WO2002012311A1 - A novel polypeptide - human fasciculation and elongation protein 16.61 and a polynucleotide encoding the same - Google Patents

Abstract

The present invention discloses a novel polypeptide human fasciculation and elongation protein 16.61 and a polynucleotide encoding the same, as well as a method of producing the polypeptide by DNA recombinant technique. The present invention also discloses methods of using the polypeptide in treatment of various disease, such as developmental deformation and/or functional disturbance of nerve system and so on. The present invention also discloses an antagonist against the polypeptide and the therapeutic use of the same. The present invention also discloses the use of such polynucleotide encoding human fasciculation and elongation protein 16.61.

Description

 A new polypeptide one-to-one bundling and elongation protein 16.61 and a polynucleotide encoding such a polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a human bundle and elongation protein 16.61, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique

 In the meridian system, axons often have to pass through different extracellular environments to reach their destination. Most axons grow along other axons, and the concentration of different axons in the nerve bundle is likely to play an important role in the tissues of the nervous system. Analysis of mutants of nematode dyskinesia revealed a set of genes that, when mutated, affect the growth of axons in the nerve fiber bundles, but axons in the matrix without surrounding nerve fibers are not affected. Specifically, mutations in this group of proteins (unc-34, unc-71, unc76) can cause two types of defects: many axons in the dorsal / abdominal nerve fiber bundles cannot stretch to their normal length; in addition, Many axons also fail to stay in the nerve fiber bundles that should normally be present. The two possible functions of unc-76 are: First, the unc-76 protein may play an important role in the formation and / or maintenance of nerve fiber bundles through interaction with cell surface adhesion proteins, axon membranes, and cytoskeleton; Second, the unc-76 protein may transmit signals from the cell surface to the inside of the cell to regulate the axon extension and adhesion. [Proc. Natl. Acad. Sci. USA Vol. 94, pp. 3414-3419, April 1997]

The human unc-76 human FEZ1 protein is called (bundling and elongating protein ζ-1). It consists of 393 amino acid residues. It has a high content of arginine / glutamic acid, its N-terminus is highly acidified, and some sites contain amphoteric helixes. FEZ1 has no signal sequence and no transmembrane region. This property implies that it exists inside the cell. FEZ1 is highly expressed in both adult mouse brain and mouse embryo. FEZ1 can interact with the N-terminal variable region of the PKCZ zeta subunit, and can also interact weakly with Pσ. This shows that FEZ1 is one of the substrates of PKC. FEZ1 plays a key role in axon guidance in mammals through PKC zeta interactions. [Proc Natl Acad Sci USA 1999 Mar 30; 96 (7): 3928-33] Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast , Growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, In spleen, prostate cancer, jejunum adenocarcinoma, and cardia cancer, the expression profile of the polypeptide of the present invention and the expression profile of human FEZ1 protein They are very similar, so their functions may be similar. The present invention ^ Human bundling and elongation protein

16. 61. ,;

 As described above, the human bundling and elongation protein 16.61 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art The human bunching and elongating protein 16.61 protein involved in these processes, especially the amino acid sequence of this protein is identified. Newcomer bundling and elongation protein 16.61 The isolation of protein-coding genes also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DM. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human bundles and elongins 16.61 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 It is another object of the present invention to provide a recombinant vector containing a polynucleotide encoding human bundling and elongating protein 16.61.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human bunching and elongation proteins 16.61.

 Another object of the present invention is to provide a method for producing human bundling and elongating protein 16.61.

 Another object of the present invention is to provide antibodies against the human polypeptide bundling and elongating protein 16.61 of the polypeptide of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of one-to-one bundling and elongation proteins 16.61 of the polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human bundling and elongin 16.61.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to polynucleotide (a); (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b). More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 701-1156 in SEQ ID NO: 1; and (b) a sequence having 1-1721 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human bundling and elongation protein 16.61 protein activity, which comprises utilizing a polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human bunching and elongation 16.61 protein, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The invention also relates to the use of the polypeptides and / or polynucleotides of the invention for the manufacture of a medicament for the treatment of cancer, developmental or immune diseases or other diseases caused by abnormal expression of human bundling and elongation protein 16.61.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

 The following terms used in the specification and claims have the following meanings unless specifically stated otherwise: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan. "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human bundling and elongating protein 16.61, can cause the protein to change, thereby regulating the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human bundling and elongating proteins 16.61.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with human bundling and elongin 16.61, can block or regulate the biological or immunological activity of human bundling and elongin 16.61. . Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human bunching and elongating proteins 16.61.

 "Regulation" refers to changes in the function of human bundling and elongin 16.61, including an increase or decrease in protein activity, changes in binding characteristics, and any other biological properties and functions of human bundling and elongation 16.61 Or changes in immune properties.

 "Substantially pure '" means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can use standard protein purification techniques to purify human bundling and elongating proteins 16.61 Basically pure human bundles and elongins 16.61 can produce a single main band on a non-reducing polyacrylamide gel. Human bundles and elongins 16.61 The purity of the polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require two sequences Columns are bound to each other as specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Clus ter method will check the distance between all pairs by Groups of sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by the Cluster method or by methods known in the art such as; Fotun Hein to determine the percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumo logy 183: 625 -645) "" Similarity "refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions when the alignment between amino acid sequences is aligned. Amino acids used for conservative substitutions For example, negatively charged amino acids may include aspartic acid Acids and glutamic acid; Positively charged amino acids can include lysine and arginine; Amino acids with similarly hydrophilic head groups that have no charge can include leucine, isoleucine, and valine Acids; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? ^ It can specifically bind to human bunching and elongation of 16.61 epitopes.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is in the same or all of the natural systems. Separation of matter that coexists with it is separation. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human bundling and elongating protein 16.61" refers to human bundling and elongating protein 16.61 that is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human bundling and elongation proteins using standard protein purification techniques 16.61. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. Human bundling and elongation protein 16.61 The purity of the polypeptide can be analyzed by amino acid sequence.

 The present invention provides a novel polypeptide one-to-one bundling and elongation protein 16.61, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.

 The invention also includes fragments, derivatives and analogs of human bundling and elongating protein 16.61. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the human bundled and extended proteins 16.61 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1721 bases, and its open reading frame 701-1 156 encodes 151 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human FEZ1 protein, and it can be inferred that the human bundle and elongation protein 16.61 have similar functions to human FEZ1 protein.

 The polynucleotide of the present invention may be in the form of DM or RNA. DM forms include cDNA, genomic DNA, or synthetic DNA. MA can be single-stranded or double-stranded. DM can be a coding chain or a non-coding chain. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 li co ll, 42 ° C, etc .; or (3) the same only between the two sequences Crosses occur only when the sex is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, preferably at least 100 nucleotides. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human bundling and elongation protein 16.61.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence of the present invention encoding human bundling and elongating protein 16.61 can be obtained by a variety of methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many proven techniques for extracting mRM, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sarabrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of human bundled and elongated protein 16.61 transcript levels; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the method (4), the protein product of 16.61 gene expression in human bundled and extended protein 'white can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 Methods for Amplifying DNA / RNA Using PCR Techniques (Saiki, et al. Science

1985; 230: 1350-1354) are preferred for obtaining the genes of the invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used for PCR. The primers can be appropriately selected based on the polynucleotide sequence information of the present invention disclosed herein, and can be synthesized by conventional methods. The amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using human bunching and elongation 16.61 coding sequence, and the recombinant technology to produce the present invention Polypeptide method.

 In the present invention, a polynucleotide sequence encoding human bundling and elongating protein 16.61 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Na thans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human bunching and elongation protein 16.61 and suitable transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sarabroook, et al. Mo l ecu lar Cloning, a Labora tory Manua l, co ld Spr ing Harbor Labora tory. New York, 1989) . The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters Promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include late initiation of replication SV40 enhancer with 100 to 270 base pairs on one side, polyoma enhancer and adenovirus enhancer on the late side of the origin of replication, and the like.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human bundling and elongating protein 16.61 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector. cell. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl, the steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human bundling and elongating protein 16.61 (Scence, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding the human-human bunching and elongation protein 16.61 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, it can be separated by various separation methods using its physical, chemical and other properties. Isolate and purify the recombinant protein. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of gene chip expression profiles of the inventor bundled and extended protein 16.61 and human FEZ1 protein. The upper graph is a graph of the expression profile of human bundling and elongation protein 16.61, and the lower graph is the graph of the expression profile of human FEZ1 protein. Among them, 1-fetal brain, 2-bladder mucosa, 3-PMA + Ecv304 cell line, 4-LPS + Ecv304 cell line thymus, 5-normal fibroblasts 1024NC, 6- Fibroblas t, growth factor stimulation, 1024NT, 7- Stimulation of scar into fc growth factor, 1013HT, 8-scar into fc without stimulation with growth factor, 1013HC, 9-bladder cancer cell EJ, 10-bladder cancer, 11-bladder cancer, 12-liver cancer, 13-liver cancer cells Strains, 14-fetal skin, 15-spleen, 16-prostate cancer, 17-jejunum adenocarcinoma, 18 cardia cancer.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human bundling and elongating protein 16.61.

17kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally in accordance with the general conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), or Follow the conditions recommended by the manufacturer.

 Example 1: Cloning of human bundling and elongin 16.61

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smar t cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5α. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the public DNA sequence database (Genebank), and one of the clones was found. The 0311g07 cDNA sequence is new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the 0311 g07 clone contained a full-length cDNA of 1721bp (as shown in Seq ID N0: l), and a 455bp open reading frame (0RF) from 701bp to 1156bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0311g07 and the encoded protein was named human bundling and elongation protein 16.61. Example 2: Cloning of a gene encoding human bundling and elongation protein 16.61 by RT-PCR

 CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Pr imer 1: 5,-CCCAACAATGTAACTGCTTGATAT — 3, (SEQ ID NO: 3)

 Pr imer2: 5'- GGAAACAGGAGGATTTATTTAGAT -3 '(SEQ ID NO: 4)

 Pr imerl is a forward sequence starting at the lbp at the 5 'end of SEQ ID NO: 1;

 Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1. .

Amplification reaction conditions: 50 mmol / L KC 1, 10 mmol / L Tris-CI, (pH 8.5.5), 1.5 ramol / L MgCl ₂ , 200 μ rao l / L in a reaction volume of 50 μ 1 dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, set β-act in as a positive control and template blank as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-1721bp shown in SEQ ID NO: 1. Example 3: Nor thern blot analysis of human bundling and elongation 16.61 gene expression:

Total RNA was extracted in one step [Ana l. Bi ochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25raM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. With 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7. 0)-5 mM sodium acetate-ImM EDTA-2. 2M formaldehyde. It was then transferred to a nitrocellulose membrane. ³² P dATP Preparation ³² P- DNA probe labeled by the random primer Method - with cc. The DNA probe used was the PCR amplified human bundling and elongating protein 16.61 coding region sequence (701bp to 1156bp) shown in FIG. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7. 4) -5 x SSC- 5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, place the filter at 1 x SSC-0.1 ° /. Wash in SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human bundling and elongation protein 16.61

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

 Pr imer3: 5'-CCCCATATGATGCTGAATTCGTCCTCAGGAAAC-3 '(Seq ID No: 5) Pr iraer4: 5' -CATGGATCCTCATTGTAACCTCTGCCTCCCAGG-3 '(Seq ID No: 6) The 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively. The Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site. PCR was performed using the pBS-0311g07 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing pBS- 0311g07 plasmid 10 pg, primers Pr imer 3 and Pr imer- 4 points, and J was 1 Opmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight in LB plates containing kanamycin (final concentration 30 g / ral). The positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0311g07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 g / ml), the host bacteria BL21 (pBT-0311g07) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 ol / L. Continue to cultivate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. Chromatography was performed using an affinity chromatography column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines "His-Tag". The purified human protein bundle and elongation protein 16.61 were obtained. After SDS-PAGE electrophoresis, a single band was obtained at 17 kDa (Figure 2). The band was transferred to a PVDF membrane using the Edams hydrolysis method. Analysis of the N-terminal amino acid sequence revealed that the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Anti-Human Bundle and Elongated Protein 16.61 Produce

A peptide synthesizer (product of PE company) was used to synthesize the following 16.61-specific peptides: NH2-Met-Leu-Asn-Ser-Ser-Ser-Gly-Asn-Leu-Leu-Lys- I le-Gln-I le-Ser- C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. With ½ g of cyanin Peptide complex plus complete Freund's adjuvant was used to immunize rabbits. After 15 days, hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody could specifically bind to human bundling and elongating protein 16.61. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30% -70%, non-specific hybridization increases when it exceeds; 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'- TGCTGAATTCGTCCTCAGGAAACTTGTTAAAAATACAGATT- 3 '(SEQ ID NO: 8)

 Probe (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5'-TGCTGAATTCGTCCTCAGGACACTTGTTAAAAATACAGATT-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: DM PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA ) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

 Steps: 1) Place fresh or freshly thawed normal liver tissue in ice and hold phosphate buffered saline

(PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 mmol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (l-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DM phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x 10 ^s cells / ml) and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation

Steps: 1) 10 volume of 2mol / L sodium acetate and 2 volumes of cold 100 ° /. Add ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DM pellet in a small volume of TE or water. Vortex at low speed or blow with a dropper while gradually increasing TE, mix until the DNA is fully lysed, and add approximately 1 ul per 1- 5 x 10 ^δ cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RMase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml, respectively. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well-20. C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A _2S . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe for later experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Leave on for 5 minutes (twice;) and dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

Labeling of probes 1) 3 μl Probe (0.1OD / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Start collecting the first peak before ³² P-Probe washes out (monitoring can be used to monitor;).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared.

 Pre-hybridization.

 Place the sample film in a plastic bag, add 3-10 mg of pre-hybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C in water. 2 hour.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake at 42 ° C overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature.

 Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 4) In 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

 X-ray auto-development:

 -70 ° C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

釆 The hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was obvious. Stronger in radioactivity than the hybridization spot of another probe. Therefore, probe 1 can be used for qualitative and quantitative analysis. The presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed. Example 7 DNA Microarray

 Gene chip or gene microarray (DM Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on slopes , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, see the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Sc ience 278, 680-686. And the literature Hel le, RA, Schema , M., Cha i, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μ ηι. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Q. Wash with 2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen). Cy 3dUTP (5-Am i no-pr opa r gy 1 -2- -deoxyur idi ne 5--tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) The mRM of human mixed tissues was labeled with a fluorescent reagent Cy5dUTP (5- Amino- propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Pharaacia Biotech). Cell line) mRM, probes were prepared after purification. For specific steps and methods, see:

Schena,

 M., Sha lon, D., Hel ler, R. (1996) Proc. Nat l. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Shalon, Dar i., Davis, RW (1995) Science. 270. (20): 467-480. (3) Hybridization

 The probes from the above two types of tissues were hybridized with the chip in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a graph based on these 18 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of human bundle and elongation protein 16.61 and human FEZ1 protein according to the present invention are very similar. Industrial applicability

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.

In the developing nervous system, axons often pass through different extracellular environments to reach their destination. Most axons grow along other axons, and different axons are concentrated in the nerve bundle, which is likely to play an important role in the tissues of the nervous system. Human FEZ1 protein has two functions: first, it plays an important role in the formation and / or maintenance of nerve fiber bundles through interaction with cell surface adhesion proteins, axon membranes, and cytoskeleton; etc. The cell surface is passed inside the cell to regulate the axon extension and adhesion. Abnormal expression of human FEZ1 protein in vivo can affect the formation and / or maintenance of nerve fiber bundles, and then lead to the occurrence of related diseases. The expression profile of the polypeptide of the present invention is consistent with the expression profile of the human FEZ1 protein, and both have similar biological functions. The polypeptide of the present invention has an important role in the formation and / or maintenance of nerve fiber bundles in the body, and its abnormal expression can lead to the development of neurological malformations and / or dysfunctional diseases, including but not limited to: Malformations: neural tube defects (no cerebral malformations, spina bifida, spinal meningocele, hydrocephalous meningoencephalocele), hydrocephalus in / outside the brain, etc.

 Cerebral cortical dysfunction-related clinical symptoms:-1. Frontal lobe: dementia, personality changes (frontal frontal), strabismus, inability to write (back middle frontal gyrus), motor aphasia (back frontal gyrus), loss of smell (Bottom of frontal lobe), limb paralysis, convulsions (central gyrus), etc .;

Parietal lobe: sensory disturbance (central posterior gyrus), dyslexia (left corner gyrus), body image disorder (right parietal lobe), etc .;

Temporal lobe: Hookback attack (anterior temporal lobe), sensory / amnestic aphasia (left temporal lobe), hearing impairment (rear superior temporal gyrus), etc.

4. Occipital lobe: hemianopia, hallucinations, visual disagreement, etc.

V. Limbic system: emotional symptoms, memory loss, disturbance of consciousness, hallucinations, etc.

 Disorders related to peripheral nervous system dysfunction

 Peripheral nervous system includes: 12 pairs of brain nerves, 31 pairs of spinal nerves, and autonomic nerves (sympathetic and parasympathetic). Its functional disorders can lead to the occurrence of related diseases or / and clinical symptoms. These diseases or / and clinical symptoms include, but are not limited to:

I. Neurological disorders:

 Loss of olfactory taste (olfactory nerve), visual impairment and / or visual field defect (optic nerve), ophthalmoplegia, diplopia, changes in pupil size / reflexes (eye movement nerve, pulley nerve, abductor nerve), facial sensory disorders, masticatory muscles Paralysis, neuroparalytic keratitis (trigeminal nerve), facial paralysis (facial nerve), deafness, tinnitus, vertigo, balance disorders, nystagmus (auditory nerve), hoarseness, dysphagia, loss of pharyngeal reflex (glossopharyngeal nerve, vagus nerve), shoulder Sagging, turning neck / shrugs, fatigue (collateral nerve), lingual muscle paralysis (sublingual nerve), etc .;

Second, spinal nerve dysfunction:

 1. Paresthesia: Inhibitory paresthesia (lack of sensation, hypoparesis), irritating paresthesia (allergy, paresthesia, pain), etc .;

2. Dyskinesias: central paralysis (monoplegia, hemiplegia, paraplegia), peripheral paralysis, etc .; 3. Autonomic (sympathetic and parasympathetic) disorders:

 1. Cardio-cerebral vascular system:

 Various arrhythmias, such as early atrial, early ventricular, sinus tachycardia, supraventricular tachycardia, ventricular tachycardia, atrial flutter, atrial fibrillation, sinus bradycardia, sinus arrest,

 Sinus syndrome, indoor conduction block, etc .;

 CAD, angina pectoris, myocardial infarction, cardiovascular neurosis, acute heart failure, chronic heart failure, HBP, neuron

 Orthostatic hypotension, syncope, cerebrovascular accident, hypotension shock, etc .;

 2. Respiratory system:

 Pulmonary edema, respiratory muscle paralysis, respiratory failure, bronchial asthma, etc .;

 3. Celiac disease:

 Nausea, vomiting, flatulence, gastrointestinal colic, biliary colic, renal colic, gastrointestinal obstruction, urinary tract obstruction, acute obstructive cholangitis, acute pancreatitis, chronic pancreatitis, etc .;

 Urinary retention, enuresis, bladder irritation (frequency of urination, urgency, dysuria), constipation, etc .; reflux esophagitis, chronic gastritis, peptic ulcer, non-ulcerative dyspepsia, neurogenic diarrhea, etc.,

 Gastrointestinal neurosis: Hydatid disease, psychogenic vomiting, neurogenic qi, anorexia nervosa, irritable bowel syndrome, etc .;

4. Endocrine system:

 Diabetes, hypoglycemia, lipidemia, hyperlipoproteinemia, obesity, pheochromocytoma, etc .;

5. Muscle motor system:

 Myasthenia gravis, periodic paralysis, muscle rigidity, muscle spasm, etc .;

 6. Peripheral vascular disease:

 Raynaud's disease, erythematous limb pain, etc .;

 7. Others: dysmenorrhea, glaucoma, visual impairment and ischemic necrosis of multiple organs, such as renal necrosis (renal failure), liver necrosis, intestinal necrosis, etc .;

 In summary, the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used for the treatment of various diseases, such as developmental disorders of the nervous system and / or dysfunctional diseases.

The invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human bundling and elongation of 16.61. Agonists enhance biological functions such as human bundling and elongation 16.61 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, in the presence of a drug, a mammalian cell or a human expressing bundle and elongation protein 16.61 of Membrane formulations were cultured with labeled human bundling and elongin 16.61. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human bundling and elongation proteins 16.61 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human bundling and elongin 16.61 can bind to human bundling and elongin 16.61 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.

 When screening compounds as antagonists, human bundles and elongin 16.61 can be added to bioanalytical assays by measuring the effects of compounds on the interactions between human bundles and elongin 16.61 and their receptors Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human bundling and elongation protein 16.61 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human bundles and elongin 16.61 molecules should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against human bunching and elongating protein 16.61 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

 The production of polyclonal antibodies can be obtained by human bunching and elongating protein 16.61 by direct injection into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on. Techniques for preparing monoclonal antibodies to human bundling and elongating protein 16.61 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human bundling and elongation protein 16.61.

 Antibodies against human bundling and elongin 16.61 can be used in immunohistochemistry to detect human bundling and elongin 16.61 in biopsy specimens.

 Monoclonal antibodies that bind to human bundling and elongation protein 16.61 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins against a specific bead site in the body. Such as human bundling and elongation protein 16. 61 High affinity monoclonal antibodies can interact with bacterial or plant toxins (such as diphtheria toxin, ricin, Ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human bunching and elongating protein 16. Positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases associated with human bundling and elongation protein 16.61. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human bundling and elongation proteins 16.61.

 The invention also relates to a diagnostic test method for the quantitative and localized detection of human bundling and elongin 16.61 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human bundling and elongin 16.61 detected in the test can be used to explain the importance of human bundling and elongin 16.61 in various diseases and for the diagnosis of human bundling and elongin 16.61 A working disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 Polynucleotides encoding human bundling and elongation proteins 16.61 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the lack of expression or abnormal / inactive expression of human bundling and elongation protein 16.61. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human bundling and elongating protein 16.61 to inhibit endogenous human bundling and elongating protein 16.61 activity. For example, a mutated human bundling and elongin 16.61 may be a shortened human bundling and elongin 16.61 that lacks a signaling domain, although it can bind to downstream substrates, but lacks signaling. active. Recombinant gene therapy vectors can therefore be used to treat diseases caused by human bundling and elongation protein 16.61. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding human bunching and elongating proteins 16.61 into cells. Methods for constructing recombinant viral vectors carrying polynucleotides encoding human bundling and elongation proteins 16.61 can be found in existing literature (Sambrook, et al.). In addition, a polynucleotide encoding human bundling and elongation protein 16.61 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DM) and ribozymes that inhibit human bundling and elongation of 16.61 mRM are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RM and DNA and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid phase phosphorus The technology of synthesizing oligonucleotides by acid amide chemical synthesis has been widely used. Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human bundling and elongin 16.61 can be used for the diagnosis of diseases related to human bundling and elongin 16.61. The polynucleotide encoding human bundling and elongation protein 16.61 can be used to detect the expression of human bundling and elongation protein 16.61 or abnormal expression of human bundling and elongation protein 16.61 in a disease state. For example, DNA sequences encoding human bunching and elongation protein 16.61 can be used to hybridize biopsy specimens to determine the expression of human bunching and elongation protein 16.61. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and the relevant kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DM chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Human bundling and elongation 16.61 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human bundling and elongation 16.61 transcription products.

 Detection of mutations in human bundling and elongin 16.61 can also be used to diagnose human bundling and elongation 16.61-related diseases. Human bundling and elongation 16.61 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human bundling and elongation 16.61 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome can be utilized Or a large number of genomic clones to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manu l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming

1 megabase mapping capability and every 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human bundling and elongin 16.61 are administered in amounts effective to treat and / or prevent specific indications. The amount and range of human bundling and elongin 16.61 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

1. An isolated polypeptide-human bundle and elongation protein 16.61, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative of the polypeptide .

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to the polynucleotide; or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence at positions 701-1156 in SEQ ID NO: 1 or a sequence at positions 1-1721 in SEQ ID NO: 1. .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human bundling and elongating protein 16.61 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing human bunching and elongation protein 16.61;

 (b) Isolating polypeptides with human bundling and elongation 16.61 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to human bundle and elongation protein 16.61.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human bundling and elongation proteins 16.61.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. The use of the compound according to claim 11, characterized in that the compound is used for regulating the activity of human bundling and elongation protein 16.61 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimics, agonists, antagonists or inhibitors of human bundling and elongation protein 16.61; or For identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human bundling and elongation 16.61 abnormalities.

18. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and drugs of various inflammations.