WO2002000835A2 - A novel polypeptide, a human transcription protein 23, and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, a human transcription protein 23, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumor, hemopathy, HIV infection, immunological disease, and various inflammation, etc. The invention also discloses the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel human transcription protein 23.

Description

 A new polypeptide-human transcription factor protein 23 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human transcription factor protein 23, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique

 Phylogenetic studies suggest that the T-box family originated before metazoans separated from a common ancestor. The T-box gene encodes a transcription factor protein that plays an important role in the development of all animals. T-box gene has been found in Caenorhabditis elegans and Drosophila

 (Drosopbi la), sea urchin (Sea urchin), ascidian (Ascidians), Xenopus (Zebrafish), mouse (Mouse) and human (Homo sapiens) and other almost all animal genomes. The T-box plays a very important role in a long period of development from unfertilized eggs to organogenesis. (Bioessays 1998 Jan; 20 (1): 9-19)

 The T-box family is characterized by a MA binding domain containing about 200 amino acids, called the T-functional domain. T-box family proteins play an extremely important role in the development of spinal impellers and invertebrate embryos, including regulating the formation of gastrula embryos, regulating the development of the heart, and even related to determining whether to form limbs. However, how the expression of the T-box is regulated and why different members of the family play different functions have not yet been clearly studied. (Trends Genet 1999 Apr; 15 (4): 154-8)

 A family of T-box genes related to mammalian brains, Tbr2, has been discovered, which is a family similar to mouse Tbrl and Xenopus mesoderm regulatory genes. Tbr2 is predominantly expressed in developing brain tissue. On the 14.5th day of embryonic development (E14.5), Tbr2 was expressed in the midbrain and hindbrain. During this period, Tbr2 was expressed in neurons located in specific parts of the brain, such as the trigeminal nerve, vestibule, and sublingual nerve. By day 18.5 of embryo development, Tbr2 expression was not detected. Tbr2 is not expressed in mature adult brain cells. Studies have shown that Tbr2 plays a vital role in the differentiation of neurons, which is much greater than its role in the development of cell merozoites or differentiated cells. (Brain Res Dev Brain Res 1999 Jun 2; 115 (2): 183-93)

 Mouse Tbr2 had two peaks of expression on day 6.5 and day 14.5 of embryonic development, suggesting that Tbr2 may also play an important role in the early stage of the gastrula embryo. (Brain Res Dev Brain Res 1999 Jun 2; 115 (2): 183-93)

Current research has demonstrated the great role of Tbr2 in biological development. In studies of many different model organisms and humans, it has been found that mutations in Tbr2 cause developmental disorders. (Bioessays 1998 Jan; 20 (1): 9-19)

 Based on the results of amino acid homology comparison, the polypeptide of the present invention was presumed to be identified as a new human transcription factor protein 23 (HTbr2P23).

Gene chip analysis found that in the bladder mucosa, A + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1 024NC, Fibroblas t, growth factor stimulation, 1 0 ²⁴ NT, scar into fc growth factor stimulation, 1013HT, scar into fc without stimulation with growth factor, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer The expression profile of the polypeptide of the invention is very similar to that of the human transcription factor protein, so the functions of the two may also be similar. The invention is named human transcription factor protein 23.

 As mentioned above, the human transcription factor protein 23 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need in the art to identify more involved in these processes. Human transcription factor protein 23 protein, particularly the amino acid sequence of this protein is identified. The isolation of the new human transcription factor protein 23 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human transcription factor protein 23 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human transcription factor protein 23.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human transcription factor protein 23.

 Another object of the present invention is to provide a method for producing human transcription factor protein 23.

 Another object of the present invention is to provide an antibody against the polypeptide-human transcription factor protein 23 of the present invention.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention-human transcription factor protein 23. .

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormality of human transcription factor protein 23.

The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide Is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70¾ identity to the polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 223-861 in SBQ ID NO: 1; and (b) a sequence having positions 1-988 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human transcription factor protein 23 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human transcription factor protein 23 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.

 The present invention also relates to a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human transcription factor protein 23.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

 The following terms used in this specification and claims have the following meanings unless specifically stated otherwise:

 "Nucleic acid sequence" refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and can also refer to genomic or synthetic DNA or RM, which can be single-stranded or double-stranded, representing the sense strand or Antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The change may include an amino acid sequence or a nucleotide sequence Amino acid or nucleotide deletions, insertions or substitutions. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with human transcription factor protein 23, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human transcription factor protein 23.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human transcription factor protein 23 when combined with human transcription factor protein 23. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human transcription factor protein 23.

 "Regulation" refers to a change in the function of human transcription factor protein 23, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immunological changes in human transcription factor protein 23.

^"11 Substantially pure" means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human transcription factor protein 23 using standard protein purification techniques. Substantially pure Human transcription factor protein 23 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human transcription factor protein 23 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be achieved by hybridization under conditions of reduced stringency (Southern blotting or

Nor thern blot, etc.) to detect. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not imply a reduction in stringency Low conditions allow non-specific binding because conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higg ins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

The number of residues matching between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Clus ter method or by methods known in the art For example, Jotun Hein determines the percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzuraology 183: 625-645). ₀ "Similarity" means that the amino acid residues at the corresponding positions are the same when the amino acid sequences are aligned. Or the extent of conservative substitution. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence. The "antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa, (^) ₂ and? ^ It can specifically bind to the epitope of human transcription factor protein 23.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not in its natural environment Ingredients, they are still separate.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated human transcription factor protein 23" means that human transcription factor protein 23 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human transcription factor protein 23 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human transcription factor protein 23 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, human transcription factor protein 23, which is basically composed of the amino acid sequence shown in SEQ ID NO: ² . The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of human transcription factor protein 23. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the human transcription factor protein 23 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or a UV) a type in which an additional amino acid sequence is fused to a mature polypeptide (such as Leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length nucleotide sequence of 988 bases, and its open reading frame 223-861 encodes 212 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile with human transcription factor protein, and it can be deduced that the human transcription factor protein 23 has a similar function to human transcription factor protein.

The polynucleotide of the present invention may be in the form of DNA or RM. DM forms include cDN A, genome DM or synthetic DNA. DM can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); and Non-coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50 ° / »(v / v) formamide, 0.1% calf serum / 0.1% Fico ll, 42 ° C, etc .; or (3) only between the two sequences The hybridization occurs only when the identity between them is at least 95%, and more preferably 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 and Active.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human transcription factor protein 23.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human transcription factor protein 23 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DNA from genomic DM Sequence; 2) chemically synthesizing a DNA sequence to obtain a double-stranded MA of the polypeptide.

 Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been developed for mRNA extraction, and kits are also commercially available (Qiagene). The construction of c-library libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Colling Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of human transcription factor protein 23; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2,000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human transcription factor protein 23 gene expression. '

 Amplification of DM / RNA by PCR (Sa iki, et a l. Science

1985; 230: 1350-1354) are preferred for obtaining the genes of the invention. In particular, when it is difficult to obtain a full-length cMA from a library, the RACE method (RACE-cMA terminal rapid amplification method) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified MA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cMA sequence of multiple clones in order to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human transcription factor protein 23 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. In the present invention, a polynucleotide sequence encoding the human transcription factor protein 23 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J Bio Cliem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding human transcription factor protein 23 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua 1, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the _PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters , Retroviral LTRs and other known promoters that can control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pairs of SV40 enhancer on the late side of the origin of replication, polyoma enhancers and adenoviral enhancers on the late side of the origin of replication.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription regulatory elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding human transcription factor protein 23 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells. Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DM may be harvested after exponential growth phase, with (: Treatment 1 _2, steps well known in the art with alternative is MgC l _2. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DM transfection methods can be selected: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Body packaging, etc.

 Using conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human transcription factor protein 23 (Sc ience, 1984; 224: 1431). Generally there are the following steps:

(1) using the polynucleotide (or variant) encoding human human transcription factor protein 23 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), the medium used in the culture may be selected from various conventional mediums according to the host cells used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of human transcription factor protein 23 and human transcription factor protein according to the present invention. The upper graph is a graph of the expression profile of human transcription factor protein 23, and the lower graph is the graph of the expression profile of human transcription factor protein 23. Among them, 1-bladder mucosa, 2- PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, ⁴ -normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6-scar into fc growth factor Stimulation, 1013HT, 7-scar into fc without stimulation with growth factors, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer. FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-MGE) of the isolated human transcription factor protein 23. ² Da is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to the conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres., 1989), or Follow the conditions recommended by the manufacturer. Example 1: Cloning of human transcription factor protein 23

 Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Quik raRNA Isolat ion Ki t

(Qiegene product) Isolate poly (A) mRNA from total MA. 2ug poly (A) mRM forms cDNA by reverse transcription. The smart cDM cloning kit (purchased from Clontech) was used to insert the cDM fragment into the multi-cloning site of the pBSK (+) vector (Clontech) to transform DH ⁵ α to form a CDM library. Dye-terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 1067M0 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the 1067hl 0 clone contains a full-length CDM of 988bp (as shown in Seq ID NO: 1), and has a 639bp open reading frame (0RF) from 223bp to 861bp, encoding a new protein (such as Seq ID N0: 2). We named this clone pBS-1067hl0 and encoded the protein as human transcription factor protein 23. Example 2: Cloning of a gene encoding human transcription factor protein 23 by RT-PCR

 CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.

 After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Pr imer 1: 5'- GGAAGGCGGAGCGCTAACGTCTAA -3 '(SEQ ID NO: 3)

 Pr imer2: 5,-TCTCACATGTTTGTTTATTAGTGT -3 '(SEQ ID NO: 4)

 Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer 2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

Conditions for the amplification reaction: ⁵⁰ mmol / L KC1 in a reaction volume of ⁵⁰ μ1, 10 legs ol / L

Tr is-Cl, (pH 8. 5), 1.5 mmol / L MgCl ₂ , 200 μιηοΙ / L dNTP, lOpmol primer, 1U Taq DNA polymerase (C 1 ontech company product). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. Set β-act in at the same time as RT-PCR For positive control and template blank as negative control. The amplified product was purified using a QIAGEN kit, and ligated to a PCR vector using a TA cloning kit (Invitrogen). DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-988bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human transcription factor protein 23 gene expression:

Total RM was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ _§ RNA, electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (H7. 0)-5 mM sodium acetate-1 mM EDTA-2. 2M formaldehyde . It was then transferred to a nitrocellulose membrane. A- ³² P dATP was used to prepare ³² P-labeled DM probes by random primer method. The DM probe used was the PCR amplified human transcription factor protein 23 coding region sequence (223bp to 861bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 × 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50 ° /. Formamide-25mM KH ₂ P0 ₄ (pH 7.4)-5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in lx SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human transcription factor protein 23

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

 Pr imer 3: 5'-CCCCATATGATGGCTCAGACAGATAAGCCAACA-3 '(Seq ID No: 5)

Pr imer 4: 5 '-CATGGATCCTTACTCCAGCCAAACCCTGGGGTT-3' (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding of the 5' and 3 'ends of the target gene, respectively. Sequence, Ndel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pBT-28b (+) (Novagen, Cat. No. 69865. 3). PCR was performed using the pBS-1067M 0 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing pBS-1067M 0 plasmid 10 pg, 51 ¾ Pr imer-3 ^ PPr imer-4 ^ J ^ 1 Opmo 1 ^ Advantage polymerase Mix (product of Clontech) 1 μ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. NdeJ and BamHI were used to double digest the amplified product and plasmid PBT-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight in LB plates containing kanamycin (final concentration 3 (^ g / ml)), and positive clones were selected by colony PCR method and sequenced. the positive clones with the correct sequence _(P ET- 1067hl 0) recombinant plasmids by the calcium chloride method to transform E. coli ^{BL 2 l (DE3) plySs (} Novagen company's product). In containing kanamycin (final concentration 30 μ β _/ πι1) in LB liquid medium, host strain BL21 (pET- 1067hl0) at 37. C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 ol / L, and continue to cultivate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidines (6His-Tag). Purified the target protein human transcription factor protein 23. After SDS-PAGE electrophoresis, a single band was obtained at 23 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-human transcription factor protein 23 antibodies

 The following peptides specific for human transcription factor protein 23 were synthesized using a peptide synthesizer (product of PE company):

NH2-Met-Ala-Gln-Thr-Asp-Lys-Pro-Thr-Cys-I le-Pro-Pro-Glu-Leu-Pro-C00H (SEQ ID: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. The titer of antibodies in rabbit serum was determined by BLISA using a 15 g / ml bovine serum albumin peptide complex-coated titer plate. Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit serum. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method demonstrated that the purified antibody specifically binds to human transcription factor protein 23. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 The suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses Higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to reduce hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the invention; the second type of probes are partially related to the invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

 2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The region is compared for homology. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe l '(probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'-TGGCTCAGACAGATAAGCCAACATGCATCCCGCCGGAGCTG-3 '(SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5'-TGGCTCAGACAGATAAGCCACCATGCATCCCGCCGGAGCTG-3 '(SEQ ID NO: 9) For other common reagents listed below and their preparation methods, please refer to the literature:

DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning experiment manuals such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambruck et al., Science Publishing house.

 Sample Preparation:

1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1000 g for 10 minutes. 3) cold homogenate buffer (0.25rao l / L sucrose; 25 leg ol / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 let ol / L MgCl ₂ ) be suspended and precipitated (approximately 10 ml / g). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet in lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x ^{10 8} cells / ml) and apply a minimum of 100 ul of lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at Π overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DM solution and mix well. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air-dry for 10-15 minutes to evaporate the surface ethanol. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DM pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, 1- 5χ10 ⁶ cells per extracted plus about lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RMase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, mix and set at -20 ° C for 1 hour. ) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-5. 14) Determine A ₂₆ . And A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

Preparation of sample film:

1) Take 4 X 2 sheets of nitrocellulose (NC film) of appropriate size, and mark the spotting position with a pencil lightly And sample number, each probe needs two NC membranes, in order to wash the membrane with high-strength conditions and intensity conditions in the subsequent experimental steps, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place in 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Filter paper for 5 minutes (twice) and dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi _Y - ³² P-dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared. Pre-hybridization

 Place the sample film in a plastic bag, add 3-10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT MA (calf thymus DM).), Seal the bag, and shake at 68 ° C in a water bath 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight.

 Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature.

 Low-intensity washing film:

 1) Take out the hybridized sample membrane. ~ 2) 2xSSC, 0.1 2 SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash at 37 ° C for 15 minutes (twice) in 0.1xSSC, 0. Γ / oSDS.

4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature. X-ray auto-development:

 -70 ° C, X-ray autoradiography (compression time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature, for example, see the literature DeRi Si, J. L., Lyer, V. & Brown, P. 0.

(1997) Sc ience 278, 680-686. And literature Hel le, R. A., Schema, M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155. '

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μ ηι. The spotted slides were hydrated, dried, and cross-linked in an ultraviolet cross-linking instrument. After elution, the DM was fixed on a glass slide to prepare chips. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. ddH ₂ 0 was washed twice for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

 7. dd 0 flush twice;

8. Dry and store at 25 ^fl C in the dark for future use. (Two) probe marking

 Total mRM was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified using Ol igotex mRNA Midi Kit (purchased from QiaGen). Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech), a fluorescent reagent, was used to label mRM of human mixed tissues, and the fluorescent reagent Cy5dUTP (5-Amino- propargy The 2'-deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification. For specific steps and methods, see:

Schena,

 M., Sha lon, D., Heller, R. (1996) Proc. Nat l. Acad. Sci. USA. Vol. 93: 10614-10619. Sc hena, M., Shalon, Dar i., Davis, RW (1995) Science. 270. (20): 467-480.

 (C) hybridization,

 The probes from the above two tissues and the chips were respectively hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution (1> SSC, 0.2% SDS) was used at room temperature. After washing, scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a graph based on these 17 Cy3 / Cy5 ratios. (figure 1 ). It can be seen from the figure that the expression profiles of human transcription factor protein 23 and human transcription factor protein according to the present invention are very similar. Industrial applicability

The polypeptide of the present invention, as well as its antagonists, agonists and inhibitors, can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases. The polypeptide-human transcription factor protein 23 (HTbr2P23) of the present invention plays an extremely important role in embryonic development, including regulating the formation of gastrula embryos, regulating the development of the heart, etc., and is even related to determining whether to form limbs. In particular, HTbr2P27 plays a vital role in neuronal differentiation. Tb is predominantly expressed in developing brain tissue, while Tbr2 is not expressed in mature adult brain cells. The polypeptide of the present invention can be used for the prevention and treatment of diseases that have appeared or may appear during the development of human embryos. For example, malignant tumors, immune diseases, human acquired immune deficiency syndrome (IDS), endocrine system diseases, nervous system diseases and so on.

 Taking the nervous system as an example, HTbr2P27 is expressed in the midbrain and hindbrain on day 14.5 (E14. 5) of the beginning of human embryonic development. During this period, HTbr2P27 is located in the brain in the trigeminal nerve, vestibule, and hypoglossal nerve. It is expressed in neurons in specific parts of the tissue. It can be said that HTbr2P27 determines the neuron differentiation during embryonic development. Neurological diseases that HTbr2P27 can prevent and treat include ischemic stroke, neurological degenerative diseases, and so on.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human transcription factor protein 23. Agonists enhance biological functions such as human transcription factor protein 23 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human transcription factor protein 23 can be cultured together with labeled human transcription factor protein 23 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human transcription factor protein 23 include selected antibodies, compounds, receptor deletions, and the like. Antagonists of human transcription factor protein 23 can bind to human transcription factor protein 23 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

 When screening compounds as antagonists, human transcription factor protein 23 can be added to a bioanalytical assay to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human transcription factor protein 23 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human transcription factor protein 23 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 23 molecules of human transcription factor protein should generally be labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The present invention also provides antibodies directed against the epitope of human transcription factor protein 23. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting human transcription factor protein 23 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. . Techniques for preparing monoclonal antibodies to human transcription factor protein 23 include, but are not limited to, hybridoma technology (Kolil er and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, BBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using known techniques (Morrison et al, PNAS, 1985, 81: 6851). And the unique technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human transcription factor protein 23.

 Anti-human transcription factor protein 23 antibodies can be used in immunohistochemical techniques to detect human transcription factor protein 23 in biopsy specimens.

 Monoclonal antibodies that bind to human transcription factor protein 23 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human transcription factor protein 23 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through disulfide exchange. This hybrid antibody can be used to kill human transcription factor protein 23 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to human transcription factor protein 23. Administration of an appropriate amount of antibody can stimulate or block the production or activity of human transcription factor protein 23.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human transcription factor protein 23 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human transcription factor protein 23 detected in the test can be used to explain the importance of human transcription factor protein 23 in various diseases and to diagnose diseases in which human transcription factor protein 23 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry.

 Polynucleotides encoding human transcription factor protein 23 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human transcription factor protein 23. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human transcription factor protein 23 to inhibit endogenous human transcription factor protein 23 activity. For example, a mutated human transcription factor protein 23 may be a shortened human transcription factor protein 23 lacking a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human transcription factor protein 23. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding human transcription factor protein 23 into a cell. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human transcription factor protein 23 can be found in the literature (Sambrook, et al.). In addition, a polynucleotide encoding human transcription factor protein 23 can be packaged into liposomes and transferred into cells. '

Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on. Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human transcription factor protein 23 fflRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation. Antisense RM, DNA and ribozymes can be obtained by any RM or DM synthesis technology, such as the solid-phase phosphate amide chemical synthesis method for oligonucleotide synthesis. Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM. This MA sequence is integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human transcription factor protein 23 can be used for the diagnosis of diseases related to human transcription factor protein 23. The polynucleotide encoding human transcription factor protein 23 can be used to detect the expression of human transcription factor protein 23 or the abnormal expression of human transcription factor protein 23 in a disease state. For example, the DNA sequence encoding human transcription factor protein 23 can be used to hybridize biopsy specimens to determine the expression of human transcription factor protein 23. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DM chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue. Human transcription factor protein 23 specific primers can also be used to detect the transcription products of human transcription factor protein 23 by in vitro amplification of RNA-polymerase chain reaction (RT-PCR).

 Detection of mutations in the human transcription factor protein 23 gene can also be used to diagnose human transcription factor protein 23-related diseases. Human transcription factor protein 23 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human transcription factor protein 23 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene has a mutation.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position of a human chromosome and can hybridize with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeat polymorphisms) are available for labeling chromosomal positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome. ,

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Use The oligonucleotide primer of the present invention can achieve sublocalization by a similar method using a group of fragments from a specific chromosome or a large number of genomic clones. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cMA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be seen in, for example, V. Mckusick, Mendel ian Inheritance in Micron (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that are mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human transcription factor protein 23 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human transcription factor protein 23 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Request for Profit

 1. An isolated polypeptide-human transcription factor protein 23, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 223-861 in SEQ ID NO: 1 or the sequence of positions 1-988 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 with a plasmid, virus or a vector expression vector Carrier.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having human transcription factor protein 23 activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing human transcription factor protein 23;

 (b) Isolating a polypeptide having human transcription factor protein 23 activity from the culture. .

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human transcription factor protein 23. _

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human transcription factor protein 23.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof shown in SBQ ID NO: 1.

13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human transcription factor protein 23 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human transcription factor protein 23; or for peptide fingerprinting Atlas identification. '

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used for manufacturing a gene chip.

17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of human transcription factor protein 23.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.