromosomal genetic element suitable for creating a cell of the first aspect, wherein said element is capable of autonomous maintenance in a filamentous fungal cell, and comprises at least one copy of the gene encoding the dominant negative mutant as well as at least one copy of a polynucleotide encoding a polypeptide of interest.
  • the present invention relates to a recombinant vector capable of autonomous maintenance in a filamentous fungal cell, the vector comprising at least one copy of a gene encoding a dominant negative mutant of a mismatch repair protein.
  • autonomous maintenance is well-recognized in the art and means that the vector is properly replicated and segregated in the progeny cells during cell division, so that the vector is not lost from the cell during growth.
  • the present inventors anticipate that it may be advantageous to have two, three, four or more copies of the gene encoding a dominant negative mutant of a mismatch repair protein comprised in the vector of the second aspect.
  • This approach provides a library with a higher diversity as compared to a library made in a wildtype filamentous fungal cell.
  • Replication herein has the recognized meaning known in the art, wherein the two strands of a polynucleotide duplex are replicated such that two separate sets of double- stranded polynucleotides are generated, each being based on a separate strand of the two original strands.
  • the diversity of the library may be increased by doing several cycles of replication e.g. repeating step (b) of the third aspect of the invention, wherein the diversity increases with each replication cycle.
  • Introducing polynucleotides into a filamentous cell may be done according to any of the many suitable techniques, such as transformation techniques. See the general fungal textbook “Fungal Genetic” (1996, ISBN 0-8247-9544-X) for a further description of such standard techniques.
  • the polynucleotide of interest may be comprised in a plasmid wherein the plasmid is characterised by that it comprises a suitable replication initiating sequence and optionally a suitable selectable marker as described above.
  • the suitable replication initiating sequence is AMA1 (Gems, D., et al. (1991 , Gene 98:61-67).
  • Cultivating a filamentous fungal cell may be done in any of the numerous suitable known media for growing filamentous fungal cells. It is within the skilled persons general knowledge to choose such a suitable media.
  • the mismatch repair system Since inactivation of the mismatch repair system normally will cause accumulation of mutations on the chromosomal DNA within the cell and thereby maybe make lethal mutations to the cell the actual preferred number of replication cycles as described above will depend on how fast such potential lethal mutations arise. It is within the skilled persons general knowledge to determine how many of duplication cycles it preferred. Due to these potential lethal mutations it may be preferred that the mismatch repair system has been inactivated transitorily. Then, after suitable cycles of replication according to step (b) of the third aspect, the transitorily inactivated mismatch repair system may then be re-activated in order to avoid lethal mutations in the filamentous fungal cell during later cultivation.
  • the present invention relates to a method for preparing a filamentous fungal cell comprising a diverse polynucleotide library of interest, the process comprising: a) introducing a polynucleotide of interest or a polynucleotide library of interest into a filamentous fungal cell as defined in the first aspect; and b) cultivating the cell of (a) under conditions allowing the polynucleotide of interest or the polynucleotide library of interest to be replicated at least once.
  • a filamentous fungal cell of the first aspect of the invention is very suitable for making a diverse polynucleotide library of interest. Accordingly, in a fourth aspect the present invention relates to the use of a filamentous fungal cell as defined in the first aspect for the generation of a diverse polynucleotide library of interest.
  • Industrially interesting polypeptides include pharmaceutical proteins and peptides, enzymes, antibodies, peptide-hormones, antimicrobial peptides, fungicidal peptides, and herbicidal peptides.
  • the present invention relates to a process for producing a polypeptide of interest, the method comprising: o a) introducing a polynucleotide of interest or a polynucleotide library of interest into a filamentous fungal cell as defined in the first aspect; b) cultivating the cell of step (a) under conditions allowing the polynucleotide of interest or the polynucleotide library of interest to be replicated at least once; c) selecting a polynucleotide encoding a polypeptide of interest from the at least once s replicated polynucleotides of step (b); and d) expressing the selected polynucleotide in a suitable expression system to produce the polypeptide of interest.
  • the desired polynucleotide of interest may be a polynucleotide encoding any polypeptide comprising a desired technical feature, such as improved stability (shelf-life); o improved temperature stability; changed/improved specific activity; pH optimum; improved wash performance in a detergent etc.
  • the fungal cell is cultivated in a suitable medium and under suitable conditions for screening or selecting for a cell harbouring the polynucleotide of interest having or encoding a desired characteristic.
  • the cultivation may be performed in accordance with methods well- 5 known in the art for screening of polynucleotide variant libraries.
  • the selected polynucleotide may be expressed by a suitable expression system of the art such as described elsewhere herein.
  • an advantage of the method of the final aspect may be that the polynucleotide of interest is selected from a filamentous fungal cell expressing the polynucleotide. 0 Consequently, it is directly known that the polynucleotide can be expressed from a filamentous fungal cell, which is useful if it is subsequently intended to express the polypeptide of interest in large scale in a filamentous fungal cell.
  • This may be of particular interest when the polynucleotide library encodes polypeptides of interest which are derived from filamentous fungal cells, since it is known that filamentous fungal polypeptides preferably 5 are produced in industrial relevant high yields in filamentous fungal cells. This is contrary to a similar selection process using e.g. a yeast cell.
  • the selected polypeptide is capable of being expressed in yeast and later expression a filamentous fungal cell might give problems, especially if high yields are required.
  • polypeptides are of industrial interest and are produced industrially in large scale plants, it is of industrial interest to diversify polynucleotides that encode polypeptides of interest in order to obtain libraries for later screening for polypeptides with changed and/or improved properties.
  • a cell of the first aspect of the invention is useful for making such polynucleotide libraries.
  • a gene denotes herein a gene (a DNA sequence) which encodes a polypeptide according to the art.
  • a gene is defined as an open reading frame (ORF) starting from a start codon (normally “ATG”, “GTG”, or “TTG”) and ending at a stop codon (normally "TAA”, TAG” or “TGA”).
  • Such standard elements may include a promoter, a ribosomal binding site, a termination sequence, and may be others elements as known in the art.
  • Suitable assays to test whether or not a filamentous fungal cell as described herein has a reduced mismatch repair efficiency are described in the examples below and include a Chlorate-resistance assay and a “gel shift assay” (also described in WO 97/05268, page 16,17 and 25).
  • sequence identity in relation to the terms "a DNA sequence encoding a polypeptide sequence which is at least 70% identical to the polypeptide sequence" is determined as the degree of identity between two sequences indicating a derivation of the first sequence from the second.
  • the identity may suitably be determined by means of computer programs known in the art such as GAP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711) (Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453).
  • the polypeptide encoded by an analogous DNA sequence of the invention exhibits a degree of identity preferably of at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%, and especially at least 97% with the amino acid sequence in question.
  • a diverse library preferably comprises at least 1000 different polynucleotides, more preferably at least 10000 different polynucleotides, and even more preferably at least 100000 different polynucleotides.
  • the filamentous fungal cell The filamentous fungal cell
  • the filamentous fungal cell as described herein includes all filamentous forms of the subdivision Eumycota and Oomycota.
  • the filamentous fungi are characterised by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
  • the filamentous fungal cell is a cell of a species of, but is not limited to, Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Scytalidium, Thielavia, Tolypocladium, and Trichoderma.
  • filamentous fungal cells of use in the present invention include an Aspergillus cell, an Acremonium cell, a Fusarium cell, a Humicola cell, a Mucor cell, a Myceliophthora cell, a Neurospora cell, a Penicillium cell, a Thielavia cell, a Tolypocladium cell, and a Trichoderma cell.
  • the filamentous fungal cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae cell; a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotricioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum cell or a Fusarium
  • a Humicola insolens cell or a Humicola lanuginosa cell a Mucor miehei cell; a Myceliophthora thermophila cell; a Neurospora crassa cell; a Penicillium purpurogenum cell; a Thielavia terrestris cell; or a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
  • the term "fungal replication initiating sequence” is defined as a nucleic acid sequence which is capable of supporting autonomous maintenance/replication of an extrachromosomal molecule e.g. a plasmid in a filamentous fungal cell, normally without structural rearrangement of the plasmid or integration into the host cell genome.
  • the replication initiating sequence may be of any origin as long as it is capable of mediating replication initiating activity in a fungal cell.
  • the replication initiating sequence is obtained from a filamentous fungal cell, more preferably a strain of Aspergillus, Fusarium or Alternaria, and even more preferably, a strain of A. nidulans, A. oryzae, A. niger, F. oxysporum or Alternaria alternateata.
  • a replication initiating sequence may be identified by methods well-known in the art. For instance, the sequence may be identified among genomic fragments derived from the organism in question as a sequence capable of sustaining autonomous replication in yeast, (Ballance and Turner, Gene, 36 (1985), 321-331), an indication of a capability of autonomous replication in filamentous fungal cells.
  • the replication initiating activity in fungi of a given sequence may also be determined by transforming fungi with contemplated plasmid replicators and selecting for colonies having an irregular morphology, indicating loss of a sectorial plasmid which in turn would lead to lack of growth on selective medium when selecting for a gene found on the plasmid (Gems et al, Gene, 98 (1991 ) 61-67).
  • AMA1 was isolated in this way.
  • An alternative way to isolate a replication initiating sequence is to isolate natural occurring plasmids (e.g. as disclosed by Tsuge et al., Genetics 146 (1997) 111-120 for Alternaria aternata).
  • replication initiating sequences include, but are not limited to, the ANSI and AMA1 sequences of Aspergillus nidulans, e.g., as described, respectively, by Cullen, D., et al. (1987, Nucleic Acids Res. 15:9163-9175) and Gems, D., et al. (1991 , Gene 98:61-67).
  • replication initiating activity is used herein in its conventional meaning, i.e. to indicate that the sequence is capable of supporting autonomous replication of an extrachromosomal molecule, such as a plasmid or a DNA vector in a fungal cell.
  • selective pressure is defined herein as culturing a filamentous fungal cell, containing a DNA vector containing a fungal selective marker gene operably linked to a polynucleotide sequence of interest, in the presence of an effective amount or the absence of an appropriate selective agent.
  • the effective amount of the selective agent is defined herein as an amount sufficient for allowing the selection of cells containing the selection marker from cells which do not contain the selection marker.
  • the fungal selective marker is selected from the group of genes which encodes a product capable of providing resistance to biocide or viral toxicity, resistance to heavy metal toxicity, or prototrophy to auxotrophs.
  • the prototrophy is obtained from an enzyme selected from the group of metabolic pathways consisting of nucleotide synthesis, cofactor synthesis, amino acid synthesis, acetamide metabolism, proline metabolism, sulfate metabolism, and nitrate metabolism.
  • the fungal selective marker is a gene selected from the group consisting of argB (ornithine carbamoyltransferase), amdS (acetamidase), bar (phosphinothhcin acetyltransferase), hemA (5-aminolevulinate synthase), hemB (porphobilinogen synthase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), prn (proline permease), pyrG (orotidine-5'- phosphate decarboxylase), pyroA, riboB, sC (sulfate adenyltransferase), and trpC (anthranilate synthase).
  • argB ornithine carbamoyltransferase
  • amdS acetamidase
  • bar phosphinothhcin acetyltrans
  • the present invention also relates to polynucleotides having a nucleotide sequence which may code for a polypeptide of interest.
  • the techniques used to isolate or clone a polynucleotide are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof.
  • the cloning of a polynucleotide of the present invention from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al., 1990, PCR: A Guide to Methods and
  • LCR ligase chain reaction
  • LAT ligated activated transcription
  • NASBA nucleotide sequence-based amplification
  • the nucleotide sequence may be cloned from a filamentous fungal strain or another related organism and thus, for example, may be an allelic or species variant of the polypeptide encoding region of the polynucleotide.
  • the polynucleotide may be obtained by standard cloning procedures used in genetic engineering to relocate the polynucleotide from its natural location to a different site where it will be reproduced.
  • the cloning procedures may involve excision and isolation of a desired fragment comprising the polynucleotide encoding the polypeptide, insertion of the fragment into a vector molecule, and incorporation of the recombinant vector into a host cell where multiple copies or clones of the polynucleotide will be replicated.
  • the polynucleotide may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.
  • Modification of a polynucleotide of the present invention may be necessary for the synthesis of an encoded polypeptide, which comprises an amino acid sequence that has at least one substitution, deletion and/or insertion.
  • These artificial variants may differ in some engineered way from the polypeptide isolated from its native source, e.g., variants that differ in specific activity, thermostability, pH optimum, or the like.
  • amino acid residues essential to the activity of the polypeptide encoded by the nucleotide sequence of the invention may be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, mutations are introduced at every positively charged residue in the molecule, and the resultant mutant molecules are tested for activity to identify amino acid residues that are critical to the activity of the molecule.
  • Sites of substrate-enzyme interaction can also be determined by analysis of the three-dimensional structure as determined by such techniques as nuclear magnetic resonance analysis, crystallography or photoaffinity labelling (see, e.g., de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, Journal of Molecular Biology 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).
  • a polynucleotide encoding a polypeptide of the present invention may be modified by introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the polypeptide encoded by the nucleotide sequence, but which correspond to the codon usage of the host organism intended for production of the enzyme.
  • the introduction of a mutation into the polynucleotide to exchange one nucleotide for another nucleotide may be accomplished by site-directed mutagenesis using any of the methods known in the art. Particularly useful is the procedure, which utilizes a supercoiled, double stranded DNA vector with an insert of interest and two synthetic primers containing the desired mutation.
  • the oligonucleotide primers, each complementary to opposite strands of the vector extend during temperature cycling by means of e.g. Pfu DNA polymerase. On incorporation of the primers, a mutated plasmid containing staggered nicks is generated.
  • Dpnl is specific for methylated and hemimethylated DNA to digest the parental DNA template and to select for mutation-containing synthesized DNA.
  • Other procedures known in the art may also be used.
  • nucleotide substitution see, e.g., Ford et al., 1991, Protein Expression and Purification 2: 95-107.
  • Nucleic Acid Constructs The present invention also relates to nucleic acid constructs or extrachromosomal genetic elements comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the polynucleotide in a suitable host cell under conditions compatible with the control sequences.
  • a nucleotide sequence encoding a polypeptide of the present invention may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the nucleotide sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying nucleotide sequences utilizing recombinant DNA methods are well known in the art.
  • the control sequence may be an appropriate promoter sequence, a nucleotide sequence which is recognized by a host cell for expression of the nucleotide sequence.
  • the promoter sequence contains transcriptional control sequences, which mediate the expression of the polypeptide.
  • the promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
  • promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae those phosphate iso erase, Aspergillus nidulans acetamidase, and Fusarium oxysporum trypsin-like protease (WO 96/00787), as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for Asperg,
  • the control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription.
  • the terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.
  • Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin- like protease.
  • the control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell.
  • the leader sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention. o Preferred leaders for filamentous fungal host cells are obtained from the genes for
  • the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleotide sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA.
  • Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
  • Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin-like protease, and o Aspergillus niger alpha-glucosidase.
  • the control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway.
  • the 5' end of the coding sequence of the nucleotide sequence may inherently contain a signal peptide coding region naturally linked in 5 translation reading frame with the segment of the coding region which encodes the secreted polypeptide.
  • the 5' end of the coding sequence may contain a signal peptide coding region which is foreign to the coding sequence.
  • the foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region.
  • the foreign signal peptide coding region may simply 0 replace the natural signal peptide coding region in order to enhance secretion of the polypeptide.
  • any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of choice may be used in the present invention.
  • Effective signal peptide coding regions for filamentous fungal host cells are the signal 5 peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase.
  • the control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide.
  • the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
  • a propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
  • the propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila laccase (WO 95/33836).
  • the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region. It may also be desirable to add regulatory sequences which allow the regulation of the expression of the polynucleotide or gene relative to the growth of the host cell. Examples of regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
  • the TAKA alpha-amylase promoter, Aspergillus niger glucoamylase promoter, and Aspergillus oryzae glucoamylase promoter may be used as regulatory sequences.
  • Other examples of regulatory sequences are those which allow for gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene which is amplified in the presence of methotrexate, and the metallothionein genes which are amplified with heavy metals. In these cases, the nucleotide sequence encoding the polypeptide would be operably linked with the regulatory sequence.
  • the present invention also relates to recombinant vectors and expression vectors/systems comprising the polynucleotide construct of the invention.
  • the various polynucleotide and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the nucleotide sequence encoding the polypeptide at such sites.
  • the nucleotide sequence of the present invention may be expressed by inserting the nucleotide sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression.
  • the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
  • the recombinant expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleotide sequence.
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vectors may be linear or closed circular plasmids.
  • the vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • a vector which exists as an extrachromosomal entity the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • the vector may contain any means for assuring self-replication.
  • the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
  • the vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed cells.
  • a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
  • Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (omithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), trpC (anthranilate synthase), as well as equivalents thereof.
  • amdS acetamidase
  • argB omithine carbamoyltransferase
  • bar phosphinothricin acetyltransferase
  • hygB hygromycin phosphotransferase
  • niaD nitrate reductase
  • amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus.
  • the vectors of the present invention preferably contain an element(s) that permits stable integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
  • the vector may rely on the nucleotide sequence encoding the polypeptide or any other element of the vector for stable integration of the vector into the genome by homologous or nonhomologous recombination.
  • the vector may contain additional nucleotide sequences for directing integration by homologous recombination into the genome of the host cell. The additional nucleotide sequences enable the vector to be integrated into the host cell genome at a precise location(s) in the chromosome(s).
  • the integrational elements should preferably contain a sufficient number of nucleotides, such as 100 to 1 ,500 base pairs, preferably 400 to 1 ,500 base pairs, and most preferably 800 to 1 ,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination.
  • the integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell.
  • the integrational elements may be non-encoding or encoding nucleotide sequences.
  • the vector may be integrated into the genome of the host cell by non-homologous recombination.
  • the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
  • More than one copy of a nucleotide sequence of the present invention may be inserted into the host cell to increase production of the gene product.
  • An increase in the copy number of the nucleotide sequence can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the nucleotide sequence where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the nucleotide sequence, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
  • the procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra).
  • Filamentous fungal cell "Filamentous fungi” include all filamentous forms of the subdivision Eumycota and
  • Oomycota (as defined by Hawksworth et al., 1995, supra).
  • the filamentous fungi are characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccha des.
  • Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.
  • vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
  • the filamentous fungal cell is a cell of a species of, but not limited to, Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, or Trichoderma.
  • the filamentous fungal cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae cell.
  • the filamentous fungal host cell is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell.
  • the filamentous fungal cell is a Fusarium venenatum (Nirenberg sp. nov.) cell.
  • the filamentous fungal cell is a Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81 : 1470- 1474. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156 and WO 96/00787.
  • the first aspect of the invention relates to a filamentous fungal cell comprising at least one copy of a gene encoding a dominant negative mutant of a mismatch repair protein, wherein the cell has a reduced mismatch repair efficiency as compared to a wildtype cell.
  • mismatch repair proteins are known in the art, as referenced elsewhere herein, the mismatch repair systems are well conserved throughout bacteria, fungi and even mammals. It is anticipated that dominant negative mutants of repair proteins homolgous to those of filamentous fungi will work in the present invention.
  • repair proteins as MutS, MutL, MutH, MSH2, MSH3, MSH6, MLH1 , MLH3, PMS1 , MutM, MutY, MutT, MutH, HexA, HexB, and GTBP/p160.
  • the invention relates to a cell of the first aspect, wherein the gene encodes a dominant negative mutant of a homologue of a mismatch repair protein selected from the group consisting of MutS, MutL, MutH, MSH2, MSH3, MSH6, MLH1 , MLH3, PMS1 , MutM, MutY, MutT, MutH, HexA, HexB, and GTBP/p160. It is of particular interest in the present invention to use a dominant negative mutant of a mismatch repair protein, which is endogenous to the cell, since an endogenous mutant protein is likely to interact with the mismatch repair system of the cell in a dominant negative fashion.
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the gene encodes a dominant negative mutant of a mismatch repair protein, which is endogenous to the cell.
  • Another preferred embodiment of the invention relates to a cell of the first aspect, wherein the gene encodes a dominant negative mutant of the mismatch repair protein MSH2,
  • MSH3, or MSH6 preferably the gene encodes a dominant negative mutant of the mismatch repair protein MSH2.
  • Studamire et al. report that an important target for mutagenesis in mismatch repair proteins is the phospate binding loop consensus sequence since mutations in this loop reduces ATPase activity and results in a dominant negative mutator phenotype (Studamire B.,
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the gene encodes a dominant negative mutant mismatch repair protein which has a reduced ATPase activity when compared to the wildtype protein; preferably the gene encodes a dominant negative mutant mismatch repair protein which has a more than 10% reduced, preferably 20%, or 30%, even 40%, more preferably 50%, or 60%, or even 70%, and most preferably 80% reduced ATPase activity when compared to the wildtype protein.
  • Another preferred embodiment of the invention relates to a cell of the first aspect, wherein the gene encodes a dominant negative mutant mismatch repair protein which is mutated in the phosphate binding loop consensus sequence.
  • Another preferred embodiment of the invention relates to a cell of the first aspect, wherein the gene encodes a dominant negative mutant mismatch repair protein which is mutated in the C-terminal half of the protein.
  • a way to make a filamentous fungal cell wherein it is possible to transitorily inactivate the mismatch repair system is by expressing the gene encoding the dominant negative mutant repair protein in a transitory manner from an artificially regulated promoter, preferably an inducible and/or repressible promoter.
  • the invention relates to a cell of the first aspect, wherein the gene is expressed by an inducible and/or repressible promoter.
  • the cell of the first aspect may be constructed by integrating the at least one copy of the gene encoding the dominant negative mutant repair protein in the genome of the cell by using standard techniques for genomic integration e.g. homologous recombination with or without antibiotic selection.
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the at least one copy of the gene is integrated in the genome of the cell.
  • the at least one copy of the gene is comprised in an extrachromosomal genetic element, since this would allow the use of a wider range of filamentous fungal cells without having to go through the trouble of integrating the gene into the genome of each cell, this would of course require that the genetic element is capable of autonomous maintenance in a filamentous fungal cell.
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the at least one copy of the gene is comprised in an extrachromosomal genetic element which is capable of autonomous maintenance in a filamentous fungal cell.
  • an extrachromosomal genetic element which is capable of autonomous maintenance in a filamentous fungal cell.
  • a well-characterized stabilizing element in filamentous fungi is the AMA1 -sequence, also described in WO 00/24883.
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the genetic element is a vector comprising an AMA1 -sequence.
  • One of the key features of the present invention is the achievement of a reduced mismatch repair efficiency in a fungal cell.
  • the observable phenotype of a cell having a reduced mismatch repair efficiency is a "mutator phenotype".
  • mutator phenotype we show how the mismatch repair efficiency can be measured by way of resulting mutation frequency.
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the cell has at least a 20% reduced mismatch repair efficiency when compared to a wildtype cell, preferably at least 30%, or at least 40%, even at least 50%, more preferably at least 60%, or at least 70%, or at least 80%, or most preferably at least 90% reduced mismatch repair efficiency when compared to a wildtype cell.
  • Polypeptides are of considerably commercial interest, especially polypeptides that have new and/or improved properties compared to the existing ones.
  • desirable properties in this respect could be related to stability, activity, specificity, allergenicity, toxicity etc.
  • Ways of improving and/or changing the properties of a particular polypeptide are not straightforward since the molecules are complex and many of the molecular mechanisms underlying these properties are not yet fully understood.
  • a preferred embodiment of the invention relates to a cell of the first aspect, further comprising at least one copy of a polynucleotide encoding a polypeptide of interest.
  • the polypeptide is an enzyme; preferably the enzyme is an amylolytic enzyme, a lipolytic enzyme, a proteolytic enzyme, a cellulytic enzyme, an oxidoreductase or a plant cell-wall degrading enzyme, more preferably it is an enzyme with an activity selected from the group consisting of aminopeptidase, amylase, amyloglucosidase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, galactosidase, beta- galacto
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the at least one copy of the polynucleotide is integrated in the genome of the cell.
  • the at least one copy of the polynucleotide is comprised in an extrachromosomal genetic element, since this would allow the use of a wider range of filamentous fungal cells without having to go through the trouble of integrating the gene into the genome of each cell.
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the at least one copy of the polynucleotide is comprised in an extrachromosomal genetic element which is capable of autonomous maintenance in a filamentous fungal cell; preferably the genetic element is a vector comprising an AMA1- sequence; more preferably the vector further comprises at least one copy of the gene of the first aspect encoding a dominant negative mutant repair protein.
  • the art describes a plasmid pAAT56 derived from the filamentous fungus Alternaria alternata (I. Kaneko et al., Structural analysis of the plasmid pAAT56 of the filamentous fungus Alternaria alternata, 1997, Gene 203:51-57).
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the genetic element is a plasmid pAAT56 derivative.
  • the genetic element is a plasmid pAAT56 derivative.
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the genetic element is replicated by an error-prone polymerase; preferably the error-prone polymerase is a reverse transchptase.
  • a polynucleotide encoding the error-prone polymerase is comprised in the extrachromosomal genetic element(s) of the preceding embodiments.
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the genetic element comprises a polynucleotide encoding the error-prone polymerase.
  • the filamentous fungi of the present invention are many, however a cell of the genus
  • Fusarium or Aspergillus is preferred, in particular a cell of the species Fusarium oxysporum, Fusarium venenatum, Aspergillus nidulans, Aspergillus oryzae, or Aspergillus niger
  • a preferred embodiment of the invention relates to a cell of the first aspect, wherein the filamentous fungal cell is a Fusarium or Aspergillus cell, preferably of the species Fusarium oxysporum, Fusarium venenatum, Aspergillus nidulans, Aspergillus oryzae, or Aspergillus niger.
  • the filamentous fungal cell is a Fusarium or Aspergillus cell, preferably of the species Fusarium oxysporum, Fusarium venenatum, Aspergillus nidulans, Aspergillus oryzae, or Aspergillus niger.
  • one way to construct a cell of first aspect of the invention could simply be to introduce into a wildtype cell a suitable extrachromosomal element or recombinant vector comprising at least one copy of a gene encoding a dominant negative mutant of a mismatch repair protein.
  • a second aspect of the invention relates to a recombinant vector capable of autonomous maintenance in a filamentous fungal cell, the vector comprising at least one copy of a gene encoding a dominant negative mutant of a mismatch repair protein.
  • a preferred embodiment of the invention relates to a vector of the second aspect, and the reasoning behind these is similar to what has already been outlined above.
  • a preferred embodiment of the invention relates to a vector of the second aspect, which comprises an AMA1 sequence.
  • Another preferred embodiment of the invention relates to a vector of the second aspect, which is derived from plasmid pAAT56. Yet another preferred embodiment of the invention relates to a vector of the second aspect, wherein the dominant negative mutant is a mutant homologue of a mismatch repair protein selected from the group consisting of MutS, MutL, MutH, MSH2, MSH3, MSH6, MLH1 , MLH3, PMS1 , MutM, MutY, MutT, MutH, HexA, HexB, and GTBP/p160.
  • the dominant negative mutant is a mutant homologue of a mismatch repair protein selected from the group consisting of MutS, MutL, MutH, MSH2, MSH3, MSH6, MLH1 , MLH3, PMS1 , MutM, MutY, MutT, MutH, HexA, HexB, and GTBP/p160.
  • Still another preferred embodiment of the invention relates to a vector of the second aspect, wherein the dominant negative mutant is a mutant of the mismatch repair protein MSH2, MSH3, or MSH6.
  • One preferred embodiment of the invention relates to a vector of the second aspect, wherein the dominant negative mutant is a mutant mismatch repair protein which has a reduced ATPase activity when compared to the wildtype protein; preferably the dominant negative mutant is a mutant mismatch repair protein which has a more than 10% reduced ATPase activity when compared to the wildtype protein, preferably more than 20%, or more than 30%, even more than 40%, more preferably more than 50%, or more than 60%, or even more than 70%, and most preferably more than 80% reduced ATPase activity when compared to the wildtype protein
  • the dominant negative mutant is a mutant mismatch repair protein which is mutated in the phosphate binding loop consensus sequence.
  • One more preferred embodiment of the invention relates to a vector of the second aspect, wherein the dominant negative mutant is a mutant mismatch repair protein which is mutated in the Walker type A nucleotide binding motif.
  • a preferred embodiment of the invention relates to a vector of the second aspect, wherein the dominant negative mutant is a mutant mismatch repair protein which is mutated in the C-terminal half of the protein.
  • Another preferred embodiment of the invention relates to a vector of the second aspect, wherein the gene encoding the dominant negative mutant is expressed by an inducible and/or repressible promoter.
  • One other preferred embodiment of the invention relates to a vector of the second aspect, wherein the vector further comprises at least one copy of a polynucleotide encoding a polypeptide of interest; preferably an enzyme, more preferably an amylolytic enzyme, a lipolytic enzyme, a proteolytic enzyme, a cellulytic enzyme, an oxidoreductase or a plant cell- wall degrading enzyme; and most preferably an enzyme having an activity selected from the group consisting of aminopeptidase, amylase, amyloglucosidase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodexthn glycosyltransferase, deoxyribonuclease, esterase, galactosidase, beta-galactosidase, glucoamylase, glucose oxidase, glucosidase, halo
  • a preferred embodiment of the invention relates to a vector of the second aspect, which further comprises a polynucleotide encoding an error-prone polymerase, preferably a reverse transchptase; preferably the vector is replicated by the error-prone polymerase.
  • the present invention relates to a method for preparing a filamentous fungal cell comprising a diverse polynucleotide library of interest.
  • the present invention relates to many different filamentous fungal cells, however a preferred embodiment of the invention relates to a method of the third aspect, wherein the filamentous fungal cell is a Fusarium or Aspergillus cell, preferably of the species Fusarium oxysporum, Fusarium venenatum, Aspergillus nidulans, Aspergillus oryzae, or Aspergillus niger.
  • the filamentous fungal cell is a Fusarium or Aspergillus cell, preferably of the species Fusarium oxysporum, Fusarium venenatum, Aspergillus nidulans, Aspergillus oryzae, or Aspergillus niger.
  • a preferred embodiment of the invention relates to a method of the third aspect, wherein the polynucleotide of interest or polynucleotide library of interest comprises shuffled polynucleotides.
  • a preferred embodiment of the invention relates to a method of the third aspect, wherein the polynucleotide of interest or polynucleotide library of interest encodes a polypeptide of interest, preferably the an enzyme, and more preferably an amylolytic enzyme, a lipolytic enzyme, a proteolytic enzyme, a cellulytic enzyme, an oxidoreductase or a plant cell-wall degrading enzyme.
  • Yet another preferred embodiment of the invention relates to a method of the third aspect, wherein the polynucleotide of interest or polynucleotide library of interest is comprised in a recombinant vector as defined in the second aspect herein.
  • shuffling procedures may be used to diversify a polynucleotide library, however such diversification may also be achieved through an in vivo recombination event(s) between non-identical polynucleotides.
  • shuffled polynucleotides are introduced into a cell of the first aspect according to the method of the third aspect, there may be several non- identical polynucleotides within one cell both before and after one or more rounds of replication. T Consequently, a preferred embodiment of the invention relates to a method of the third aspect, wherein one or more in vivo recombination event(s) takes place in step b) between non-identical polynucleotides of interest.
  • a fourth aspect of the invention relates to the use of a filamentous fungal cell as defined in the first aspect herein for the generation of a diverse polynucleotide library of interest.
  • the final aspect relates to a process for producing a polypeptide of interest, wherein a polynucleotide encoding a polypeptide of interest is selected from a diverse library of polynucleotides produced by a method of the third aspect and present in a cell of the first aspect, and expressing the selected polynucleotide in a suitable expression system to produce the polypeptide of interest.
  • the present invention also relates to methods for producing a polypeptide of the present invention comprising (a) cultivating a strain, which in its wild-type form is capable of producing the polypeptide; and (b) recovering the polypeptide.
  • the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art.
  • the cell may be cultivated by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated.
  • the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
  • the polypeptides may be detected using methods known in the art that are specific for the polypeptides. These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide as described herein.
  • the resulting polypeptide may be recovered by methods known in the art.
  • the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
  • polypeptides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
  • electrophoretic procedures e.g., preparative isoelectric focusing
  • differential solubility e.g., ammonium sulfate precipitation
  • SDS-PAGE or extraction
  • Chemicals used as buffers and substrates were commercial products of at least reagent grade.
  • Plasmids pENI1298 and pENI1299 were described in WO 00/24883.
  • the plasmid pENI1298 was further developed in order to decrease plasmid size (thus improve transformation), improve expression (by improving promoter), have expression in E. coli lor improved library screening (by improving same promoter), ease cloning (by introducing unique restriction sites downstream of promoter), ease cloning (by using the Gateway cloning technology).
  • Plasmid pENI1960 was made using the Gateway VectorTM conversion system
  • Plasmid pENI1902 was made in order to have a promoter that works in both E.coli and Aspergillus. This was done by unique site elimination using the "Chameleon double stranded site-directed mutagenesis kit" as recommended by Stratagene ® . Plasmid pENI1861 was used as template and the following primers were used as selection primers ("5'P" indicates a 5 ' phosphorylation of the primer):
  • the 080399J19 primer was used as mutagenic primer to introduce a -35 and -10 promoter consensus sequence (from E.coli) in the Aspergillus expression promoter. io Introduction of the mutations was verified by sequencing.
  • Plasmid pENI1861 was made in order to have the state of the art Aspergillus promoter in the expression plasmid, as well as a number of unique restriction sites for cloning.
  • a PCR fragment (app. 620 bp) was made using pMT2188 (see Example 5) as template and the following primers:
  • the fragment was cut BssHII and Bgl II, and cloned into pENI1849 which was also cut with BssHII and Bgl II. The cloning was verified by sequencing.
  • Plasmid pENI1849 was made in order to truncate the pyrG gene to the essential sequences for pyrG expression, in order to decrease the size of the plasmid, thus improving transformation frequency.
  • a PCR fragment (app. 1800 bp) was made using pENI1299 as template and the following primers:
  • 270999J8 (SEQ ID 7): 5" tctgtgaggcctatggatctcagaac 270999J9 (SEQ ID 8): 5' gatgctgcatgcacaactgcacctcag
  • the Aspergillus oryzae expression plasmid pCaHj 483 (WO 98/00529) consists of an expression cassette based on the Aspergillus niger neutral amylase II promoter fused to the Aspergillus nidulans those phosphate isomerase non translated leader sequence (Pna2/tpi) and the A. niger amyloglycosidase terminater (Tamg). Also present on the plasmid is the Aspergillus selective marker amdS from A. nidulans enabling growth on acetamide as sole nitrogen source. These elements are cloned into the E. coli vector pUC19 (New England Biolabs). The ampicillin resistance marker enabling selection in E. coli of this plasmid was replaced with the URA3 marker of Saccharomyces cerevisiae that can complement a pyrF mutation in E. coli, the replacement was done in the following way:
  • the pUC19 origin of replication was PCR amplified from pCaHj483 with the primers:
  • Primer 142780 introduces a Bbu ⁇ site in the PCR fragment.
  • the Expand PCR system Roche Molecular Biochemicals, Basel, Switserland
  • the URA3 gene was amplified from the general S. cerevisiae cloning vector pYES2
  • Primer 140288 introduces an EcoRI site in the PCR fragment.
  • the two PCR fragments were fused by mixing them and amplifying using the primers 142780 and 140288 in the splicing by overlap method (Horton et al (1989) Gene, 77, 61-68).
  • the resulting fragment was digested with EcoRI and Bbu ⁇ and ligated to the largest fragment of pCaHj 483 digested with the same enzymes.
  • the ligation mixture was used to transform the pyrF E.coli strain DB6507 (ATCC 35673) made competent by the method of Mandel and Higa (Mandel, M. and A. Higa (1970) J. Mol. Biol. 45, 154). Transformants were selected on solid M9 medium (Sambrook et. al (1989) Molecular cloning, a laboratory manual, 2. edition, Cold Spring Harbor Laboratory Press) supplemented with 1 g/l casaminoacids, 500 ⁇ g/l thiamine and 10 mg/l kanamycin.
  • a plasmid from a selected transformant was termed pCaHj527.
  • ThePna2/tpi promoter present on pCaHj527 was subjected to site directed mutagenises by a simple PCR approach.
  • Nucleotide 134 - 144 was altered from GTACTAAAACC to CCGTTAAATTT using the mutagenic primer 141223.
  • the resulting plasmid was termed pMT2188.
  • Nucleotide 423 - 436 was altered from ATGCAATTTAAACT to CGGCAATTTAACGG using the mutagenic primer 141222.
  • Primer 141222 (SEQ ID 14):
  • Primer 19671 (SEQ ID NO.15): 5'ctcccttctctgaacaataaccc; and Primer 220900J4 (SEQ ID NO.16): 5'tcccatgttaggaccagtaatgat
  • Primer 220900J2 (SEQ ID NO.19): 5'actggtcctaacatgggaggtgcgtcgacttatattcgc
  • Reaction 4 (mutation S650A): Primer 991213j5 (SEQ ID NO.17); and Primer 220900J3 (SEQ ID NO.20): 5'actggtcctaacatgggaggtaaagcgacttatattcgc Reaction 11 (wt):
  • PCR fragments were separated by electrophoresis and purified from an 1.5 % agarose gel, and four additional PCR reactions were carried out using PWO polymerase and buffer as described by the manufacturer (Boehringer MannheimTM) in a standard PCR reaction (94°C 5 min, 25 * (94°C 20 sec, 50°C 20 sec, 72°C 90 sec), 72°C 5 min) using the purified PCR fragments as templates and the following primers:
  • Primer 160600J2 (SEQ ID NO.21 ); and Primer 19072000J1 (SEQ ID N0.22):
  • Reaction 12 with reaction 1 and 2 as template.
  • Reaction 13 with reaction 1 and 3 as template.
  • Reaction 14 with reaction 1 and 4 as template.
  • Reaction 17 with reaction 1 and 11 as template.
  • the four PCR reactions above run and PCR fragments were purified after electrophoresis from a 1.0% agarose gel.
  • the PCR fragments were cloned into pENI1960 ( 10070) using the GatewayTM technology (Lifetechnology ® ).
  • the "BP" cloning reaction was made by mixing the PCR fragment with BP reaction buffer, pDONR201 vector and BP clonase mix. Plasmid pENI1960 was cut with Seal (in order to cleave in the ccdB gene), and mixed with the BP reaction and "LR" clonase mix (as recommended by Lifetechnology ® ) and transformed into E. coli DH10b (Life-TechnologyTM cat. no.18290-015).
  • pENI2039 containing the wildtype msh2 gene in pENI1960 (PCR reaction 17).
  • pENI2040 containing the msh2 mutant G648A in pENI1960 (PCR reaction 12).
  • pENI2041 containing the msh2 mutant K649A in pENI1960 (PCR reaction 13).
  • PENI2042 containing the msh2 mutant S650A in pENI1960 (PCR reaction 14).
  • the 4 plasmids pENI2039-2042 were sequenced across the entire msh2 gene in order to confirm the introduction of the mutation as well as the lack of other unintended mutations.
  • Transformation of Aspergillus oryzae Induction of inactive dominant MSH protein and test of In Vivo mutation rates in A. oryzae tranformants is demonstrated in the following.
  • the plasmids pENI2039, pENI2040, pENI2041 and pENI2042 were constructed as outlined above from the parental plasmid pENI1960 which is derived from plasmid pENI1298
  • pENI1298 has the ability to replicate autonomously in Aspergillus and gives equivalent expression levels between independent transformants, when measuring the activity of a reporter gene.
  • plasmids pENI2039, pENI2040, pENI2041 and pENI2042 replicate autonomously in Aspergillus and give rise to production of similar levels of MSH2 protein from the corresponding encoding msh2-genes comprised in the plasmids.
  • JaL250 is a derivative of A. oryzae A1560 wherein the pyrG gene has been inactivated, as described in WO 98/01470; transformation protocol as described in WO 00/24883).
  • the transformants were incubated for 4 days at 37°C.
  • a spore-suspension was made from the Jal250 transformants and plated onto minimal plates containing 2 % maltose and urea (2 % maltose, 10 mM Urea, 2 % agar, 2 % salt solution, 24 % sorbitol) as described in (WO 98/01470) in order to induce the promoter upstream of the msh2 gene, and to be able to cultivate transformants despite mutations in the n/a-genes of A. oryzae Jal250.
  • the transformants are expected to have a decreased level of active MSH-complex due to production of inactive dominant MSH2 protein, thus leading to an increase in In Vivo overall mutation frequency.
  • the plates were incubated for 4 days at 37°C before a new spore-suspension was made. Dilutions were made of the spore-suspensions and plated both on minimal plates (1% glucose, 0.5 mM NH , 2 % agar, 2% salt solution, 0.01 % triton) where all the transformants are capable of growth, and on chlorate-containing plates (5% chlorate, 1% glucose, 0.5 mM NH 4 , 2 % agar, 2% salt solution, 0.01 % triton), where only transformants mutated in the n/a- genes that are involved in the nitrate metabolism can grow. Chlorate is toxic to an A.
  • Chlorate resistance frequency of the transformants is shown in table 1 (number of chlorate resistant divided by number of transformants grown on minimal plates):
  • a gel shift assay may also be suitable for confirming that a filamentous fungal cell as described herein has reduced mismatch repair efficiency.
  • the principle in this gel shift assay is that cell extracts are prepared of both (a) a filamentous fungal cell wherein the gene, as described herein, involved in the mismatch repair system is mutated; and (b) the corresponding filamentous fungal cell wherein the gene is NOT mutated. These extracts are then bound to/mixed with oligonucleotides containing the base-pair mismatched G:T; G:A; G:G; A:C, and an extrahelical TG dinucleotide and run on a nondenaturing gel.
  • the gel shift assay demonstrates that the control filamentous fungal cell wherein the gene is NOT inactivated comprises any protein(s) which binds to any of above mentioned oligonucleotides and these binding protein(s) is NOT seen in the filamentous fungal cell wherein the gene involved in the mismatch repair system is mutated, then it is a confirmation that the mismatch repair protein in the latter is a mutant.
  • the mismatch repair protein may be mutated in such a way that it binds to heteroduplex DNA just like wildtype protein, however it remains inactive due to a loss of e.g. ATPase activity.
  • the above assay may be modified by addition of ATP to the reaction after confirming that both proteins bind to the DNA. Addition of ATP to a DNA bound wildtype protein results in the release of the protein from the DNA, whereas an ATPase negative mutant remains bound. A second gel-shift assay can confirm such a result.
  • Annealing of oligonucleotides, binding of cell extracts to duplex oligonucleotides containing mismatched, and nondenaturing polyacrylamide gelelectrophoresis are performed essentially as described (Stephenson and Karran; Selective binding to DNA base pair mismatches by proteins from human cells; J. Biol. Chem. 264:2177-21182 (1989)).
  • oligonucleotide U is radiolabelled and annealed with any of the unlabelled oligonucleotides L-G.T. L-G.A. L-G.C. L-A.C. L-T.G. or L-HOM.
  • Oligonucleotide sequences are derived from Aquilina et al. Proc Natl. Acad. Sci. USA 91 :8905-8909 (1994).
  • L-G.A (SEQ ID NO 25): 5 ' gagcataggaggctgacaatggggcctggcagcttccc (resulting in a G.A mismatch)
  • L-G.G (SEQ ID NO 26): 5 ' gagcataggaggctgacagtggggcctggcagcttccc (resulting in a G.G mismatch)
  • L-A.C (SEQ ID NO 27): 5 ' gagcataggaggctgacaccggggcctggcagcttccc (resulting in a A.C mismatch)
  • L-HOM (SEQ ID NO 29): 5 ' gagcataggaggctgacaccggggcctggcagcttccc (resulting in a homoduplex).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne une cellule fongique filamenteuse présentant un phénotype mutateur ou une efficacité réduite de correction de mésappariement de nucléotides par rapport à une cellule de type sauvage. L'invention concerne également un vecteur, un procédé de production d'une telle cellule, et un procédé de production de diverses bibliothèques de polynucléotides dans une cellule à phénotype mutateur.
PCT/DK2002/000050 2001-01-24 2002-01-24 Mutation in vivo et recombinaison dans des champignons filamenteux WO2002059331A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DKPA200100123 2001-01-24
DKPA200100123 2001-01-24
US26530001P 2001-01-31 2001-01-31
US60/265,300 2001-01-31

Publications (1)

Publication Number Publication Date
WO2002059331A1 true WO2002059331A1 (fr) 2002-08-01

Family

ID=26068951

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DK2002/000050 WO2002059331A1 (fr) 2001-01-24 2002-01-24 Mutation in vivo et recombinaison dans des champignons filamenteux

Country Status (1)

Country Link
WO (1) WO2002059331A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005121351A2 (fr) 2004-05-27 2005-12-22 Novozymes, Inc. Methodes permettant de transformer et de cribler l'expression de cellules de champignons filamenteux au moyen d'une bibliotheque d'adn
WO2014086706A1 (fr) * 2012-12-07 2014-06-12 Novozymes A/S Procédé permettant de générer des mutations spécifiques au site dans des champignons filamenteux
CN110511877A (zh) * 2019-07-31 2019-11-29 千禾味业食品股份有限公司 一种低半纤维素酶活米曲霉及其在高氨氮浅色酱油酿造中的应用
WO2024026344A1 (fr) * 2022-07-27 2024-02-01 Inscripta, Inc. Modulation de mécanismes de réparation cellulaire pour édition génomique

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000050567A1 (fr) * 1999-02-24 2000-08-31 Novozymes A/S Cellules fongiques contenant un systeme de reparation des mesappariements de l'adn inactive
US6146894A (en) * 1998-04-14 2000-11-14 The Johns Hopkins University Method for generating hypermutable organisms

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6146894A (en) * 1998-04-14 2000-11-14 The Johns Hopkins University Method for generating hypermutable organisms
WO2000050567A1 (fr) * 1999-02-24 2000-08-31 Novozymes A/S Cellules fongiques contenant un systeme de reparation des mesappariements de l'adn inactive

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005121351A2 (fr) 2004-05-27 2005-12-22 Novozymes, Inc. Methodes permettant de transformer et de cribler l'expression de cellules de champignons filamenteux au moyen d'une bibliotheque d'adn
WO2014086706A1 (fr) * 2012-12-07 2014-06-12 Novozymes A/S Procédé permettant de générer des mutations spécifiques au site dans des champignons filamenteux
CN104837993A (zh) * 2012-12-07 2015-08-12 诺维信公司 用于在丝状真菌中产生位点特异性突变的方法
CN110511877A (zh) * 2019-07-31 2019-11-29 千禾味业食品股份有限公司 一种低半纤维素酶活米曲霉及其在高氨氮浅色酱油酿造中的应用
CN110511877B (zh) * 2019-07-31 2022-03-11 千禾味业食品股份有限公司 一种低半纤维素酶活米曲霉及其在高氨氮浅色酱油酿造中的应用
WO2024026344A1 (fr) * 2022-07-27 2024-02-01 Inscripta, Inc. Modulation de mécanismes de réparation cellulaire pour édition génomique

Similar Documents

Publication Publication Date Title
EP2147107B1 (fr) Procédé de clonage d'expression, approprié pour sélectionner des clones de bibliothèque produisant un polypeptide d'intérêt
US11174487B2 (en) Stable genomic integration of multiple polynucleotide copies
EP1124949B1 (fr) Etablissement et criblage d'une banque d'adn d'interet dans des cellules fongiques filamenteuses
EP2683732B1 (fr) Système vecteur-hôte
US20110223671A1 (en) Methods for using positively and negatively selectable genes in a filamentous fungal cell
EP1478755B1 (fr) Procedes de clonage d'expression dans des champignons filamenteux
US8883482B2 (en) Methods for increasing homologous recombination of a nucleic acid sequence
US20220025423A1 (en) Modified Filamentous Fungal Host Cells
JP2019122386A (ja) 選択的オートファジー経路の不活性化成分を含む糸状真菌細胞及びその使用方法
EP3445776B1 (fr) Cellules hôtes fongiques filamenteuses inactivées par rlma
WO2018172155A1 (fr) Cellules hôtes fongiques filamenteuses améliorées
WO2002059331A1 (fr) Mutation in vivo et recombinaison dans des champignons filamenteux
WO2000050567A1 (fr) Cellules fongiques contenant un systeme de reparation des mesappariements de l'adn inactive
US6518042B1 (en) Process for making DNA libraries in filamentous fungal cells using a novel cloned gene involved in the mismatch repair system of filamentous fungal cells
EP3775222B1 (fr) Proteines chaperons d'origine fongique
US6767701B1 (en) Methods of constructing and screening a DNA library of interest in filamentous fungal cells
EP3864136A1 (fr) Cellule hôte fongique filamenteuse modifiée

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP