WO2002026990A1 - Nouveau polypeptide, proline oligopeptidase 13.2, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, proline oligopeptidase 13.2, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002026990A1
WO2002026990A1 PCT/CN2001/001090 CN0101090W WO0226990A1 WO 2002026990 A1 WO2002026990 A1 WO 2002026990A1 CN 0101090 W CN0101090 W CN 0101090W WO 0226990 A1 WO0226990 A1 WO 0226990A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
prolyl oligopeptidase
prolyl
seq
Prior art date
Application number
PCT/CN2001/001090
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002210327A priority Critical patent/AU2002210327A1/en
Publication of WO2002026990A1 publication Critical patent/WO2002026990A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6402—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals
    • C12N9/6405—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals not being snakes
    • C12N9/6408—Serine endopeptidases (3.4.21)

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ M aminoacyl oligopeptidase 13.2, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.
  • kinases can be divided into several protein families, including the most thoroughly studied chymotrypsin and subtilisin families. Prolyl oligopeptidases and other related enzymes make up the prolyl oligopeptidase family, which also belongs to serine kinases, and this family is involved in some specific metabolic processes (Barret t and Rawlings, 1992).
  • Prolyl oligopeptidase was first found in human uterus, is an enzyme that can be degraded by oxytocin (Walter et al., 1971), and exists in the cytoplasm as a monomer. This enzyme can break prolyl bonds in polypeptides containing the Xaa-Pro-Yaa sequence.
  • Xaa is an amino acid that is blocked at the N-terminus
  • Yaa can be a peptide, amino acid, amido, or ethanol (Yoshimoto et al. a l., 1978).
  • Prolyl oligopeptidases are highly specific for the pro-imino side peptide bond of the trans conformation (Lin and Brandts, 1983).
  • prolyl oligopeptidases can be found in plants, microorganisms, and mammals, and its tissues are also widely distributed. It has high activity in the brain, kidney, lung, and muscle. In humans, they have been purified from the lung, brain, red blood cells, and placenta, respectively (Ka lwant and Porter, 1992).
  • prolyl oligopeptidases are serine kinases.
  • the N-terminus of the purified prolyl oligopeptidase is blocked, and the sequence of 14 amino acids at positions 136-149 is Gly-Glu- Tyr-Phe- Ala-Tyr-Gly- Leu-Ser-Ala-Ser -Gly-Ser-Asp, this sequence is very conserved.
  • prolyl oligopeptidase can catalyze the cleavage of some biologically active peptides (such as angiotensin ⁇ , vasopressin, bradykinin, etc.).
  • prolyl oligopeptidase can regulate blood pressure by participating in the blood pressure angiotensinogenase system, and can reduce the total amount of blood pressure angiotensin II and its precursors.
  • the polypeptide produced by cleavage of angiotensin has autologous vasodilator activity
  • prolyl oligopeptidase may also act as an inhibitor to affect memory processes (Yoshimoto et al., 1987). Prolyl oligopeptidases are not able to metabolize some small proteins (Moryama et al., 1988), but they do not include a class that can undergo rapid extracellular cleavage Solution of protein.
  • the prolyl oligopeptidase 13.2 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more participation in the field
  • the prolyl oligopeptidase 13.2 protein of these processes identifies the amino acid sequence of this protein.
  • the isolation of neoprolyl oligopeptidase 13.2 protein-coding genes also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a genetically engineered host cell comprising a polynucleotide encoding a prolyl oligopeptidase 13.2.
  • Another object of the present invention is to provide a method for producing prolyl oligopeptidase 13.2.
  • Another object of the present invention is to provide antibodies against the prolyl oligopeptidase 13.2 of the polypeptide of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, prolyl oligopeptidase 13.2.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of prolyl oligopeptidase 13.2. Summary of invention
  • the invention relates to an isolated polypeptide, which is of human origin, and which comprises: SEQ ID No. 2 Amino acid sequence of a polypeptide, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 380-742 in SEQ ID NO: 1; and (b) a sequence having 1-1662 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit prolyl oligopeptidase 13.2 protein activity, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method. '
  • the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of prolyl oligopeptidase 13.2 protein in vitro, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of prolyl oligopeptidase 13. 2 .
  • FIG. 1 is a comparison diagram of gene chip expression profiles of prolyl oligopeptidase 13.2 and prolyl oligopeptidase of the present invention.
  • the upper graph is a graph of the prolyl oligopeptidase 13. 2 expression, and the lower graph is the expression of the prolyl oligopeptidase 13. Spectrum chart.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated prolyl oligopeptidase 13.2.
  • 1 3 kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
  • the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
  • Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with prolyl oligopeptidase 13.2., Can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate or any other molecule that can bind to prolyl oligopeptidase II.
  • An antagonist or “inhibitor” refers to a biological or immunological activity that can block or regulate prolyl oligopeptidase 13.2 when combined with prolyl oligopeptidase 13.2 Molecule.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to prolyl oligopeptidase 13.2.
  • “Regulation” refers to a change in the function of prolyl oligopeptidase 13.2, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties of prolyl oligopeptidase 13.2 , Functional or immune properties.
  • Substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify prolyl oligopeptidase 13.2 using standard protein purification techniques. Substantially pure prolyl oligopeptidase 13.2 produces a single main band on a non-reducing polyacrylamide gel. Prolyl oligopeptidase 13.2 The purity of the polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
  • Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences (Hi gg ins, D. G. and
  • Nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein Percentage of identity between them (He in L, (1990) Methods in enzymology 183: 625-645). "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of prolyl oligopeptidase 13.2.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated oligomeric prolyl endopeptidase 13.2 refers to oligomeric prolyl peptidase I 3. 2 is substantially free of naturally associated with other proteins, lipids, carbohydrates or other substances .
  • Those skilled in the art can purify prolyl oligopeptidase 13.2 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the prolyl oligopeptidase 13. 2 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, prolyl oligopeptidase 13. 2, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic Polypeptide, preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives and analogs of prolyl oligopeptidase 13.2.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the prolyl oligopeptidase 13.2 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) is one in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as leader sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences).
  • such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1662 bases and its open reading frame of 380-742 encodes 120 amino acids.
  • this polypeptide has a similar expression profile to prolyl oligopeptidase, and it can be deduced that the prolyl oligopeptidase 13.2 has similar functions to prolyl oligopeptidase.
  • the polynucleotide of the present invention may be in the form of DNA or RM.
  • DM forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide means including a polynucleotide encoding the polypeptide and including additional Coding and / or non-coding polynucleotides.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • stringent conditions refers to: (1) hybridization and wash under lower ionic strength and higher temperature, such as 0. 2 xSSC, 0.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 and active.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding prolyl oligopeptidase 13.2.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the prolyl oligopeptidase 13.2 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separation of double-stranded DNA sequence from DM of the genome; 2) chemical synthesis of DNA sequence to obtain double-stranded DM of the polypeptide
  • genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) the determination of the prolyl oligopeptidase 13. 2 transcript Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1 000 nucleotides.
  • the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the prolyl oligopeptidase 13.2 gene.
  • a method for amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 546 3-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDM sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a prolyl oligopeptidase 13.2 coding sequence, and the present invention is produced by recombinant technology Methods of the polypeptide.
  • a polynucleotide sequence encoding a prolyl oligopeptidase 13. 2 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: a 7-promoter-based expression vector (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a prolyl oligopeptidase 13.2 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • Competent cells that absorb DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method, the steps used are well known in the art. Alternatively, M g Cl 2 is used.
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • polynucleotide sequence of the present invention can be used to express or produce recombinant prolyl oligopeptidase 13. 2 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally, the following steps are taken:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
  • Prolyl oligopeptidase and other related enzymes make up the prolyl oligopeptidase family, which also belongs to serine kinase, and its activity can be inhibited by PhMeS0 2 F and iPr 2 PF. This family is involved in some specific metabolic processes. Studies have found that prolyl oligopeptidase is present in the cytoplasm as a monomer and is an enzyme that can be degraded by oxytocin.
  • prolyl oligopeptidase can catalyze the cleavage of some biologically active peptides (such as angiotensin ⁇ , vasopressin, bradykinin, etc.).
  • prolyl oligopeptidase can regulate blood pressure by participating in the angiotensinogen enzyme system, and can reduce the content of angiotensin II and its precursors.
  • the polypeptide produced by cleavage of angiotensin has an activity of diastolic blood vessels.
  • prolyl oligopeptidase may also act as an inhibitor to affect memory processes. Prolyl oligopeptidase cannot metabolize some small proteins, but it does not include a class of proteins that can undergo rapid extracellular cleavage.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human prolyl oligopeptidase, and both have similar biological functions.
  • the polypeptide of the present invention can catalyze the cleavage of some biologically active polypeptides (such as angiotensin II, vasopressin, bradykinin, etc.) in vivo. For example, it can regulate blood pressure by participating in the angiotensinogen enzyme system, and can reduce the content of angiotensin II and its precursors.
  • angiotensin II can directly contract the arterioles of the whole body and increase blood pressure. The veins are constricted, and the amount of blood returned to the heart is increased.
  • Angiotensin ⁇ can act on the pre-joint angiotensin receptor on the fiber end of the sympathetic constriction blood vessel, and it can act as a pre-joint modulation to increase the release of transmitters from the sympathetic nerve endings and angiotensin.
  • II can also act on the angiotensin receptors of some neurons in the central nervous system, increasing sympathetic vasoconstriction. Therefore, angiotensin II can increase peripheral blood vessel resistance and blood pressure through the central and peripheral mechanisms.
  • angiotensin II can increase the reabsorption of Na + by renal tubules and increase the amount of extracellular fluid.
  • the polypeptide produced by cleavage angiotensin has autologous activity to relax blood vessels.
  • prolyl oligopeptidase may also act as an inhibitor to affect memory processes.
  • Prolyl oligopeptidase cannot metabolize some small proteins, but it does not include a class of proteins that can undergo rapid extracellular cleavage.
  • the abnormal expression of the polypeptide of the present invention will lead to abnormal blood pressure regulation mechanism, reduce the degradation level of vasoactive polypeptides such as angiotensin II, vasopressin, bradykinin and other substances, resulting in disorder of renin-angiotensin system activity, And produce related diseases.
  • the abnormal expression of the polypeptide of the present invention will also affect the memory function of the brain.
  • the abnormal expression of the prolyl oligopeptidase 13. 2 of the present invention will produce various diseases, especially cardiovascular diseases and neurological degenerative diseases, including but not limited to:
  • Cardiovascular diseases are cardiovascular diseases.
  • Hypertension Primary hypertension, secondary hypertension such as renal hypertension, endocrine hypertension, cardiovascular hypertension, neurological hypertension, hypertension during pregnancy
  • Coronary heart disease heart pain, myocardial infarction, occult coronary heart disease, heart failure and arrhythmia coronary heart disease, sudden death coronary heart disease
  • Heart failure acute heart failure, chronic heart failure
  • Degenerative neurological diseases Alzheimer's disease, Parkinson's disease, chorea, depression, forgetfulness Symptoms, Huntington's disease, Epilepsy, Migraine, Dementia, Multiple sclerosis
  • polypeptide of the present invention as well as its antagonists, agonists and inhibitors, can be directly used in the treatment of diseases, for example, it can treat various diseases, especially cardiovascular diseases, neurological degenerative diseases and the like.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) prolyl oligopeptidase 13.2.
  • Agonists increase prolyl oligopeptidase 13.2 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing prolyl oligopeptidase 13.2 can be cultured together with labeled prolyl oligopeptidase 13.2 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of prolyl oligopeptidase 13.2 include antibodies, compounds, receptor deletions, and the like that have been screened.
  • An antagonist of prolyl oligopeptidase 13.2 can bind to prolyl oligopeptidase 13.2 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that The polypeptide cannot perform biological functions.
  • prolyl oligopeptidase 13.2 can be added to a bioanalytical assay by determining the compound's interaction with prolyl oligopeptidase 13.2 and its receptors. Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above.
  • Peptide molecules capable of binding to prolyl oligopeptidase 13.2 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the prolyl oligopeptidase 13.2 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies against the prolyl oligopeptidase 13.2 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
  • Polyclonal antibodies can be produced by prolyl oligopeptidase 13.2 by direct injection in immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc.
  • Techniques for preparing monoclonal antibodies to prolyl oligopeptidase 13. 2 include, but are not limited to, hybridoma technology (Kohier and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PMS, 1985, 81: 6851).
  • the unique technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against prolyl oligopeptidase 13.2.
  • Antibodies against prolyl oligopeptidase 13.2 can be used in immunohistochemical techniques to detect prolyl oligopeptidase 13.2. In biopsy specimens.
  • Monoclonal antibodies that bind to prolyl oligopeptidase 13.2 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins against a specific bead site in the body.
  • prolyl oligopeptidase 13.2 High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of the antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill prolyl oligopeptidase 13.2 positive Cell.
  • the antibodies of the invention can be used to treat or prevent diseases related to prolyl oligopeptidase 13.2. Administration of appropriate doses of antibodies can stimulate or block the production or activity of prolyl oligopeptidase 13.2.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of the level of prolyl oligopeptidase 13.2.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of prolyl oligopeptidase 13.2 detected in the test can be used to explain the importance of prolyl oligopeptidase 13.2 in various diseases and to diagnose the role of prolyl oligopeptidase 13.2. disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • prolyl oligopeptidase 13.2 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of prolyl oligopeptidase 13.2.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant prolyl oligopeptidase 13.2 to inhibit endogenous prolyl oligopeptidase 13.2 activity.
  • a variant prolyl oligopeptidase 13.2 may be a shortened prolyl oligopeptidase 13.2 that lacks a signaling functional domain, and although it can bind to downstream substrates, it lacks signaling activity.
  • recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of prolyl oligopeptidase 13.2.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding prolyl oligopeptidase 13.2 into a cell.
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding prolyl oligopeptidase 13.2 can be found in the existing literature (Sambrook, et al.).
  • a recombinant polynucleotide encoding prolyl oligopeptidase 13.2 can be packaged into liposomes and transferred into cells.
  • Methods for introducing polynucleotides into tissues or cells include: Injecting polynucleotides directly into tissues in vivo Or in vitro through a vector (such as a virus, phage, or plasmid) to introduce the polynucleotide into the cell, and then transplant the cell into the body.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense MA and DNA
  • ribozymes that inhibit prolyl oligopeptidase 13.2 are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RM.
  • This DM sequence is integrated downstream of the RNA polymerase promoter of the vector.
  • it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding prolyl oligopeptidase 13.2 can be used for the diagnosis of diseases related to prolyl oligopeptidase 1 3.2.
  • Polynucleotide encoding prolyl oligopeptidase 13. 2 can be used to detect the expression of prolyl oligopeptidase 13. 2 or the abnormality of prolyl oligopeptidase 13. 2 in a disease state expression.
  • the DM sequence encoding prolyl oligopeptidase 13.2 can be used to hybridize biopsy specimens to determine the expression of prolyl oligopeptidase 13.2.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
  • polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DM chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • a DM chip also called a "gene chip”
  • Prolyl oligopeptidase 13.2 specific primers for RNA-polymerase chain reaction (RT-PCR) amplification in vitro can also detect the transcription of prolyl oligopeptidase 13.2.
  • Prolyl oligopeptidase 13.2 mutations can also be used to diagnose prolyl oligopeptidase 1 3.2 related diseases.
  • Prolyl oligopeptidase 13.2 Mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type prolyl oligopeptidase 1 3.2 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome. In short, PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
  • PCR primers preferably 15-35 bp
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Prolyl oligopeptidase 13.2 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of prolyl oligopeptidase 13.2 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms cDM by reverse transcription. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multicloning site of the pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library.
  • Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDM sequence of one of the clones 0970b07 was new DNA.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • the 0970b07 clone contains a full-length cDNA of 1662bp (as shown by Seq ID NO: l), and has a 362bp open reading frame (0RF) from 380bp to 742bp, encoding a new protein (such as Seq ID NO : Shown in 2).
  • This clone pBS-0970b07 and named the encoded protein as prolyl oligopeptidase 13.2.
  • Example 2 Cloning of a gene encoding prolyl oligopeptidase 13.2 by RT-PCR
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
  • Pr imerl 5'- CATCTCAAAAAAAAAGAAAAAA -3 '(SEQ ID NO: 3)
  • Priraer2 5'- GAGACAGAGTCTTGCTCTGTTGCC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at Ibp;
  • Priraer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification conditions 50 ⁇ l reaction volume containing 50 mmol / L C1, 10 mmol / L Tris-HCl pH 8. 5, 1. 5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, l Opmol primer, 1U Taq DNA polymerization Enzyme (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55. C 30sec; 72. C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DM sequence of the PCR product was exactly the same as that of 1-1662bp shown in SEQ ID NO: 1.
  • Example 3 Northern blot analysis of prolyl oligopeptidase 13.2 gene expression
  • RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
  • This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2 ⁇ sodium acetate ( ⁇ 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol ( 49: 1), centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
  • Primer 3 5'-CCCCATATGATGGAGAACTTGGGGTTGTCTCCA-3 '(Seq ID No: 5)
  • Primer4 5'-CATGGATCCTTACTGTAGAGGGTGCCAGACTGT-3' (Seq ID No: 6)
  • the two ends of the two primers contain Ndel and BainHI restriction sites , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • the PCR reaction was performed using pBS-0970b07 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of plasmid pBS-0970b07, primers Primer-3 and Primer-4 were lOpmol, Advantage, respectively polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligated product was transformed into E. coli DH5 ct by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ral)), positive clones were screened by colony PCR method and sequenced. Positive sequence correct clone (PET-0970b07) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
  • Example 5 the anti-prolyl endopeptidase embodiment oligomeric antibody produced 13.2
  • a peptide synthesizer (product of PE company) was used to synthesize the following prolyl oligopeptidase 13.
  • 2 specific polypeptides NH2-Met-Glu-Asn-Leu-Gly-Leu-Ser-Pro-Arg-Ser-Phe -I le-Pro-Thr-Pro-C00H (SEQ ID NO: 7).
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immunochemis try, 1969; 6:43.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, 6 8. C water bath for 2 hours.
  • 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to D to fix the slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen). ] The fluorescent reagent Cy3dUTP (5-Araino-propargyl-2'-deoxyuridine 5 '-triphate.
  • Cy3 f luorescent dye purchased from Amersham Phamacia Biotech
  • Cy5dUTP 5- Amino- propargyl-2'- deoxyuridine 5 '-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
  • the probes from the above two tissues and the chips were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature. After scanning with ScanArray 3000 scanner (purchased from General Scanning, USA), the scanned images were processed with Imagene software (Biodi scovery, USA). Analyze and calculate the Cy3 / Cy5 ratio of each point.
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, Cardiac cancer. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn ( Figure 1). It can be seen from the figure that the prolyl oligopeptidase 13.2 and prolyl oligopeptidase expression profiles according to the present invention are very similar.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une proline oligopeptidase 13.2, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment de maladies cardio-vasculaires et de la dégénérescence du système nerveux. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la proline oligopeptidase 13.2.
PCT/CN2001/001090 2000-06-30 2001-06-29 Nouveau polypeptide, proline oligopeptidase 13.2, et polynucleotide codant ce polypeptide WO2002026990A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002210327A AU2002210327A1 (en) 2000-06-30 2001-06-29 A novel polypeptide-prolyl oligomeric peptidase 13.2 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN 00116964 CN1331323A (zh) 2000-06-30 2000-06-30 一种新的多肽——脯氨酰寡聚肽酶13.2和编码这种多肽的多核苷酸
CN00116964.5 2000-06-30

Publications (1)

Publication Number Publication Date
WO2002026990A1 true WO2002026990A1 (fr) 2002-04-04

Family

ID=4586363

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001090 WO2002026990A1 (fr) 2000-06-30 2001-06-29 Nouveau polypeptide, proline oligopeptidase 13.2, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1331323A (fr)
AU (1) AU2002210327A1 (fr)
WO (1) WO2002026990A1 (fr)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN [online] 10 December 1999 (1999-12-10), MAYO B. ET AL., retrieved from GI:280236 accession no. NCBI Database accession no. (A43747) *
DATABASE PROTEIN [online] 2 March 1998 (1998-03-02), DOUMAS A., retrieved from GI:2924305 accession no. NCBI Database accession no. (CAA05343.1) *
DATABASE PROTEIN [online] 21 January 2000 (2000-01-21), MENEZ A. AND QUEMENEUR E., retrieved from GI:6733498 accession no. NCBI Database accession no. (CAB69334.1) *

Also Published As

Publication number Publication date
CN1331323A (zh) 2002-01-16
AU2002210327A1 (en) 2002-04-08

Similar Documents

Publication Publication Date Title
WO2002026990A1 (fr) Nouveau polypeptide, proline oligopeptidase 13.2, et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001088158A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide
WO2002012297A1 (fr) Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide
WO2001075048A2 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide
WO2001085752A1 (fr) Polynucleotide codant un peptide de myosine
WO2001075117A1 (fr) Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide
WO2001079434A2 (fr) Nouveau polypeptide, signal peptidase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001066578A1 (fr) Nouveau polypeptide, adn polymerase 10, et polynucleotide codant pour ce polypeptide
WO2001048006A1 (fr) Nouveau polypeptide, proteine de liaison de la cobalamine 10, et polynucleotide codant pour ce polypeptide
WO2001092541A1 (fr) Nouveau polypeptide, catalase 12, et polynucleotide codant ce polypeptide
WO2001092326A1 (fr) Nouveau polypeptide, phosphatase acide 13, et polynucleotide codant ce polypeptide
WO2001092286A1 (fr) Nouveau polypeptide, proteine humaine 48 de liaison oct, et polynucleotide codant ce polypeptide
WO2002020575A1 (fr) Nouveau polypeptide, proteine humaine 10 associee aux maladies auto-immunes, et polynucleotide codant ce polypeptide
WO2002020583A1 (fr) Nouveau polypeptide, facteur humain de transcription lcr-f19.02, et polynucleotide codant ce polypeptide
WO2001074883A1 (fr) Nouveau polypeptide, proteine endoase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001090164A1 (fr) Nouveau polypeptide, tyrosinase humaine 9, et polynucleotide codant ce polypeptide
WO2002026971A1 (fr) Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide
WO2001087951A1 (fr) Nouveau polypeptide, helicase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001075030A2 (fr) Nouveau polypeptide, tyrosinase humaine 11, et polynucleotide codant pour ce polypeptide
WO2001073012A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 36, et polynucleotide codant pour ce polypeptide
WO2001087970A1 (fr) Polypeptide de tyrosinase 12 humaine, et polynucleotide le codant
WO2001071001A1 (fr) Nouveau polypeptide, tyrosinase humaine 15, et polynucleotide codant pour ce polypeptide
WO2002006473A1 (fr) Nouveau polypeptide, proteine humaine 10.01 associee au recepteur d'oestrogene, et polynucleotide codant ce polypeptide
WO2001049732A1 (fr) Nouveau polypeptide, transglutaminase 10, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP