WO2002022808A2 - Cripto mutant and uses thereof - Google Patents

Cripto mutant and uses thereof Download PDF

Info

Publication number
WO2002022808A2
WO2002022808A2 PCT/US2001/029066 US0129066W WO0222808A2 WO 2002022808 A2 WO2002022808 A2 WO 2002022808A2 US 0129066 W US0129066 W US 0129066W WO 0222808 A2 WO0222808 A2 WO 0222808A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
cripto
polypeptide
amino acid
full length
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2001/029066
Other languages
English (en)
French (fr)
Other versions
WO2002022808A3 (en
Inventor
Kevin P. Williams
Susan Foley
Susan Schiffer
Bruno Domon
Michele Sanicola-Nadel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biogen Inc
Original Assignee
Biogen Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to NZ525380A priority Critical patent/NZ525380A/en
Priority to JP2002527250A priority patent/JP2004524810A/ja
Priority to CA002422814A priority patent/CA2422814A1/en
Priority to AU9272401A priority patent/AU9272401A/xx
Priority to AU2001292724A priority patent/AU2001292724B2/en
Priority to EP01973111A priority patent/EP1320604A2/en
Application filed by Biogen Inc filed Critical Biogen Inc
Publication of WO2002022808A2 publication Critical patent/WO2002022808A2/en
Publication of WO2002022808A3 publication Critical patent/WO2002022808A3/en
Priority to US10/390,566 priority patent/US7604931B2/en
Anticipated expiration legal-status Critical
Priority to AU2005204268A priority patent/AU2005204268B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • the invention relates generally to CRIPTO mutant and uses thereof.
  • CRIPTO-1 (CR-1, human; Cr-1, mouse), also known as teratocarcinoma- derived growth factor-1 (U.S. patent numbers 5,792,616; 5,256,643; 5,654,140), and CRIPTO-3 (CR-3, human; Cr-3, mouse) (U.S. patent numbers 5,264,557; 5,620,866; 5,650,285), collectively referred to herein as CRIPTO, are EGF-related proteins. Their genes are expressed in the developing embryo, in normal adult tissues and in tumor cells, including but not limited to, breast cancer cells and colon cancer cells.
  • CRIPTO expressed in mammalian cells is modified with O-linked fucose, an unusual form of O-linked glycosylation, at amii 0 acid residue threonine-88 of CRIPTO polypeptide as depicted in Figure 1.
  • Enzymes that add fucose modifications to proteins recognize a seven amino acid configuration ("fucosylation site").
  • two residues in particular at positions N-l i.e. glycine residue 86 from CRIPTO polypeptides shown in Figure 1
  • N-2 glycine residue 87 from CRIPTO polypeptides shown in Figure 1
  • Non-fucosylated forms of CRIPTO which act as functional antagonists have anti-tumor activity.
  • Non-fucosylated forms of CRIPTO that can act as functional antagonists include but are not limited to mutant CRIPTO polypeptides which alter the binding of CRIPTO to a CRIPTO binding partner.
  • O-linked fucose modification in any of the soluble EGF-ligands, i.e. epidermal growth factor, transforming growth factor alpha, heregulin.
  • the present invention relates to CRIPTO mutant, including CRIPTO variants and fragments thereof, preferably CRIPTO mutants having at least one amino acid substitution at a fucosylation site of a CRIPTO polypeptide wherein the amino acid is substituted with another amino acid which is different form that present in the CRIPTO polypeptide.
  • At least one amino acid from a CRIPTO polypeptide or functional fragment thereof is substituted with another amino acid which is different from that present in the CRIPTO polypeptide, wherein the amino acid substitution is selected from the group consisting of amino acid residues 86, 87, and 88 of the amino acid sequence of the CRIPTO polypeptide.
  • the CRIPTO polypeptide is selected from the group consisting of the polypeptide shown in SEQ ID NO: 1 (full length CR-1) or SEQ ID NO: 2 (full length CR-3) or functional fragment thereof; the polypeptide shown in SEQ ID NO: 1 (full length CR-1) or SEQ ID NO: 2 (full length CR-3) or functional fragment thereof, lacking its associated signal peptide; or the domain of the polypeptide shown in SEQ ID NO: 5 [aa75-aall2 CR-1], SEQ ID NO: 18 [aa75-aall2 CR-3], SEQ ID NO: 4 [38aa-169aa CR-1], SEQ ID NO: 17 [38aa-169aa CR-3], SEQ ID NO:3 [31aa-169aa CR-1] or SEQ ID NO: 16 [31aa-169aa CR-3] or functional fragment thereof.
  • the one or more substitutions are amino acids selected from the group consisting of an alan
  • the CRIPTO mutant comprises a defucosylation modification at position 88 of a CRIPTO polypeptide.
  • the CRIPTO polypeptides being selected from the group consisting of the polypeptide shown in SEQ ID NO: 1 (full length CR-1) or SEQ ID NO: 2 (full length CR-3) or functional fragment thereof; the polypeptide shown in SEQ ID NO: 1 (full length CR-1) or SEQ ID NO: 2 (full length CR-3), lacking its associated signal peptide or functional fragment thereof; or the domain of the polypeptide shown in SEQ ID NO: 5 [aa75-aall2 CR-1], SEQ ID NO: 18 [aa75-aall2 CR-3], SEQ ID NO: 4 [38aa-169aa CR-1], SEQ ID NO: 17 [38aa- 169aa CR-3], SEQ ID NO:3 [31aa-169aa CR-1] or SEQ ID NO: 16 [31aa-169aa CR-3] or
  • nucleic acid sequences encoding the aforementioned CRIPTO mutants and functional fragments thereof.
  • the invention includes an isolated nucleic acid encoding a sequence that hybridizes under stringent conditions to a hybridization probe, the nucleotide sequence of the probe consisting of the coding sequence of SEQ ID NO: 36 (CR-1) or SEQ ID NO: 37 (CR-3) or the complement of the coding sequence of SEQ ID NO: 36 (CR-1) or SEQ ID NO: 37 (CR- 3) and further comprising at least one amino substitution, wherein the amino acid substitution is selected from the group consisting of amino acid residues 86, 87, and 88 of the amino acid sequence of the CRIPTO polypeptide.
  • the present invention provides chimeric molecules comprising an mutant CRIPTO polypeptide according to the aforementioned CRIPTO mutants and functional fragments thereof and further comprising a heterologous polypeptide.
  • the heterologous polypeptide is fused to the C- terminal of the mutant CRIPTO polypeptide.
  • the heterologous polypeptide is fused to the N-terminal of the mutant CRIPTO polypeptide.
  • the heterologous polypeptides include but are not limited to glutathione-S-transferase, DNA binding domains, polymerase activating domains, histidine tags, HSA tags, epitope tag sequence and Fc regions of immunoglobulins.
  • the invention provides chimeric molecule comprising an mutant CRIPTO polypeptide according to the aforementioned CRIPTO mutants and further comprising a synthetic polymer.
  • a non-limiting example of a synthetic polymer includes PEG (polyethylene glycol).
  • the present invention provides methods for inhibiting the growth of a tumor cell comprising exposing the tumor cell to an effective amount of the aforementioned modified polypeptides.
  • the tumor cell is exposed in vivo.
  • the tumor cell is exposed in vitro.
  • the present invention provides a method for treating or reducing the advancement, severity or effects of a disease associated with undesired cell proliferation, comprising administering to the subject an effective amount of the aforementioned polypeptides.
  • the disease or condition is associated with undesired cell proliferation.
  • the disease or condition is associated with undesired cell proliferation is a cancer.
  • the cancer is selected from the group consisting of breast cancer, ovarian cancer, renal cancer, colorectal cancer, uterine cancer, prostate cancer, lung cancer, bladder cancer, central nervous system cancer, melanoma or leukemia.
  • FIG. 1 Alignment of human Cripto- 1 and human Cripto-3 proteins; SEQ ID NOS: 1 and 2, respectively. Threonine 88 for Cripto- 1 and Cripto-3 is shown in bold. The signal sequence for Cripto-1 (comprising residues 1-30 of SEQ ID NO: 1) is shown underlined. Fig. 2. Schematic representation of the Cripto expression constructs described. Constructs were generated as described in EXAMPLE 3.
  • Fig. 3 Electrospray mass spectrometric analysis of N-deglycosylated CR(CC)-Fc protein.
  • DTT dithiothreitol
  • the N-deglycosylated product was analyzed by ESI-MS analyses on a triple quadrupole instrument (Quattro II, Micromass, Manchester, UK).
  • Fig. 6 Cripto signaling assay.
  • the biological activity of human Cripto-1 (SEQ ID NO: 1) and human Cripto-1 T88A (SEQ ID NO: 5) were assessed in F9 Cripto KO cells transfected with the FAST regulatory element-luciferase reporter construct as described in EXAMPLE 4.
  • F9 Cripto KO cells (6.5 x 10 5 cells/well) were transfected with equal amounts of FAST, FAST regulatory element-luciferase reporter DNA, and in the absence or presence of Cripto full length wild-type DNA, in the absence or presence of Cripto T88A mutant full length DNA, and to assess blocking activity with equal amounts of wild type CR and CR T88A cDNAs. Forty eight hours following transfection, cells were lysed with LucLite (Packard Instrument Company) and luciferase activity measured in a luminescence counter.
  • LucLite Packard Instrument Company
  • SEQ ID NO: 36 nucleic acid sequence encoding CR-1
  • Patent 4,683,195 Mullis et al, invs.; Nucleic Acid Hybridization (Hames & Higgins, eds.), 1984; Transcription and Translation (Hames & Higgins, eds.), 1984; Culture of Animal Cells (Freshney), Alan R.
  • CRIPTO polypeptide is any naturally occurring CRIPTO protein or polypeptide including for example CRIPTO-1 as depicted in SEQ ID NO: 1 or CRIPTO-3 as depicted in SEQ ID NO: 2, or fragment or variant thereof. Variants can differ from a naturally occurring CRIPTO polypeptide in amino acid sequence or in ways that do not involve sequence, or both. Variants in amino acid sequence are produced when one or more amino acids in naturally occurring CRIPTO polypeptide is substituted with a different natural amino acid, an amino acid derivative or non-natural amino acid.
  • substitution variants include naturally occurring CRIPTO polypeptides, or biologically active unique fragments thereof, whose sequences differ from the wild type sequence by one or more conservative amino acid substitutions, which typically have minimal influence on the secondary structure and hydrophobic nature of the protein or peptide.
  • Conservative substitutions typically include the substitution of one amino acid for another with similar characteristics, such as substitutions within the following groups: valine, glycine; glycine, alanine; valine, isoleucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
  • a "CRIPTO mutant” is a CRIPTO polypeptide or CRIPTO variant in which at least one amino acid from a CRIPTO polypeptide is substituted with another amino acid which is different from that present in the CRIPTO polypeptide and which can block or inhibit CRIPTO binding to a CRIPTO binding partner.
  • the amino acid substitution includes but is not limited to amino acid residues 86, 87 or 88 of the amino acid sequence of the CRIPTO polypeptide or protein.
  • the CRIPTO mutant binding blocks or inhibits cellular responses which would otherwise be triggered by ligation of the CRIPTO binding partner with CRIPTO.
  • the CRIPTO mutant can inhibit or block CRIPTO binding to a CRIPTO binding partner by about 20, 30, 40 or 50 percent.
  • a "functional fragment" of a mutant CRIPTO polypeptide is a fragment of the polypeptide that is shorter than the full length polypeptide and has the ability to block or inhibit CRIPTO binding to a CRIPTO binding partner.
  • the functional fragment can inhibit or block CRIPTO binding to a CRIPTO binding partner by about 20%, 30%, 40% or 50%).
  • Methods of establishing whether a fragment of an mutant CRIPTO polypeptide is functional are known in the art. For example, fragments of interest can be made by either recombinant, synthetic, or proteolytic digestive methods. Such fragments can then be isolated and tested for their ability to block or inhibit CRIPTO binding to a CRIPTO binding partner by procedures by methods known to those of skill in the art including competitive blocking experiments.
  • inhibiting the growth of a tumor cell means a molecule that can inhibit or block the growth or proliferation of a tumor cell by about 20%, alternatively about 30%, about 40% or preferably by about 50% as measured by techniques known to those of skill in the art including monitoring a tumor by radiological imaging techniques including computed tomography (CT), which is typically used to monitor diseased areas in the chest, abdomen, pelvis and head; magnetic resonance imaging (MRI), which is typically used to monitor diseased areas in the abdomen, pelvis, brain, spine, other bones; mammograms which is typically used to monitor diseased areas in the breast.
  • CT computed tomography
  • MRI magnetic resonance imaging
  • mammograms which is typically used to monitor diseased areas in the breast.
  • tumor markers known to those of skill in the art include carcinoembryonic antigen (CEA) often used to monitor patients with colorectal cancer for disease progression as well as patients with for example gastrointestinal or breast tumors with documented elevated levels of CEA at diagnosis or later in their disease course; CA19-9 most commonly used to monitor patients with pancreatic cancer but also elevated in colorectal cancer; CA15-3 and CA27.29 which is often elevated in patients with breast cancer (CA means cancer antigen).
  • CEA carcinoembryonic antigen
  • CA19-9 most commonly used to monitor patients with pancreatic cancer but also elevated in colorectal cancer
  • CA15-3 and CA27.29 which is often elevated in patients with breast cancer (CA means cancer antigen).
  • heterologous means derived from a distinct entity from that of the rest of the entity to which it is being compared.
  • heterologous a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide.
  • a DNA binding domain a histidine tag
  • an “Fc region” refers to the part of an antibody comprising the CH2, CH3 and hinge regions but lacking the antigen binding sites.
  • fucose is an amino acid sequence which can be defined experimentally using mass spectrometry by the identification of a 146 Dalton mass addition characteristic of a fucose group on a particular amino acid residue.
  • a CRIPTO polypeptide has "activity" if it has at least one of the following properties: (i) it induces phosphorylation of smad2; (ii) it modulates FAST dependent activity as measured by the induction of a FAST regulatory element- luciferase reporter construct; (iii) stimulates migration of mammary gland cell lines in Boydon chamber migration assay; (iv) stimulate branching of mammary epithelial cells in collagen gel (see Ebert et al., Exp Cell Res 25: 223-229, 2000). A mutant CRIPTO that blocks CRIPTO binding to a CRIPTO binding partner would show decreased levels of these activities relative wild type CRIPTO.
  • a CRIPTO mutant as defined herein would result in 20%, preferably 30% and more preferably 50% less phosphorylation of SMAD2 as compared to a control.
  • a mutant CRIPTO that blocks CRIPTO binding to a CRIPTO binding partner modulates FAST dependent activity as measured by the inhibition of a FAST regulatory element, ie luciferase reporter by 20%, preferably 30% more preferably 50% as compared to a control.
  • a used herein "defucosylation modification” mean the chemical or enzymatic removal of a fucose group.
  • the fucose on the Thr 88 on the CRIPTO polypeptide of the present invention as used herein can be removed enzymatically by fucosidase alternatively the fucose on the Thr 88 on the CRIPTO polypeptide of the present invention can be chemically removed by acid treatment.
  • hybridization of the oligonucleotide probe to a nucleic acid sample typically is performed under "stringent conditions".
  • Nucleic acid duplex or hybrid stability is expressed as the melting temperature or Tm, which is the temperature at which a probe dissociates from a target DNA. This melting temperature is used to define the required stringency conditions. If sequences are to be identified that are related and substantially identical, rather than identical, then it is useful to first establish the lowest temperature at which only homologous hybridization occurs with a particular concentration of salt (e.g., SSC or SSPE).
  • salt e.g., SSC or SSPE
  • the temperature of the final wash in the hybridization reaction is reduced accordingly (for example, if the sequences have > 95% identity with the probe are sought, the final wash temperature is decreased 5°C).
  • the change in the Tm can be between 0.5 C and 1.5 C per 1% mismatch.
  • Stringent conditions involve hybridization at 68°C in 5x SSC/5x Denhardt's solution/1.0% SDS, and washing in 0.2xSSC/0.1% SDS at room temperature.
  • “Moderately stringent conditions” include washing in 3xSSC at 42°C.
  • the parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid. Additional guidance regarding such conditions is readily available in the art, for example, by Sambrook et al., supra; and Ausubel et al., supra. Therapeutic Uses of the Compounds of the Invention
  • the invention provides for treatment or prevention of various diseases and disorders by administration of pharmaceutical compositions of the invention.
  • compositions of the invention are used to treat or prevent undesired cell proliferation in subject.
  • the pharmaceutical compositions of the invention can be used therapeutically to inhibit or block growth of tumors which depend on CRIPTO protein for growth.
  • the disease or condition associated with undesired cell proliferation is cancer.
  • the cancer is selected from the non-limiting group consisting of breast cancer, ovarian cancer, renal cancer, colorectal cancer, uterine cancer, prostate cancer, lung cancer, bladder cancer, central nervous system cancer, melanoma or leukemia.
  • the invention provides methods of treatment by administration to a subject of an effective amount of a pharmaceutical composition of the invention.
  • the pharmaceutical composition is substantially purified.
  • subject as used herein is taken to mean any mammal to which a pharmaceutical composition of the present invention can be administered.
  • Subjects specifically intended for treatment with the method of the invention include humans, as well as nonhuman primates, sheep, horses, cattle, goats, pigs, dogs, cats, rabbits, guinea pigs, hamsters, gerbils, rats and mice.
  • in vitro assays can be carried out with representative cells of cell types (e.g. breast cancer cells) involved in a subject's disorder to determine if CRIPTO mutant has a desired effect upon such cell types, e.g. as described in Example 4
  • an exemplary carrier comprises normal physiologic saline (0.15M NaCl, pH 7.0 to 7.4).
  • acceptable carriers are well known in the art and are described, for example, in Remington's Pharmaceutical Sciences, Gennaro, ed., Mack Publishing Co., 1990. Acceptable carriers can include biocompatible, inert or bioabsorbable salts, buffering agents, oligo- or polysaccharides, polymers, viscosity- improving agents, preservatives, and the like.
  • the term "carrier” encompasses liposomes and the HIV-1 tat protein (See Chen et al., Anal. Biochem. 227: 168-175, 1995) as well as any plasmid and viral expression vectors.
  • Any CRIPTO mutant of this invention can be used in the form of a pharmaceutically acceptable salt.
  • Suitable acids and bases which are capable of forming salts with the polypeptides, nucleic acids and vectors of the present invention are well known to those of skill in the art, and include inorganic and organic acids and bases.
  • CRIPTO mutants of the invention are dispersed in the carrier to concentrations sufficient to deliver to the subject a therapeutically effective amount of the compound, which is an amount sufficient to produce a detectable, preferably medically beneficial effect in the subject.
  • Medically beneficial effects would include preventing, delaying or attenuating deterioration of, or detectably improving, the subject's medical condition. It is expected that the concentration or amount of a CRIPTO mutant that will produce a medically beneficial effect will vary considerably with the circumstances in which the invention is practiced. An effective amount can be determined by an ordinarily skilled physician or other practitioner through no more than routine experimentation.
  • an indication of the status of undesired cell proliferation can be monitored with one or more routine laboratory tests which measure, for example, the CEA, CA19-9, CA15-3, CA27.29 or CA15-3 levels as described supra.
  • routine laboratory tests which measure, for example, the CEA, CA19-9, CA15-3, CA27.29 or CA15-3 levels as described supra.
  • the parameters measure by these tests can be used by a physician to assess disease progression or regression.
  • a CRIPTO mutant is formulated in a liposome delivery system, including without limitation any of a variety of unilamellar vesicles, multilamellar vesicles, or stable plurilamellar vesicles, all of which can prepared and administered according to methods well known to those of skill in the art, for example in accordance with the teachings of United States Patent 5,169,637, 4,762,915, 5,000,958 or 5,185,154.
  • treatment of a disease or condition associated with undesired cell proliferation with liposome-encapsulated CRIPTO mutant may be performed in vivo by introducing a CRIPTO mutant into a patient in need of such treatment using liposomes.
  • the liposomes can be delivered via catheter to the subjects artery.
  • the encapsulated protein may be tested in vitro for any effect on inhibiting undesired cell proliferation.
  • the compounds of the invention may be administered in any manner which is medically acceptable. Depending on the specific circumstances, local or systemic administration may be desirable.
  • the compound is administered via a parenteral route such as by an intravascular, intravenous, intraarterial, subcutaneous, intramuscular, intratumor, intraorbital, intraventricular, intraperitoneal, subcapsular, intracranial, intraspinal, or intranasal injection, infusion or inhalation.
  • the compound also may be administered by implantation of an infusion pump, or a biocompatible or bioerodable sustained release implant, or by installation of a catheter (e.g., in a renal artery), into the subject.
  • a catheter e.g., in a renal artery
  • certain compounds of the invention, or formulations thereof may be appropriate for oral or enteral administration. Still other compounds of the invention will be suitable for topical administration. Treatment Regimes
  • Determining appropriate dosage and frequency of treatment with any particular CRIPTO mutant to be administered to an individual is within the skills and clinical judgement of ordinary practitioners.
  • EXAMPLE 1 Production of Recombinant Crinto A. Expression and Purification of human CriptocC-Fc in CHO cells
  • An expression plasmid designated pSGS480 was constructed by sub-cloning a cDNA encoding human Cripto amino acids residues Methionine 1 to Serinel69 of SEQ ID NO: 1 fused to human IgGi Fc domain (CR(CC)-Fc; SEQ ID NO: 6) into vector pEAGHOO (constructs are shown schematically in Figure 2).
  • the vector pEAGHOO is a derivative of GTBCO-BRL Life Technologies plasmid pCMV-Sport-betagal, whose use in CHO transient transfections was described by Schifferli et al., 1999, Focus 21: 16.
  • Plasmid pSGS480 was transiently transfected into CHO cells and the cells were grown at 28°C for 7 days. The presence of CR(CC)-Fc protein in these cells and the conditioned media was examined by Western blot analysis.
  • Western blot analysis conditioned media and cells from Cripto transfected cells were subjected to SDS-PAGE on 4-20% gradient gels under reducing conditions, transferred electrophoretically to nitrocellulose, and the Cripto detected with a rabbit polyclonal antiserum raised against a Cripto 17-mer peptide (comprising residues 97-113 of SEQ ID NO: l)-keyhole limpet hemocyanin conjugate.
  • N-terminal sequencing was carried out on a Perkin-Elmer Applied Biosystems (PE-ABD) Procise HT sequencer, run in the pulsed liquid mode.
  • the resulting PTH amino acids were separated using a PE ABD 140C Microgradient System with a PTH C18 2.1 x 250 mm column and analyzed on-line using a PE ABD 785 A programmable absorbance detector. Data was analyzed using ABI 610A data analysis software. Sequencing identified a single N-terminus: L 31 GHQEFAR.
  • An expression plasmid designated pSGS422 was constructed by sub-cloning a cDNA encoding human NCAM-1 signal peptide fused to human Cripto-1 residues 75- 112 of SEQ ID NO: 1 fused to human IgGi Fc domain (CR(75-112)-Fc, SEQ ID NO: 8) in vector pEAGHOO, essentially as described above for CR(CC)-Fc ( Figure 2). Plasmid pSGS422 was transiently transfected into CHO cells. The CR(75-112)-Fc protein was efficiently secreted into the supernatant and purified from the conditioned media by chromatography on Protein A as described above for CR(CC)-Fc. EXAMPLE 2: Characterization of O-linked glvcosylation on Cripto
  • PNGase F was purchased from Oxford Glycosciences.
  • DTT dithiothreitol
  • the N-deglycosylated product was analyzed by ESI-MS analyses on a triple quadrupole instrument (Quattro ⁇ , Micromass, Manchester, UK).
  • Electrospray ionization mass spectrometry data for the N-deglycosylated and reduced CR(CC)-Fc showed a number of species with masses ranging from 4116 to 42870 Da (Figure 3). A number of these species had measured masses that matched the predicted mass for CR(CC)-Fc starting at residue 31 and being modified with -linked glycans (HexNAc-Hex-NeuAc). In contrast, a number of species were identified for which the masses did not agree with any available prediction, although the difference in mass of 146 Da for each species was consistent with the addition of a fucose group (Figure 3).
  • the CR(CC)-Fc sample used for the following peptide mapping experiments was reduced with DTT as described above, and after adjusting the sample to 6 M guanidine, reduced with an additional 10 mM DTT for 35 min at 45°C, and alkylated with 30 mM iodoacetamide at room temperature in the dark for 30 min.
  • the mass of the intact, N- deglycosylated, reduced and fully alkylated protein was still 146 Da higher than predicted. This indicated that the +146 Da was not associated with a cysteine residue.
  • the reduced and alkylated CR(CC)-Fc material was digested in 1 M urea, 200 mM Tris-HCl, pH 8.5 with endoproteinase Lys-C (Achromobacter lyticus; WAKO) at a 1:10 enzyme to substrate ratio, for 16 hours at room temperature.
  • the peptides from the endoproteinase Lys-C digest of reduced and alkylated-CR(CC)-Fc sample were separated by reversed-phase(rp)-HPLC on a YMC C 18 column using a Waters Alliance System at a flow rate of 0.05 ml/min with a 120 minute 0-45% solvent B gradient (solvent A: 0.1% TFA; solvent B: 0.085% TF A/75% acetonitrile), and analyzed on-line by mass spectrometry (Micromass Quattro II triple quadrupole instrument). The data showed that the +146 Da modification was associated with an endoproteinase Lys-C generated Cripto peptide comprising residues 77-112.
  • Each Cripto peptide (or mixture) was collected and analyzed by MALDI mass spectrometry (Voyager DE STR instrument, Perseptive Biosystems) using -cyano-4 hydroxy-cinnamic acid as the matrix. Eluate (2 ⁇ l) covering a specified peak were applied to the MALDI plate and allowed to partially air-dry. To each spot, 0.7 ⁇ L of matrix (10 mg alpha cyano-4 hydroxy-cinamic acid /mL 0.1% trifluoroactic acid, 50 % acetonitrile) were added and allowed to air-dry completely. Samples were analyzed in the linear mode.
  • the CNBr treated Cripto peptides were fractionated by rp-HPLC on a Vydac C 4 column using the following gradient of Solvent A, 0.1% TFA, Solvent B 0.085% TFA, 75% acetonitrile: 0-20 % B from 0-10 minutes; 20-75% B from 10-120 minutes; 75-100% B from 120-130 minutes.
  • CNBr cleavage yields a fragment corresponding to predicted residues 71-90 disulfide-linked to residues 91-154 ( Figure 4).
  • a molecular mass as measured by MALDI mass spectrometry showed the mass of peptide 71-90 to be 146 dalton higher than predicted.
  • the CNBr-treated CR(CC)-Fc fragments were further digested with endoproteinase Lys-C in 1 M urea at an estimated enzyme: substrate ratio of 1:5 for 18 hours at room temperature.
  • the peptides from the CNBr/endoproteinase Lys-C digest of CR(CC)-Fc sample were separated by reversed-phase(rp)-HPLC on a YMC C 18 column as described above. The data confirmed that the +146 Da modification was associated with a CNBr/endoproteinase Lys-C generated Cripto peptide comprising residues 83- 90.
  • the CNBr fragment comprising residues 71-90 disulfide -linked to residues 91-154 was reduced with 5 mM DTT and treated with carboxypeptidase Y (Boehringer Mannheim). Portions of the digest were analyzed at 10 minute intervals by MALDI mass spectrometry. The results showed that the C-terminal homoserine lactone (Met converted to homoserine lactone after CNBr cleavage) of peptide 71-90 could be removed without loss of the extra 146 Da ( Figure 4).
  • the endoproteinase Lys-C digest of CR(CC)-Fc (Example 2, part B) localized the 146 Da modification to a Cripto peptide comprising residues 83-112.
  • the CNBr/endoproteinase Lys-C digests of CR(CC)-Fc (Example 2, part C) localized the 146 Da modification to a Cripto peptide comprising residues 71-90. Taken together these two analyses localized the 146 Dalton modification to residues 83-90.
  • the carboxypeptidase Y treatment further localized the 146 dalton modification to Cripto residues 83-89 CLNGGTC.
  • cysteine residues within this sequence were shown above to be available for alkylation, and are hence not modified by the 146 Dalton.
  • Leucine, glycine are not typically modified.
  • Asn followed by Gly can form a cycle imide with associated loss of 17 Da (loss of NH 3 ), which under basic conditions forms a or ⁇ aspartic acid (addition of OH), resulting in a net increase of 1 Da for this peptide.
  • threonine 88 to alanine was accomplished by spliced overlap extension polymerase chain reaction (SOE PCR), reference Stephan Ho et. Al., Gene 11, 1989, pgs 51-59.
  • NEW- 658 GCCTGAATGGGGGAG * C * C * TGCATGCTGGGATCCTTTTGTGCCTGC 3 ' ( SEQ ID NO :
  • oligos change the threonine codon ACC to the codon for alanine, GCC.
  • a mutation was introduced into an adjacent codon to facilitate identification of mutant clones following mutagenesis.
  • the same oligos also make a silent change to the sequence to introduce a BamHl site, changing the glycine 62 codon from GGG to GGA. This new site gave the ability to screen for the mutant clone.
  • the wild type and T88A Cripto constructs are shown schematically in Figures 2 and 5, respectively.
  • the first mutant (CR(CC) T88A, SEQ ID NO: 10), designated pSGS901, was made using template pSGS140, which is a cDNA encoding human Cripto amino acid residues methioninel -serine 169 of SEQ ID NO: 1 in pEAGHOO vector for transient transfection.
  • the second mutant (CR(75-112)-Fc T88A), SEQ ID NO: 15), designated pSGS902, was generated from template pSGS422, which is a cDNA encoding human VCAM-1 signal peptide fused to human Cripto-1 residues Serine75 to lysinell2 of SEQ ID NO: 1 fused to human IgGi Fc domain (SEQ ID NO: 8) in vector pEAGHOO.
  • the third mutant (CR T88A, SEQ ID NO: 9), designated pSGS903, is made using template pSGS151, which is a cDNA encoding human Cripto amino acid residues 1-188 of SEQ ID NO: 1 in pCS2 vector (See Rapp et al., Genes Dev 8: 1311-1323, 1994; and Turner et al., Genes Dev 8: 1434-1447, 1994) for transient transfection.
  • Phase I was PCR to produce two products A+B.
  • Product A the 5' end of the cDNA, was generated by using a top strand oligo of 5' sequence, NEW-547 (SEQ ID NO: 29) for pSGS901 and pSGS903, and NEW-423 (SEQ ID NO: 32) for pSGS902, and the bottom strand mutagenic oligo, NEW-659 (SEQ ID NO: 35).
  • Product B the 3' end of the cDNA, was generated by using the top strand mutagenic oligo, NEW-658 (SEQ ID NO: 34), and a bottom strand oligo of 3' sequence, NEW-587 (SEQ ID NO: 30) for pSGS901, NEW-588 (SEQ ID NO: 31) for pSGS903, and NEW-670 (SEQ ID NO: 33) for pSGS902.
  • Phase II of SOE PCR was to make product C, which is the entire mutagenized cDNA.
  • This step used products A+B, which have 44 nucleotides of overlapping sequence, and the 5' top strand and 3' bottom strand oligos discussed in step I above.
  • Phase I for products A and B for both mutants pSGS901, pSGS902 and pSGS903 was done as follows. PCR was performed with five nanograms (ng) of template cDNA, 30 picomoles (pmol) each of 5' and 3' oligos, 200 nanomoles (nmol) of each deoxynucleotide (dNTP), 1 x cloned Pfu DNA polymerase reaction buffer (2 mM MgCl 2 ), and 2.5 units of PfuTurbo DNA polymerase (Stratagene, cat. #600252 ) added after a hot start, in 100 microliters ( ⁇ l) total volume.
  • the reactions required 30 cycles of a 94°C-1 minute melting step, a 58°C-1 minute annealing step, a 72°C-2 minute extension step, followed by one cycle of a 72°C-7 minute extension.
  • the only exception to this procedure was that the annealing temperature for NEW-423 (SEQ ID NO: 32) was 50°C.
  • Phase H for mutants pSGS901, pSGS902 and ⁇ SGS903 was done as follows. 10 ⁇ l each of products A+B were mixed with 200 nmol dNTPs, 30 pmol each of 5' and 3' oligos, Pfu buffer, and 2.5 units of PfuTurbo enzyme added after a hot start. Phase II PCR reaction steps were done as above except for the annealing temperatures. The annealing temperature for ⁇ SGS901 and ⁇ SGS903 product C PCR is 65°C, and for pSGS902 product C PCR was 55°C.
  • PCR product C for pSGS901 and ⁇ SGS902 are was then digested with 60 units of Notl restriction enzyme for 16 hours at 37°C.
  • PCR product C for pSGS903 was digested with 60 units of Xhol and Hindi 11 restriction enzymes for 16 hours at 37°C.
  • the enzyme was extracted once with phenol and chloroform together, once with chloroform, and the DNA was precipitated with ethanol plus 0.3 M sodium acetate pH 5.2 with glycogen as a carrier.
  • the DNA pellet was washed with 70% ethanol plus water and resuspended in 10 mM Tris pH 8.
  • ligations were now performed between the 20 ng of Not 1 digested product C inserts and 50 ng Notl digested and calf intestinal phosphatase treated pEAGUOO vector in 10 ⁇ l total volume for 16 hours at 16°C.
  • a ligation for pSGS903 was done with 20 ng of the Xhol/Hindl 11 digested product C and Xhol/Hindl 11 digested ⁇ CS2+ vector. Two ⁇ l of this reaction was tranformed into 50 ⁇ l E.coli DH5 and plated on Luria broth (LB) agar plates with 50 ⁇ g/ml ampicillin.
  • Colonies were picked and grown up in 2 mis of LB broth for 16 hours at 37°C. Plasmid DNA was purified using Qiagen miniprep ts, digested with BamHl for 1.5 hours, and run on agarose gels to visualize which clone contained the silent mutation and thus contained the threonine 88 to alanine change. The sequence of clonal inserts (Cripto and Ig sequences) was checked and confirmed by dideoxy DNA sequencing. C. Transfection into CHO cells
  • mutant Cripto protein Mutations were confirmed by DNA sequencing. After the correct mutant clone was verified, a large scale transient transfection was performed to obtain mutant Cripto protein. This was done using CHO cells (CD-CHO) grown as a suspension culture in spinner flasks. For each liter culture, 2 mg of cDNA was mixed with DMRIE-C (Life Technologies) cationic lipid plus cholesterol solution, in a total volume of 240 mis of serum free media (CD-CHO media, Life Technologies), at room temperature for 15 minutes. Then 1.5xl0 9 CHO cells in 240 mis of the same media was added to the DNA plus DMRIE-C solution, transferred to a 1 liter spinner flask, and grown for 4 hours at 37°C.
  • Cripto activity can lead to a de-differentiated state promoting mesenchymal cell characteristics, increased proliferation and cell migration (Salomon et al interchange BioEssays 21: 61-70, 1999; Ciardiello et al., Oncogene 9: 291-298, 1994; and Baldassarre et al., Int. J. Cancer 66:538-543, 1996) - all phenotypes associated with cell transformation seen in neoplasia. Cripto antagonists that block Cripto activity could be therapeutically beneficial and a potential treatment for cancer.
  • Cripto antagonists One method of testing the activity of Cripto antagonists and their ability to modulate the Cripto signaling is with a F9-Cripto knock-out (KO) cell line (Minchiotti at al., Mech. Dev. 90: 133-142, 2000). Cripto will stimulate smad2 phosphorylation and the transcription factor FAST in Xenopus embryos, and the activity of the transcription factor FAST can be monitored by measuring the luciferase activity from a FAST regulatory element-luciferase reporter gene (Saijoh et al., Mol. Cell 5:35-47, 2000).
  • F9- Cripto KO cells are deleted for the Cripto gene and are thus null for Cripto and Cripto- dependent signaling (Minchiotti at al., Mech. Dev. 90: 133-142, 2000). Cripto signaling can be assessed in the F9 Cripto KO cells by transfecting in Cripto, FAST and the FAST regulatory element-luciferase gene construct ( Figure 6). No Cripto dependent FAST luciferase activity was seen in these cell lines unless Cripto cDNA and FAST cDNA was transfected into them ( Figure 6).
  • the activity of wild-type and mutant Cripto constructs can be measured by transfecting into the F9 Cripto KO cells.
  • F9 Cripto KO cells (6.5 x 10 5 cells/well) were transfected with equal amounts of FAST, FAST luciferase reporter DNA, and in the absence and presence of Cripto full length wild-type DNA and in the absence and presence of Cripto T88A mutant full length DNA.
  • Total DNA transfected was always 1.0 ⁇ g and control vector DNA (pEAGlOO or pCS2) was used to bring the total up to 1.0 ⁇ g when necessary (transfections were done with Lipofectamine using conditions standard to those with skill in the field, Lipofectamine was purchased from Bethesda Reasearch Labs).
  • Cripto antagonists are screened for in vivo activity as potential anticancer agents in mice following standard protocols used by those with skill in the art. Example of such protocols are those listed below and outlined by the National Cancer Institute (NCI) in their "in vivo cancer models screening" protocols, NIH publication number 84-2635 (Feb 1984).
  • NCI National Cancer Institute
  • Cripto antagonist protein, Control Antibody, and PBS control animals are injected ip on staging day and continue every 4 days for a total of 3 injections. Body weights and tumor measurements are recorded on initial treatment day (staging day) and selected measurement days. Final evaluation day is the measurement day which yields the optimum (best) tumor weight for t/c% is designated the final evaluation day. End and evaluate experiment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Oncology (AREA)
  • Hematology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2001/029066 2000-09-18 2001-09-18 Cripto mutant and uses thereof Ceased WO2002022808A2 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
JP2002527250A JP2004524810A (ja) 2000-09-18 2001-09-18 Cripto変異体およびその使用
CA002422814A CA2422814A1 (en) 2000-09-18 2001-09-18 Cripto mutant and uses thereof
AU9272401A AU9272401A (en) 2000-09-18 2001-09-18 Cripto mutant and uses thereof
AU2001292724A AU2001292724B2 (en) 2000-09-18 2001-09-18 CRIPTO mutant and uses thereof
EP01973111A EP1320604A2 (en) 2000-09-18 2001-09-18 Cripto mutant and uses thereof
NZ525380A NZ525380A (en) 2000-09-18 2001-09-18 Non-fucosylated forms of Cripto and their use as tumor blocking agents
US10/390,566 US7604931B2 (en) 2000-09-18 2003-03-17 Cripto mutant and uses thereof
AU2005204268A AU2005204268B2 (en) 2000-09-18 2005-08-26 CRIPTO Mutant and Uses Thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US23314800P 2000-09-18 2000-09-18
US60/233,148 2000-09-18

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US10/390,566 Continuation US7604931B2 (en) 2000-09-18 2003-03-17 Cripto mutant and uses thereof

Publications (2)

Publication Number Publication Date
WO2002022808A2 true WO2002022808A2 (en) 2002-03-21
WO2002022808A3 WO2002022808A3 (en) 2003-01-16

Family

ID=22876077

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/029066 Ceased WO2002022808A2 (en) 2000-09-18 2001-09-18 Cripto mutant and uses thereof

Country Status (7)

Country Link
US (1) US7604931B2 (https=)
EP (1) EP1320604A2 (https=)
JP (1) JP2004524810A (https=)
AU (2) AU9272401A (https=)
CA (1) CA2422814A1 (https=)
NZ (1) NZ525380A (https=)
WO (1) WO2002022808A2 (https=)

Cited By (77)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002077033A1 (en) * 2001-03-26 2002-10-03 The Austin Research Institute Antibodies against cancer
WO2005033341A3 (en) * 2003-10-03 2005-06-02 Us Gov Health & Human Serv Use of cripto-1 as a biomarker for neurodegenerative disease and method of inhibiting progression thereof
WO2008040759A1 (en) * 2006-10-03 2008-04-10 Pharmexa A/S Method for down-regulation of cripto
US7531174B2 (en) 2001-04-26 2009-05-12 Biogen Idec Ma Inc. Cripto blocking antibodies and uses thereof
US7582299B2 (en) 2001-04-26 2009-09-01 Biogen Idec Ma Inc. Cripto-specific antibodies
EP2135952A3 (en) * 2003-09-15 2010-09-29 Research Development Foundation Cripto antagonism of activin and TGF-beta signaling
EP2260858A2 (en) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Monomethylvaline compounds capable of conjugation to ligands
EP2286844A2 (en) 2004-06-01 2011-02-23 Genentech, Inc. Antibody-drug conjugates and methods
WO2011031870A1 (en) 2009-09-09 2011-03-17 Centrose, Llc Extracellular targeted drug conjugates
WO2011056983A1 (en) 2009-11-05 2011-05-12 Genentech, Inc. Zirconium-radiolabeled, cysteine engineered antibody conjugates
US8021661B2 (en) 2005-01-05 2011-09-20 Biogen Idec Ma Inc. Cripto binding molecules
WO2011130598A1 (en) 2010-04-15 2011-10-20 Spirogen Limited Pyrrolobenzodiazepines and conjugates thereof
WO2011156328A1 (en) 2010-06-08 2011-12-15 Genentech, Inc. Cysteine engineered antibodies and conjugates
WO2012074757A1 (en) 2010-11-17 2012-06-07 Genentech, Inc. Alaninyl maytansinol antibody conjugates
WO2012155019A1 (en) 2011-05-12 2012-11-15 Genentech, Inc. Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides
WO2013130093A1 (en) 2012-03-02 2013-09-06 Genentech, Inc. Biomarkers for treatment with anti-tubulin chemotherapeutic compounds
WO2014057074A1 (en) 2012-10-12 2014-04-17 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
WO2014140174A1 (en) 2013-03-13 2014-09-18 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
WO2014140862A2 (en) 2013-03-13 2014-09-18 Spirogen Sarl Pyrrolobenzodiazepines and conjugates thereof
WO2014159981A2 (en) 2013-03-13 2014-10-02 Spirogen Sarl Pyrrolobenzodiazepines and conjugates thereof
WO2015023355A1 (en) 2013-08-12 2015-02-19 Genentech, Inc. 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment
WO2015095227A2 (en) 2013-12-16 2015-06-25 Genentech, Inc. Peptidomimetic compounds and antibody-drug conjugates thereof
WO2015095223A2 (en) 2013-12-16 2015-06-25 Genentech, Inc. Peptidomimetic compounds and antibody-drug conjugates thereof
WO2015095212A1 (en) 2013-12-16 2015-06-25 Genentech, Inc. 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment
WO2016040825A1 (en) 2014-09-12 2016-03-17 Genentech, Inc. Anthracycline disulfide intermediates, antibody-drug conjugates and methods
WO2016040856A2 (en) 2014-09-12 2016-03-17 Genentech, Inc. Cysteine engineered antibodies and conjugates
WO2016037644A1 (en) 2014-09-10 2016-03-17 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2016090050A1 (en) 2014-12-03 2016-06-09 Genentech, Inc. Quaternary amine compounds and antibody-drug conjugates thereof
EP3088004A1 (en) 2004-09-23 2016-11-02 Genentech, Inc. Cysteine engineered antibodies and conjugates
WO2017059289A1 (en) 2015-10-02 2017-04-06 Genentech, Inc. Pyrrolobenzodiazepine antibody drug conjugates and methods of use
WO2017064675A1 (en) 2015-10-16 2017-04-20 Genentech, Inc. Hindered disulfide drug conjugates
WO2017068511A1 (en) 2015-10-20 2017-04-27 Genentech, Inc. Calicheamicin-antibody-drug conjugates and methods of use
WO2017165734A1 (en) 2016-03-25 2017-09-28 Genentech, Inc. Multiplexed total antibody and antibody-conjugated drug quantification assay
EP3235820A1 (en) 2014-09-17 2017-10-25 Genentech, Inc. Pyrrolobenzodiazepines and antibody disulfide conjugates thereof
WO2017201449A1 (en) 2016-05-20 2017-11-23 Genentech, Inc. Protac antibody conjugates and methods of use
WO2017205741A1 (en) 2016-05-27 2017-11-30 Genentech, Inc. Bioanalytical method for the characterization of site-specific antibody-drug conjugates
WO2017214024A1 (en) 2016-06-06 2017-12-14 Genentech, Inc. Silvestrol antibody-drug conjugates and methods of use
WO2018031662A1 (en) 2016-08-11 2018-02-15 Genentech, Inc. Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof
US9919056B2 (en) 2012-10-12 2018-03-20 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US9931414B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9931415B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
WO2018065501A1 (en) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Methods for preparing antibody drug conjugates
US9950078B2 (en) 2013-10-11 2018-04-24 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9956299B2 (en) 2013-10-11 2018-05-01 Medimmune Limited Pyrrolobenzodiazepine—antibody conjugates
US10010624B2 (en) 2013-10-11 2018-07-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10029018B2 (en) 2013-10-11 2018-07-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2019060398A1 (en) 2017-09-20 2019-03-28 Ph Pharma Co., Ltd. ANALOGUES OF THAILANSTATINE
US10392393B2 (en) 2016-01-26 2019-08-27 Medimmune Limited Pyrrolobenzodiazepines
US10420777B2 (en) 2014-09-12 2019-09-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10543279B2 (en) 2016-04-29 2020-01-28 Medimmune Limited Pyrrolobenzodiazepine conjugates and their use for the treatment of cancer
US10544223B2 (en) 2017-04-20 2020-01-28 Adc Therapeutics Sa Combination therapy with an anti-axl antibody-drug conjugate
WO2020049286A1 (en) 2018-09-03 2020-03-12 Femtogenix Limited Polycyclic amides as cytotoxic agents
WO2020086858A1 (en) 2018-10-24 2020-04-30 Genentech, Inc. Conjugated chemical inducers of degradation and methods of use
WO2020123275A1 (en) 2018-12-10 2020-06-18 Genentech, Inc. Photocrosslinking peptides for site specific conjugation to fc-containing proteins
US10695439B2 (en) 2016-02-10 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine conjugates
US10695433B2 (en) 2012-10-12 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
WO2020157491A1 (en) 2019-01-29 2020-08-06 Femtogenix Limited G-a crosslinking cytotoxic agents
US10736903B2 (en) 2012-10-12 2020-08-11 Medimmune Limited Pyrrolobenzodiazepine-anti-PSMA antibody conjugates
US10751346B2 (en) 2012-10-12 2020-08-25 Medimmune Limited Pyrrolobenzodiazepine—anti-PSMA antibody conjugates
US10780096B2 (en) 2014-11-25 2020-09-22 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
US10799595B2 (en) 2016-10-14 2020-10-13 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11059893B2 (en) 2015-04-15 2021-07-13 Bergenbio Asa Humanized anti-AXL antibodies
US11135303B2 (en) 2011-10-14 2021-10-05 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US11160872B2 (en) 2017-02-08 2021-11-02 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
WO2022023735A1 (en) 2020-07-28 2022-02-03 Femtogenix Limited Cytotoxic agents
US11318211B2 (en) 2017-06-14 2022-05-03 Adc Therapeutics Sa Dosage regimes for the administration of an anti-CD19 ADC
US11352324B2 (en) 2018-03-01 2022-06-07 Medimmune Limited Methods
US11370801B2 (en) 2017-04-18 2022-06-28 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11517626B2 (en) 2016-02-10 2022-12-06 Medimmune Limited Pyrrolobenzodiazepine antibody conjugates
US11524969B2 (en) 2018-04-12 2022-12-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof as antitumour agents
US11612665B2 (en) 2017-02-08 2023-03-28 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
WO2023078273A1 (en) 2021-11-03 2023-05-11 Hangzhou Dac Biotech Co., Ltd. Specific conjugation for an antibody-drug conjugate
US11649250B2 (en) 2017-08-18 2023-05-16 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11702473B2 (en) 2015-04-15 2023-07-18 Medimmune Limited Site-specific antibody-drug conjugates
IT202200007580A1 (it) * 2022-04-15 2023-10-15 Consiglio Nazionale Ricerche Vescicole lipidiche per l’uso nel trattamento terapeutico di tumori aggressivi
WO2024220546A2 (en) 2023-04-17 2024-10-24 Peak Bio, Inc. Antibodies and antibody-drug conjugates and methods of use and synthetic processes and intermediates
US12209099B2 (en) 2019-03-15 2025-01-28 Medimmune Limited Azetidobenzodiazepine dimers and conjugates comprising them for use in the treatment of cancer

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090123470A1 (en) * 2001-03-26 2009-05-14 The Macfarlane Burnet Istitute For Medical Research And Public Health Ltd. Antibodies Against Cancer
WO2006074341A2 (en) * 2005-01-07 2006-07-13 Glaxo Group Limited Novel use
AU2007243181A1 (en) * 2006-04-28 2007-11-08 Biogen Idec Ma Inc. Composition and methods for the detection of Cripto-3
AU2007248253B2 (en) * 2006-05-02 2010-12-23 Genentech, Inc. Microwave assisted deglycosylation of proteins for molecular weight determination by mass spectrometry
CN105189507A (zh) 2012-12-21 2015-12-23 斯皮罗根有限公司 吡咯并苯并二氮杂卓及其结合物
CN105246894A (zh) 2012-12-21 2016-01-13 斯皮罗根有限公司 用于治疗增殖性和自身免疫疾病的非对称吡咯并苯并二氮杂卓二聚物
EP4637833A2 (en) 2022-12-23 2025-10-29 Genentech, Inc. Cereblon degrader conjugates, and uses thereof
WO2026006689A2 (en) 2024-06-28 2026-01-02 Firefly Bio, Inc. Bcl-xl degrader antibody conjugates and uses thereof
WO2026006688A2 (en) 2024-06-28 2026-01-02 Firefly Bio, Inc. Degrader antibody conjugates and uses thereof

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5256643A (en) * 1990-05-29 1993-10-26 The Government Of The United States Human cripto protein
US5264557A (en) * 1991-08-23 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Polypeptide of a human cripto-related gene, CR-3
KR19980703534A (ko) * 1995-06-05 1998-11-05 벤슨로버트에이치 사람 크립틴 성장 인자
DE69737457T2 (de) * 1997-01-31 2007-11-29 Genentech, Inc., South San Francisco O-fukosyltransferase
JP2002505338A (ja) * 1998-03-05 2002-02-19 カイロン コーポレイション 生物学的に活性な分子の血清半減期を増加するための方法
IL125608A0 (en) * 1998-07-30 1999-03-12 Yeda Res & Dev Tumor associated antigen peptides and use of same as anti-tumor vaccines

Cited By (107)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002077033A1 (en) * 2001-03-26 2002-10-03 The Austin Research Institute Antibodies against cancer
US7318924B2 (en) 2001-03-26 2008-01-15 The Austin Research Institute Antibodies against cancer
US7888052B2 (en) 2001-04-26 2011-02-15 Biogen Idec Ma Inc. Cripto blocking antibodies and uses thereof
US8673303B2 (en) 2001-04-26 2014-03-18 Biogen Idec Ma Inc. Cripto blocking antibodies and uses thereof
US7531174B2 (en) 2001-04-26 2009-05-12 Biogen Idec Ma Inc. Cripto blocking antibodies and uses thereof
US7582299B2 (en) 2001-04-26 2009-09-01 Biogen Idec Ma Inc. Cripto-specific antibodies
US7674462B2 (en) 2001-04-26 2010-03-09 Biogen Idec Ma Inc. Cripto blocking antibodies and uses thereof
US8003763B2 (en) 2001-04-26 2011-08-23 Biogen Idec Ma Inc. Cripto blocking antibodies and uses thereof
EP2135952A3 (en) * 2003-09-15 2010-09-29 Research Development Foundation Cripto antagonism of activin and TGF-beta signaling
US7820620B2 (en) 2003-09-15 2010-10-26 Research Development Foundation Cripto antagonism of activin and TGF-b signaling
US9546210B2 (en) 2003-09-15 2017-01-17 Research Development Foundation Cripto antagonism of activin and TGF-b signaling
WO2005033341A3 (en) * 2003-10-03 2005-06-02 Us Gov Health & Human Serv Use of cripto-1 as a biomarker for neurodegenerative disease and method of inhibiting progression thereof
EP2489364A1 (en) 2003-11-06 2012-08-22 Seattle Genetics, Inc. Monomethylvaline compounds onjugated to antibodies
EP3858387A1 (en) 2003-11-06 2021-08-04 Seagen Inc. Monomethylvaline compounds capable of conjugation to ligands
EP2260858A2 (en) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Monomethylvaline compounds capable of conjugation to ligands
EP3434275A1 (en) 2003-11-06 2019-01-30 Seattle Genetics, Inc. Assay for cancer cells based on the use of auristatin conjugates with antibodies
EP2478912A1 (en) 2003-11-06 2012-07-25 Seattle Genetics, Inc. Auristatin conjugates with anti-HER2 or anti-CD22 antibodies and their use in therapy
EP2486933A1 (en) 2003-11-06 2012-08-15 Seattle Genetics, Inc. Monomethylvaline compounds conjugated with antibodies
EP2286844A2 (en) 2004-06-01 2011-02-23 Genentech, Inc. Antibody-drug conjugates and methods
EP3088004A1 (en) 2004-09-23 2016-11-02 Genentech, Inc. Cysteine engineered antibodies and conjugates
US8021661B2 (en) 2005-01-05 2011-09-20 Biogen Idec Ma Inc. Cripto binding molecules
WO2008040759A1 (en) * 2006-10-03 2008-04-10 Pharmexa A/S Method for down-regulation of cripto
WO2011031870A1 (en) 2009-09-09 2011-03-17 Centrose, Llc Extracellular targeted drug conjugates
WO2011056983A1 (en) 2009-11-05 2011-05-12 Genentech, Inc. Zirconium-radiolabeled, cysteine engineered antibody conjugates
WO2011130598A1 (en) 2010-04-15 2011-10-20 Spirogen Limited Pyrrolobenzodiazepines and conjugates thereof
WO2011156328A1 (en) 2010-06-08 2011-12-15 Genentech, Inc. Cysteine engineered antibodies and conjugates
WO2012074757A1 (en) 2010-11-17 2012-06-07 Genentech, Inc. Alaninyl maytansinol antibody conjugates
WO2012155019A1 (en) 2011-05-12 2012-11-15 Genentech, Inc. Multiple reaction monitoring lc-ms/ms method to detect therapeutic antibodies in animal samples using framework signature pepides
US11135303B2 (en) 2011-10-14 2021-10-05 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2013130093A1 (en) 2012-03-02 2013-09-06 Genentech, Inc. Biomarkers for treatment with anti-tubulin chemotherapeutic compounds
EP2839860A1 (en) 2012-10-12 2015-02-25 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
US11701430B2 (en) 2012-10-12 2023-07-18 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US11690918B2 (en) 2012-10-12 2023-07-04 Medimmune Limited Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US11771775B2 (en) 2012-10-12 2023-10-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11779650B2 (en) 2012-10-12 2023-10-10 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10994023B2 (en) 2012-10-12 2021-05-04 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10799596B2 (en) 2012-10-12 2020-10-13 Adc Therapeutics S.A. Pyrrolobenzodiazepine-antibody conjugates
US10780181B2 (en) 2012-10-12 2020-09-22 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US12121590B2 (en) 2012-10-12 2024-10-22 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2014057074A1 (en) 2012-10-12 2014-04-17 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
US10751346B2 (en) 2012-10-12 2020-08-25 Medimmune Limited Pyrrolobenzodiazepine—anti-PSMA antibody conjugates
US10736903B2 (en) 2012-10-12 2020-08-11 Medimmune Limited Pyrrolobenzodiazepine-anti-PSMA antibody conjugates
US10722594B2 (en) 2012-10-12 2020-07-28 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US10695433B2 (en) 2012-10-12 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10646584B2 (en) 2012-10-12 2020-05-12 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10335497B2 (en) 2012-10-12 2019-07-02 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US9919056B2 (en) 2012-10-12 2018-03-20 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US9931415B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9889207B2 (en) 2012-10-12 2018-02-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US9931414B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
WO2014140174A1 (en) 2013-03-13 2014-09-18 Spirogen Sàrl Pyrrolobenzodiazepines and conjugates thereof
WO2014159981A2 (en) 2013-03-13 2014-10-02 Spirogen Sarl Pyrrolobenzodiazepines and conjugates thereof
WO2014140862A2 (en) 2013-03-13 2014-09-18 Spirogen Sarl Pyrrolobenzodiazepines and conjugates thereof
WO2015023355A1 (en) 2013-08-12 2015-02-19 Genentech, Inc. 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment
US9950078B2 (en) 2013-10-11 2018-04-24 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9956299B2 (en) 2013-10-11 2018-05-01 Medimmune Limited Pyrrolobenzodiazepine—antibody conjugates
US10010624B2 (en) 2013-10-11 2018-07-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10029018B2 (en) 2013-10-11 2018-07-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2015095223A2 (en) 2013-12-16 2015-06-25 Genentech, Inc. Peptidomimetic compounds and antibody-drug conjugates thereof
WO2015095227A2 (en) 2013-12-16 2015-06-25 Genentech, Inc. Peptidomimetic compounds and antibody-drug conjugates thereof
WO2015095212A1 (en) 2013-12-16 2015-06-25 Genentech, Inc. 1-(chloromethyl)-2,3-dihydro-1h-benzo[e]indole dimer antibody-drug conjugate compounds, and methods of use and treatment
WO2016037644A1 (en) 2014-09-10 2016-03-17 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10188746B2 (en) 2014-09-10 2019-01-29 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10420777B2 (en) 2014-09-12 2019-09-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2016040825A1 (en) 2014-09-12 2016-03-17 Genentech, Inc. Anthracycline disulfide intermediates, antibody-drug conjugates and methods
WO2016040856A2 (en) 2014-09-12 2016-03-17 Genentech, Inc. Cysteine engineered antibodies and conjugates
EP3235820A1 (en) 2014-09-17 2017-10-25 Genentech, Inc. Pyrrolobenzodiazepines and antibody disulfide conjugates thereof
US10780096B2 (en) 2014-11-25 2020-09-22 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
WO2016090050A1 (en) 2014-12-03 2016-06-09 Genentech, Inc. Quaternary amine compounds and antibody-drug conjugates thereof
US11059893B2 (en) 2015-04-15 2021-07-13 Bergenbio Asa Humanized anti-AXL antibodies
US11702473B2 (en) 2015-04-15 2023-07-18 Medimmune Limited Site-specific antibody-drug conjugates
WO2017059289A1 (en) 2015-10-02 2017-04-06 Genentech, Inc. Pyrrolobenzodiazepine antibody drug conjugates and methods of use
WO2017064675A1 (en) 2015-10-16 2017-04-20 Genentech, Inc. Hindered disulfide drug conjugates
WO2017068511A1 (en) 2015-10-20 2017-04-27 Genentech, Inc. Calicheamicin-antibody-drug conjugates and methods of use
US10392393B2 (en) 2016-01-26 2019-08-27 Medimmune Limited Pyrrolobenzodiazepines
US10695439B2 (en) 2016-02-10 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11517626B2 (en) 2016-02-10 2022-12-06 Medimmune Limited Pyrrolobenzodiazepine antibody conjugates
EP4273551A2 (en) 2016-03-25 2023-11-08 F. Hoffmann-La Roche AG Multiplexed total antibody and antibody-conjugated drug quantification assay
WO2017165734A1 (en) 2016-03-25 2017-09-28 Genentech, Inc. Multiplexed total antibody and antibody-conjugated drug quantification assay
US10543279B2 (en) 2016-04-29 2020-01-28 Medimmune Limited Pyrrolobenzodiazepine conjugates and their use for the treatment of cancer
WO2017201449A1 (en) 2016-05-20 2017-11-23 Genentech, Inc. Protac antibody conjugates and methods of use
WO2017205741A1 (en) 2016-05-27 2017-11-30 Genentech, Inc. Bioanalytical method for the characterization of site-specific antibody-drug conjugates
WO2017214024A1 (en) 2016-06-06 2017-12-14 Genentech, Inc. Silvestrol antibody-drug conjugates and methods of use
WO2018031662A1 (en) 2016-08-11 2018-02-15 Genentech, Inc. Pyrrolobenzodiazepine prodrugs and antibody conjugates thereof
WO2018065501A1 (en) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Methods for preparing antibody drug conjugates
US10799595B2 (en) 2016-10-14 2020-10-13 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11160872B2 (en) 2017-02-08 2021-11-02 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
US11813335B2 (en) 2017-02-08 2023-11-14 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11612665B2 (en) 2017-02-08 2023-03-28 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11370801B2 (en) 2017-04-18 2022-06-28 Medimmune Limited Pyrrolobenzodiazepine conjugates
US10544223B2 (en) 2017-04-20 2020-01-28 Adc Therapeutics Sa Combination therapy with an anti-axl antibody-drug conjugate
US11938192B2 (en) 2017-06-14 2024-03-26 Medimmune Limited Dosage regimes for the administration of an anti-CD19 ADC
US11318211B2 (en) 2017-06-14 2022-05-03 Adc Therapeutics Sa Dosage regimes for the administration of an anti-CD19 ADC
US11649250B2 (en) 2017-08-18 2023-05-16 Medimmune Limited Pyrrolobenzodiazepine conjugates
WO2019060398A1 (en) 2017-09-20 2019-03-28 Ph Pharma Co., Ltd. ANALOGUES OF THAILANSTATINE
US11352324B2 (en) 2018-03-01 2022-06-07 Medimmune Limited Methods
US11524969B2 (en) 2018-04-12 2022-12-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof as antitumour agents
WO2020049286A1 (en) 2018-09-03 2020-03-12 Femtogenix Limited Polycyclic amides as cytotoxic agents
WO2020086858A1 (en) 2018-10-24 2020-04-30 Genentech, Inc. Conjugated chemical inducers of degradation and methods of use
WO2020123275A1 (en) 2018-12-10 2020-06-18 Genentech, Inc. Photocrosslinking peptides for site specific conjugation to fc-containing proteins
WO2020157491A1 (en) 2019-01-29 2020-08-06 Femtogenix Limited G-a crosslinking cytotoxic agents
US12209099B2 (en) 2019-03-15 2025-01-28 Medimmune Limited Azetidobenzodiazepine dimers and conjugates comprising them for use in the treatment of cancer
WO2022023735A1 (en) 2020-07-28 2022-02-03 Femtogenix Limited Cytotoxic agents
WO2023078273A1 (en) 2021-11-03 2023-05-11 Hangzhou Dac Biotech Co., Ltd. Specific conjugation for an antibody-drug conjugate
IT202200007580A1 (it) * 2022-04-15 2023-10-15 Consiglio Nazionale Ricerche Vescicole lipidiche per l’uso nel trattamento terapeutico di tumori aggressivi
WO2023199237A1 (en) * 2022-04-15 2023-10-19 Consiglio Nazionale Delle Ricerche Cripto-positive lipid vesicles for use in the therapeutic treatment of aggressive tumours
WO2024220546A2 (en) 2023-04-17 2024-10-24 Peak Bio, Inc. Antibodies and antibody-drug conjugates and methods of use and synthetic processes and intermediates

Also Published As

Publication number Publication date
JP2004524810A (ja) 2004-08-19
US20030232755A1 (en) 2003-12-18
EP1320604A2 (en) 2003-06-25
AU9272401A (en) 2002-03-26
AU2001292724B2 (en) 2005-05-26
WO2002022808A3 (en) 2003-01-16
NZ525380A (en) 2008-06-30
CA2422814A1 (en) 2002-03-21
US7604931B2 (en) 2009-10-20

Similar Documents

Publication Publication Date Title
US7604931B2 (en) Cripto mutant and uses thereof
AU2001292724A1 (en) CRIPTO mutant and uses thereof
KR101220245B1 (ko) 성장인자에 결합하는 융합 단백질
KR100611620B1 (ko) 안지오포이에틴 수용체 결합 도메인 및 다중체화 도메인을포함하는 융합 단백질
EP0850304B1 (en) Cerebellum-derived growth factors, and uses related thereto
JP2020158546A (ja) 筋ジストロフィー治療のためのユートロフィン誘導に関するactriibタンパク質およびその改変体およびその使用
EP0599274A1 (en) HER4, a human receptor tyrosine kinase of the epidermal growth factor receptor family
JP2007044044A (ja) 線維芽細胞増殖因子様ポリペプチド
CZ361598A3 (cs) Nukleová kyselina kódující ligand c-Ret, polypeptid ligand c-Ret, způsob jeho přípravy a použití pro stimulaci růstu tkání
TW201142024A (en) Robo1-Fc fusion protein and use thereof in the treatment of tumours
AU735794B2 (en) Don-1 gene and polypeptides and uses therefor
WO1998007736A9 (en) Don-1 gene and polypeptides and uses therefor
AU2714700A (en) Method of enhancing the biological activity of ligands
AU2001266876B2 (en) Pleiotrophin growth factor receptor for the treatment of proliferative, vascular and neurological disorders
US6544759B1 (en) Polynucleotides encoding a novel growth factor which acts through ErbB-4 kinase receptor tyrosine
CN102134275B (zh) 表皮生长因子受体变异体
AU2001266876A1 (en) Pleiotrophin growth factor receptor for the treatment of proliferative, vascular and neurological disorders
AU2005204268B2 (en) CRIPTO Mutant and Uses Thereof
AU2007200329A1 (en) CRIPTO Mutant and Uses Thereof
JP2001522589A (ja) ミエリン乏突起膠細胞糖タンパク質ファミリーの新規タンパク質メンバーである、bmogおよびその免疫調節目的のための使用
CN102443056A (zh) 表皮生长因子受体的外显子缺失变异体
US20020127594A1 (en) Don-1 gene and polypeptides and uses therefor
MXPA06011508A (es) Farmaco antiobesidad.
Wu Tumorigenesis of A431 human epidermoid carcinoma cell

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 10390566

Country of ref document: US

Ref document number: 2002527250

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2422814

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2001973111

Country of ref document: EP

Ref document number: 525380

Country of ref document: NZ

Ref document number: 2001292724

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 2001973111

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 2001292724

Country of ref document: AU