WO2002032952A1 - A novel polypeptide, a human kinesin light chain 62.92 and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, a human kinesin light chain 62.92, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as embryonic development deformation, tumour, paralysis, arhythmia, bronchial asthma, peptic ulcer, dementia etc. The invention also discloses the agonistes against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel human kinesin light chain 62.92.

Description

 A new polypeptide-human kinesin light chain 62.92 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a human kinesin light chain 62.92, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing the polynucleotides and polypeptides. Background technique

 Kinesin is a chemical kinetic protein that can use the energy generated by the hydrolysis of ATP to generate mechanical forces. In the presence of ATP, kinesin can bind to microtubules and move on them. Therefore, kinesin is also called "molecular motor". Kinesin is present in almost all cells. Most kinesins are free in the cytoplasm, while some are related to different membrane-bound organelles, such as cell vesicles, endoplasmic reticulum, and some membrane structures between the endoplasmic reticulum and the Golgi apparatus. Injecting kines in heavy chain (KHC) antibodies into cells can inhibit the movement of lysosomal, Golgi-derived transport vesicles, and membrane-bound pigment particles. Injecting antisense nucleic acids of KHC 'mRNA into cells can prevent the anterograde axial transport of many proteins.

 Kinesin also exists in the ciliary and flagellar systems of eukaryotic cells and is closely related to its 9 + 2 microtubule structure, which may participate in the relative rotational movement of the two microtubule fibers at the center of the 9 + 2 structure. Another kinesin-like protein, kinesin II, exists not only in the movable 9 + 2 cilia / flagellar movement system, but also in the immobile 9 + 0 cilia system, and a This type of transmission is called inter-flagellar transmission.

 In cell division, kinesin and other kinesin-related proteins (kines in-relatable proteins, KRPs) are the driving force for the formation, maintenance, binding of chromosomes, and movement of chromosomes to the poles. . Kinesin is indispensable in the formation of spindle poles and the arrangement of chromosomes in the position of the red plate. There is also evidence that kinesin can accelerate the depolymerization of the sacral duct, so kinesin may have a role in regulating the microtubule dynamics during mitosis. In addition, kinesin-spindle binding was also found in oocyte meiosis, which explained the role of kinesin in gamete formation.

Almost all kinesins have a backbone composed of two alpha helical fibers intertwined with each other. Many kinesins have an additional polypeptide chain at one end, called a light chain. Therefore, kinesin is a heterotetrameric structure of α 2-β 2 composed of two heavy chains and two light chains. Eukaryotic kinesin light chains have significant similarities in the same species, mainly in highly conserved domains [Beu s hausen, S., K lada kis, A. and Ja f fe, H. 1993. DNA Ce ll Bio l. 12, 901-909]. A significant feature of eukaryotic kinesin light chains is the diversity of the C-terminal tail domain, which may specifically bind to kinesin light chain-dependent proteins.

 In eukaryotes, the kinesin light chain has two functions: the N-terminal coiled coiled knot domain is required to bind the kinesin heavy chain, and the C-terminal tail domain is involved in protein transport.

 The kinesin family contains two main components: a dynamic domain and a carrier binding domain. Kinesins are involved in the transport of cellular vesicles and organelles within neurons. The mutated driver proteins in Drosophila cause weakened or lost neuron function. For humans, defects in the gene encoding the kinesin can cause neuropathy and clinically important syndromes. Because kinesin provides motive power for chromosome movement during meiosis and mitosis, defects in meiotic kinesin can cause infertility, spontaneous abortion, neonatal chromosomal disorders, and non-integral multiples of chromosomes. Defects in mitotic kinesin can cause abnormalities in somatic cells or tumor formation.

 The polypeptides of the present inventors have 43 ¾ identity and 59 ¾ similarity at the amino acid level with human kinesin light chains, respectively, and have similar structural characteristics. They all belong to the human kinesin family, so they are named human kinesin light chains 62 92, at the same time speculated that it has similar biological functions.

 As mentioned above, the human kinesin light chain 62.92 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of more participation has been required in the art These processes of the human kinesin light chain 62.92 protein, in particular, identify the amino acid sequence of this protein. New human kinesin light chain 62. 92 The isolation of protein-coding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs, so isolating its coding DNA is important. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human kinesin light chains 62.92 and their fragments, analogs and derivatives.

 Another object of the present invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a reconstituted body containing a polynucleotide encoding human kinesin light chain 62.92.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human kinesin light chain 62.92.

 Another object of the present invention is to provide a method for producing a human kinesin light chain 62.92.

Another object of the present invention is to provide a human kinesin light chain 62. 92 for the polypeptide of the present invention. Hang body.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human kinesin light chain 62.92.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of the human kinesin light chain 62.92.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to the polynucleotide [a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 970-2688 in SEQ ID NO: 1; and (b) a sequence having 1-331 in SEQ ID NO: 1 3-bit sequence.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; A method for preparing a polypeptide of the present invention by using a host cell and recovering an expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human kinesin light chain 62.92 protein activity, which comprises utilizing a polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of the human kinesin light chain 62.92 protein, including detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.

 The present invention also relates to a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptides and / or polynucleotides of the present invention in the preparation of a medicament for the treatment of cancer, cyanotic disease or immune disease or other diseases caused by abnormal expression of human kinesin light chain 62.92

Other aspects of the invention will be apparent to those skilled in the art due to the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthesis DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide, or protein sequence and a slice or portion thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such a "polypeptide" or "protein" does not mean that the amino acid sequence is limited to the completeness associated with the protein molecule Natural ammonia, basic acid.

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as leucine # for isoleucine. Variation may also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with the human kinesin light chain 62.92, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds a human kinesin light chain 62.92.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with human kinesin light chain 62.92, can block or regulate the biological or immunological activity of human kinesin light chain 62.92. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the human kinesin light chain 62.92.

 "Regulation" refers to changes in the function of human kinesin light chain 62.92, including the well height or array of protein activity, changes in binding characteristics, and any other biological properties, functions, or functions of human kinesin light chain 62.92. Changes in immune properties.

"Purely pure" means essentially free of other proteins, lipids, sugars or other substances that are naturally associated with it. Those skilled in the art can purify human kinesin light chains using standard protein purification techniques. 62. 92 , Basically Pure human kinesin light chain 62.92 on a non-reducing polyacrylamide gel can produce a single major human kinesin light chain 62.92 polypeptide. The purity of the polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-CT". The complementarity between two single-stranded molecules can be partial or complete. Interactions between nucleic acid chains and their degree have a significant effect on the efficiency and strength of hybridization between nucleic acid chains.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of a completely homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that conditions with a reduced degree of stringency allow non-specific binding, because conditions with a low degree of stringency require that the two sequences interact with each other specifically or selectively.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Clus ter method compares groups of sequences by checking the distance between all pairs. Arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues matching between sequence A and sequence X 100 Number of residues in sequence A-number of interval residues in sequence A-number of interval residues in sequence B

 The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jot Hein (Hein J., (1990) Methods in emzumology 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

"Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand". "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Hang body" refers to a complete antibody molecule and its fragments, such as Fa, F (ab,) ₂ and Fv, which can specifically bind to the epitope of human kinesin light chain 62.92.

 "Humanized anti-hugh" refers to an antibody in which the amino acid sequence of a non-antigen-binding region has been replaced to become more similar to human hugh, but still retain the original binding activity.

 The term "isolated" refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human kinesin light chain 62. 92" refers to human kinesin light chain 62. 92 that is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human kinesin light chains using standard protein purification techniques 62.92. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human kinesin light chain 62. 92 The purity of the polypeptide can be analyzed by amino acid sequence.

 The present invention provides a novel polypeptide-human kinesin light chain 62.92, which is basically composed of the amino acid sequence shown in SEQ 11) NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or nucleated hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue,

The present invention also includes fragments, derivatives and analogs of the human kinesin light chain 62.92. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the human kinesin light chain 62.92 of the present invention. The fragment, derivative or iC-like substance of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are conserved or non- Substitutions with respect to amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon; or (II) such a type in which one or more of the amino acid residues are A group on is substituted with another group to include a substituent; or (III) one in which the mature polyamine is fused with another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) A polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) formed by fusing additional amino acid sequences into a mature polypeptide. As explained herein, such fragments, Derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. The entire length of the polynucleotide sequence is 3313 bases, and its open reading frame 970-2688 encodes 572 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 43¾ homology with the human kinesin light chain, and it can be deduced that the human kinesin light chain 62. 92 has a similar structure and function of the human kinesin light chain.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" means including a polynucleotide encoding the polypeptide and including additional

The present invention also relates to the above-described variants of the described polynucleotides, which encode polypeptides or fragments, analogs, and derivatives of polypeptides having the same amino acid sequence as the present invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides without substantially altering the function of the polypeptide it encodes.

The present invention also refers to polynucleotides that hybridize to the sequences described above (the two sequences have 50% less, preferably with the same identity). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at relatively high ionic strength and higher temperature, such as 0.2xSSC, 0.1¾SDS, 6 (TC; or (2) added during hybridization Denaturing agents, such as 50% (ν / ν) formyl, amine, 0.1% calf serum / 0.1! FicoU, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95 Hybridization occurs only when the ratio is more than 97%, and the polypeptide encoded by the hybridizable polynucleotide has the same biological activity and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, the length of a "nucleic acid slice" contains at least 10 nucleotides, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PGR, to identify and / or isolate polynucleotides encoding human kinesin light chain 62.92.

 The polypeptides and nucleotides in the present invention are preferably provided in an isolated form, and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human kinesin light chain 62.92 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to a genomic or cDNA library to detect homologous polynucleotide sequences, and 2) chromosomal screening of expression libraries to detect multicores of clones with common structural characteristics Nucleotide fragments.

 The DNA fragment sequence of the present invention can also be transmitted by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of GDNA sequences. The standard method for isolating GDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular loning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available GDNA libraries are also available, such as different GDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (fe is not limited to): (l) DNA DNA or DNA RNA hybridization; (2) the presence or absence of marker gene functions; Π) determining the level of the transcript of the human robbery protein light chain 62.92; (4) by Immunological techniques or assays to determine biological properties, to detect 'gene expressed protein products. The above methods can be used alone or in combination.

In the method (1), the probe used for hybridization is homologous to any of the polynucleotides of the present invention, and has a length of at least 10 nucleotides, preferably at least 30 nucleotides, more Fortunately, at least 5 cores- Acid, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2,000 nucleotides, and the lesser is within 1,000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 Among the T (4) methods, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein products expressed by the human kinesin light chain 62.92 gene.

 A method using PCR to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Selected and synthesized by conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDN A sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human kinesin light chain 62.92 coding sequence, and a method for producing a polypeptide described in the present invention by recombinant technology .

 In the present invention, a polynucleotide sequence encoding the human kinesin light chain 62.92 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct recombinant expression vectors. An important feature of an expression vector is that it usually includes replication origins, promoters, marker genes, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing DNA sequences encoding human kinesin light chain 62. and appropriate transcriptional / translational regulatory partners. These methods include in vitro recombination 1) NA technology, 1) NA synthesis technology, and intracranial recombination technology (Sambroook, et al. Molecular Cloning, a L; i bora tory Manual, cold Sing Harbor Laboratory. New York, 丄 989 ). All

,) The described DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. The progeny of these promoters are: E. coli lac or trp promoter; Lambda phage PL promoter; eukaryotic promoters include GMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter Promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a human kinesin light chain 62.92 or a recombinant load containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or a recombinant vector. cell. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as Drosophila S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells. The conventional techniques are well known to those skilled in the art. When the host is a prokaryote such as E. coli, it can absorb

Competent cells of DA can be harvested after the exponential growth phase and treated with the GaC L ₂ method. The steps used are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a nucleated organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipids. Body packaging, etc.

Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human kinesin light chain 62. 92 (SG i en _Ge , 1984; 224: 1431) _0. Generally, the following reports Steps: (1) using the polynucleotide (or variant) encoding human human kinesin light chain 62.92 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

(2) culturing the host cell in a suitable medium; (3). Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic bacteria, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, Ion exchange chromatography, high performance liquid chromatography (HPI) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims.

 Figure 1 is a comparison diagram of the amino acid sequence homology of the human kinesin light chain 62.92 and the human kinesin light chain of the present invention. The upper sequence is the human kinesin light chain 62. 92, and the lower sequence is the human kinesin light chain. Identical amino acids and amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human kinesin light chain 62.92. 62.92kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The following specific examples are provided to further explain the present invention. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally based on conventional conditions such as Sambrook et al., Molecular Cloning: The conditions described in the Laboratory Manual (New Yor Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's instructions. Suggested Articles

 Example I 1: Cloning of human kinesin light chain 62.92

Total RNA from human fetal brain was extracted by guanidine isothiocyanate / phenol / chloroform method. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation lit (Qiegene). 2ug poly (A) raRNA forms c-ship through reverse transcription. The Smart! GDNA Cloning Kit (purchased from (UonteGh)) was used to insert the c! WA fragment into the multiple cloning site of pBSK (+) vector (CtonteGh) to transform DH5a. The bacteria were used to form a cMA library for Dye. The texnun te cycle react ion sequencing kit (Perkin-Eier) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the 5 'and y-terminal sequences of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and the GDNA sequence of one of the clones 1417 d 02 was found to be a new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the 1417d02 clone contains a full-length GDNA of 3313bp (as shown in Seq ID NO: 1), and has a 1719bp open reading frame (0RF) from 970bp to 2688bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-I4l7d02, and the encoded protein was named human kinesin light chain 62.92. Example 2: Homologous search of cDNA clones

 The sequence of the human kinesin light chain 62.92 and the protein sequence encoded by the human kinesin light chain according to the present invention are used by the Blast program.

(Bas iclocal Alignment search tool) [Altschul, SF et al.

J. Mol. Biol. 1990; 215: 403-10], homology search was performed in Genbank, Swissport and other databases. The gene with the highest homology to the human kinesin light chain 62.92 of the present invention is a known human kinesin light chain, and its encoded protein has an accession number of 1178597 in Genbank. The results of protein homology are shown in Fig. 1. The two are highly homologous and their identity is 43¾; their similarity is 59¾. Example 3: Cloning of a gene encoding human kinesin light chain 62.92 by RT-PCR

 CDM was synthesized using fetal brain cell total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification by Qiagene's kit, the following primers were used for PCR amplification:

 Primer 1: 5'- ATTGGAAGACTGTGAAGAAGCTTT -3 '(SEQ ID NO: 3)

 Primer 2: 5'- ACAGAGTCTCACCCTGTTGCCCAG -3, (SBQ ID NO: 4)

 Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;

Primer ² is the 3 'end reverse sequence in SEQ ID NO: 1.

 Amplification conditions: 50 μL cU / L KCLlOmmoi / L Ti.is- in a 50 μL reaction volume

Ci, (pH8.5), 1.5 ol / L MgCl ₂ , 200 pmol / L dNTP, lOpmo 丄 primer, 1U Taq DNA polymerase

(Clech company products). On a PE9600 DNA thermal cycler (Perkin-Elmer), press "Column F-Reaction 25 weeks Phase I: 4" C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, β-ac t ίη was set as a positive control and template blank was used as a negative control. The amplified product was purified with a QIAGBN kit and ligated to a PCR vector using a TA clone kit (Invitrog i). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-3313bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of human kinesin light chain 62.92 gene expression:

Total RNA was extracted by a one-shot method [Anal. Biochem 1987, 162, 156-159]. The method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue was homogenized with 4M guanidinium isothiocyanate_25mM sodium citrate, 0.2M sodium acetate (pH 4.D), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added. ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70¾ ethanol, dried and dissolved in water. Perform electrophoresis on 20 μ _§ INA on a 1.2¾ agarose gel containing 20 mM 3 (N-morpholine) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-IraM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. A ³² P dATP was used to prepare a ³² P-labeled DNA probe by a random primer method. The DNA probe used was the PCR amplified human kinesin light chain 62.92 coding region sequence ( ⁹ 70bp to 2688bp) shown in FIG. A 32P-labeled probe (approximately 2 × 10 ⁶ Gpm / ml) and RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contained 50% formamide-25 mM KH ₂ PO ₄ (pH 7.4)-5 x SSC-5 Denhardt's solution and 200 g / ral salmon sperm DNA. After hybridization, the filter was washed in 1 SSC-0.1¾SDS for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant human kinesin light chain 62.92

 Based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers were designed. The sequences are as follows:

 Primer 3: 5,-CCCCATATGATGGCAAATGATGTGGATAAAGAG-3 '(Seq ID No: 5)

 Primer 4: 5'- CCCGAGCTCTTACCTTTGTCCTTGCTGAAGGAA-3 '(Seq ID No: 6) The 5' ends of these two primers are respectively filled with Ndel and Sacl digestion sites, and the 5 'end and

The 3 'end coding sequence, Ndel and Sacl restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b W (Novagen, Cat. No. 69865.3). PCR was performed using the pBS_1417d02 plasmid containing the full-length target gene as a template. The PCR reaction conditions are as follows: a total volume of 50 μl contains 10 pg of pBS-MJ dD ² plasmid, primers Primer-3 and Primer-4, and ¹ J is lOpmol, Advantage polymerase Mix (product of CUontech) 1 μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and Sacl were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / mi), positive clones were selected by colony PGR method and sequenced. A positive clone (pET-I4l7d02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. The host strain BL21 (pET-I417d02) was 37 in LB liquid medium containing kanamycin (final concentration 30 μg / ml). C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue to cultivate for 5 hours. Collect the bacterial cells by centrifugation, break the bacteria with ultrasonic waves, and collect the supernatant by centrifugation. 92. A histidine (6H s-Tag) -binding affinity chromatography column His s. Bind Quick Car tr idge (product of Novageu) was chromatographed to obtain a purified human protein kinesin light chain 62. 92. After SDS-PAGE electrophoresis, a single band was obtained at 62.92kDa (Figure 2). The band was transferred to a PVDF membrane, and the N-terminal ammonia and amino acid sequence analysis was performed by the Edams hydrolysis method. As a result, 15 amino acids at the N-terminus and 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2 were completely formed. the same. Example 6 Production of anti-human kinesin light chain 62.92 antibodies

A peptide synthesizer (product of PE company) was used to synthesize the following human kinesin light chain 62. 92-specific peptides: NH2-Met-A la-Asn-Asp-Va l-As p-Lys-G lu-Leu-Met -Lys-G ln-l le-Leu-Cys-C00H (SEQ ID NO: 7) ₀ The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avramea s, et a l. Immunoohemi s try, 1969; 6: 43 ₀ Rabbits were immunized with 4mg of the above hemocyanin polypeptide complex plus Hendricken Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / n bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The peptide was bound to a Cyanol-activated Sepharose4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody could specifically bind to the human kinesin light chain 62.92. Example 7: Use of a polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to the genome or GDNA library of normal tissues or pathological tissues from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.

The purpose of this example is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer so that the non-specific binding site of the sample on the filter is saturated with the carrier and synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the probe on the hybridization is suddenly removed by a series of membranes. This embodiment uses high-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the background of the hybridization. And Only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the beech product is fixed on the filter membrane by the dot blot method. Under the high-strength washing film strip, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30¾-70¾, if it exceeds, non-specific hybridization increases;

3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as a preliminary selection dance, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology if the homology with non-target molecular regions is greater than 85 »/. Or if more than 15 consecutive bases are identical, the primary probe should not be used in general;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'- TGGCAAATGATGTGGATAAAGAGCTAATGAAGCAGATCCTC- 3 '(SEQ ID NO: 8) Probe 1 (piobe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (4lNt):

 5'-TGGCAAATGATGTGGATAAACAGCTAATGAAGCAGATCCTC-3 '(SEQ ID NO: 9) For other common reagents listed below and their preparation methods, please refer to the literature: DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA (USA) ) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (1998 Second Edition) [US] Sambrook et al., Science Press.

 # 品 制作 ： Product preparation:

1.Extract DNA from fresh or frozen tissue

 Steps-Steps: 1) Place fresh or freshly thawed normal liver tissue in ice and hold phosphate buffered saline

(PBS). Cut the tissue into small pieces with scissors or a scalpel. The tissue should be kept moist during operation. 2) Centrifuge the tissue at 1000g for 10 minutes. 3) Use cold homogenate buffer (0.25mol / L sucrose; ² 5ramot / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 mmol / L MgCl ₂ ) Suspended precipitate (about 1 OnU / g). 4) At 4 "C, homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Pellet the cells with resuspended cells (add 1 to every 0.1 g of the initial tissue sample- 5ml), and then centrifuged at 1000g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1ml per 0.1 g of the original tissue sample), and then follow the following phenol extraction method.

 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-l Onil cold PBS and centrifuge at 1000 _g for 10 minutes. 2) Use cold cell lysate to resuspend the floating pelleted cells (lx 10 ^s cells / ml) and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 0) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. IWA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2moi / L sodium acetate and 1 volume of cold 100% ethanol to the DNA solution and mix. Leave at -20 C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 70¾ cold ethanol 500 and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500 cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air-dry for 10-15 minutes to evaporate the surface ethanol. Be careful not to dry the precipitate, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper, and gradually increase TE, mix until the DNA is fully dissolved, and add approximately 1 lu per 1-5 X 10 ^δ cells.

 The following steps 8-13 are only used when pollution must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 10 (kig / ml, incubate at 37 ° C for 30 minutes. 9) Add and proteinase K, the final concentrations are 0.5½ and 100ug / ral, respectively. 37 ^U G for 30 minutes. 1)) The reaction solution was extracted with isocratic phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuged for 10 minutes. 11) Carefully #out the water phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully decant the water phase, add 1 / 丄 0 volume of 2mo 1 / L sodium acetate and 2.5 liters of cold ethanol, mix and set-20 ^U C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100¾ ethanol, air dry, and resuspend the nucleic acid, the process is the same as steps 3-6. 14) Determine A _2M , and A _2Sft to test the purity and yield of DNA. 15) Store at -20 ° (:) after packing.

If, 1) Take 4x2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two membranes are required for each probe, so that they can be separated in the following experimental steps. Wash the film with high intensity conditions and strength bars.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μ 1 Pro be (0.10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi _Y - ² P-dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 1 hour.

 3) Add 1/5 bromophenol blue indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) Combine the collected solutions of the first peak and print as ³² P_Probe (the second peak is free γ- ³² P-dATP). Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After the bag was sealed, it was shaken at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, and seal the bag, 42. C. Water was shaken overnight. Diaphragm:

 High-strength diaphragm:

 1) Take out the hybridized sample membrane.

 2) Wash in 2 乂 SSC, 0.1¾SDS at 40 ° C for 1 minute (twice).

 3) 0. I SSC, 0.1¾SDS, 40 ° C 冼, 15 minutes (2 times).

4) In 0.1xSSC, 0.1¾SDS, wash at 55 ^U C for 30 minutes (twice), and dry at room temperature.

 ½ intensity wash film:

1) Take out the sample membrane of hybridization. 2) 2xSSC, 0.12 SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) IxSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray autoradiography:

 -70 "G, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the hybridization spots of the above two probes; while the hybridization experiments conducted under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was significantly stronger than The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 Kinesin is a chemical kinetic protein that can use the energy generated by the hydrolysis of ATP to generate mechanical forces. In the human body, kinesin is involved in the transport of cellular vesicles and organelles in neurons; in addition, it drives the movement of chromosomes in meiosis and mitosis. Its abnormal expression can cause disorder of human neurotransmitter transportation and cell division, and then cause related diseases.

 The study found that kinesin is a heterotetrameric structure of α 2-β 2 composed of two heavy chains and two light chains. Among them, the kinesin light chain has an important influence on the physiological function of the protein.

 The polypeptide of the present invention and the human kinesin light chain are human kinesin light chains and contain characteristic sequences of the protein family. Both have similar biological functions. The abnormal expression of the polypeptide in vivo can cause human neurotransmitter transport. Disturbances with cell division, and then cause related diseases, including but not limited to:

 Common embryonic malformations, such as head and face hypoplasia, paralimb malformations, bone hypoplasia, cretinism, megacolon, polydactyly (toe) deformity, etc.

 Tumors are common in various tissues, such as skin squamous cell carcinoma, bone (sarcoma) tumors, various leukemias, (malignant) gliomas, (malignant) hydatidiform moles, (malignant) teratomas, and the like.

 Disorders related to peripheral nervous system dysfunction

The peripheral nervous system includes: 12 pairs of cerebral nerves, 31 pairs of spinal nerves, and autonomic nerves (sympathetic and parasensory), whose functional disorders can lead to the occurrence of related diseases or / and clinical symptoms. These diseases or / and clinical is Symptoms include, but are not limited to:

Cerebral nerve dysfunction:

 Loss of olfactory taste (olfactory nerve), visual impairment and / or visual field defect (optic nerve), ophthalmoplegia, diplopia, changes in pupil size / reflexes (eye movement nerve, pulley nerve, abductor nerve), facial sensory disorders, masticatory muscles Paralysis, neuroparalytic keratitis (trigeminal nerve), facial paralysis (facial nerve), deafness, tinnitus, vertigo, balance disorders, nystagmus (auditory nerve), hoarseness, dysphagia, loss of pharyngeal reflex (glossopharyngeal nerve, vagus nerve), shoulder Sagging, neck / shrug fatigue (collateral nerve), lingual muscle paralysis (sublingual nerve), etc .; 3. Spinal nerve dysfunction:

 1. Sensory disorders: inhibitory sensory disorders (lack of sensation, hyposensory sensation), irritating sensory disorders (sensory allergy, paresthesia, pain), etc .;

 2. Dyskinesia: central paralysis (monoplegia, hemiplegia, paraplegia), peripheral paralysis, etc .; autonomic (sympathetic and parasympathetic) functional disorders:

 1. Cardio-cerebral vascular system:

 Various arrhythmias, such as early atrial, early ventricular, sinus tachycardia, supraventricular tachycardia, atrial tachycardia, atrial flutter, atrial fibrillation, sinus bradycardia, sinus arrest, sick sinus syndrome, indoor conduction block, etc .;

 CAD, angina pectoris, myocardial infarction, cardiovascular neurosis, acute heart failure, chronic heart failure, HBP, neurogenic orthostatic hypotension, syncope, cerebrovascular accident, hypotension shock, etc .;

 2. Respiratory system:

 Pulmonary leeches, respiratory muscle paralysis, respiratory failure, bronchial asthma, etc .;

 3. Celiac disease:

 Nausea, vomiting, flatulence, gastrointestinal colic, biliary colic, renal colic, gastrointestinal obstruction, urinary tract obstruction, acute obstructive cholangitis, acute pancreatitis, chronic pancreatitis, etc .;

 Urine retention, enuresis, bladder irritation (frequency, urgency, dysuria), constipation, etc .;

 Reflux esophagitis, chronic gastritis, peptic ulcer, non-ulcerative dyspepsia, neurodiarrhea, etc., gastrointestinal neurosis: globus, psychogenic vomiting, nervous gas, anorexia nervosa, irritable bowel Syndrome, etc.

4. Endocrine system:

Diabetes, hypoglycemia, hyperlipidemia, hyperlipoproteinemia, obesity, pheochromocytoma, etc. 5. Muscle motor system: Myasthenia gravis, periodic paralysis, muscle rigidity, muscle spasm, etc .;

 6. Peripheral blood intellectual disease:

 Raynaud's disease, erythematous limb pain, etc .;

 7. Others: dysmenorrhea, glaucoma, visual impairment and ischemic necrosis of multiple organs, such as renal necrosis (renal failure), liver necrosis, intestinal necrosis, etc .;

 Cerebral cortical dysfunction related clinical symptoms:

―. Frontal lobe: dementia, personality changes (frontal frontal), strabismus, inability to write (back middle frontal gyrus), motor aphasia (back frontal lower back), olfactory loss (bottom of frontal lobe), paralysis of limbs , Convulsions (front central gyrus), etc .;

Parietal lobe: sensory disturbance (central gyrus), dyslexia (left corner gyrus), body image disorder (right side)

 Parietal lobe) etc;

3. Temporal lobe: Hookback attack (anterior temporal lobe), sensory / amnestic aphasia (left palate temporal lobe), hearing impairment (rear superior temporal gyrus), etc.

4. Occipital lobe: hemianopia, hallucination, visual disagreement, etc.

V. Limbic system: emotional symptoms, memory loss, disturbance of consciousness, hallucinations, etc.

 Cerebellar dysfunction

 Imbalance, positional nystagmus, cerebellar ataxia, fine movement disorders, etc .;

 In summary, the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of various diseases, such as embryonic developmental malformations, tumors, paralysis, arrhythmia, bronchial asthma, peptic ulcer, Dementia and more.

 The present invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) the human drive protein light chain 62.92. Agonists enhance human kinesin light chains 62.92 stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, a mammalian cell or a membrane preparation expressing a human kinesin light chain 62.92 can be cultured with a labeled human actin light chain 62.92 in the presence of a drug. Then measure the ability of the drug to increase or block this interaction ^

 Antagonists of the human kinesin light chain 62.92 include antibodies, compounds, deficiencies and analogs that have been screened. Antagonists of human kinesin light chain 62.92 can bind to human kinesin light chain 62.92 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.

ΐ When screening compounds as antagonists, human kinesin light chain 62. 92 can be added to the bioanalytical assay, and the effects of compounds on the interaction between human kinesin light chain 62. 92 and its receptor can be determined To determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds. Polypeptide molecules capable of binding to the human kinesin light chain 62.92 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, 62.92 molecules of human kinesin light chain should generally be labeled.

 The present invention provides a method for producing a body using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the human kinesin light chain 62.92 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

The production of polyclonal antibodies can be obtained by direct injection of human kinesin light chain 62.92 into immunized animals (such as home immunity, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent. Techniques for preparing monoclonal antibodies against human kinesin light chain 62. 92 include, but are not limited to, hybridoma technology (ohl er and Milste in. Nature, 1975, 256: 495-497), triple tumor technology, human B -Cell hybridoma technology, EBV-hybridoma technology, etc. The chimeric human antibody constant region and the variable region of non-human origin may be used in combination Pat some production techniques (Morr i son etal, PNAS, 1985, 81: 6851) 0 only some technical production of single chain antibodies (US Pa t No. 4946778) can also be used for the production of single-chain antibodies against human kinesin light chain 62. 92.

 The human kinesin light chain 62. 92 antibody can be used in immunohistochemical techniques to detect human kinesin light chain 62. 92 in biopsy specimens.

 Monoclonal antibodies that bind to the human kinesin light chain 62. 92 can also be labeled with radioisotopes, and their location and distribution can be tracked by injection. This radiolabeled anti-hive can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Anti-rest can also be used to design immunotoxins targeting a particular part of the body. For example, human kinesin light chain 62. 92 High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of the Hangzhou body with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid body can be used to kill the human kinesin light chain 62. 92 positive cells.

 Hang body in the present invention can be used to treat or prevent diseases related to human kinesin light chain 62.92. Administration of an appropriate dose of Hanguxiu can stimulate or block the production or activity of human kinesin light chain 62.92

The present invention also relates to a diagnostic test method for quantitative and localized detection of human kinesin light chain 62.92 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human kinesin light chain 62. 92 detected in the test can be used to explain the importance of human kinesin light chain 62. 92 in various diseases and to diagnose human kinesin light chain 62. 92. Disease. The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding the human kinesin light chain 62. 92 can also be used for rural therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or generation due to the non-expression or abnormal / inactive expression of human kinesin light chain 62.92. Recombinant gene therapy vectors (such as viral vectors) can be designed for human kinesin light chain 62.92, which is mutated to inhibit endogenous human kinesin light chain 62.92 activity. For example, a variant human kinesin light chain 62.92 may be a shortened human kinesin light chain 62.92, which lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human kinesin light chain 62.92. Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding the human kinesin light chain 62.92 into a cell. A method of constructing a recombinant viral vector carrying a polynucleotide encoding a human kinesin light chain 62.92 can be found in the literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human kinesin light chain 62. 92 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell via a vector (such as a virus, phage, or plasmid) outside the cell, and then introducing the cell栘 implanted into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human kinesin light chains 62.92 niRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA and DNA and ribozymes can be obtained by any of the existing RNA or DNA synthesis techniques, such as the technique of solid phase phosphoramidation synthesis of oligonucleotides, which is widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence is integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.

The polynucleotide encoding human kinesin light chain 62. 92 can be used for diagnosis of diseases related to human kinesin light chain 62. 92. The polynucleotide encoding human kinesin light chain 62. 92 can be used to detect the expression of human kinesin light chain 62. 92 or the abnormal expression of human kinesin light chain 62. 92 in a disease state. Driven by coders! · The DNA sequence of white light chain 62. 92 can be used to hybridize biopsy specimens to determine the expression status of human kinesin light chain 62. 92. Hybridization techniques include Scui thern blotting, Nort hern blotting, in situ hybridization, and the like. These techniques and methods are all mature technologies that are publicly available, and the relevant kits are commercially available. Some or all of the polynuclear acids can be used as probes for immobilization on Mic Array aray. Or DNA chip (also called "gene chip"), used to analyze the differential expression analysis of genes and gene deduction in tissues. Human kinesin light chain 62.92 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human kinesin light chain 62.92 transcription products.

 Detection of mutations in the human kinesin light chain 62.92 gene can also be used to diagnose human kinesin light chain 62.92-related diseases. Human kinesin light chain 62.92 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human kinesin light chain 62.92 WfA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, there is a need to identify resting sites for genes on the chromosome. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on GDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that have a human gene corresponding to the primer will produce amplified fragments.

 PCR localization of heterozygous cells is a quick way to locate DNA to specific staining cells. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct a chromosome-specific library.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step. For fans of this technique, see Verma et al. Hu Gui n Chromosomes: a Manua l of Bas IG Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Meidlian Inher itaiiGe in Man (available online with Johns Hopkins University Welch Medical library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosome regions.

Upstairs, differences in cDNA or genomic sequences need to be determined between diseased and diseased individuals. If a mutation is observed in some or all affected individuals, and the mutation is observed in any normal individual, The mutation may be the cause of the disease. Comparing diseased and oncoming individuals usually involves first looking for changes in crusting during staining, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, cDN A, which is accurately mapped to a chromosomal region common to the disease, can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase Figure resolution and each 20 kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human kinesin light chain 62. 92 is administered in an amount effective to treat and / or prevent the indication. The amount and dosage range of human kinesin light chain 62.92 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Request for Profit

1. An isolated polypeptide human kinesin light chain 62.92, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog or derivative thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of said polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises an amino group having the amino group shown in SEQ ID NO: 2

4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) a polypeptide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or the like; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to the polynucleotide; or

 (G) A polynucleotide having at least 70¾ identity to (a) or (b).

5-The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence shown in SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 970-2688 in SEQ ID NO: 1 or the sequence of positions 1-3313 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4 to 6 with a plasmid, a virus, or a carrier expression vector. Carrier.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having human kinesin light chain 62.92 activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing human kinesin light chain 62.92;

 (b) Isolating a polypeptide having human kinesin light chain 62.92 activity from the culture.

10. An antibody capable of binding to a native peptide, which is characterized in that the antibody is a Hang body that specifically binds to a human kinesin light chain 62.92.

丄 丄, a class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are mimics, Compounds that antagonize or inhibit the activity of human kinesin light chain 62.92.

丄 2. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

丄 3. A use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of the human driving protein light chain 62.92 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a polypeptide related to the polypeptide of any one of claims 1 to 3, characterized in that it comprises detecting the expression level of the polypeptide or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening a mimetic, agonist, antagonist or inhibitor of human kinesin light chain 62.92; or Identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing Gene

17. Use of a polypeptide, polynucleotide or compound as claimed in any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human kinesin light chain 62.92 abnormality.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as embryonic developmental abnormalities , Tumor, paralysis, arrhythmia, bronchial asthma, peptic ulcer, dementia medication.