WO2018172155A1 - Cellules hôtes fongiques filamenteuses améliorées - Google Patents

Cellules hôtes fongiques filamenteuses améliorées Download PDF

Info

Publication number
WO2018172155A1
WO2018172155A1 PCT/EP2018/056377 EP2018056377W WO2018172155A1 WO 2018172155 A1 WO2018172155 A1 WO 2018172155A1 EP 2018056377 W EP2018056377 W EP 2018056377W WO 2018172155 A1 WO2018172155 A1 WO 2018172155A1
Authority
WO
WIPO (PCT)
Prior art keywords
aspergillus
seq
host cell
gene
polypeptide
Prior art date
Application number
PCT/EP2018/056377
Other languages
English (en)
Inventor
Hiroaki Udagawa
Original Assignee
Novozymes A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes A/S filed Critical Novozymes A/S
Publication of WO2018172155A1 publication Critical patent/WO2018172155A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01016—Chitin synthase (2.4.1.16)

Definitions

  • the present invention relates to improved ChsB-inactivated filamentous fungal cells producing a heterologous polypeptide of interest, methods of producing a heterologous polypeptide of interest in said cells as well as methods of producing said cells.
  • the Aspergillus nidulans chitin synthase ChsB encoded by the chsB gene is necessary for normal hyphal growth and development, its inactivation by site-specifically inserting the native A. nidulans argB gene encoding ornithine transcarbamylase into the chsB coding sequence was disclosed (Borgia PT. er a/. 1996. Fungal Genet Biol. 1996 Sep; 20(3): 193-203).
  • the inactivation of chsB by pyrG disruption in Aspergillus oryzae has also been disclosed (MQIIer C. et al. 2003. Biotechnol Bioeng. 2003 Mar 5; 81 (5): 525-34).
  • a reporter system for the identification of antifungal compounds in filamentous fungi through cell wall stress-induced promoters to drive expression of a reporter protein has been disclosed; one such induced promoter was the Aspergillus niger agsA promoter; the cloning of the full-length agsA gene using degenerate primers as well as the isolation of ags-homologues from other fungi was provided (WO 03/020922). The inactivation of agsA in A niger has also been described (Damveld R. er a/. 2004. Fungal Genetics and Biology 42 (2005) 165-177).
  • the present invention is directed to improved genetically modified filamentous fungal host cells producing a heterologous polypeptide, in which host cells the chsB gene has been inactivated.
  • Inactivation of the chsB gene may be done by any suitable gene inactivation method known in the art.
  • An example of a convenient way to eliminate or reduce chsB expression is based on techniques of gene replacement or gene interruption.
  • the productivity or yield of the heterologous polypeptide is higher in the improved host cells of the invention, wherein the chsB gene is inactivated, as compared to chsB wild-type host cells.
  • the invention relates to filamentous fungal host cells producing a heterologous polypeptide of interest and comprising an inactivated chitin synthase- encoding gene, where said chitin synthase-encoding gene in its active form:
  • ii) comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO:1 ;
  • iii) comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO:2.
  • the invention further provides methods for producing a heterologous polypeptide of interest by cultivating a filamentous fungal host cell of the invention under conditions conducive for expression of the heterologous polypeptide of interest and, optionally, recovering the heterologous polypeptide of interest.
  • the invention relates to methods of producing a heterologous polypeptide of interest, said method comprising the steps of:
  • i) encodes a chitin synthase polypeptide having at least 80% amino acid sequence identity with SEQ ID NO:3;
  • ii) comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO:1 ;
  • iii) comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO:2;
  • the invention relates to method of producing a filamentous fungal host cell having an improved productivity of a heterologous polypeptide of interest, said method comprising the following steps in no particular order:
  • i) encodes a chitin synthase polypeptide having at least 80% amino acid sequence identity with SEQ ID NO:3;
  • ii) comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO:1 ; and/or iii) comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO:2.
  • cDNA means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA.
  • the initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
  • Coding sequence means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide.
  • the boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA.
  • the coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
  • control sequences means nucleic acid sequences necessary for expression of a polynucleotide encoding a mature polypeptide of the present invention.
  • Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the polypeptide or native or foreign to each other.
  • control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator.
  • the control sequences include a promoter, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.
  • expression includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
  • Expression vector means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.
  • host cell means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention.
  • host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
  • Isolated means a substance in a form or environment that does not occur in nature.
  • isolated substances include (1 ) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).
  • Mature polypeptide means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino acid) expressed by the same polynucleotide.
  • one host cell expressing a polynucleotide may produce a different mature polypeptide (e.g., having a different C-terminal and/or N-terminal amino acid) as compared to another host cell expressing the same polynucleotide.
  • Mature polypeptide coding sequence means a polynucleotide that encodes a mature polypeptide
  • nucleic acid construct means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.
  • operably linked means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
  • Sequence identity The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity".
  • sequence identity is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later.
  • the parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.
  • the output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
  • sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later.
  • the parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix.
  • the output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
  • the present invention relates to recombinant host cells comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the production of a heterologous polypeptide of interest.
  • a construct or vector comprising a polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extra- chromosomal vector as described earlier.
  • the term "host cell” encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.
  • the host cell may be a fungal cell.
  • "Fungi” as used herein includes the phyla Ascomycota,
  • Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).
  • the fungal host cell of the invention is a filamentous fungal cell.
  • "Filamentous fungi” include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra).
  • the filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.
  • the filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
  • the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysospohum lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zona
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se.
  • Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81 : 1470-1474, and Christensen et al, 1988, Bio/Technology 6: 1419-1422.
  • Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787.
  • the invention relates to methods of producing a filamentous fungal host cell having an improved productivity of a heterologous polypeptide of interest, said method comprising the following steps in no particular order:
  • i) encodes a chitin synthase polypeptide having at least 80% amino acid sequence identity with SEQ ID NO:3;
  • ii) comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO:1 ;
  • iii) comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO:2
  • the invention relates to the resulting host cells; filamentous fungal host cell producing a heterologous polypeptide of interest and comprising an inactivated chitin synthase-encoding gene, where said chitin synthase-encoding gene in its active form:
  • i) encodes a chitin synthase polypeptide having at least 80% amino acid sequence identity with SEQ ID NO:3;
  • ii) comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO:1 ; and/or iii) comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO:2.
  • the filamentous fungal host cell is of a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes and Trichoderma; even more preferably the filamentous fungal host cell is an Aspergillus cell; preferably an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, As
  • the heterologous polypeptide of interest is an enzyme; preferably the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha- galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipa
  • the ChsB chitin synthase polypeptide comprises or consists of an amino acid sequence at least 80% identical to the amino acid sequence shown in SEQ ID NO:3; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the amino acid sequence shown in SEQ ID NO:3.
  • the chsB gene or homologue thereof in its active form comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO:1 ; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the genomic DNA sequence shown in SEQ ID NO:1.
  • the chsB gene or homologue thereof in its active form comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO:2; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the cDNA sequence shown in SEQ ID NO:2.
  • the filamentous fungal host cells further comprises an inactivated 1 ,3-alpha-D-glucan synthase-encoding agsA gene, wherein said agsA gene in its active form:
  • i) encodes an 1 ,3-alpha-D-glucan synthase AgsA polypeptide having at least 80% amino acid sequence identity with SEQ ID NO:6; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the amino acid sequence shown in SEQ ID NO:6; ii) comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO:4; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the genomic DNA sequence shown in SEQ ID NO:4; and/or
  • iii) comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO:5; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the cDNA sequence shown in SEQ ID NO:5.
  • the present invention also relates to nucleic acid constructs comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
  • the polynucleotide may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
  • the control sequence may be a promoter, a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention.
  • the promoter contains transcriptional control sequences that mediate the expression of the polypeptide.
  • the promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
  • promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase ⁇ glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn
  • the control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription.
  • the terminator is operably linked to the 3'-terminus of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.
  • Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reese/ cellobiohydrolase II, Trichoderma reese/ endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma ree
  • control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.
  • the control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell.
  • the leader is operably linked to the 5'-terminus of the polynucleotide encoding the polypeptide. Any leader that is functional in the host cell may be used.
  • Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
  • the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the polynucleotide and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
  • Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
  • the control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide and directs the polypeptide into the cell's secretory pathway.
  • the 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the polypeptide.
  • the 5'-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence.
  • a foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence.
  • a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide.
  • any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell may be used.
  • Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
  • the control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a polypeptide.
  • the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
  • a propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
  • the propeptide coding sequence may be obtained from the genes for Bacillus subtilis alkaline protease ⁇ aprE), Bacillus subtilis neutral protease ⁇ nprT), Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor.
  • the propeptide sequence is positioned next to the N-terminus of a polypeptide and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.
  • regulatory sequences that regulate expression of the polypeptide relative to the growth of the host cell.
  • regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
  • filamentous fungi the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used.
  • Other examples of regulatory sequences are those that allow for gene amplification.
  • these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals.
  • the polynucleotide encoding the polypeptide would be operably linked to the regulatory sequence.
  • the present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals.
  • the various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the polypeptide at such sites.
  • the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression.
  • the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
  • the recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide.
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vector may be a linear or closed circular plasmid.
  • the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • the vector may contain any means for assuring self-replication.
  • the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
  • the vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells.
  • a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
  • Selectable markers for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosyl- aminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof.
  • adeA phosphoribosylaminoimidazole-succinocarboxamide synthase
  • adeB phospho
  • the selectable marker may be a dual selectable marker system as described in WO 2010/039889. In one aspect, the dual selectable marker is an hph-tk dual selectable marker system.
  • the vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
  • the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination.
  • the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s).
  • the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination.
  • the integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
  • the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
  • the origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell.
  • the term "origin of replication" or "plasmid replicator” means a polynucleotide that enables a plasmid or vector to replicate in vivo.
  • AMA1 and ANSI examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANSI (Gems et al., 1991 , Gene 98: 61 -67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.
  • More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a polypeptide.
  • An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
  • the present invention also relates to methods of producing a mutant of a parent cell, which comprises inactivating, disrupting or deleting a polynucleotide, or a portion thereof, encoding a ChsB chitin synthase polypeptide of the present invention, which results in the mutant cell producing less of the ChsB chitin synthase polypeptide than the parent cell when cultivated under the same conditions.
  • the mutant cells is completely deficient in producing a ChsB chitin synthase polypeptide of the invention.
  • the mutant cell may be constructed by reducing or eliminating expression of the chsB polynucleotide or a homologue thereof using methods well known in the art, for example, insertions, disruptions, replacements, or deletions.
  • the polynucleotide is inactivated.
  • the polynucleotide to be modified or inactivated may be, for example, the coding region or a part thereof essential for activity, or a regulatory element required for expression of the coding region.
  • An example of such a regulatory or control sequence may be a promoter sequence or a functional part thereof, i.e., a part that is sufficient for affecting expression of the polynucleotide.
  • Other control sequences for possible modification include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator, and transcriptional activator.
  • Modification or inactivation of the polynucleotide may be performed by subjecting the parent cell to mutagenesis and selecting for mutant cells in which expression of the polynucleotide has been reduced or eliminated.
  • the mutagenesis which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the mutagenesis may be performed by use of any combination of these mutagenizing agents.
  • Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues.
  • UV ultraviolet
  • MNNG N-methyl-N'-nitro-N-nitrosoguanidine
  • EMS ethyl methane sulphonate
  • sodium bisulphite formic acid
  • nucleotide analogues examples include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide ana
  • the mutagenesis is typically performed by incubating the parent cell to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions, and screening and/or selecting for mutant cells exhibiting reduced or no expression of the gene.
  • Modification or inactivation of the chsB polynucleotide or homologue thereof may be accomplished by insertion, substitution, or deletion of one or more nucleotides in the gene or a regulatory element required for transcription or translation thereof.
  • nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, or a change in the open reading frame.
  • modification or inactivation may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art.
  • the modification may be performed in vivo, i.e., directly on the cell expressing the polynucleotide to be modified, it is preferred that the modification be performed in vitro as exemplified below.
  • An example of a convenient way to eliminate or reduce expression of a polynucleotide is based on techniques of gene replacement, gene deletion, or gene disruption.
  • a nucleic acid sequence corresponding to the endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence that is then transformed into the parent cell to produce a defective gene.
  • the defective nucleic acid sequence replaces the endogenous polynucleotide.
  • the defective polynucleotide also encodes a marker that may be used for selection of transformants in which the polynucleotide has been modified or destroyed.
  • the polynucleotide is disrupted with a selectable marker such as those described herein.
  • the present invention also relates to methods of inhibiting the expression of a polypeptide having ChsB activity in a cell, comprising administering to the cell or expressing in the cell a double-stranded RNA (dsRNA) molecule, wherein the dsRNA comprises a subsequence of a chsB polynucleotide or homologue thereof.
  • dsRNA double-stranded RNA
  • the dsRNA is about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25 or more duplex nucleotides in length.
  • the dsRNA is preferably a small interfering RNA (siRNA) or a micro RNA (miRNA).
  • siRNA small interfering RNA
  • miRNA micro RNA
  • the dsRNA is small interfering RNA for inhibiting transcription.
  • the dsRNA is micro RNA for inhibiting translation.
  • the present invention also relates to such double-stranded RNA (dsRNA) molecules, comprising a portion of the polypeptide coding sequence of SEQ ID NO: 1 for inhibiting expression of the polypeptide in a cell.
  • dsRNA double-stranded RNA
  • the dsRNA can enter a cell and cause the degradation of a single-stranded RNA (ssRNA) of similar or identical sequences, including endogenous mRNAs.
  • ssRNA single-stranded RNA
  • RNAi RNA interference
  • the dsRNAs of the present invention can be used in gene-silencing.
  • the invention provides methods to selectively degrade RNA using a dsRNAi of the present invention.
  • the process may be practiced in vitro, ex vivo or in vivo.
  • the dsRNA molecules can be used to generate a loss-of-function mutation in a cell, an organ or an animal.
  • Methods for making and using dsRNA molecules to selectively degrade RNA are well known in the art; see, for example, U.S. Patent Nos. 6,489,127; 6,506,559; 6,51 1 ,824 and 6,515,109.
  • ChsB chitin synthase polypeptide-deficient mutant cells are particularly useful as host cells for expression of a heterologous polypeptide of interest; preferably a secreted heterologous polypeptide of interest; preferable embodiments thereof may be found herein.
  • the methods used for cultivation and purification of the heterologous polypeptide of interest may be performed by methods known in the art.
  • the host cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art.
  • the cells may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated.
  • the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
  • the polypeptide may be detected using methods known in the art that are specific for the polypeptides. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide.
  • the polypeptide may be recovered using methods known in the art.
  • the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
  • a fermentation broth comprising the polypeptide is recovered.
  • the polypeptide may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure polypeptides.
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
  • electrophoretic procedures e.g., preparative isoelectric focusing
  • differential solubility e.g., ammonium sulfate precipitation
  • SDS-PAGE or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989)
  • polypeptide is not recovered, but rather a host cell of the present invention expressing the polypeptide is used as a source of the polypeptide.
  • One aspect of the invention relates to methods of producing a heterologous polypeptide of interest, said method comprising the steps of:
  • i) encodes a chitin synthase polypeptide having at least 80% amino acid sequence identity with SEQ ID NO:3;
  • ii) comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO:1 ;
  • iii) comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO:2;
  • the filamentous fungal host cell is of a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes and Trichoderma; even more preferably the filamentous fungal host cell is an Aspergillus cell; preferably an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus jap
  • the heterologous polypeptide of interest is an enzyme; preferably the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha- galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phyta
  • the ChsB chitin synthase polypeptide comprises or consists of an amino acid sequence at least 80% identical to the amino acid sequence shown in SEQ ID NO:3; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the amino acid sequence shown in SEQ ID NO:3.
  • the chsB gene or homologue thereof in its active form comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO:1 ; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the genomic DNA sequence shown in SEQ ID NO:1.
  • the chsB gene or homologue thereof in its active form comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO:2; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the cDNA sequence shown in SEQ ID NO:2.
  • Enzymes for DNA manipulations e.g. restriction endonucleases, ligases etc.
  • Enzymes for DNA manipulations are obtainable from New England Biolabs, Inc. and were used according to the manufacturer's instructions.
  • AMG trace metals solution was composed of 0.3 g of citric acid, 0.68 g of ZnCI 2 , 0.25 g of CuS0 4 -5H 2 0, 0.024 g of NiCI 2 -6H 2 0, 1.39 g of FeS0 4 -7H 2 0, 1.356 g of MnSCv5H 2 0, and deionized water to 1 liter.
  • COVE-N-gly plates were composed of 218 g of sorbitol, 10 g of glycerol, 2.02 g of KNO3, 50 ml of COVE salt solution, 25 g of Noble agar, and deionized water to 1 liter.
  • COVE medium was composed of 342.3 g of sucrose, 20 ml of 50X COVE salts solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCI2, 25 g of Noble agar, and deionized water to 1 liter.
  • COVE2 medium was composed of 30 g of sucrose, 20 ml of 50X COVE salts solution, 10 ml of 1 M acetamide, 25 g of Noble agar, and deionized water to 1 liter.
  • COVE-N plates were composed of 342.3 g of sucrose, 20 ml of COVE salt solution, 3 g of NaN03, 30 g of Noble agar, and deionized water to 1 liter.
  • COVE-N top agarose was composed of 342.3 g of sucrose, 20 ml of COVE salt solution, 3 g of NaN03, 10 g of low melt agarose, and deionized water to 1 liter.
  • COVE-N JP plates were composed of 30 g of sucrose, 20 ml of COVE salt solution, 3 g of NaN03, 30 g of Noble agar, and deionized water to 1 liter.
  • COVE salt solution was composed of 26 g of KCI, 26 g of MgS0 4 -7H 2 0, 76 g of KH 2 P0 4 , 50 ml of COVE trace metals solution, and deionized water to 1 liter.
  • COVE trace metals was composed of 0.04 g of Na 2 B 4 O 7 - 10H 2 O, 0.4 g of CuS0 4 -5H 2 0, 1 .2 g of FeS0 4 -7H 2 0, 1.0 g of MnS0 4 -5H 2 0, 0.8 g of Na 2 Mo0 4 -2H 2 0, 10 g of ZnS0 4 -7H 2 0, and deionized water to 1 liter.
  • LB medium was composed of 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, and deionized water to 1 liter.
  • LB plus ampicillin plates were composed of 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, 15 g of Bacto agar, ampicillin at 100 ⁇ g per ml, and deionized water to 1 liter.
  • MSS medium was composed of 70 g of sucrose, 100 g of soy bean powder, three drops of pluronic antifoam, and deionized water to 1 liter; pH adjusted to 6.0.
  • MU-1 glu medium without urea was composed of 260 g of glucose, 3 g of MgSC I- O,
  • 50% Urea was composed of 500 g of urea and deionized water to 1 liter.
  • YPG medium was composed of 10 g of yeast extract, 20 g of Bacto peptone, 20 g of glucose, and deionized water to 1 liter.
  • STC was composed of 0.8 M sorbitol, 25 mM or 50 mM Tris pH 8, and 25 mM or 50 mM
  • SPTC was composed of 40% polyethyleneglycol 4000 (PEG4000) in STC buffer.
  • SOC medium was composed of 20 g of tryptone, 5 g of yeast extract, 0.5 g of NaCI, 10 ml of 250 mM KCI, and deionized water to 1 liter.
  • TAE buffer was composed of 4.84 g of Tris Base, 1 .14 ml of Glacial acetic acid, 2 ml of 0.5 M EDTA pH 8.0, and deionized water to 1 liter.
  • E.coli DH5-alpha (Toyobo) was used for plasmid construction and PCR amplification.
  • the commercial plasmids pBluescript II SK- (Stratagene #212206) were used for cloning of PCR fragments. Amplified plasmids were recovered with QiagenD Plasmid Kit (Qiagen). Ligation was done with DNA ligation kit (Takara) or T4 DNA ligase (Boehringer Mannheim). Polymerase Chain Reaction (PCR) was carried out with Expand TM PCR system (Boehringer Mannheim). QIAquickTM Gel Extraction Kit (Qiagen) was used for the purification of PCR fragments and extraction of DNA fragments from agarose gel.
  • the expression host strain Aspergillus niger C3105 was isolated by Novozymes and is a derivative of Aspergillus niger NN049184 which was isolated from soil. C3105 is genetically modified to disrupt expression of amyloglycosidase activities and alpha-amylase activities followed by introducing Aspergillus niger cytosine deaminase gene ⁇ fcy1).
  • the expression host strain Aspergillus niger M1405-1435-16 was isolated by Novozymes and is an ags/ ⁇ -minus derivative of Aspergillus niger C3105 (its construction is disclosed in Example 3 of WO 2016/066690).
  • Plasmid pHUda801 is disclosed in Example 4 of WO 2012/160093. Plasmid pRika147 for the expression of enzyme genes is also disclosed in Example 9 of WO 2012/160093.
  • Transformation of the parent Aspergillus niger host cell was achieved using the general methods known for transformation in filamentous fungi, as described in the Yelton et al., "Transformation of Aspergillus nidulans by using a trpC plasmid," Proc Natl Acad Sci U S A. 1984 Mar;81 (5):1470-4, and as follows:
  • Aspergillus niger host strain was inoculated to 100 ml of YPG medium supplemented with 10 mM uridine in case the host strain is a pyrG deficient mutant, and incubated for 16 hrs at 32°C at 80 rpm. Pellets were collected and washed with 0.6 M KCI, and resuspended 20 ml 0.6 M KCI containing a commercial D-glucanase product (GLUCANEXTM, Novozymes A/S, Bagsvaerd, Denmark) at a final concentration of 20 mg per ml. The suspension was incubated at 32 °C at 80 rpm until protoplasts were formed, and then washed twice with STC buffer.
  • GLUCANEXTM commercial D-glucanase product
  • the protoplasts were counted with a hematometer and resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final concentration of 2.5x10 7 protoplasts/ml. Approximately 4 ⁇ g of plasmid DNA was added to 100 ⁇ of the protoplast suspension, mixed gently, and incubated on ice for 30 minutes. One ml of SPTC was added and the protoplast suspension was incubated for 20 minutes at 37°C. After the addition of 10 ml of 50°C COVE-N top agarose, the mixture was poured onto the minimum medium and the plates were incubated at 30°C for 5days.
  • Spores of the selected transformants were inoculated in 100 ml of MSS media and cultivated at 30 C for 3 days. 10 % of seed culture was transferred to MU-1 glu medium in lab- scale tanks with feeding the appropriate amounts of glucose and ammonium and cultivated at 30 C for 6 days. The supernatant was obtained by centrifugation. Culture supernatant after centrifugation was used for enzyme assay.
  • Mycelia of the selected transformants were harvested from overnight culture in 3 ml YPG medium, rinsed with distilled water. Ground mycelia were subject to genome DNA preparation using FastDNA SPIN Kit for Soil (MP Biomedicals) follows by manufacture's instruction. Nonradioactive probes were synthesized using a PCR DIG probe synthesis kit (Roche Applied Science, Indianapolis IN) followed by manufacture's instruction. DIG labeled probes were gel purified using a QIAquickTM Gel Extraction Kit (QIAGEN Inc., Valencia, CA) according to the manufacturer's instructions.
  • DNA Five micrograms of genome DNA was digested with appropriate restriction enzymes completely for 16 hours (40 ⁇ total volume, 4U enzyme/ ⁇ DNA) and run on a 0.8 % agarose gel.
  • the DNA was fragmented in the gel by treating with 0.2 M HCI, denatured (0.5M NaOH, 1 .5M NaCI) and neutralized (1 M Tris, pH7.5; 1.5M NaCI) for subsequent transfer in 20X SSC to Hybond N+ membrane (Amersham).
  • the DNA was UV cross-linked to the membrane and prehybridized for 1 hour at 42 oC in 20 ml DIG Easy Hyb (Roche Diagnostics Corporation, Mannheim, Germany).
  • the denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42 oC was done. Following the post hybridization washes (twice in 2X SSC, room temperature, 5 min and twice in 0.1X SSC, 68o C, 15 min. each), chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol. The DIG-labeled DNA Molecular Weight Marker II (Roche) was used for the standard marker.
  • the Bradford assay a colorimetric protein assay, is based on an absorbance shift of the dye Coomassie Brilliant Blue G-250 in which under acidic conditions the red form of the dye is converted into its bluer form to bind to the protein being assayed. The binding of the dye to the protein stabilizes the blue anionic form.
  • the increase of absorbance at 595 nm is proportional to the amount of bound dye, and thus to the amount (concentration) of protein present in the sample.
  • Example 1 Construction of plasmid pHUda1435, a vector for targeted gene disruption of Aspergillus niger chsB
  • Plasmid pHUda1435 was constructed to contain 5' and 3' flanking regions for the Aspergillus niger chitin synthase (chsB) gene separated by the A. nidulans orotidine-5'-phosphate decarboxylase gene ⁇ pyrG) as a selectable marker with its terminator repeats, and the human Herpes simplex virus 1 (HSV-1 ) thymidine kinase gene.
  • the HSV-1 thymidine kinase gene lies 3' of the 3' flanking region of the chsB gene, allowing for counter-selection of Aspergillus niger transformants that do not correctly target to the chsB gene locus.
  • the plasmid was constructed in several steps as described below.
  • a PCR product containing the 5' flanking region of A. niger chsB was generated using the following primers:
  • Primer chsB1 (sense) (SEQ ID NO:7): ggtggcggccgcatttactacttgtttact
  • Primer chsB2 (antisense) (SEQ ID NO:8): ccactagtcgatcaaatcctaattattgtc
  • the desired fragment was amplified by PCR in a reaction composed of approximately
  • the resulting 2,136 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
  • the purified 2,136 bp PCR fragment was digested by Notl and Spel.
  • Plasmid pHUda801 (Example 4 in WO 2012160093 A1 ) was digested with Not I and Spel, and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 9,558 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit. The 9,558 bp fragment was ligated to the 2,136 bp PCR fragment in a reaction composed of 1 ⁇ of the 9,558 bp fragment, 3 ⁇ of the 2,136 bp fragment, 1 ⁇ of 5X ligase Buffer, 5 ⁇ of 2X Ligase Buffer and 1 ⁇ of Ligase (Roche Rapid DNA Ligation Kit).
  • the ligation reaction was incubated at room temperature for 10 minutes. Five ⁇ of the ligation mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHUda801 -5'c/?sS.
  • a PCR product containing the 3' flanking region of A. niger chsB was generated using the following primers:
  • Primer chsB3 (sense) (SEQ ID NO:9): cttctagagtgttgcctggtgctttctcag
  • Primer chsB4 antisense (SEQ ID NO:10): gagaattccattgcaccaccgcctgcccat
  • the desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of Aspergillus niger C3105, 1 ⁇ of Expand High Fidelity polymerase (Roche), 100 ⁇ of primer chsB3, 100 ⁇ of primer chsB4, 5x PCR buffer (incl.MgCI2), 20 ⁇ 2.5mM dNTP mix (total volume; 100 ⁇ ).
  • the reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 2 minutes; 1 cycle at 72°C for 7 minutes; and a 4°C hold.
  • the resulting 1 ,976 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit.
  • the purified 1 ,976 bp PCR fragment was digested by ba/ and EcoRI.
  • Plasmid pHUda801 -5'chsB was digested with Xbal and EcoRI, and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 9,638 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
  • the 9,638 bp fragment was ligated to the 1 ,976 bp PCR fragment in a reaction composed of 1 ⁇ of the 9,638 bp fragment, 3 ⁇ of the 1 ,976 bp fragment, 1 ⁇ of 5X ligase Buffer, 5 ⁇ of 2X Ligase Buffer and 1 ⁇ of Ligase (Roche Rapid DNA Ligation Kit).
  • the ligation reaction was incubated at room temperature for 10 minutes. Five ⁇ of the ligation mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHUda1435.
  • Example 2 The Aspergillus niger chsB gene disruption in C3105
  • the pyrG gene in C3105 was rescued as follows.
  • the strain C3105 was inoculated on
  • Strains in which the pyrG gene has been deleted will grow in the presence of 5-FOA; those that retain the gene will convert 5-FOA to 5-fluoro-UMP, a toxic intermediate.
  • the grown colonies were transferred with sterile toothpicks to COVE-N-gly plates supplemented with 10 mM uridine and were grown at 30°C for 7 days.
  • the isolated strain was named M1405.
  • Protoplasts of Aspergillus niger strain M1405 were prepared by cultivating the strain in 100 ml of YPG medium supplemented with 10 mM uridine at 32°C for 16 hours with gentle agitation at 80 rpm. Pellets were collected and washed with 0.6 M KCI, and resuspended 20 ml 0.6 M KCI containing a commercial beta-glucanase product (GLUCANEXTM, Novozymes A S, Bagsvaerd, Denmark) at a final concentration of 20 mg per ml. The suspension was incubated at 32 °C at 80 rpm until protoplasts were formed.
  • GLUCANEXTM commercial beta-glucanase product
  • Protoplasts were filtered through a funnel lined with MIRACLOTH® into a 50 ml sterile plastic centrifuge tube and were washed with 0.6 M KCI to extract trapped protoplasts. The combined filtrate and supernatant were collected by centrifugation at 2,000 rpm for 15 minutes. The supernatant was discarded and the pellet was washed with 10-25 ml of STC and centrifuged again at 2,000 rpm for 10 minutes and then washed twice with STC buffer. The protoplasts were counted with a hematometer and resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final concentration of 2.5x10 7 protoplasts/ml.
  • the grown transformants were transferred with sterile toothpicks to Cove-N JP plates supplemented with 1.5 ⁇ 5-Flouro-2-deoxyuridine (FdU), an agent which kills cells expressing the herpes simplex virus (HSV) thymidine kinase gene (TK) harboring in pHUda1435.
  • FdU 5-Flouro-2-deoxyuridine
  • HSV herpes simplex virus
  • TK thymidine kinase gene harboring in pHUda1435.
  • Single spore isolates were transferred to COVE-N-gly plates.
  • genomic DNA from each transformant Five ⁇ g of genomic DNA from each transformant were digested with Xhol.
  • the genomic DNA digestion reactions were composed of 5 ⁇ g of genomic DNA, 1 ⁇ of Xhol, 2 ⁇ of 10X NEBuffer 4, and water to 20 ⁇ .
  • Genomic DNA digestions were incubated at 37°C for approximately 16 hours.
  • the digestions were submitted to 0.8 % agarose gel electrophoresis using TAE buffer and blotted onto a hybond N+ (GE Healthcare Life Sciences, Manchester, NH, USA) using a TURBOBLOTTER® for approximately 1 hourfollowing the manufacturer's recommendations.
  • the membrane was hybridized with a 500 bp digoxigenin-labeled Aspergillus niger chsB probe, which was synthesized by incorporation of digoxigenin-1 1 -dUTP by PCR using primers chsB5 (sense) and chsB6 (antisense) shown below:
  • Reverse primer (chsB6) (SEQ ID NO:12): aggtccataatgaccgatgttgta
  • the amplification reaction (100 ⁇ ) was composed of 200 ⁇ PCR DIG Labeling Mix (vial 2) (Roche Applied Science, Palo Alto, CA, USA), 0.5 ⁇ primers, EXPAND® High Fidelity Enzyme mix (vial 1 ) (Roche Applied Science, Palo Alto, USA), and 1 ⁇ (100 pg/ ⁇ ) of pHUda1435 as template in a final volume of 100 ⁇ .
  • the amplification reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds and a 4°C hold.
  • PCR products were separated by 0.8 % agarose gel electrophoresis using TAE buffer where a 0.5 kb fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
  • the denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42 oC was done.
  • chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol.
  • the DIG- labeled DNA Molecular Weight Marker II (Roche) was used for the standard marker.
  • a strain, M1405-1435-9, giving the correct integration at the chsB loci (a hybridized band shifted from 9.7 kb to 4.8 kb) were selected for the subsequent experiments.
  • Example 3 The Aspergillus niger chsB gene disruption in M 1405-1685-16
  • Protoplasts of Aspergillus niger strain M1405-1685-16 were prepared by cultivating the strain in 100 ml of YPG medium at 32°C for 16 hours with gentle agitation at 80 rpm. Pellets were collected and washed with 0.6 M KCI, and resuspended 20 ml 0.6 M KCI containing a commercial beta-glucanase product (GLUCANEXTM, Novozymes A S, Bagsvaerd, Denmark) at a final concentration of 20 mg per ml. The suspension was incubated at 32°C at 80 rpm until protoplasts were formed.
  • GLUCANEXTM commercial beta-glucanase product
  • Protoplasts were filtered through a funnel lined with MIRACLOTH® into a 50 ml sterile plastic centrifuge tube and were washed with 0.6 M KCI to extract trapped protoplasts. The combined filtrate and supernatant were collected by centrifugation at 2,000 rpm for 15 minutes. The supernatant was discarded and the pellet was washed with 10-25 ml of STC and centrifuged again at 2,000 rpm for 10 minutes and then washed twice with STC buffer. The protoplasts were counted with a hematometer and resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final concentration of 2.5x10 7 protoplasts/ml.
  • the grown transformants were transferred with sterile toothpicks to Cove-2 plates supplemented with 1 .5 ⁇ 5-Flouro-2-deoxyuridine (FdU), an agent which kills cells expressing the herpes simplex virus (HSV) thymidine kinase gene (TK) harboring in pHUda1435.
  • FdU 5-Flouro-2-deoxyuridine
  • HSV herpes simplex virus
  • TK thymidine kinase gene harboring in pHUda1435.
  • Single spore isolates were transferred to COVE-N-gly plates.
  • Possible transformants of Aspergillus niger strain M1405-1685-16 containing the pHUdal 435 to disrupt chsB gene were screened by Southern analysis. Each of the spore purified transformants were cultivated in 3 ml of YPG medium and incubated at 30°C for 2 days with shaking at 200 rpm. Biomass was collected using a MIRACLOTH® lined funnel. Ground mycelia were subject to genome DNA preparation using FastDNA SPIN Kit for Soil (MP Biomedicals) follows by manufacture's instruction. Southern blot analysis was performed to confirm the disruption of the chsB gene locus. Five ⁇ g of genomic DNA from each transformant were digested with Xhol.
  • the genomic DNA digestion reactions were composed of 5 ⁇ g of genomic DNA, 1 ⁇ of Xhol, 2 ⁇ of 10X NEBuffer 4, and water to 20 ⁇ . Genomic DNA digestions were incubated at 37°C for approximately 16 hours. The digestions were submitted to 0.8 % agarose gel electrophoresis using TAE buffer and blotted onto a hybond N+ (GE Healthcare Life Sciences, Manchester, NH, USA) using a TURBOBLOTTER® for approximately 1 hourfollowing the manufacturer's recommendations.
  • the membrane was hybridized with a 500 bp digoxigenin-labeled Aspergillus niger chsB probe, which was synthesized by incorporation of digoxigenin-1 1 -dUTP by PCR using primers chsB5 (sense) and chsB6 (antisense) shown below:
  • Reverse primer (chsB6) (SEQ ID NO: 14): aggtccataatgaccgatgttgta
  • the amplification reaction (100 ⁇ ) was composed of 200 ⁇ PCR DIG Labeling Mix (vial 2) (Roche Applied Science, Palo Alto, CA, USA), 0.5 ⁇ primers, EXPAND® High Fidelity Enzyme mix (vial 1 ) (Roche Applied Science, Palo Alto, USA), and 1 ⁇ (100 pg/ ⁇ ) of pHUda1435 as template in a final volume of 100 ⁇ .
  • the amplification reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds and a 4°C hold.
  • PCR products were separated by 0.8% agarose gel electrophoresis using TAE buffer where a 0.5 kb fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
  • the denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42°C was done.
  • chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol.
  • the DIG- labeled DNA Molecular Weight Marker II (Roche) was used for the standard marker.
  • Plasmid pHUda1556 was constructed to contain Kionochaeta phospholipase C gene (pic) driven by Aspergillus niger neutral amylase promoter II (Pna2) and glucoamylase terminator (Tamg), the A. nidulans acetamidase gene (amdS) as a selectable marker, and the yeast Saccharamyces cerevisiae FLP recombinase gene (flp) driven by Aspergillus niger acid stable amylase promoter (PasaA) and the Aspergillus oryzae nitrate reductase terminator (Tniad). Based on amino acid sequences of Kionochaeta phospholipase C, the codon optimized gene with no amino acid changes were synthesized and ordered from the commercial supplier GeneArtTM.
  • a PCR product containing the synthetic Kionochaeta phospholipase C gene was generated using the following primers:
  • Primer KplcC-1 (sense) (SEQ ID NO: 15): ggatccaccatgagagcatcgagcatcctg
  • Primer KplcC-2 (antisense) (SEQ ID NO: 16): cacgtgctaaactgccattcggcgtttctc
  • the desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of the plasmid DNA harboring synthetic Kionochaeta phospholipase C gene, 1 ⁇ of Expand High Fidelity polymerase (Roche), 100 ⁇ of primer KplcC -1 , 100 ⁇ of primer KplcC - 2, 5x PCR buffer (incl.MgCI2), 20 ⁇ 2.5mM dNTP mix (total volume; 100 ⁇ ).
  • the reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 2 minute; 1 cycle at 72°C for 7 minutes; and a 4°C hold.
  • the resulting 1 ,947 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK® Gel Extraction Kit. The purified 1 ,947 bp PCR fragment was digested by BamHI and Pmll.
  • Plasmid pRika147 (disclosed in Example9 of WO 2012/160093) was digested with BamHI and Pmll, and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 10,512 bp fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
  • the 10,512 bp fragment was ligated to the 1 ,947 bp PCR fragment in a reaction composed of 1 ⁇ of the 10,512 bp fragment, 3 ⁇ of the 1 ,947 bp fragment, 1 ⁇ of 5X ligase Buffer, 5 ⁇ of 2X Ligase Buffer and 1 ⁇ of Ligase (Roche Rapid DNA Ligation Kit).
  • the ligation reaction was incubated at room temperature for 10 minutes. Five ⁇ of the ligation mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37°C overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated pHUda1556.
  • Example 5 Introduction of Kionochaeta phospholipase C gene (pic) expression vector pHUda1556 in Aspergillus niger strains C3105, M1405-1435-9 and M1405-1685-1435-24
  • the pic expression cassette of pHUda1556 should be introduced in each strain by site- specific FLP/fri recombination into four pre-determined chromosomal loci: neutral amylase I (amyA), neutral amylase II (amyB), acid stable amylase (asaA) and putative alkali sulfatase (payA).
  • Protoplasts of Aspergillus niger strains C3105, M 1405-1435-9 and M 1405-1685-1435- 24 were prepared by cultivating the strains in 100 ml of YPG medium at 32°C for 16 hours with gentle agitation at 80 rpm.
  • the suspension was incubated at 32°C at 80 rpm until protoplasts were formed.
  • Protoplasts were filtered through a funnel lined with MIRACLOTH® into a 50 ml sterile plastic centrifuge tube and were washed with 0.6 M KCI to extract trapped protoplasts. The combined filtrate and supernatant were collected by centrifugation at 2,000 rpm for 15 minutes.
  • Possible pHUda1556 transformants of Aspergillus niger strain either C3105, M1405- 1435-9 or M 1405-1685-1435-24 were screened by Southern analysis. Each of the spore purified transformants were cultivated in 3 ml of YPG medium and incubated at 30°C for 2 days with shaking at 200 rpm. Biomass was collected using a MIRACLOTH® lined funnel. Ground mycelia were subject to genome DNA preparation using FastDNA SPIN Kit for Soil (MP Biomedicals) follows by manufacture's instruction.
  • Southern blot analysis was performed to confirm the introduction of the pic gene at the four pre-determined loci: amyA, amyB, asaA and payA.
  • Five g of genomic DNA from each transformant were digested with Hindlll.
  • the genomic DNA digestion reactions were composed of 5 g of genomic DNA, 0.5 ⁇ of Spel and Pmll, 2 ⁇ of 10X NEBuffer 4, and water to 20 ⁇ . Genomic DNA digestions were incubated at 37°C for approximately 16 hours.
  • the digestions were submitted to 0.5 % agarose gel electrophoresis using TAE buffer and blotted onto a hybond N+ (GE Healthcare Life Sciences, Manchester, NH, USA) using a TURBOBLOTTER® for approximately 1 hour following the manufacturer's recommendations.
  • the membrane was hybridized with a 500 bp digoxigenin-labeled pic probe, which was synthesized by incorporation of digoxigenin-1 1 -dUTP by PCR using primers KplcC-3 (sense) and KplcC-4 (antisense) shown below:
  • Reverse primer (KplcC-4) (SEQ ID NO: 18): ggttcgtacaggtagaagtt
  • the amplification reaction (100 ⁇ ) was composed of 200 ⁇ PCR DIG Labeling Mix (vial 2) (Roche Applied Science, Palo Alto, CA, USA), 0.5 ⁇ primers, EXPAND® High Fidelity Enzyme mix (vial 1 ) (Roche Applied Science, Palo Alto, USA), and 1 ⁇ (100 pg/ ⁇ ) of pHUda1556 as template in a final volume of 100 ⁇ .
  • the amplification reaction was incubated in a Bio-Rad® C1000 TouchTM Thermal Cycler programmed for 1 cycle at 94°C for 2 minutes; 30 cycles each at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds and a 4°C hold.
  • PCR products were separated by 0.8% agarose gel electrophoresis using TAE buffer where a 0.5 kb fragment was excised from the gel and extracted using a QIAQUICK® Gel Extraction Kit.
  • the denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42°C was done.
  • chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol.
  • the DIG- labeled DNA Molecular Weight Marker 11 (Roche) was used for the standard marker.
  • Aspergillus niger C3105-1556-1 &2, M1405-1435-3 & 4 and M1405-1685-1435-5 & 6 were cultivated on COVE-N-gly plates at 30°C for about a week.
  • a sterile transfer pipette was used to punch a piece of small plugs from each plate, which were each inoculated into 100 ml of MSS medium in 500 ml flasks. The flasks were incubated at 30°C for 3 days at 200 rpm. And then, 10 ml of culture broth was transferred to 100 ml of MU1 glu medium in 500 ml flasks. The flasks were incubated at 30°C for 6 days at 200 rpm.
  • PLC productivity assay was performed using a Quick StartTM Bradford Protein Assay Kit (Bio-Rad inc.). Culture supernatants were diluted appropriately in distilled water. A bovine serum albumin (WAKO cat number 519-83921 ) was diluted using several steps starting with a 0.5 mg/ml concentration and ending with a 0.1 mg/ml concentration in the distilled water. Five ⁇ of each dilution including standard were transferred to a 96-well flat bottom plate.
  • the chsB- ' m activated A. niger M 1405-1435 strain showed a surprisingly improved phospholipase C (PLC) productivity of 10-15% in shake flasks compared with the non-inactivated parent A. niger C3105-1556 strain (table 1 ).
  • the double cshB- and ags/ ⁇ -inactivated A. niger M1405-1685-1435 strain had an even more surprisingly improved PLC productivity of 60-65% compared to the non-inactivated parent (Table 1 ).
  • Table 1 PLC productivity in shake flask culture.

Abstract

La présente invention concerne des cellules fongiques filamenteuses inactivées par ChsB améliorées qui produisent un polypeptide d'intérêt, des procédés de production d'un polypeptide hétérologue d'intérêt dans lesdites cellules, ainsi que des procédés de production desdites cellules.
PCT/EP2018/056377 2017-03-23 2018-03-14 Cellules hôtes fongiques filamenteuses améliorées WO2018172155A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP17162530 2017-03-23
EP17162530.4 2017-03-23

Publications (1)

Publication Number Publication Date
WO2018172155A1 true WO2018172155A1 (fr) 2018-09-27

Family

ID=58428095

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/056377 WO2018172155A1 (fr) 2017-03-23 2018-03-14 Cellules hôtes fongiques filamenteuses améliorées

Country Status (1)

Country Link
WO (1) WO2018172155A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110699387A (zh) * 2019-10-29 2020-01-17 华东理工大学 一种使用生物可降解有机酸催化剂的木质纤维素预处理方法
WO2020074502A1 (fr) * 2018-10-09 2020-04-16 Novozymes A/S Cellule hôte fongique filamenteuse modifiée
CN113265417A (zh) * 2020-02-14 2021-08-17 中国科学院天津工业生物技术研究所 有机酸产量提高的菌株及其构建方法和应用

Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0238023A2 (fr) 1986-03-17 1987-09-23 Novo Nordisk A/S Procédé de production de produits protéiniques dans aspergillus oryzae et promoteur à utiliser dans aspergillus
WO1990000192A1 (fr) 1988-07-01 1990-01-11 Genencor, Inc. Champignons filamenteux a carence de proteinase aspartique
US5190931A (en) 1983-10-20 1993-03-02 The Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
WO1995033836A1 (fr) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides efficaces dans le traitement de maladies cardiovasculaires
WO1996000787A1 (fr) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Systeme d'expression de fusarium non pathogene, non toxicogene, non toxique, et promoteurs et terminateurs utilises dans ce systeme
WO1998011203A1 (fr) * 1996-09-13 1998-03-19 Novo Nordisk Biotech, Inc. Cellules presentant des mutations d'insertion d'adn produisant des quantites modifiees d'un polypeptide
US6011147A (en) 1986-04-30 2000-01-04 Rohm Enzyme Finland Oy Fungal promoters active in the presence of glucose
WO2000024883A1 (fr) 1998-10-26 2000-05-04 Novozymes A/S Etablissement et criblage d'une banque d'adn d'interet dans des cellules fongiques filamenteuses
WO2000056900A2 (fr) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoteurs exprimant les genes d'une cellule fongique
US6489127B1 (en) 2000-01-14 2002-12-03 Exelixis, Inc. Methods for identifying anti-cancer drug targets
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US6511824B1 (en) 1999-03-17 2003-01-28 Exelixis, Inc. Nucleic acids and polypeptides of invertebrate TWIK channels and methods of use
US6515109B1 (en) 2000-10-12 2003-02-04 Exelixis, Inc. Human ECT2 polypeptide
WO2003020922A2 (fr) 2001-08-28 2003-03-13 Stichting Voor De Technische Wetenschappen Procedes et substances pour identifier des substrats antifongiques dans le champignon filamenteux
WO2010039889A2 (fr) 2008-09-30 2010-04-08 Novozymes, Inc. Procédés pour utiliser des gènes de sélection positive et négative dans une cellule de champignon filamenteux
WO2012160093A1 (fr) 2011-05-23 2012-11-29 Novozymes A/S Intégrations simultanées spécifiques d'un site de multiples copies géniques dans un champignon filamenteux
WO2016066690A1 (fr) 2014-10-29 2016-05-06 Novozymes A/S Cellules hôtes à double mutant de champignons filamenteux

Patent Citations (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5190931A (en) 1983-10-20 1993-03-02 The Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
EP0238023A2 (fr) 1986-03-17 1987-09-23 Novo Nordisk A/S Procédé de production de produits protéiniques dans aspergillus oryzae et promoteur à utiliser dans aspergillus
US6011147A (en) 1986-04-30 2000-01-04 Rohm Enzyme Finland Oy Fungal promoters active in the presence of glucose
WO1990000192A1 (fr) 1988-07-01 1990-01-11 Genencor, Inc. Champignons filamenteux a carence de proteinase aspartique
WO1995033836A1 (fr) 1994-06-03 1995-12-14 Novo Nordisk Biotech, Inc. Phosphonyldipeptides efficaces dans le traitement de maladies cardiovasculaires
WO1996000787A1 (fr) 1994-06-30 1996-01-11 Novo Nordisk Biotech, Inc. Systeme d'expression de fusarium non pathogene, non toxicogene, non toxique, et promoteurs et terminateurs utilises dans ce systeme
WO1998011203A1 (fr) * 1996-09-13 1998-03-19 Novo Nordisk Biotech, Inc. Cellules presentant des mutations d'insertion d'adn produisant des quantites modifiees d'un polypeptide
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
WO2000024883A1 (fr) 1998-10-26 2000-05-04 Novozymes A/S Etablissement et criblage d'une banque d'adn d'interet dans des cellules fongiques filamenteuses
US6511824B1 (en) 1999-03-17 2003-01-28 Exelixis, Inc. Nucleic acids and polypeptides of invertebrate TWIK channels and methods of use
WO2000056900A2 (fr) 1999-03-22 2000-09-28 Novo Nordisk Biotech, Inc. Promoteurs exprimant les genes d'une cellule fongique
US6489127B1 (en) 2000-01-14 2002-12-03 Exelixis, Inc. Methods for identifying anti-cancer drug targets
US6515109B1 (en) 2000-10-12 2003-02-04 Exelixis, Inc. Human ECT2 polypeptide
WO2003020922A2 (fr) 2001-08-28 2003-03-13 Stichting Voor De Technische Wetenschappen Procedes et substances pour identifier des substrats antifongiques dans le champignon filamenteux
WO2010039889A2 (fr) 2008-09-30 2010-04-08 Novozymes, Inc. Procédés pour utiliser des gènes de sélection positive et négative dans une cellule de champignon filamenteux
WO2012160093A1 (fr) 2011-05-23 2012-11-29 Novozymes A/S Intégrations simultanées spécifiques d'un site de multiples copies géniques dans un champignon filamenteux
WO2016066690A1 (fr) 2014-10-29 2016-05-06 Novozymes A/S Cellules hôtes à double mutant de champignons filamenteux

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
"Protein Purification", 1989, VCH PUBLISHERS
BORGIA PT. ET AL., FUNGAL GENET BIOL., vol. 20, no. 3, September 1996 (1996-09-01), pages 193 - 203
CHRISTENSEN ET AL., 6/B/7EC/?N0/0GY, vol. 6, 1988, pages 1419 - 1422
CHRISTIAN MÜLLER ET AL: "Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae : Chitin Synthesis, Morphology, and Viscosity", BIOTECHNOLOGY AND BIOENGINEERING, vol. 81, no. 5, 5 March 2003 (2003-03-05), US, pages 525 - 534, XP055471923, ISSN: 0006-3592, DOI: 10.1002/bit.10491 *
CULLEN, NUCLEIC ACIDS RES., vol. 15, 1987, pages 9163 - 9175
DAMVELD R. ET AL., FUNGAL GENETICS AND BIOLOGY, vol. 42, 2004, pages 165 - 177
GEMS, GENE, vol. 98, 1991, pages 61 - 67
HAWKSWORTH ET AL.: "Ainsworth and Bisby's Dictionary of The Fungi", 1995, CAB INTERNATIONAL, UNIVERSITY PRESS
MALARDIER ET AL., GENE, vol. 78, 1989, pages 147 - 156
MAY, G.: "Applied Molecular Genetics of Filamentous Fungi", 1992, BLACKIE ACADEMIC AND PROFESSIONAL, pages: 1 - 25
MILLER ET AL., MOL. CELL. BIOL., vol. 5, 1985, pages 1714 - 1721
MULLER C. ET AL., BIOTECHNOL BIOENG., vol. 81, no. 5, 5 March 2003 (2003-03-05), pages 525 - 34
NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
RAST D M ET AL: "Cell wall-associated enzymes in fungi", PHYTOCHEMI, PERGAMON PRESS, GB, vol. 64, no. 2, 1 January 2004 (2004-01-01), pages 339 - 366, XP004448651, ISSN: 0031-9422, DOI: 10.1016/S0031-9422(03)00350-9 *
RICE ET AL., EMBOSS: THE EUROPEAN MOLECULAR BIOLOGY OPEN SOFTWARE SUITE, 2000
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET, vol. 16, 2000, pages 276 - 277, XP004200114, DOI: doi:10.1016/S0168-9525(00)02024-2
SAMBROOK,J.; FRITSCH,E.F.; MANIATIS,T.: "Mo-lecular cloning: a laboratory manual", 1989, COLD SPRING HARBOR LABORATORY
TURNER, G.: "Vectors for Genetic Manipulation", 1994, ELSEVIER, pages: 641 - 665
YELTON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 1470 - 1474
YELTON ET AL.: "Transformation of Aspergillus nidulans by using a trpC plasmid", PROC NATL ACAD SCI USA., vol. 81, no. 5, March 1984 (1984-03-01), pages 1470 - 4, XP000674725, DOI: doi:10.1073/pnas.81.5.1470

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020074502A1 (fr) * 2018-10-09 2020-04-16 Novozymes A/S Cellule hôte fongique filamenteuse modifiée
CN113056552A (zh) * 2018-10-09 2021-06-29 诺维信公司 经修饰的丝状真菌宿主细胞
US11434475B2 (en) 2018-10-09 2022-09-06 Novozymes A/S Modified filamentous fungal host cell for encoding a secreted polypetide of interest
CN110699387A (zh) * 2019-10-29 2020-01-17 华东理工大学 一种使用生物可降解有机酸催化剂的木质纤维素预处理方法
CN113265417A (zh) * 2020-02-14 2021-08-17 中国科学院天津工业生物技术研究所 有机酸产量提高的菌株及其构建方法和应用

Similar Documents

Publication Publication Date Title
WO2018015444A1 (fr) Édition du génome de crispr-cas9 avec des arn guides multiples dans des champignons filamenteux
US20170313997A1 (en) Filamentous Fungal Double-Mutant Host Cells
US20190225988A1 (en) Genomic integration of DNA fragments in fungal host cells
US11046736B2 (en) Filamentous fungal host
US20220025423A1 (en) Modified Filamentous Fungal Host Cells
WO2018172155A1 (fr) Cellules hôtes fongiques filamenteuses améliorées
US10550398B2 (en) RlmA-inactivated filamentous fungal host cell
DK2652138T3 (en) Promoters for expression of genes in a fungal cell
JP2019122386A (ja) 選択的オートファジー経路の不活性化成分を含む糸状真菌細胞及びその使用方法
WO2018167153A1 (fr) Cellule hôte fongique filamenteuse améliorée
US20160251666A1 (en) Promoters for Expressing Genes in a Fungal Cell
US11434475B2 (en) Modified filamentous fungal host cell for encoding a secreted polypetide of interest
WO2021018783A1 (fr) Cellule hôte fongique filamenteuse modifiée
EP3887391A1 (fr) Cellules hôtes fongiques filamenteuses améliorées
EP4237430A1 (fr) Peptides-leaders et polynucléotides codant pour ceux-ci

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18714982

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18714982

Country of ref document: EP

Kind code of ref document: A1