WO2001094536A2 - A novel polypeptide, a human zinc-finger protein 10.89 and the polynucleotide encoding the polypeptide - Google Patents
A novel polypeptide, a human zinc-finger protein 10.89 and the polynucleotide encoding the polypeptide Download PDFInfo
- Publication number
- WO2001094536A2 WO2001094536A2 PCT/CN2001/000852 CN0100852W WO0194536A2 WO 2001094536 A2 WO2001094536 A2 WO 2001094536A2 CN 0100852 W CN0100852 W CN 0100852W WO 0194536 A2 WO0194536 A2 WO 0194536A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- zinc finger
- finger protein
- human zinc
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ⁇ zinc finger protein 10.89, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide.
- zinc finger proteins There are a large class of proteins in organisms, and their protein sequences contain one or more zinc atom binding domains. These proteins are involved in the interaction of various proteins with nucleic acids and proteins and proteins in the organism. They are usually used as Transcription factors and signaling molecules are involved in the expression and regulation of related tissue genes. These proteins constitute a large family of proteins, called zinc finger proteins. The human genome contains about 300 to 700 zinc finger proteins. These zinc finger proteins bind to nucleotides in the body and play many important biological functions. The most important role is to regulate the transcription and expression of genes. Studies have found that zinc finger protein is expressed in various tissues of different organisms, including hematopoietic cells, brain, nervous system, various tissues associated with tumors, and tissues of immortal cell lines. It plays an extremely important role in regulating gene transcription and expression in these tissues.
- the zinc finger structure of zinc finger protein mainly has the following types: C2H2 configuration, C2C2 configuration, C2HC configuration, C2HC4C configuration, C3H configuration, C3HC4 configuration.
- the zinc finger protein genes containing the C2H2 configuration constitute the largest group of genes in the human genome.
- people have isolated zinc finger proteins of various configurations from various organisms such as yeast, fruit fly, rat and human, and carried out the biological functions of these zinc finger proteins and their chromosomal localization. Study in depth. C2H2 zinc finger proteins are involved in the activation and suppression of gene transcription.
- the C2H2 type zinc atom binding domain was first obtained in the protein transcription factor II IA, and it is the most widely distributed DNA binding domain in eukaryotic transcription factors.
- the protein sequence of the C2H2 zinc finger protein contains the following conserved sequence features: (Tyr, Phe) -X-Cys-X (2, 4) -Cys-X3-Phe-X5-Leu- X2-Hi s- X (3, 5) -His (where X represents an arbitrary amino acid residue; cysteine forms a coordination bond with histidine and a zinc atom, and binds to the zinc atom; the other three conservative amino acid residues form a hydrophobic center region ; Other changed amino acid residues are responsible for mediating protein interactions with other molecules).
- a C2H2 zinc finger protein may contain one or more zinc finger domains as described above, which are unique in vivo Li completed his own physiological functions. In many cases, proteins containing zinc finger domains interact with special double-stranded and single-stranded DNA sequences and act as transcriptional regulators.
- C2H2 type zinc finger domains not only play an important role in regulating gene expression in some tissues, but also play a key role in the developmental regulation of organisms.
- C2H2 zinc finger proteins there is a part of the protein, the protein sequence of which contains a Drosophila segment gene-related sequence fragment, these proteins constitute the Kruppel subfamily of C2H2 zinc finger proteins. All members of the Kruppel subfamily of C2H2 zinc finger proteins contain conserved sequence fragments of the C2H2 zinc finger protein family as described above. This sequence contains multiple copies in many different zinc finger proteins, with different copy numbers (different number of zinc fingers) and different functions.
- the binding of zinc finger protein to DNA of different lengths depends on the number of finger structures.
- the multi-finger structure may be related to the binding stability of the complex, which is the site of RNA polymerase transcription.
- Mutations or abnormal expression of these two proteins will usually lead to abnormal gene expression in related tissues in the body, and then cause various related metabolic and developmental disorders, neurological diseases, inflammation of various related tissues and malignant tumors and cancers. .
- the protein is closely related to the occurrence of skin diseases such as scleroderma and epidermal myositis in the body.
- the expression profiles of 5 are very similar, so their functions may be similar.
- the invention is named human zinc finger protein 1.89.
- the human zinc finger protein 10.89 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participation in the field. These processes are the human zinc finger protein 10.89 protein, especially the amino acid sequence of this protein is identified. Isolation of the new human zinc finger protein 10.89 protein encoding gene also provided a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding for MA. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human zinc finger protein 10.89.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human zinc finger protein 10.89.
- Another object of the present invention is to provide a method for producing human zinc finger protein 10.89.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human zinc finger protein 10.89.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human zinc finger protein 10.89.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human zinc finger protein 10.89. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1713-2012 in SEQ ID NO: 1; and (b) a sequence having 1-2289 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human zinc finger protein 10.89 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of human zinc finger protein 10.89 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human zinc finger protein 10.89.
- FIG. 1 is a comparison diagram of gene chip expression profiles of human zinc finger protein 10.89 and human zinc finger protein 5 of the present invention.
- the upper graph is a graph of the expression profile of human zinc finger protein 10.89, and the lower graph is the graph of the expression profile of human zinc finger protein 5.
- 1-bladder mucosa 2- PMA + Ecv304 cell line, 3- LPS + Ecv304 cell line thymus, 4- normal fibroblasts 1024NC, 5- Fibrob las t, growth factor stimulation, 1024NT, 6- scar growth into fc Factor stimulation, 1013HT, 7-scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer construct cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13- Placenta, 14-spleen, 15-front row ' Adenocarcinoma, 16-jejunum adenocarcinoma, ⁇ -cardia carcinoma.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human zinc finger protein 10.89.
- l lkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human zinc finger protein 10.89, causes the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind to human zinc finger protein 10.89.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human zinc finger protein 10.89 when combined with human zinc finger protein 10.89.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human zinc finger protein 10.89.
- Regulation refers to a change in the function of human zinc finger protein 10.89, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human zinc finger protein 10.89. change.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human zinc finger protein 10.89 using standard protein purification techniques. Basically pure human zinc finger protein 10. 89 produces a single main band on a non-reducing polyacrylamide gel. Human zinc finger protein 10. 89 The purity of the polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks each pair by checking the distance between all pairs. Groups of sequences are arranged into clusters. Each cluster is then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art, such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
- 0 "similarity" means The degree of identical or conservative substitution of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution such as negatively charged amino acids can include aspartic acid and glutamic acid; with positive Charged amino acids can include lysine and arginine; have uncharged Amino acids with similar hydrophilicity in the head group may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylpropyl And tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds human zinc finger protein 1 0.89 epitopes.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human zinc finger protein 10.89 means human zinc finger protein 10.89 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human zinc finger protein 10.89 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human zinc finger protein 10. 89 The purity of the peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, a human zinc finger protein, 10.89, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
- polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human zinc finger protein 10.89. As used in the present invention, the terms “fragment”, “derivative” and “analog” refer to a polypeptide that substantially maintains the same biological function or activity of the human zinc finger protein 10.89 of the present invention.
- a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (I II) Such that the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or
- a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) formed by fusion of an additional amino acid sequence into a mature polypeptide.
- a polypeptide sequence such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence of 2289 bases in length and its open reading frame 1713-2012 encodes 99 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human zinc finger protein 5, and it can be inferred that the human zinc finger protein 10.89 has similar functions to human zinc finger protein 5.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic MA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is a polynucleotide A replacement form, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes.
- the invention also relates to a polynucleotide that hybridizes to the sequence described above ('at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 »/ « SDS, 60 ° C; or ( 2) Add a denaturant during hybridization, such as 503 ⁇ 4 (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ⁇ , etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-6G nucleotides, and most preferably at least 100 cores Glycylic acid or more.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human zinc finger protein 10.89.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human zinc finger protein 10.89 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the MA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
- the standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Coll Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very few expression products can be cloned.
- genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or absence of a marker gene function; (3) the level of the transcript of human zinc finger protein 10.89; ( 4) through immunological techniques or determination of biological activity, To detect gene-expressed protein products. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the human zinc finger protein 10.89 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method for amplifying DNA / RM using PCR technology is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human zinc finger protein 10.89 coding sequence, and a recombinant technology to produce a polypeptide of the present invention. method.
- the polynucleotide sequence encoding the human zinc finger protein 10.89 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- DNA containing human zinc finger protein 10.89 An expression vector of sequences and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM technology, bandit synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human zinc finger protein 10.89 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human zinc finger protein 10.89 (Science, 1984; 224: 1431). Generally there are the following steps: (1) using the polynucleotide (or variant) encoding human human zinc finger protein 10.89 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Zinc binding protein is usually used as a transcription factor and signal transduction molecule to participate in the expression and regulation of genes. It is found in different biological tissues such as hematopoietic cells, brain, nervous system, various tumor-related tissues and tissues of immortalized cell lines. Expression etc. C2H2 type zinc finger domain-containing proteins also play a regulatory role in development. Kruppel-type zinc finger proteins containing KRAB domains have become a subfamily. KRAB domains are related to the correct localization and function of proteins.
- C2H2 type zinc finger domains are related to the following diseases: solid tumors such as thyroid adenoma, uterine fibroids, neurological diseases such as extrapyramidal dysfunction, Parkinson's syndrome, ataxia, nerve cells Tumors, glioblastomas, hematological malignancies such as leukemia, non-Hodgkin's lymphoma, developmental disorders such as Williams syndrome, cleft-hand and cleft foot syndrome, Bayer's syndrome, other tumors such as neuroblasts Cell tumor, colon cancer, breast cancer, etc.
- solid tumors such as thyroid adenoma, uterine fibroids
- neurological diseases such as extrapyramidal dysfunction, Parkinson's syndrome, ataxia
- nerve cells Tumors such as leukemia, non-Hodgkin's lymphoma
- developmental disorders such as Williams syndrome, cleft-hand and cleft foot syndrome, Bayer's syndrome
- other tumors such as neuroblasts Cell tumor, colon cancer, breast cancer, etc.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of zinc finger protein 5 which is a member of the human zinc finger protein C2H2 type Kruppe l protein family, and both have similar biological functions.
- the polypeptide of the present invention is involved in gene expression and regulation as a transcription factor and signal transduction molecule in vivo, and its abnormal expression is usually closely related to pathological processes such as tumorigenesis, nervous system dysfunction, abnormal blood cell division and differentiation, and developmental disorders. Related diseases. It can be seen that the abnormal expression of the human zinc finger protein 10.89 of the present invention will produce various diseases, especially various tumors, neurological diseases, hematological malignant diseases, and developmental disorders. These diseases include, but are not limited to:
- Tumors of various tissues thyroid tumors, uterine fibroids, endometrial cancers, neuroblastomas, ependymomas, colon cancers, breast cancers, leukemias, lymphomas, malignant histiocytosis, melanomas, sarcomas, Gastric cancer, liver cancer, lung cancer, esophageal cancer, myeloma, teratoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, brain cancer, uterine cancer, gallbladder cancer, liver cancer, thymic tumor, astrocytoma, glial cells Tumors, neurofibromas, myeloma, bone marrow cancer, gallbladder cancer, laryngeal cancer, tracheal tumors, fibroids, fibrosarcomas, lipomas, liposarcomas, leiomyomas
- Hematological malignancies Leukemia, non-Hodgkin's lymphoma
- the abnormal expression of the human finger protein 10.89 of the present invention will also cause certain genetic diseases, such as endocrine system diseases such as endocrine adenoma, and immune system diseases.
- the polypeptide of the present invention and the antagonists, agonists 1 and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, neurological diseases, hematological malignant diseases, and developmental disorders. Certain hereditary diseases, endocrine system diseases such as endocrine adenoma, immune system diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human zinc finger protein 10.89.
- Agonists increase human zinc finger protein 10.89 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human zinc finger protein 10.89 can be cultured with labeled human zinc finger protein 10.89 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human zinc finger protein 10.89 include screened antibodies, compounds, receptor deletions and classes Like things. Antagonists of human zinc finger protein 10.89 can bind to human zinc finger protein 10.89 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human zinc finger protein 10.89 When screening compounds as antagonists, human zinc finger protein 10.89 can be added to the bioanalytical assay to determine whether the compound is a compound by measuring the effect of the compound on the interaction between human zinc finger protein 10.89 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human zinc finger protein 10.89 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally the human zinc finger protein 10.89 molecule should be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human zinc finger protein 10.89 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
- Polyclonal antibodies can be produced by direct injection of human zinc finger protein 10.89 into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent.
- Techniques for preparing monoclonal antibodies against human zinc finger protein 10.89 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0
- Existing techniques for producing single-chain antibodies can also be used to produce single chain antibodies against human zinc finger protein 10.89.
- Antibodies against human zinc finger protein 10.89 can be used in immunohistochemical techniques to detect human zinc finger protein 10.89 in biopsy specimens.
- Monoclonal antibodies that bind to human zinc finger protein 10.89 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins against a specific bead site in the body.
- human zinc finger protein 10.89 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol crosslinker such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human zinc finger protein 10.89 positive cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human zinc finger protein 10.89. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human zinc finger protein 10.89.
- the invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human zinc finger protein 10.89.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human zinc finger protein 10.89 detected in the test can be used to explain the importance of human zinc finger protein 10.89 in various diseases and to diagnose diseases where human zinc finger protein 10.89 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- human zinc finger protein 10.89 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human zinc finger protein 10.89.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human zinc finger protein 10.89 to inhibit endogenous human zinc finger protein 10.89 activity.
- a variant human zinc finger protein 10.89 may be a shortened human zinc finger protein 10.89, which lacks a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human zinc finger protein 10.89.
- Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human zinc finger protein 10.89 into cells.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human zinc finger protein 10.89 can be found in the literature (Sarabrook, et al.).
- a recombinant polynucleotide encoding human zinc finger protein 10.89 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RM and DM
- ribozymes that inhibit human zinc finger protein 10.89 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target A to perform endonucleation.
- Antisense RNA and DM and ribozymes can be obtained by any RM or DNA synthesis technology, such as the technology of solid phase phosphoramidite synthesis of oligonucleotides, which is widely used.
- Antisense MA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the A.
- This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond rather than the phosphate Ester bond.
- the polynucleotide encoding human zinc finger protein 10.89 can be used for the diagnosis of diseases related to human zinc finger protein 10.89.
- the polynucleotide encoding human zinc finger protein 10.89 can be used to detect the expression of human zinc finger protein 10.89 or the abnormal expression of human zinc finger protein 10.89 in a disease state.
- the DNA sequence encoding human zinc finger protein 10.89 can be used to hybridize biopsy specimens to determine the expression of human zinc finger protein 10.89.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
- a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human zinc finger protein 10. 89 specific primers for RM-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human zinc finger protein 10.89 transcripts.
- Human zinc finger protein 10.89 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human zinc finger protein 10.89 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that have a human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDM libraries.
- Fluorescent in situ hybridization of cDNA clones and metaphase chromosomes allows precise chromosomal localization in one step.
- FI SH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human zinc finger protein 10. 89 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human zinc finger protein 10.89 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total MA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH50. The bacteria formed a cDNA library.
- the Dye terminate cycle reaction sequencing kit Perkin-Elmer
- the dish 377 automatic sequencer Perkin-Elmer
- the Dye terminate cycle reaction sequencing kit Perkin-Elmer
- the dish 377 automatic sequencer Perkin-Elmer
- the Dye terminate cycle reaction sequencing kit Perkin-Elmer
- the dish 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence Comparing the determined cDNA sequence with the existing public DNA sequence database (Genebank), it was found that the CDM sequence of one of the clones 0573B07 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the 0573B07 clone contains a full-length cDNA of 2289bp (as shown in Seq ID NO: 1), and has a 299bp open reading frame (0RF) from 1713bp to 2012bp, encoding a new protein (such as Seq ID NO : Shown in 2).
- This clone P BS-0573B07 and the encoded protein was named human zinc finger protein 10.89.
- Example 2 Cloning of a gene encoding human zinc finger protein 10.89 by RT-PCR
- CDNA was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primer2 5'- GAATTTAATATTTTTAAAAAGACA -3 '(SEQ ID NO: 4)
- Priraerl is a forward sequence starting at the lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method includes acid sulfur Guanidinium cyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (approximately 2 x 10 6 c P m / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7. 4)-5 ⁇ SSC- 5 ⁇ Denhardt's solution and 20 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was placed in 1 x SSC- 0.1% SDS at 55 ° C. Wash for 30min. Then, use Phosphor Imager for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human zinc finger protein 10.89
- Pr imer3 5, — CCCAAGCTTATGCAAATTAAGGGTTTTGACTTA- 3, (Seq ID No: 5)
- Pr imer4 5 '-CCCCTCGAGTC ATCTTGC ACGCTT AGATTCCAC- 3' (Seq ID No: 6)
- These primers contain Hindlll and Xiiol at the 5 'ends, respectively. Enzymatic digestion sites, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively. Hindlll and Xhol digestion sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865) 3) Selective endonuclease sites.
- the PCR reaction was performed using the pBS-0573B07 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of PBS-0573B07 plasmid, 51 substances of Primer-3 and Primer-4 were 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, 25 cycles in total.
- the amplified product and plasmid pET-28 (+) were double-digested with Hindl11 and Xhol, respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed with colibacillus DH5 CX by the calcium chloride method. After the LB plate was cultured overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0573B07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host strain BL21 (pET-0573B07) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, and continued Incubate for 5 hours.
- the cells were collected by centrifugation, and the supernatant was collected by centrifugation.
- the supernatant was collected by centrifugation. Chromatography was performed using an affinity chromatography column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag).
- the purified human zinc finger protein was obtained 10. 89.
- a peptide specific to the following human finger protein 10.89 was synthesized: NH2-Met-Gln-I le-Lys-Gly-Phe-Asp-Leu-His-Ser-Leu- Gly-His-Glu-Trp-C00H (SEQ ID NO: 7).
- the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: The first type of probe Are oligonucleotide fragments that are completely identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are oligonucleotides that are partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention Acid fragments.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- sample film 1) Take 4x2 sheets of nitrocellulose membrane of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so that they can be separated in the following experimental steps. The film was washed with high strength conditions and strength conditions.
- the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
- prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification.
- the spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m.
- the spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed on glass slides to prepare chips.
- the specific method steps have been reported in the literature.
- the sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Ki t (purchased from QiaGen).
- Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5> -triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dlITP (5- Amino-propargy 2 '-deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amers am Phamacia Biotech Company, labeled the specific tissue (or stimulated cell line) mRNA of the body, and purified the probe to prepare a probe.
- Cy5dlITP 5- Amino-propargy 2 '-deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar-like fc growth factor Stimulation, 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU89495/01A AU8949501A (en) | 2000-05-24 | 2001-05-21 | A novel polypeptide, a human zinc-finger protein 10.89 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115841 CN1324858A (en) | 2000-05-24 | 2000-05-24 | New polypeptide human zinc finger protein 10.89 and polynucleotides for encoding |
CN00115841.4 | 2000-05-24 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001094536A2 true WO2001094536A2 (en) | 2001-12-13 |
WO2001094536A3 WO2001094536A3 (en) | 2002-04-04 |
Family
ID=4585283
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000852 WO2001094536A2 (en) | 2000-05-24 | 2001-05-21 | A novel polypeptide, a human zinc-finger protein 10.89 and the polynucleotide encoding the polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1324858A (en) |
AU (1) | AU8949501A (en) |
WO (1) | WO2001094536A2 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999021991A1 (en) * | 1997-10-29 | 1999-05-06 | Shanghai Second Medical University | Bmzf12: a zinc finger gene cloned from bone marrow |
WO1999062951A1 (en) * | 1998-06-04 | 1999-12-09 | Shanghai Second Medical University | A human zinc finger protein gene (bmzf3) |
-
2000
- 2000-05-24 CN CN 00115841 patent/CN1324858A/en active Pending
-
2001
- 2001-05-21 AU AU89495/01A patent/AU8949501A/en not_active Abandoned
- 2001-05-21 WO PCT/CN2001/000852 patent/WO2001094536A2/en active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1999021991A1 (en) * | 1997-10-29 | 1999-05-06 | Shanghai Second Medical University | Bmzf12: a zinc finger gene cloned from bone marrow |
WO1999062951A1 (en) * | 1998-06-04 | 1999-12-09 | Shanghai Second Medical University | A human zinc finger protein gene (bmzf3) |
Also Published As
Publication number | Publication date |
---|---|
WO2001094536A3 (en) | 2002-04-04 |
AU8949501A (en) | 2001-12-17 |
CN1324858A (en) | 2001-12-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001090176A1 (en) | A novel polypeptide - human keratin 45.87 and the polynucleotide encoding said polypeptide | |
WO2001092319A1 (en) | A NOVEL POLYPEPTIDE-HOMO TNF α RECEPTOR 19.68 AND POLYNUCLEOTIDE ENCODING SAID POLYPEPTIDE | |
WO2002014510A1 (en) | A novel polypeptide- human cbp20 protein 47.74 and the polynucleotide encoding said polypeptide | |
WO2001094536A2 (en) | A novel polypeptide, a human zinc-finger protein 10.89 and the polynucleotide encoding the polypeptide | |
WO2002040525A1 (en) | A novel polypeptide-homo zinc finger protein 18.92 and polynucleotide encoding said polypeptide | |
WO2001092517A1 (en) | A novel polypeptide, a human transformer-2-beta protein 29.15 and the polynucleotide encoding the polypeptide | |
WO2002006470A1 (en) | A novel polypeptide, a human myoglobulin ixa11.88 and the polynucleotide encoding the polypeptide | |
WO2002006471A1 (en) | A novel polypeptide, a nucleophosmin9.68 and the polynucleotide encoding the polypeptide | |
WO2001090352A1 (en) | A novel polypeptide, a centrosome nek-2 binding protein 110.12 and the polynucleotide encoding the polypeptide | |
WO2001090177A1 (en) | A novel polypeptide, a human natural killer cell enhancing factor b13.64 and the polynucleotide encoding the polypeptide | |
WO2001092518A1 (en) | A novel polypeptide, a human ccr4 relative protein 9.5 and the polynucleotide encoding the polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2002012297A1 (en) | A novel polypeptide- human tropodulin 9 and the polynucleotide encoding said polypeptide | |
WO2001092329A1 (en) | A NOVEL POLYPEPTIDE - α-SUBUNIT 9.9 OF ATP SYNTHASE AND A POLYNUCLEOTIDE ENCODING THE SAME | |
WO2001096387A1 (en) | A novel polypeptide - estrogen receptor related protein 9.13 and a polynucleotide encoding the same | |
WO2001092515A1 (en) | A novel polypeptide, a human transcription factor 29.26 and the polynucleotide encoding the polypeptide | |
WO2001094534A2 (en) | A novel polypeptide, a human transcription factor 9.57 and the polynucleotide encoding the polypeptide | |
WO2001090379A1 (en) | Novel polypeptide - a human basophil granule protein 22.55 and polynucleotide encoding it | |
WO2002020595A1 (en) | A novel polypeptide-homo zinc finger protein 18.04 and polynucleotide encoding said polypeptide | |
WO2002012489A1 (en) | A novel polypeptide- human zinc finger protein 44 and the polynucleotide encoding said polypeptide | |
WO2002020600A1 (en) | A new polypeptide- human zinc finger protein 10.45 and the polynucleotide encoding it | |
WO2001090131A1 (en) | A novel peptide - human tre cancerogenic gene protein 10.56 and the polynucleotide coding this novel peptide | |
WO2001092324A1 (en) | A novel polypeptide -human basonuclin 10.78 and a polynucleotide sequence encoding the same | |
WO2001090172A1 (en) | A novel polypeptide-human ribosomal l39 protein 13 and the polynucleotide encoding said polypeptide | |
WO2001092325A1 (en) | A novel polypeptide human-zinc-finger protein 13 and a polynucleotide encoding the same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |