WO2001046440A1 - Novel polypeptide-human neuronal thread protein 15 and polynucleotide encoding it - Google Patents

Abstract

The invention concerns human neuronal thread protein 15 and polynucleotide encoding it. The invention also concerns the process of producing the polypeptide by recombinant DNA technique. The methods for treating many diseases e.g. malignant tumor, hemopathy, infection of HIV, immunological diseases and a variety of inflammations utilizing the polypeptide are disclosed. The invention discloses the antagonist against the polypeptide and therapeutics thereof. The invention also discloses the uses of the polynucleotide, which encodes human neuronal thread protein 15.

Description

 A new polypeptide-human neuron line protein 15 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human neuron line protein 15, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique

 Nerve cells are also called neurons. They and neural collagen cells are the basic components of the nervous system. The shape of the neuron is related to its function. It is a large and vigorously metabolized cell. It is responsible for transmitting electrical signals, receiving information, and transmitting it to a certain destination. Neurons can receive stimuli from inside and outside the body, and change the information of the stimulus into electrical excitation waves through changes in cell membrane potentials, called action potentials or nerve impulses. The action potential is transmitted along the cell process, and then "analyzed" or "stored" by the neuron, and then sends out an adjusted impulse, which is transmitted to another neuron or effector via the cell process to complete various activities of the nervous system.

 The neuron theory holds that: a neuron and its processes are an independent unit of cell morphology and function, and the connection between neurons is only contact, not communication. Therefore, the neurites grow from nerve cells, and the grown synapses reach specific targets and establish a well-organized set of connections with other cells. This also proves the importance of neuron development and growth in the entire nervous system.

 Neuron l thread protein (NTP) is a class of phosphoproteins. Studies have found that it is expressed during the germination of synapses.

 However, the understanding of the structure of NTP is limited to the sequence of the primary structure, and the structure of NTP still needs further research.

NTP contains molecules in the brain and certain nerve cell strains. Through the study of recombinant AD7c- NTP protein, it has been clearly demonstrated that in patients with Alzhe imer's disease (AD), NTP overexpression and cause AD There are important links in paired spiral neurodegeneration injury. (J Neuropa tho l Exp Neurol 1996 Oc t; 55 (10): 1038-50) In patients with Alzhe imer's disease, 21 Kd and 39-42 kD NTP are overexpressed. NTP is thought to be involved in the detachment of synapses. (J Cereb B lood F low Metab 1997 Jun; 17 (6): 623-35)

 According to experimental experience, NTP is considered to have important significance in the role of the central nervous system. (J Cereb Blood Flow Metab 1997 Jun; 17 (6): 623-35)

 Studies have found that 15-18 kD NTP has an important relationship to the development and differentiation of neurons. (J Cereb Blood Flow Metab 1997 Jun; 17 (6): 623-35)

 The results of in situ hybridization and immune cell biology of human and mouse cerebral infarction individuals show that: NTP gene expression is overexpressed in peripheral nerve cells of the lesion. This conclusion has been confirmed by quantitative Northern and Western hybridization results. (J Cereb Blood Flow Metab 1997 Jun; 17 (6): 623-35)

 The results of Western hybridization further proved that 15-18 kD NTP plays an important role in the process of neuron repair in individuals with acute and subacute cerebral infarction experiments. Therefore, it is useful for mature central nervous system damage repair, nerve repair The process of regeneration of the yuan is of great significance. (J Cereb Blood Flow Metab 1997 Jun; 17 (6): 623-35)

 Studies have also shown that the abnormal expression of NTP in Down syndrome is the original cause of its disease. (： Γ Neurol Sci 1996 Feb; 135 (2): 118-25) NTP For neurological systems such as AD, AD + Down's syndrome (DN), AD + Parkinson's syndrome (PD), PD dementia (PDD) There is an important relationship between the occurrence and treatment of the disease. (J Neurol Sci 1992 Dec; 113 (2): 152-64) In short, the expression of NTP and the phosphorylation of related NTP molecules are extremely closely related to the growth and development of ganglia, and in addition, Processes such as damage repair, neuron regeneration, and the role of the central nervous system also have important significance. (J Neurol Sci 1996 Jun; 138 (1-2): 26-35)

 According to the results of amino acid homology comparison, the polypeptide of the present invention was inferred and identified as a new human neuron linear protein 15 (HNTP15), and its homologous protein was a discovered human neuron linear protein. The number is AF010144.

As mentioned above, the human neuronal fibrin 15 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these processes The human neuron line protein 15 protein, in particular, identifies the amino acid sequence of this protein. The isolation of the new human neuronal line protein 15 protein encoding gene has also been confirmed for research. It provides a basis for determining the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human neuronal linear protein 15 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human neuronal line protein 15.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human neuronal line protein 15.

 Another object of the present invention is to provide a method for producing human neuronal line protein 15.

 Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human neuronal line protein 15.

 Another object of the present invention is to provide analog compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human neuronal linear protein 15.

 It is another object of the present invention to provide a method for diagnosing and treating diseases associated with abnormalities of human neuron linear protein 15.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID D. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 154-564 in SEQ ID NO: 1; and (b) a sequence having positions 1-1 in SEQ ID NO: 1 187-bit sequence. The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell: a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human neuronal line protein 15 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human neuron linear protein 15 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease, or other diseases caused by abnormal expression of human neuronal line protein 15.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of Leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human neuronal line protein 15, can cause the protein to change, thereby regulating the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human neuronal line protein 15.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human neuronal line protein 15 when combined with human neuronal line protein 15. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human neuronal line protein 15.

 "Regulation" refers to a change in the function of human neuronal line protein 15, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human neuronal line protein 15. .

 "Substantially pure '" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human neuronal line protein 15 using standard protein purification techniques. Basically Pure human neuron line protein 15 can generate a single main band on a non-reducing polyacrylamide gel. The purity of human neuron line protein 15 can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" A partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The CI us ter method arranges the groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of matching residues between sequence A and sequence B

 X 100

 Number of residues in sequence A-number of spacer residues in sequence A-number of spacer residues in sequence B

 The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art, such as Jotun Hein (Hein L, (1990) Methods in emzumology 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

"Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules. "Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') ₂ ^ Fv, which can specifically bind to the epitope of human neuron line protein 15.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector-or it may be such a polynucleotide or polypeptide that is part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human neuron line protein 15" means that human neuron line protein 15 is substantially free of other proteins, lipids, carbohydrates, or other substances naturally associated with it. Those skilled in the art can purify human neuronal line protein 15 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human neuronal line protein 15 can be analyzed by amino acid sequences.

 The present invention provides a new polypeptide, human neuron line protein 15, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

The invention also includes fragments, derivatives, and analogs of human neuronal line protein 15. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human neuronal line protein 15 of the present invention. Fragments, derivatives or The analog may be: (I) a type in which one or more amino acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be inherited Codon-encoded; or (II) such a type in which a group on one or more amino acid residues is substituted with another group to include a substituent; or (II I) such a type in which the mature polypeptide and another Fusion of a compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or To purify the sequence of the polypeptide or protease sequence) As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1187 bases in length and its open reading frame (154-564) encodes 136 amino acids. Based on the amino acid sequence homology comparison, it was found that the polypeptide has 60% homology with a human neuron linear protein that has been discovered. Similar structure and function.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences. The present invention also relates to a variant of the polynucleotide described above, which encodes the same amino group as the present invention. Acid sequences of polypeptides or fragments, analogs and derivatives of polypeptides. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The present invention also relates to a polynucleotide that hybridizes to the sequence described above (there is at least 50 »/, and preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) added during hybridization Use a denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% Above, more preferably 97% or more hybridization occurs. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human neuronal line protein 15.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human neuronal linear protein 15 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage CDM library. There are many mature techniques for extracting mRNA, and kits are also commercially available. Way to get (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as C'lontech's non-cDNA library. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (DDNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of human neuronal line protein 15; (4) by Immunological technology or determination of biological activity to detect protein products of gene expression. The above methods can be used alone or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 5Q A nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides. Preferably it is within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes.

DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human neuronal line protein 15 gene.

 A method of applying a PCR technique to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human neuronal line protein 15 coding sequence, and produced by recombinant technology Method for producing a polypeptide according to the present invention.

 In the present invention, the polynucleotide sequence encoding the human neuron line protein 15 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human neuronal line protein 15 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be effectively linked to an expression vector. On appropriate promoters to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance used in E. coli, etc. It will be clear to those skilled in the art how to select an appropriate vector / transcription control element (such as Promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human neuron line protein 15 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS, or Bowes s melanoma cells, etc. .

Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl. The procedures used are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human neuron line protein 15 (Scence, 1984; 224: 1431). Generally there are the following steps:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding human human neuronal line protein 15 of the present invention, or with a recombinant expression vector containing the polynucleotide;

 (2) culturing the host cell in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high Performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 According to research, the expression of the polypeptide of the present invention (human neuron line protein 15) and the phosphorylation of related human neuron line protein 15 are extremely closely related to the growth and development of ganglia. In addition, human neuron line protein 15 pairs The mature central nervous system damage repair, neuron regeneration, and the role of the central nervous system are also of great significance.

 It has been shown that human neuronal fibrin 15 is associated with AD, AD + Down syndrome (DN), AD +

The occurrence and treatment of neurological diseases such as Parkinson's syndrome (PD) and PD dementia (PDD) are important. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Fig. 1 is a comparison diagram of amino acid sequence homology between human neuronal linear protein 15 of the present invention and a discovered human neuronal linear protein. The upper sequence is human neuron linear protein 15 and the lower sequence is a human neuron linear protein that has been discovered. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

 Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human neuronal line protein 15. 15kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally performed according to the conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturing conditions. Conditions recommended by the dealer.

 Example 1: Cloning of human neuronal line protein 15

Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed CDNA is formed. A Smart cDNA cloning kit (purchased from Clontech) was used to orient the 00 ^ fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5α, and the bacteria formed a cDNA library. Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 and 3 'ends of all clones. The determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0509e02 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the full-length cDNA contained in the 0509e02 clone was 1187 bp (as shown in Seq IDNO: 1), and there was a 411 bp open reading frame (0RF) from 154 bp to 564 bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0509e02 and the encoded protein was named human neuron line protein 15. Example 2: Homologous search of cDNA clones

 Using the sequence of the human neuronal linear protein 15 of the present invention and the encoded protein sequence, the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], Homology search in databases such as Genbank and Swissport. The gene with the highest homology to the human neuronal linear protein 15 of the present invention is a known human neuronal linear protein that has been identified, and its accession number encoded in Genbank is AF010144. The protein homology results are shown in Figure 1. The two are highly homologous, with 60% identity; 67% similarity. Example 3: Cloning of a gene encoding human neuronal line protein 15 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Primer 1: 5, one GGAGCCAGGAGGCGGAAGTTCCCG —3, (SEQ ID NO: 3)

 Primer2: 5'- GATTTGCAGTATTTTAATAAGGAT -3, (SEQ ID NO: 4)

 Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 μl reaction volume containing 50 mniol / L KC1, 10 mol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primer , 1U Taq DNA Polymerization Enzyme (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, set β-act in as a positive control and template blank as a negative control. Amplification products were purified using QIAGEN's kit, and TA cloning kit was used to connect to the PCR vector (Unvitrogen product). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1187bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of human neuron line protein 15 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) are added. ) And centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ _§ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (ρΗ7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation of ct- ³² P dATP with ³² P- DNA probe labeled by the random primer method. The DNA probe used was the sequence of the human neuron line protein 15 coding region (154bp to 564b _P ) amplified by PCR shown in FIG. 1. A 32P-labeled probe (approximately 2 × 10 ⁶ cpm / ral) and RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide-25mM KH ₂ P0 ₄ (pH7.4) -5 χ SSC-5 χ Denhardt's solution and 200 μg / ml salmon sperm DNA. After hybridization, the filter was washed in 1 ^X SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant human neuronal line protein 15

 According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

Primer3: 5'- CCCCATATGATGAGCAACTACAGTGTGTCACTGG -3, (Seq ID No: 5) Primer4: 5,-CATGGATCCTTAATAGAGAATGATCTCAGGGTAA -3, (Seq ID No: 6) These two primers contain Ndel and BamHI restriction sites, respectively. The coding sequences for the 5 'and 3' ends of the gene of interest are followed, respectively. The Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. PBS- The 0509e02 plasmid was used as a template for the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of _P BS_0509e02 plasmid, primers Primer-3 and Pr imer- 4 points (J is lOpmol, Advantage polymerase Mix

(Clontech) 1 μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into colibacillus DH5CC by calcium chloride method.

After the LB plate (final concentration: 30 _{M g} / ml) was cultured overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0509e02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration 30 g / ml) of LB liquid medium, host strain BL21 _(P ET-0509e02) at 37. C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue incubating for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge was used which could bind to 6 histidines (6His-Tag).

(Product of Novagen company) Chromatography was performed to obtain purified human neuronal line protein 15. After SDS-PAGE electrophoresis, a single band was obtained at 15 kDa (Figure 2). The band was transferred to a PVDF membrane, and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-human neuronal line protein 15 antibodies

Polypeptide synthesizer (product of PE company) was used to synthesize the following human neuronal line protein 15 specific peptides: NH ₂ -Met-Ser-Asn-Tyr-Ser-Val-Ser-Leu-Val-Gly-Pro-Ala- Pro-Trp-Gly- C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum. The peptide was bound to a cyanogen bromide-activated Sepharose4B column and bound from total IgG using affinity chromatography. Example 7: Use of a polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is identified whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can also be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in pathological tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Nor thern blotting, and copying methods. They all use the same basic hybridization method after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2. The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences The column and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5 '-GGCCCAGCTCCTTGGGGTTTCCGGCTGCAGGGCGGTAAGGA-3' (SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 '-GGCCATCGTCCTTGGGGAACGCGGCTGCAGGGATCGAAGGA-3' (SEQ ID NO: 9)

 Please refer to the literature for other commonly listed reagents and their preparation methods related to the following specific experimental procedures: DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA) and more commonly used molecular cloning experiment manual books such as "Molecular Guide to Cloning Experiments, Second Edition, U998) [US] Sambrook, et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 legs ol / LnaCl; 25 mmol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (original tissue sample was added 1- ⁵ ml per 0. lg), and then centrifuged at 1000g for 10 min. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1 x 10 ⁸ cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may Large agglomerates are formed which are difficult to break, and reduce the overall yield. This is particularly serious when extracting> ιο ⁷ cells.

4) Add proteinase K to a final concentration of 200ug / nU. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

3. Purification of DNA and ethanol precipitation

 Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution, mix well and leave it at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500 μl of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the precipitate to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper, and gradually increase TE, mix until the DNA is fully dissolved, and add approximately 1 ul per 1-5 x 1 (T cells extracted).

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well--20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe for later experiments. In the step, the film was washed with high-strength conditions and strength conditions, respectively.

2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature. 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Caught in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μ IProbe (0.10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) 37 Γ incubate for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Start to collect the first peak before ³² P-Probe washes out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) The combined solution after the first peak was collected as ³² P-Probe (second peak to prepare the desired free γ- ³² Ρ- dATP).

 Pre-hybridization

 Put the sample film in a plastic bag, add 3-10 mg of pre-hybridization solution (10xDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C for 2 hours in a water bath .

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 3) In 0.1xSSC, 0.1% SDS, wash at 0 ° C for 15 minutes (twice).

 4) 0.1xSSC, 0.1% SDS, 55. Wash for 30 minutes (twice) and dry at room temperature.

Low-intensity washing film: 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 37. C Wash for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

 -70 ° C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1.

Example 8 DNA Microarray

 Gene chip or gene microarray (DM Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, see DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. Schema, M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by (such as the method described in the example) PCR. After the purified amplified product was purified, the concentration was adjusted to about 500ng / ul, and a Cartesian 7500 spotting instrument (purchased from the United States) was used. (Cartesian) on a glass medium, the distance between the points is 280 μm. The spotted glass was hydrated, dried, and cross-linked in an ultraviolet cross-linking instrument. After elution, the glass was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. G.2% SDS washing for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (2) Probe marking

 Total mRNA was extracted from human normal liver and liver cancer tissues in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP (5- Ami no-pr opar gyl) was separately reverse-transcribed. -2- -deoxy uridine 5'-tr iphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label mRNA of normal liver tissue, and the fluorescence test was also used. Cy5dUTP (5-Amino-pr opar gy 1-2 ·- deoxyuri dine 5'-tr iphate coupled to Cy5 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label abnormal liver tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see:

Schena,

 M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Shalon, Dar i., Davis, RW (1995) Science. 270. (20): 467-480.

(Three) cross

Probes from the two types of tissues and the chip were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000. Scanner (purchased from General Scanning Company, USA) for scanning, and the scanned images were processed with Imagene software (Biodiscovery, USA) for data Analyze and calculate the Cy3 / Cy5 ratio of each point. The points with the ratio less than 0.5 and greater than 2 are considered to be genes with different expressions.

 The experimental results show that Cy3 signal = 3039.14 (average of four experiments), Cy5signal = 2993.54 (average of four experiments), Cy3 / Cy5 = l.0152328, the polynucleotide of the present invention is in the above two tissues There was no significant difference in expression. The human neuronal line protein 15 of the present invention can be used for the diagnosis and treatment of many diseases, such as neurological diseases, endocrine system diseases, immune diseases and the like.

 Developmental disorders of the nervous system that can be treated by the polypeptide of the present invention include neural tube insufficiency such as spina bifida, anencephaly, brain (meningeal) bulge, craniocerebral fissure, neural tube cyst; Forebrain and hydrocephalus malformations; neuron migration disorders such as abnormal brain gyrus formation; other malformations such as aqueduct malformations, cerebellar dysplasia, Down syndrome, spinal malformations, congenital hydrocephalus, congenital cerebral nucleus dysgenesis disease.

 Neurodegenerative diseases that can be treated by the polypeptide of the present invention include Alzheimer's disease, Parkinson's disease, multiple sclerosis, chorea, depression, amnesia, Huntington's disease, epilepsy, migraine, dementia .

 Developmental disorders that can be treated using the polypeptides of the present invention include: spina bifida, craniocerebral fissure, anencephaly, malocclusion, foramen forebral malformation, Down syndrome, congenital hydrocephalus, aqueduct malformation, cartilage dysgenesis Dwarfism, spinal epiphyseal dysplasia, pseudochondral dysplasia, Langer-Giedion syndrome, funnel chest, gonad hypoplasia, congenital adrenal hyperplasia, urethral fissure, cryptorchidism, with short stature (such as Conradi Syndrome and Danbolt-Closs Syndrome), congenital glaucoma or cataract, congenital lens position abnormality, congenital blepharoplasia, retinal dysplasia, congenital optic atrophy, congenital sensorineural hearing loss, cleft palsy , Teratology, Williams Syndrome, Alagille Syndrome, Behwei Syndrome, etc.

The polypeptide of the present invention is also an immunomodulatory agent and has an immune promoting or immunosuppressing effect. The polypeptide of the present invention can be used for the treatment of diseases including non-response of immune response, or abnormal immune response, or ineffective host defense. The polypeptides and the antibodies of the present invention also have effects on damage, defects or disorders of immune tissues, especially for diseases of the hematopoietic system (such as malignant anemia) and skin diseases (such as Psoriasis), autoimmune diseases (such as rheumatoid arthritis), radiation diseases, and the production and regulation of immune lymphocytes are extremely closely related.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human neuron line protein 15. Agonists enhance human neuronal fibrin 15 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human neuronal line protein 15 can be cultured together with labeled human neuronal line protein 15 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human neuronal line protein 15 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human neuron line protein 15 can bind to human neuron line protein 15 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions .

 When screening compounds as antagonists, human neuronal fibrin 15 can be added to bioanalytical assays to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human neuronal fibrin 15 and its receptor. . Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human neuron line protein 15 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, 15 molecules of human neuronal line protein should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the human neuronal linen 15 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.

Polyclonal antibodies can be produced by injecting human neuronal fibrin 15 directly into immunized animals (such as home immunity, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. . Techniques for preparing monoclonal antibodies to human neuronal fibrin 15 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta cells Hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). Single-chain antibody technology (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against human neuronal line protein 15.

 Anti-human neuronal line protein 15 antibodies can be used in immunohistochemical techniques to detect human neuronal line protein 15 in biopsy specimens.

 Monoclonal antibodies that bind to human neuron line protein 15 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human neuron linear protein 15 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human neuronal fibrin 15 positive cells .

 The antibodies of the present invention can be used to treat or prevent diseases related to human neuronal fibrin 15. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human neuronal line protein 15.

 The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human neuronal line protein 15. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human neuronal line protein 15 detected in the test can be used to explain the importance of human neuronal line protein 15 in various diseases and to diagnose diseases in which human neuronal line protein 15 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

The polynucleotide encoding human neuronal line protein 15 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human neuronal line protein 15. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human neuron line protein 15 to inhibit endogenous human neuron line protein 15 activity. For example, a mutated human neuron line protein 15 may be a shortened human neuron line protein 15 lacking a signaling functional domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human neuron linear protein 15. Virus-derived Expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human neuronal line protein 15 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding human neuron line protein 15 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human neuron line protein 15 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell. Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human neuronal fibrin 15 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation. Antisense RNA and DNA and ribozymes are available. Any RNA or DNA synthesis technology, such as the solid-phase phosphoramidite chemical synthesis method, has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.

 A polynucleotide encoding human neuronal line protein 15 can be used in the diagnosis of diseases related to human neuronal line protein 15. The polynucleotide encoding human neuronal line protein 15 can be used to detect the expression of human neuronal line protein 15 or the abnormal expression of human neuronal line protein 15 in a disease state. For example, the DNA sequence encoding human neuron line protein 15 can be used to hybridize biopsy specimens to determine the expression of human neuron line protein 15. Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip

(Also known as "gene chip") for differential expression analysis and gene diagnosis of genes in tissues. Human neuronal line protein 15 specific primers can also be used to detect human neuronal line protein 15 transcription products by in vitro amplification of RNA-polymerase chain reaction (RT-PCR).

Detection of mutations in the human neuron line protein 15 gene can also be used to diagnose human neuron line protein 15 Diseased forms of human neuronal fibrin 15 include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human neuronal fibrin 15 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, it is necessary to identify the specific loci of each gene on the chromosome. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark the chromosome position. According to the present invention, in order to associate these sequences with disease-related genes, the important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cMA libraries

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendeliaii Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is not observed in any normal individual, The mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the current resolution capabilities of physical mapping and gene mapping technology, the cDNA mapped by spermidine to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase) Mapping resolution and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human neuronal line protein 15 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human neuronal line protein 15 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

 1. An isolated polypeptide-human neuron line protein 15, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID D0: 2 or an active fragment, analog or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 154 to 564 in SEQ ID NO: 1 or the sequence of positions 1-1 to 187 in SEQ ID NO: 1 sequence.

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human neuronal line protein 15 activity, characterized in that the method includes:

(a) culturing the engineered host cell according to claim 8 under the condition of expressing human neuronal line protein 15; (b) Isolating a polypeptide having human neuronal line protein 15 activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human neuronal line protein 15.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human neuronal line protein 15.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. An application of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human neuronal line protein 15 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human neuron line protein 15; or for peptides Fingerprint identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose in combination with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormalities of human neuron line protein 15.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and various types of inflammation drugs.