WO2002020589A1 - Nouveau polypeptide, proteine humaine associee aux tumeurs de la retine 19.91, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine associee aux tumeurs de la retine 19.91, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002020589A1 WO2002020589A1 PCT/CN2001/001129 CN0101129W WO0220589A1 WO 2002020589 A1 WO2002020589 A1 WO 2002020589A1 CN 0101129 W CN0101129 W CN 0101129W WO 0220589 A1 WO0220589 A1 WO 0220589A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- binding protein
- human
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide—a human retinal tumor binding protein 19.91, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique
- Retinoma (RB) protein plays an important role in the proliferation and differentiation of normal cells. Cell division requires cells to go through multiple stages in the cell cycle. RB is thought to inhibit cell division by maintaining cells at the G1 and G O phases of the cell cycle [We intraub SJ et al. Nature 1995; 375: 812-5].
- RB can control cell growth. For some tissues that have stopped growing due to the role of RB, this feature can be used to stimulate their growth. For example: Myocardial tissue lost function due to cell death can be repaired by the proliferation of living cells. Therefore, blocking the cellular control function of RB can help induce tissue repair in the case of death of myocardium or nerve cells [Wiman KG. FASEB J 1993; 7: 841-5] 0
- RB is a tumor suppressor gene that has been widely studied.
- This inactivation can be caused by a mutation, or it can be caused by a combination of a viral proto-oncoprotein (a product of a pro-oncovirus).
- This inactivation occurs in a specific region of the RB protein, which is important for growth control and is called the "RB pocket region".
- Many factors, including the toxic proto-oncoprotein can be combined with the RB pocket region to control the function of the RB protein.
- the discovery of protein-binding factors that bind to RB can help find new ways to control RB-mediated cell proliferation and differentiation under conditions of disease, including, but not limited to, loss of heart and nerve function or the occurrence of malignant tumors. Therefore, it is necessary to find new protein factors that bind and regulate RB.
- the present invention provides a new RB-binding protein that meets this requirement.
- the human retinal tumor binding protein 19.91 protein regulates cell division and embryo development Plays an important role in important functions of the body, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more human retinoma-binding protein 19.91 proteins involved in these processes, especially identifying this protein Amino acid sequence.
- Isolation of the new human retinal tumor binding protein 19.91 protein encoding gene also provides a basis for the study to determine the role of this protein in health and disease states. This protein may form the basis for the development of a diagnostic and / or therapeutic agent for the disease, and it is therefore important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human retinoma binding protein 19.91.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human retinoma binding protein 19.91.
- Another object of the present invention is to provide a method for producing human retinoma binding protein 19.91.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human retinoma binding protein 19.91.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed against the polypeptide of the present invention-human retinal tumor binding protein 19.91.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human retinoma binding protein 19.91.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; a package
- the method of preparing the polypeptide of the present invention includes culturing the host cell and recovering the expressed product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a screened simulation, activation, antagonism or inhibition of human retinoma binding protein
- a method of a 91-protein-active compound comprising utilizing a polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human retinal binding protein 19.91 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease, or other diseases caused by abnormal expression of human retinal tumor binding protein 19.91.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similar The term “immunologically active” refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human retinal tumor binding protein 19.91, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human retinal tumor binding protein 19.91.
- Antagonist refers to a molecule that can block or modulate the biological or immunological activity of human retinoblastoma binding protein 19.91 when combined with human retinoblastoma binding protein 19.91.
- Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to the human omental tumor binding protein 19.91.
- Regular refers to a change in the function of human retinoma binding protein 19.91, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of human retinoma binding protein 19.91. Change of nature.
- substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can use standard protein purification techniques to purify human retinoma binding protein 19.91.
- the substantially pure human retinoma binding protein 19.91 can produce a single main band on a non-reducing polyacrylamide gel.
- the purity of the human retinoma binding protein 19.91 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the MEGA GN program can compare two or more sequences according to different methods such as the Cluster method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0
- the Clus ter method checks each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues matching between sequence A and sequence B
- the number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B can also be determined by the Cluster method or by methods known in the art such as Jotun Hein. (Hein J (1990) Methods in emzumology 183: 625-645) 0 "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or MA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the epitope of human retinoma binding protein 19.91.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human retinoma binding protein 19.91 refers to human retinoma binding protein 19.91 which is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. 91.
- Those skilled in the art can purify human retinoma binding protein 19.91 using standard protein purification techniques.
- Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
- the purity of the human retinoma binding protein 19.91 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human retinal tumor binding protein 19.91, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
- polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
- the polypeptides of the invention may also include or exclude the initial methionine residue.
- the invention also includes fragments, derivatives and analogs of the human retinoma binding protein 19.91.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human retinoma binding protein 19.91 of the present invention.
- the fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1,026 bases in length, and its open reading frames 213-758 encode 181 amino acids.
- this polypeptide has a similar expression profile with human retinoblastoma binding protein, and it can be inferred that the human retinoblastoma binding protein 19.91 has similar functions to human retinoblastoma binding protein.
- the polynucleotide of the present invention may be in the form of DNA or RM.
- DNA forms include cDNA, genomic DNA, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human retinoblastoma binding protein 19.91.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human retinoma binding protein 19.91 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic MA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.
- genomic MA is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mMA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage CDM library. There are many mature techniques for extracting mRNA. Kits are also available from commercial Way to get (Qiagene). It is also a common method to construct cMA libraries (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DM or DM-RM hybridization; (2) the appearance or loss of marker gene function; (3) measuring the level of transcript of human retinoma binding protein 19.91; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probes used here are usually MA sequences chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- 91 gene expression protein product can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human retinoma binding protein 19.91 coding sequence, and generating the present invention through a sacral group technique Polypeptide method.
- a polynucleotide sequence encoding a human retinal tumor binding protein 19.91 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: expression in bacteria T7 promoter-based expression vector (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vector (Lee and Nathans, J Bio Chem.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
- promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, tumorigenic enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human retinal tumor binding protein 19.91 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl 2 method. It is well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human retinoblastoma binding protein 19. 91 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Fig. 1 is a comparison chart of gene chip expression profiles of the human retinal tumor binding protein 19.91 and human retinal tumor binding protein according to the present invention.
- the upper graph is a graph of the expression profile of human retinoma-binding protein 19.91
- the lower graph is the graph of the expression profile of human retinoma-binding protein.
- 1-bladder mucosa 2-PMA + Ecv304 cell line, 3-LPS + Ecv304 cell line thymus, 4-normal fibroblasts 1024NC, 5-Fibroblas t, growth factor stimulation, 1024NT, 6-scarf to fc growth factor Stimulation, 1013HT, 7-scar into fc without stimulation with growth factor, 1013HC, 8-bladder cancer cell EJ, 9-bladder cancer, 10-bladder cancer, 11-liver cancer, 12-liver cancer cell line, 13-fetus Skin, 14-spleen, 15-prostate cancer, 16-jejunum adenocarcinoma, 17 cardia cancer.
- FIG. 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of an isolated human retinoma-binding protein 19.91. 19. 91 kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention
- Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRM was formed by reverse transcription to form cDNA.
- the Smart cDNA Cloning Kit (purchased from Clontech) was used to insert the cDM fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ .
- the bacteria formed a cDM library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0967a08 was new DNA.
- the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Pr imer 1 5'- CAAAGAGTTGGAAACAACCTAAAT -3 '(SEQ ID NO: 3)
- Pr imer2 5'- GGTTCCAACTGTTTTATACTGAAA-3 '(SEQ ID NO: 4)
- Pr imerl is a forward sequence starting at the lbp end of SBQ ID NO: 1;
- Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l of ol / L KC1, 10 ⁇ l / L of Ti 'i s-CI, (pH 8.5.5), 1.5 mmol / L MgCl 2 , 200 ⁇ in a reaction volume of 50 ⁇ 1 mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72. C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-lO bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human retinoblastoma binding protein 19.91 gene expression: Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction.
- the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH 4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge.
- the aqueous phase was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain a RM precipitate.
- the resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-IfflM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
- the DM probe used was the 19.91 coding region sequence (213bp to 758bp) of the human retinoblastoma binding protein PCR amplified shown in FIG. 1.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC- 5 x Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DM. After hybridization, the filter was washed in lxSSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human retinoma binding protein 19.91
- Primer 3 5, — CCCCATATGATGATGCATGCAAATGTTAACAGT- 3, (Seq ID No: 5)
- Primer4 5 '-CATGGATCCTCAGCTGAAGGGCTTCACCAGCTT-3' (Seq ID No: 6)
- the 5 'ends of these two primers contain Mel and BamHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the Ndel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site.
- the PCR reaction was performed using the pBS-0967a08 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0967a08 plasmid, primer Primer-3 Primer-4; ⁇ 3 ⁇ 4! ⁇ 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
- Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured in LB plates containing kanamycin (final concentration 30 ⁇ ⁇ / ⁇ 1) overnight, positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0967a08) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration 30 g / ml) of LB liquid medium, host strain BL21 (P ET-0967a08) at 37. C.
- Polypeptide synthesizer (product of PE company) was used to synthesize the following human retinal tumor binding protein 19. 91 specific peptide:
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to human retinoma binding protein 19.91.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; A needle is an oligonucleotide fragment that is partially identical or complementary to the polynucleotide SEQ ID NO: 1 of the present invention.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (bond):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cMAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- the mRNA was extracted from the human mixed tissue and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5 -Amino- propargy 2'-deoxyuridine 5 '-tr iphate cou led to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech Company, labeled mRM of specific tissues (or stimulated cell lines) of the body, and prepared probes after purification .
- Cy3dUTP 5-Amino-propargyl-2'-deoxyur idine 5'-
- the probes from the above two tissues and the chips were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleCheni) hybridization solution for 16 hours, and the washing solution (1 ⁇ SSC, 0.2% SDS) was used at room temperature. After washing, scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar-like fc growth factor stimulation 1013HT, scar into fc without stimulation with growth factors, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunum adenocarcinoma, cardia cancer. Draw a graph based on these 17 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of the human retinal tumor binding protein 19.91 and the human retinal tumor binding protein according to the present invention are very similar. Industrial applicability
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Retinoma (RB) protein plays an important role in the proliferation and differentiation of normal cells. RB is thought to inhibit cell division by maintaining cells in the G1 and GO phases of the cell cycle. For some tissues that have stopped growing due to the action of RB, this feature can be used to stimulate their growth. For example: Blocking the cellular control of RB can help induce tissue repair in the event of cardiac or nerve cell death.
- RB-binding protein-binding factors can help find new ways to control RB-mediated cell proliferation and differentiation in disease states.
- the polypeptide of the present invention and the human retinoma RB protein are human retinoma binding proteins and contain characteristic sequences of the human retina tumor RB protein family. Both have similar biological functions. It regulates cell proliferation and differentiation in vivo, and its abnormal expression is closely related to the occurrence of growth retardation, overgrowth, division, cancer, etc., and produces related diseases.
- the abnormal expression of the human retinoma binding protein 19.91 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include but not limited to:
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, embryonic developmental disorders Symptoms: Congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
- Inflammation .. Chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- the abnormal expression of the human retinoma binding protein 19.91 of the present invention will also produce certain hereditary, blood diseases and the like.
- the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human retinoma binding protein 19.91.
- the agonist enhances human retinoma binding protein 19.91 to stimulate biological functions such as cell proliferation, while the antagonist prevents and treats disorders related to cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human retinoma binding protein 19.91 can be cultured together with labeled human retinoma binding protein 19.91 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human retinoma binding protein 19.91 include antibodies, compounds, receptor deletions, and the like that have been screened.
- Antagonist of human retinoma binding protein 19.91 can bind to and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.
- human retinal tumor binding protein 19.91 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human retinal tumor binding protein 19.91 and its receptor. Whether it is an antagonist. In the same manner as described above for screening compounds, it is possible to screen for 'receptor deletions' and analogs which act as antagonists.
- Polypeptide molecules capable of binding to human retinoma binding protein 19.91 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human retinal tumor binding protein 19.91 molecule should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against a human retinoma binding protein 19.91 epitope. These antibodies include (but are not limited to): 'Polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments and fragments produced by Fab expression libraries.
- polyclonal antibodies can be obtained by direct injection of human retinal tumor binding protein 19.91 into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
- Techniques for the preparation of monoclonal antibodies against human retinal tumor binding protein 19.91 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using known techniques (Morr i son et
- Antibodies against human retinoma binding protein 19.91 can be used in immunohistochemical techniques to detect human retinoma binding protein 19.91 in biopsy specimens.
- Monoclonal antibodies that bind to human retinoma binding protein 19.91 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body. Such as human retinoma binding protein 19. 91 High affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a sulfhydryl cross-linking agent such as SPDP, and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human retinoma binding protein 19.91 positive Cell.
- a sulfhydryl cross-linking agent such as SPDP
- the antibodies of the present invention can be used to treat or prevent diseases related to human retinoma binding protein 19.91. Sick. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human retinoblastoma binding protein 19.91.
- the present invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human retinoma binding protein 19.91.
- diagnostic tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of 19.91 human retinal tumor binding protein detected in the test can be used to explain the importance of human retinal tumor binding protein 19.91 in various diseases and for the role of human retinal tumor binding protein 19.91 disease.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding the human retinoma binding protein 19.91 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat cell proliferation, development, or metabolic abnormalities due to the non-expression or abnormal / inactive expression of human retinal tumor binding protein 19.91.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human retinoma binding protein 19.91 to inhibit endogenous human retinoma binding protein 19.91 activity.
- a mutated human retinoma binding protein 19.91 may be a shortened human retinoma binding protein 19.91 that lacks a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity.
- the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human retinal binding protein 19.91.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding human retinoblastoma binding protein 19.91 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a human retinoma binding protein 19.91 can be found in the literature
- a recombinant polynucleotide encoding human retinal tumor binding protein 19.91 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and MA
- ribozymes that inhibit the human retinoma binding protein 19.91 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific A. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target MA to perform endonucleation.
- Antisense RNA, MA, and ribozymes can be obtained by any existing RM or DM synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RNA. This DNA sequence is integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides should use phosphorothioate or peptide bonds instead of Phosphodiester bond.
- Polynucleotides encoding human retinal tumor binding protein 19.91 can be used for the diagnosis of diseases related to human retinal tumor binding protein 19.91.
- the polynucleotide encoding the human retinal tumor binding protein 19.91 can be used to detect the expression of the human retinal tumor binding protein 19.91 or the abnormal expression of the human retinal tumor binding protein 19.91 in a disease state.
- the DM sequence encoding human retinoma binding protein 19.91 can be used to hybridize biopsy specimens to determine the expression of human retinoma binding protein 19.91.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are available commercially.
- Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- a microarray or a DM chip also known as a "gene chip” for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human retinal tumor binding protein 19.91 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human retinal tumor binding protein 19.91 transcript.
- Detection of mutations in the human retinoma binding protein 19.91 gene can also be used to diagnose human retinoma binding protein 19.91-related diseases.
- the form of the human retinoma binding protein 19.91 mutation includes point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human retinoma binding protein 19.91 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DM sequences on a chromosome.
- the PCR primers (preferably 15-35b P ) are prepared based on the cDNA, and the sequence can be mapped on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization (FISH) of cDM clones and metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human retinoma binding protein 19. 91 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human retinoma binding protein 19.91 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Chemical & Material Sciences (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2002223373A AU2002223373A1 (en) | 2000-07-07 | 2001-07-02 | A novel polypeptide-the human retinoblastoma binding protein 19.91 and the polynucleotide encoding said polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00117045.7 | 2000-07-07 | ||
CN00117045A CN1333255A (zh) | 2000-07-07 | 2000-07-07 | 一种新的多肽——人视网膜瘤结合蛋白19.91和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002020589A1 true WO2002020589A1 (fr) | 2002-03-14 |
Family
ID=4586443
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/001129 WO2002020589A1 (fr) | 2000-07-07 | 2001-07-02 | Nouveau polypeptide, proteine humaine associee aux tumeurs de la retine 19.91, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1333255A (zh) |
AU (1) | AU2002223373A1 (zh) |
WO (1) | WO2002020589A1 (zh) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995017198A1 (en) * | 1993-12-20 | 1995-06-29 | Board Of Regents Of The University Of Texas System | A novel tumor suppressor gene |
-
2000
- 2000-07-07 CN CN00117045A patent/CN1333255A/zh active Pending
-
2001
- 2001-07-02 WO PCT/CN2001/001129 patent/WO2002020589A1/zh active Application Filing
- 2001-07-02 AU AU2002223373A patent/AU2002223373A1/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1995017198A1 (en) * | 1993-12-20 | 1995-06-29 | Board Of Regents Of The University Of Texas System | A novel tumor suppressor gene |
Also Published As
Publication number | Publication date |
---|---|
CN1333255A (zh) | 2002-01-30 |
AU2002223373A1 (en) | 2002-03-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2002014510A1 (fr) | Nouveau polypeptide, proteine cbp20 humaine 47.74, et polynucleotide codant ce polypeptide | |
WO2001092319A1 (en) | A NOVEL POLYPEPTIDE-HOMO TNF α RECEPTOR 19.68 AND POLYNUCLEOTIDE ENCODING SAID POLYPEPTIDE | |
WO2002020589A1 (fr) | Nouveau polypeptide, proteine humaine associee aux tumeurs de la retine 19.91, et polynucleotide codant ce polypeptide | |
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001090352A1 (fr) | Nouveau polypeptide, proteine 110.12 de liaison avec le centrosome nek-2, et polynucleotide codant ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2001092515A1 (fr) | Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001070965A1 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide | |
WO2002012297A1 (fr) | Nouveau polypeptide, proteine humaine 9 de liaison a la tropomoduline, et polynucleotide codant ce polypeptide | |
WO2001075101A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide | |
WO2001079423A2 (en) | A novel polypeptide, human bcr protein 10 and the polynucleotide encoding said polypeptide | |
WO2001092329A1 (fr) | Nouveau polypeptide, sous-unite $g(a) d'atp-synthetase 9.9, et polynucleotide codant ce polypeptide | |
WO2002006471A1 (fr) | Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide | |
WO2001092315A1 (en) | A novel polypeptide, a human splicing protein 10.56 and the polynucleotide encoding the polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2001094407A1 (fr) | Nouveau polypeptide, enzyme de conjugaison de l'ubiquitine humaine 10.01, et polynucleotide codant ce polypeptide | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide | |
WO2001094536A2 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 10.89, et polynucleotide codant ce polypeptide | |
WO2001092327A1 (fr) | Nouveau polypeptide, proteine 111 associee au centrosome nek-2, et polynucleotide codant ce polypeptide | |
WO2001070791A1 (fr) | Nouveau polypeptide, facteur humain lie a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2002020595A1 (fr) | Nouveau polypeptide, proteine a doigt de zinc humaine 18.04, et polynucleotide codant ce polypeptide | |
WO2002020580A1 (fr) | Nouveau polypeptide, proteine humaine 15 tnfr/ngfr contenant un domaine de cytochrome c, et polynucleotide codant ce polypeptide | |
WO2002000832A2 (en) | A novel polypeptide--a p80-coilin protein 8.8 and the polynucleotide encoding this novel polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |