WO2001094532A2 - A novel polypeptide, ribosomal protein l39 9 and the polynucleotide encoding the polypeptide - Google Patents
A novel polypeptide, ribosomal protein l39 9 and the polynucleotide encoding the polypeptide Download PDFInfo
- Publication number
- WO2001094532A2 WO2001094532A2 PCT/CN2001/000820 CN0100820W WO0194532A2 WO 2001094532 A2 WO2001094532 A2 WO 2001094532A2 CN 0100820 W CN0100820 W CN 0100820W WO 0194532 A2 WO0194532 A2 WO 0194532A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- protein
- polynucleotide
- ribosomal
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide glycoprotein L39 protein 9 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide.
- the correct translation of proteins is very important for all bacteria and higher organisms.
- the research on the regulation mechanism of protein translation is obtained from E. coli.
- the protein translation process is mainly completed by various aminoacyl-tRNA synthetases, various tRNAs and ribosomes.
- the ribosome and other cofactors together provide the entire enzymatic activity of the translation process. These enzyme activities are only in the Only when the overall structure of the body is complete. Therefore, the ribosome and its constituent subunits act synergistically in the body and play an important physiological function.
- Ribosomes are organelles that synthesize proteins. Their sole function is to synthesize polypeptide chains from amino acids in accordance with the instructions of mRNA. It is called ribosome, and is simply called ribosome or ribosome. Ribosomes are found in almost all cells, whether in prokaryotic or eukaryotic cells, there are a large number of ribosomes. The ribosome is a granular structure without a membrane, and its diameter is 25nm. The main components are protein and RNA. The ribosome MA is called rRNA. The protein content is about 40% and RNA is about 60%.
- Protein molecules are mainly distributed on the surface of the ribosome, while rRNA is located inside, and the two are bound together by non-covalent bonds.
- Cell Biology, Zhai Zhonghe, Higher Education Press, PP122-129 The functional research of ribosomes has focused on ribosomal RNA. There are many rRNA functional domains that determine the different functions of ribosomes (Annu Rev Biochem. 1991; 60: 191-227).
- ribosomes there are two basic types of ribosomes in biological organism cells: one is a ribosome of 70S (S is the Sverdberg sedimentation coefficient unit). The ribosomes of all prokaryotic cells are 70S eukaryotic cells. Approximately 70S. The other is 80S ribosomes, the ribosomes of eukaryotic cells (except for mitochondria and chloroplast ribose) are 80S. Ribosomes, whether 70S or 80S, are composed of two subunits of different sizes.
- the ribosome size subunits are often free in the cytoplasmic matrix within the cell. Only when the small subunits are combined with mRNA do the large subunits bind to the small subunits to form a complete ribosome. After the peptide synthesis is terminated, the large and small subunits dissociate and then exist freely in the cytoplasmic matrix.
- Ribosomal protein L39 is one of the ribosomal large subunit binding proteins. It is related to ribosomal L39 protein. Exist in most prokaryotic and eukaryotic cells.
- the C-terminus of all ribosomal proteins L39 contains a conserved region containing the following consistent sequence fragments: [OA] -TX (3)-[LIVM]-[KRQF] -x- [NHS] - ⁇ ( 3) -R- [NHY] -WRR.
- This sequence fragment is contained in ribosomal protein L39 in many different organisms, and this fragment may play an important role in the action of ribosomes. This structural motif plays a very important role in the process of the protein's normal physiological function.
- Ribosomal protein L39 plays an important role in protein translation. If it is deleted or chemically modified, or the gene encoding it is mutated, it will affect the function of ribosomes and reduce the activity of peptide synthesis. Although the research on the function of ribosomal protein L39 is not thorough enough, according to various research results, it can be proved that:
- the functions of ribosomal protein L39 include: (1) It is very important for rRNA to fold into a functional three-dimensional structure; ( 2) In protein synthesis, a series of changes occur in the spatial conformation of the ribosome, and the ribosomal protein may play a "fine-tuning" role in the conformation of the ribosome; (3) it may even play a catalytic role at the binding site of the ribosome Ribosomal proteins work with rRM.
- ribosomal protein L39 Based on the sequence similarity of ribosomal protein L39, it is considered to belong to the ribosomal protein family. Deletion of this protein will slow down cell growth [J. Stephen Gantt, Michael D. Thompson, 1990, J. Biol. Chem., 265: 2763-2767] ⁇ . Therefore, ribosomal protein L39 is transcribed and translated from DNA. It plays an extremely important role in cell proliferation. Its abnormal expression will cause the growth rate of the tissue to slow down, which will cause various developmental disorders, such as stunting.
- ribosome L39 protein 9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. There has been a need to identify more ribosomal L39 protein 9 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new ribosomal L39 protein 9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding ribosomal L39 protein 9.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding ribosomal L39 protein 9.
- Another object of the present invention is to provide a method for producing ribosome L39 protein 9.
- Another object of the present invention is to provide an antibody against the polypeptide monoribosomal L39 protein 9 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide monoribosomal L39 protein 9 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of ribosomal L39 protein 9. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1367-1618 in SEQ ID NO: 1; and (b) a sequence having 1-2119 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of ribosomal L39 protein 9 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of ribosomal L39 protein 9 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the biological sample, or detecting a biological sample The amount or biological activity of a polypeptide of the invention.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of ribosomal L39 protein 9.
- Fig. 1 is a comparison diagram of gene chip expression profiles of ribosome L39 protein 9 and ribosome L39 protein according to the present invention.
- the upper graph is a graph of the ribosome L39 protein 9 expression profile
- the lower graph is the gene of the ribosome L39 protein expression profile.
- 1-bladder mucosa 2- PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-F ibroblas t, growth factor stimulation, 1024NT, 6- scar growth into fc Factor stimulation, 1013HT, 7-scar scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13- Placenta, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of an isolated ribosome L39 protein 9.
- FIG. 9kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioly active refers to a protein with the scab, regulatory, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with ribosomal L39 protein 9, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to ribosomal L 39 protein 9.
- Antagonist refers to a molecule that, when combined with ribosomal L 39 protein 9, can block or regulate the biological or immunological activity of ribosome L39 protein 9.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to ribosomal L 39 protein 9.
- ribosome L 39 protein 9 refers to a change in the function of ribosome L 39 protein 9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of ribosome L 39 protein 9.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify ribosomal L39 protein 9 using standard protein purification techniques. Basic The pure ribosomal L39 protein 9 produced a single main band on a non-reducing polyacrylamide gel. The purity of ribosomal L39 protein 9 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MBGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGAUGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi gg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The C lus ter method checks the distance between all pairs. The groups of sequences are arranged into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jo tun He in (He in J., (1990) Methods in enzymo l ogy 183: 625-645). 0
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification can be Replace a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and?, which can specifically bind to the epitope of ribosomal L 39 protein 9.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated ribosome L39 protein 9 means that ribosome L39 protein 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify ribosomal L39 protein 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of ribosomal L39 protein 9 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide 3 ⁇ 4 glycosome L39 protein 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of ribosomal L39 protein 9.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the ribosome L 39 protein 9 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution Amino acids may or may not be Encoded by the genetic code; or ( ⁇ ) such a type in which a group on one or more amino acid residues is substituted with another group to include a substituent; or (III) such a type in which the mature polypeptide and Fusion of another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or
- polypeptide sequence such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide or a protease sequence
- polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide.
- fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue.
- the length of the polynucleotide sequence is 2119 bases, and its open reading frame 1367-1618 encodes 83 amino acids.
- this polypeptide has a similar expression profile to ribosomal L39 protein, and it can be deduced that this ribosome L39 protein 9 has similar functions to ribosomal L39 protein.
- the polynucleotide of the present invention may be in the form of DM or RNA.
- DM forms include cDM, genomic DM, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DM can be coded or non-coded.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SBQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the present invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the present invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to the sequence described above (the two sequences have at least 5 and preferably 70% identity).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- "strict conditions” means: (1) in the lower Hybridization and elution at ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) adding a denaturant such as 50% (v / v) formamide during hybridization, 0. 1 '/.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding ribosomal L39 protein 9.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding ribosomal L39 protein 9 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene). And the construction of cDNA library is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Coll Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DM or DM-RM hybridization; (2) the appearance or loss of marker gene function; (3) determination of the level of ribosomal L39 protein 9 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probes used here are typically the genes of the invention Sequence information is based on chemically synthesized DNA sequences. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (BLISA) can be used to detect the protein product of ribosomal L39 protein 9 gene expression.
- BLISA enzyme-linked immunosorbent assay
- a method for amplifying DM / RM using PCR technology is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a ribosome L39 protein 9 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology .
- a polynucleotide sequence encoding a ribosome L39 protein 9 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding ribosomal L39 protein 9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DM technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Col. Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- eukaryotic promoters include the CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoters, retroviral LTRs, and other known controllable genes in prokaryotic or eukaryotic cells Or a promoter expressed in its virus.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
- Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription.
- Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding ribosomal L39 protein 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the MA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the 0.1 (12 ) method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant ribosomal L39 protein 9 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various Conventional medium. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Ribosomes and other cofactors together provide the full enzymatic activity of the translation process. These enzyme activities are only in the ribosome Only if the overall structure is complete.
- the ribosome size subunits are often free in the cytoplasmic matrix in the cell. Only when the small subunits are combined with the mRNA can the large subunits combine with the small subunits to form a complete ribosome and initiate the synthesis of the peptide chain.
- Ribosomal protein L39 is one of the proteins in the large ribosomal subunit.
- L39 protein can select the correct tRM to bind to small ribosomal subunits to avoid mismatches, which is directly related to the stability of the passage of the organism. And the loss of ribosomal protein will slow down the growth of cells.
- abnormal expression of the specific L39 family protein raot if will cause the dysfunction of the polypeptide containing the L39 family protein mot if of the present invention, resulting in mistranslation of mRNA, and related diseases such as tumor and embryo development disorders. , Growth and development disorders.
- abnormal expression of the ribosome L39 protein 9 of the present invention will produce various diseases, especially embryonic developmental disorders, growth and development disorders, various tumors, and inflammations. These diseases include, but are not limited to:
- Embryonic developmental disorders congenital abortion, cleft palate, facial oblique fissure, limb absentness, limb differentiation disorder, gastrointestinal atresia or stenosis, hyaline membrane disease, atelectasis, polycystic kidney disease, ectopic kidney, double ureter, cryptorchidism , Congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital Cataract, congenital glaucoma or cataract, congenital deafness Growth and development disorders: mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin
- Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma , Colon cancer, malignant histiocytosis, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, thymic tumor, nasal cavity and sinus cancer, nasopharyngeal cancer, Laryngeal cancer, tracheal tumor, pleural mesothelioma, fibroid, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- Abnormal expression of the ribosome L 39 protein 9 of the present invention will also cause certain hereditary, hematological and immune system diseases.
- the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) ribosomal L 39 protein 9.
- Agonists increase the biological functions of ribosome L39 protein 9 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing ribosomal L39 protein 9 can be cultured with labeled ribosomal L39 protein 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of ribosomal L39 protein 9 include antibodies, compounds, receptor deletions and analogs that have been screened.
- An antagonist of ribosomal L 39 protein 9 can bind to ribosome L39 protein 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- ribosomal L39 protein 9 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between ribosomal L 39 protein 9 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to ribosomal L39 protein 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 9 molecules of ribosomal L 39 protein should be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the ribosome L 39 protein 9 epitope. These antibodies include (but are not limited to): Dok Antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting ribosomal L39 protein 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to ribosomal L39 protein 9 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
- Chimeric antibodies that combine human constant regions with non-human-derived variable regions can be produced using existing techniques (Morris on e t al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against ribosomal L39 protein 9.
- Antibodies against ribosome L39 protein 9 can be used in immunohistochemistry to detect ribosome L 39 protein 9 in biopsy specimens.
- Monoclonal antibodies that bind to ribosomal L39 protein 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- ribosome L39 protein 9 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill ribosome L39 protein 9 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to ribosomal L39 protein 9.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of ribosomal L39 protein 9.
- the invention also relates to a diagnostic test method for quantitative and localized detection of ribosomal L 39 protein 9 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of ribosome L 39 protein 9 detected in the test can be used to explain the importance of ribosome L39 protein 9 in various diseases and to diagnose diseases in which ribosome L 39 protein 9 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding ribosomal L39 protein 9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of ribosomal L39 protein 9.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutations Ribosome L39 protein 9 to inhibit endogenous ribosome L39 protein 9 activity.
- a variant ribosome L39 protein 9 may be a shortened ribosome L39 protein 9 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of ribosomal L39 protein 9.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer a polynucleotide encoding ribosomal L39 protein 9 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a ribosome L 39 protein 9 can be found in the existing literature (Sambrook, eta l.).
- a recombinant polynucleotide encoding ribosomal L39 protein 9 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RM and DM
- ribozymes that inhibit ribosomal L39 protein 9 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that specifically decomposes a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target A for endonucleation.
- Antisense RNA, DNA and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as solid-phase phosphate amide chemical synthesis technology for oligonucleotide synthesis, which is widely used.
- Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the MA. This DNA sequence is integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- Polynucleotides encoding ribosomal L39 protein 9 are useful in the diagnosis of diseases related to ribosomal L39 protein 9.
- Polynucleotides encoding ribosome L39 protein 9 can be used to detect the expression of ribosome L39 protein 9 or abnormal expression of ribosome L39 protein 9 in disease states.
- a DNA sequence encoding ribosomal L39 protein 9 can be used to hybridize biopsy specimens to determine the expression of ribosomal L39 protein 9.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
- a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Ribosome L39 protein 9 specific primers can also be used to detect the transcription products of ribosome L39 protein 9 by MA-polymerase chain reaction (RT-PCR) in vitro amplification.
- Ribosome L39 protein 9 mutations can also be used to diagnose ribosome L39 protein 9-related Disease.
- Ribosome L39 protein 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type ribosome L39 protein 9 DNA sequence. Mutations can be detected using well-known techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Ribosome L39 protein 9 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of ribosomal L39 protein 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total MA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the 00 fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0429e06 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- CDM was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed with the following primers:
- Pr imerl 5, — GTCTAAGCATTGCATGTTCTTTTG -3, (SEQ ID NO: 3)
- Primer2 5,-CAGAGTAGCATTTTTATTGCAGTA -3, (SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;
- Primer 2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions A reaction volume of 50 ⁇ 1 contains 50 mmol / L KCl, 10 crypto ol / L Tri s- HC1 pH 8. 5 and 1. 5 let ol / L MgCl 2 , 20 ( ⁇ mol / L dNTP, lOpmol Primer, 1U Taq DNA polymerase (product of Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min During RT-PCR, ⁇ -act in was used as a positive control and template blank was used as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (product of Invitrogen).
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 2119bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of the expression of ribosomal L39 protein 9 gene
- Total MA was extracted in one step [Anal. Biochem 1987, 162, 156-159].
- This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (P H7. 4) -5 ⁇ SSC- 5 ⁇ Denhardt 's solution and 200 ⁇ 8 / ⁇ 1 salmon sperm DNA. After hybridization, the filter was placed at 1 x SSC-0.1 ° /. Wash in SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation, and purification of recombinant ribosomal L39 protein 9 According to SBQ ID NO: 1 and the coding region sequence shown in FIG. 1, a pair of specific amplification primers were designed. The sequences are as follows:
- Primer3 5, — CATGCTAGCATGGTCCTCTGTGTAGGTGAATGT- 3, (Seq ID No: 5)
- Primer4 5'-CATGGATCCTCAGTGTTTCATAGGTCTTCGCAG-3 '(Seq ID No: 6)
- the two ends of the two primers contain Nhel and BamHI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Nhel and BaniHI restriction sites correspond to the selection on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). Sex endonuclease site.
- PCR was performed using the pBS-0429e06 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-0429eO6 plasmid in a total volume of 50 ⁇ 1, Primer-3 and Primer-4 primers were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- Ligation products were transformed by the calcium chloride method Escherichia bacteria DH5 a, the (final concentration of 30 ⁇ ⁇ / ⁇ 1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced. Selected positive clones with the correct sequence (pET- 0429e06) the recombinant plasmid by the calcium chloride method to transform E. coli BL21 (DE3) plyS S (No V agen Products).
- kanamycin final concentration of 3 ( ⁇ g / ml) of LB liquid medium, host strain BL21 (P ET-0429e06) at 37.C cultured to logarithmic phase, IPTG was added to a final concentration of lmmol / L, continue to culture for 5 hours. Centrifuge the bacterial cells, decompose them by ultrasound, collect the supernatant by centrifugation, and use an affinity chromatography column His s. Bind Quick Cartridge (6 His-Tag) Novagen product) was chromatographed to obtain purified target protein ribosomal L39 protein 9. After SDS-PAGE electrophoresis, a single band was obtained at 9 kDa ( Figure 2).
- the following peptides specific to ribosomal L39 protein 9 were synthesized using a peptide synthesizer (product of PE company): Ser-Leu-C00H (SEQ ID NO: 7).
- the polypeptide was coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- protein A-Sepiaiarose to separate from antibody-positive rabbit serum Off total IgG.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
- the immunoprecipitation method proved that the purified antibody could specifically bind to ribosomal L39 protein 9.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements Region for homology comparison, if the homology with non-target molecular region is greater than 85% or more than 15 Two consecutive bases are completely the same, the primary probe should generally not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- probe 2 (P robe2), belong to the second probe, corresponding to SBQ ID NO: 1, or a replacement gene fragment complementary to a fragment of the mutant sequence (41Nt) :
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Example 7 DM Microarray
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DMs, including the polynucleotides of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
- the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ .
- the spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip.
- the specific method steps have been reported in the literature.
- the sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen). Reverse transcription was used to separate fluorescent reagents.
- Cy3dUTP (5- Amino- propargyl-2'-deoxyur idine 5--tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino- propargy 1 -2'- deoxyuridine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech The company) labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare the probe.
- fluorescent reagent Cy5dUTP (5- Amino- propargy 1 -2'- deoxyuridine 5'-tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech The company) labeled the body's specific tissue (or stimulated cell line) mRNA, and purified
- Probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000
- the instrument purchased from General Scanning Company, USA was used for scanning.
- the scanned images were analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC; Fibroblast, growth factor stimulation, 1024NT, scar into fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Based on these 17 Cy3 / Cy5 ratios, a histogram is drawn (Figure 1). It can be seen from the figure that the expression profiles of ribosomal L39 protein 9 and ribosomal L39 protein according to the present invention are very similar.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU89479/01A AU8947901A (en) | 2000-05-24 | 2001-05-21 | A novel polypeptide, ribosomal protein l39 9 and the polynucleotide encoding thepolypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115815 CN1324810A (en) | 2000-05-24 | 2000-05-24 | New polypeptide ribosome L39 protein 9 and polynucleotides for encoding same |
CN00115815.5 | 2000-05-24 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001094532A2 true WO2001094532A2 (en) | 2001-12-13 |
WO2001094532A3 WO2001094532A3 (en) | 2002-02-28 |
Family
ID=4585257
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000820 WO2001094532A2 (en) | 2000-05-24 | 2001-05-21 | A novel polypeptide, ribosomal protein l39 9 and the polynucleotide encoding the polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1324810A (en) |
AU (1) | AU8947901A (en) |
WO (1) | WO2001094532A2 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997048797A1 (en) * | 1996-06-17 | 1997-12-24 | Genzyme Corporation | Novel human chromosome 16 genes, compositions, methods of making and using same |
WO2000028079A2 (en) * | 1998-11-09 | 2000-05-18 | Gemini Genomics Ab | Genetic variation associated with aplastic anemia, and diagnosis and therapy based thereon |
-
2000
- 2000-05-24 CN CN 00115815 patent/CN1324810A/en active Pending
-
2001
- 2001-05-21 AU AU89479/01A patent/AU8947901A/en not_active Abandoned
- 2001-05-21 WO PCT/CN2001/000820 patent/WO2001094532A2/en active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1997048797A1 (en) * | 1996-06-17 | 1997-12-24 | Genzyme Corporation | Novel human chromosome 16 genes, compositions, methods of making and using same |
WO2000028079A2 (en) * | 1998-11-09 | 2000-05-18 | Gemini Genomics Ab | Genetic variation associated with aplastic anemia, and diagnosis and therapy based thereon |
Also Published As
Publication number | Publication date |
---|---|
WO2001094532A3 (en) | 2002-02-28 |
AU8947901A (en) | 2001-12-17 |
CN1324810A (en) | 2001-12-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001074879A1 (en) | A novel polypeptide - homo ribosome protein s3-12 and polynucleotide encoding said polypeptide | |
WO2001094532A2 (en) | A novel polypeptide, ribosomal protein l39 9 and the polynucleotide encoding the polypeptide | |
WO2001092319A1 (en) | A NOVEL POLYPEPTIDE-HOMO TNF α RECEPTOR 19.68 AND POLYNUCLEOTIDE ENCODING SAID POLYPEPTIDE | |
WO2002014510A1 (en) | A novel polypeptide- human cbp20 protein 47.74 and the polynucleotide encoding said polypeptide | |
WO2001090177A1 (en) | A novel polypeptide, a human natural killer cell enhancing factor b13.64 and the polynucleotide encoding the polypeptide | |
WO2002040525A1 (en) | A novel polypeptide-homo zinc finger protein 18.92 and polynucleotide encoding said polypeptide | |
WO2001092518A1 (en) | A novel polypeptide, a human ccr4 relative protein 9.5 and the polynucleotide encoding the polypeptide | |
WO2001075101A1 (en) | A novel polypeptide- human transcription regulator 8 and the polynucleotide encoding said polypeptide | |
WO2002000823A2 (en) | A novel polypeptide, a enzymatic activation protein ras gtp 9.57 and the polynucleotide encoding the polypeptide | |
WO2001066584A1 (en) | A novel polypeptide, human pax protein 9 and the polynucleotide encoding thereof | |
WO2001092515A1 (en) | A novel polypeptide, a human transcription factor 29.26 and the polynucleotide encoding the polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001075048A2 (en) | A novel polypeptide, human ribosomal protein s11 23 and the polynucleotide encoding the polypeptide | |
WO2001092315A1 (en) | A novel polypeptide, a human splicing protein 10.56 and the polynucleotide encoding the polypeptide | |
WO2002048355A1 (en) | A novel polypeptide, a human garp protein 12.98 and the polynucleotide encoding the polypeptide | |
WO2001092517A1 (en) | A novel polypeptide, a human transformer-2-beta protein 29.15 and the polynucleotide encoding the polypeptide | |
WO2002012318A1 (en) | A novel peptide--glycophosphatidylinositol f11.22 and the polynucleotide coding this novel peptide | |
WO2001092516A1 (en) | A NOVEL POLYPEPTIDE, A RIBOSOME s19e PROTEIN 13 AND THE POLYNUCLEOTIDE ENCODING THE POLYPEPTIDE | |
WO2001090172A1 (en) | A novel polypeptide-human ribosomal l39 protein 13 and the polynucleotide encoding said polypeptide | |
WO2001092316A1 (en) | A novel polypeptide, a phytochrome 12 and the polynucleotide encoding the polypeptide | |
WO2001094536A2 (en) | A novel polypeptide, a human zinc-finger protein 10.89 and the polynucleotide encoding the polypeptide | |
WO2001090173A1 (en) | A novel polypeptide, a molecular chaperone cpn60 protein 10 and the polynucleotide encoding the polypeptide | |
WO2002000835A2 (en) | A novel polypeptide, a human transcription protein 23, and the polynucleotide encoding the polypeptide | |
WO2001092324A1 (en) | A novel polypeptide -human basonuclin 10.78 and a polynucleotide sequence encoding the same | |
WO2001094538A2 (en) | A novel polypeptide, dna ligase 21 and the polynucleotide encoding the polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |