WO2001088147A1 - Polypeptide de tyrosine kinase 14 humaine et polynucleotide le codant - Google Patents
Polypeptide de tyrosine kinase 14 humaine et polynucleotide le codant Download PDFInfo
- Publication number
- WO2001088147A1 WO2001088147A1 PCT/CN2001/000715 CN0100715W WO0188147A1 WO 2001088147 A1 WO2001088147 A1 WO 2001088147A1 CN 0100715 W CN0100715 W CN 0100715W WO 0188147 A1 WO0188147 A1 WO 0188147A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- tyrosine kinase
- sequence
- seq
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, tyrosine kinase 14, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- oncogenes encoding tyrosine kinases are homologous to growth factor receptors: epidermal growth factor and erbB oncogenes [Ul lr ich, A., L. Cous sens, JS Hayflick, TJ Dul l, A. Gray, AW Tarn et a l., 1984. Nature (Lodon) 309: 418-425], fms oncogenes and clone-stimulating factors [Sherr, CF, CW Ret tenmier, R. Sacca, MF Rous sel et a l. , 1985. Cel Hl: 665-676] 0 Other growth factor receptors have no homologous oncogenes, but share the same highly conserved tyrosine kinase domain.
- the FER protein includes a domain with protein kinase characteristics, while other protein sequence characteristics clearly indicate that it is a protein kinase and most likely a phosphorylation target site for tyrosine residues.
- the invention is named tyrosine kinase 14.
- the tyrosine kinase 14 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
- Tyrosine kinase 14 protein especially the amino acid sequence of this protein is identified.
- the isolation of the novel tyrosine kinase 14 protein encoding gene also provides the basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a tyrosine kinase 14.
- Another object of the present invention is to provide a method for producing tyrosine kinase 14.
- Another object of the present invention is to provide antibodies against the polypeptide of the present invention, tyrosine kinase 14.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, tyrosine kinase 14.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of tyrosine kinase 14. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- the sequence of the polynucleotide is one selected from the group consisting of: (a) having SEQ ID NO: 1 A sequence of positions 638-1012; and (b) a sequence of positions 1-2723 in SEQ ID NO: 1.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of a tyrosine kinase 14 protein, which comprises utilizing a polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a tyrosine kinase 14 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
- the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of malignant tumors, hematological diseases, developmental disorders, HIV infections, immune diseases and various types of inflammation or other abnormalities due to tyrosine kinase 14 expression Use of drugs that cause disease.
- FIG. 1 is a comparison diagram of gene chip expression profiles of tyrosine kinase 14 and tyrosine kinase of the present invention.
- the upper graph is a histogram of the expression profile of tyrosine kinase 14.
- the lower graph is the histogram of the expression profile of tyrosine kinase.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA-
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 Indicates prostate
- 21 indicates fetal heart
- 22 indicates heart
- 23 indicates muscle
- 24 indicates testis
- 25 indicates fetal thymus
- 26 indicates thymus.
- FIG. 2 is a polyacrylamide gel electrophoresis chart (SDS-PAGE) of the isolated tyrosine kinase 14.
- FIG. 14KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with tyrosine kinase 14, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind tyrosine kinase 14.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of tyrosine kinase 14 when combined with tyrosine kinase 14.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind tyrosine kinase 14.
- tyrosine kinase 14 refers to a change in the function of tyrosine kinase 14, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of tyrosine kinase 14.
- Substantially pure 1 'means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify tyrosine kinase 14 using standard protein purification techniques. Essentially pure Tyrosine kinase 14 produces a single main band on a non-reducing polyacrylamide gel. The purity of the tyrosine kinase 14 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0 The Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification can be Replace a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of tyrosine kinase 14.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated tyrosine kinase 14 means that tyrosine kinase 14 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify tyrosine kinase 14 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of the tyrosine kinase 14 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, tyrosine kinase 14, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of tyrosine kinase 14.
- fragment refers to the tyrosine ugly enzyme, enzyme, which substantially maintains the present invention! 14 Peptides of the same biological function or activity.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such a type in which one or more of the amino acid residues Each group is substituted by another group to include a substituent; or (III) one in which the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such A type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a proteinogen sequence).
- an additional amino acid sequence is fused into a mature polypeptide (such as a leader sequence or a secreted sequence or a sequence used to pur
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2723 bases, and its open reading frame 638-1012 encodes 124 amino acids.
- this polypeptide has a similar expression profile with tyrosine kinase, and it can be inferred that this tyrosine kinase 14 has a similar function to tyrosine kinase.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Cross When adding denaturants, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc .; or (3) only the same between the two sequences Crosses occur only when the sex is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding tyrosine kinase 14.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the tyrosine kinase 14 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of tyrosine kinase 14 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the gene or fragment of the present invention may of course Used as a probe.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the tyrosine kinase 14 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DM / RM fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a tyrosine kinase 14 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .
- a polynucleotide sequence encoding a tyrosine kinase 14 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing DM sequences encoding tyrosine kinase 14 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spin Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a tyrosine kinase 14 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the Ca (H 2) method.
- the steps used are well known in the art.
- MgCl 2 can be used.
- transformation can also be performed by electroporation.
- the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant tyrosine kinase 14 by conventional recombinant DNA technology (Sc ience, 1984; 224: 1431). Generally there are the following steps: '
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When host cells grow to proper After inducing the cell density, the appropriate promoter (such as temperature conversion or chemical induction) is used to induce the selected promoter, and the cells are cultured for a period of time.
- the appropriate promoter such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- Tyrosine kinases in cell signaling pathways are very important for regulating cell signal molecule transmission and cascade reactions.
- oncogenes encoding tyrosine kinases are homologous to growth factor receptors: epidermal growth factor and erbB oncogenes, fms oncogenes and clone-stimulating factors.
- Other growth factor receptors do not have homologous oncogenes, but share the same highly conserved tyrosine kinase domain.
- the FER gene (fps / fes-related) is a new gene encoding tyrosine kinase, which is very similar to the fps / fes protein and is involved in the regulation of oncogenes.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of the human FER gene protein, and both have similar biological functions.
- the polypeptide of the present invention mainly regulates the expression of certain oncogenes and oncogenes and their downstream responses in the body. It is important for the normal development and tissue differentiation of the body, and its abnormal expression involves the occurrence of tumor cells, embryo developmental disorders, and growth. Developmental disorders, inflammation, immune regulation disorders and other pathological processes, and produce related diseases.
- the abnormal expression of the tyrosine kinase 14 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth disorders, inflammation, and immune diseases. These diseases include, but are not limited to:
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
- Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the tyrosine kinase 14 of the present invention will also cause certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) tyrosine kinase 14.
- Agonists increase tyrosine kinase 14 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing tyrosine kinase 14 can be cultured with labeled tyrosine kinase 14 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of tyrosine kinase 14 include antibodies, compounds, receptor deletions, and analogs that have been screened. Antagonists of tyrosine kinase 14 can bind to tyrosine kinase 14 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- tyrosine kinase 14 When screening compounds as antagonists, tyrosine kinase 14 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between tyrosine kinase 14 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to tyrosine kinase 14 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, tyrosine kinase 14 molecules should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against a tyrosine kinase 14 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and Fab expression libraries. Paragraph.
- Polyclonal antibodies can be produced by tyrosine kinase 14 directly injected into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to tyrosine kinase 14 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV -Hybridoma technology, etc.
- Chimeric antibodies that combine human constant regions with non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851) and existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against tyrosine kinase 14.
- Anti-tyrosine kinase 14 antibodies can be used in immunohistochemistry to detect tyrosine kinase 14 in biopsy specimens.
- Monoclonal antibodies that bind to tyrosine kinase 14 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- tyrosine kinase 14 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill tyrosine kinase 14 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to tyrosine kinase 14. Administration of appropriate doses of antibodies can stimulate or block the production or activity of tyrosine kinase 14.
- the invention also relates to a diagnostic test method for quantitative and localized detection of tyrosine kinase 14 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of tyrosine kinase 14 detected in the test can be used to explain the importance of tyrosine kinase 14 in various diseases and to diagnose diseases in which tyrosine kinase 14 functions.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding tyrosine kinase 14 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of tyrosine kinase 14.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant tyrosine kinase 14 to inhibit endogenous tyrosine kinase 14 activity.
- a variant tyrosine kinase 14 may be a shortened tyrosine kinase 14 lacking a signaling domain, although it may be related to downstream Substrate binding, but lacks signaling activity.
- the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of tyrosine kinase 14.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a tyrosine kinase 14 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a tyrosine kinase 14 can be found in existing literature (Sambrook, et al.).
- the polynucleotide encoding the tyrosine kinase 14 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RM and DM
- ribozymes that inhibit tyrosine kinase 14 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RM, DM, and ribozymes can be obtained by any existing RNA or DM synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of the DM sequence encoding the RM. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- a polynucleotide encoding tyrosine kinase 14 can be used for the diagnosis of diseases related to tyrosine kinase 14.
- a polynucleotide encoding tyrosine kinase 14 can be used to detect the expression of tyrosine kinase 14 or the abnormal expression of tyrosine kinase 14 in a disease state.
- the DM sequence encoding tyrosine kinase 14 can be used to hybridize biopsy specimens to determine the expression of tyrosine kinase 14.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
- a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in a tissue.
- RNA-polymerase chain reaction (RT-PCR) in vitro amplification with tyrosine kinase 14 specific primers can also detect tyrosine kinase 14 transcripts.
- Detection of mutations in the tyrosine kinase 14 gene can also be used to diagnose tyrosine kinase 14-related diseases.
- Forms of tyrosine kinase 14 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type tyrosine kinase 14 DM sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated. The sequences of the invention are also valuable for chromosome identification.
- This sequence will specifically target a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for labeling chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cMA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Tyrosine kinase 14 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and dose range of tyrosine kinase 14 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Using Quik mRNA I solat ion Ki t ( Qiegene Products) isolating poly (A) mRNA 0 2ug poly (A) mRM by reverse transcription from total RNA form cDNA. Smart cDNA cloning kit (purchased from Clontech 1) was used to insert the cDNA fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 oc to form a cDNA library.
- Dye terminate cycle react ion sequencing ki t Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elraer
- the determined CDM sequences were compared with the existing public DM sequence database (Genebank). By comparison, it was found that the CDM sequence of one of the clones 0474h07 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
- CDM was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification of Qiagene's kit, PCR amplification was performed with the following primers:
- Primerl 5,-CTAGGAAGGTGAGAAGTATTTGGT -3, (SEQ ID NO: 3)
- Primer 2 5'- GATGGAGTCTTGCTCTGTCACCCA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3, terminal reverse sequence of SBQ ID NO: 1.
- Amplification conditions 50 mmol / L KCl, 10 mmol / L Tri s-HCl pH 8.5, 1.5 mraol / L MgCl 2 , 200 mol / L dNTP, lOpraol primer, 1U Taq DNA in 50 ⁇ 1 reaction volume Polymerase (Clontech).
- the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 2723 bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of tyrosine kinase 14 gene expression
- RNA extraction in one step involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- the 32P- labeled probes (about 2 xl 0 6 cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide -25mM KH 2 P0 4 (pH7. 4) -5 ⁇ SSC -5 x Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant tyrosine kinase 14
- Primer3 5'- CCCCATATGATGGAAACTAGCCACATGGTGGCC -3 '(Seq ID No: 5)
- Priraer4 5'- CATGGATCCTTAGTAGTGTTGCTGTTTCCAGAA -3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Mel and BamHI digestion sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively.
- the Ndel and BamHI digestion sites correspond to the expression vector plasmid pET-28b ( +) (Novagen, Cat. No. 69865. 3) selective endonuclease site.
- the PCR reaction was performed using pBS-0474h07 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-0474h07 plasmid was contained in a total volume of 50 ⁇ 1, and primers Primer-3 and Primer-4 were lOpmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
- the amplified product and plasmid pET-28 (+) were double-digested with Mel and BamHI, respectively, and large fragments were recovered and ligated with T4 ligase.
- Ligation products were transformed by the calcium chloride method Escherichia bacteria DH5 a, the (final concentration of 30 ⁇ 8 / ⁇ 1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced. A positive clone (PET-0474h07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- NH2-Met-Glu-Thr-Ser-His-Met-Val-Ala-I le-Arg-Gln-Lys-Arg-Asn-Pro-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 1 ⁇ 2g of the hemocyanin multiple-deficient complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically binds to tyrosine kinase 14.
- Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
- oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes. Uses: if the probe can be used to hybridize to the genomic or cDNA library of normal tissue or pathological tissue from different sources to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, it can further be used The probe detects whether the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof is abnormally expressed in cells of normal tissue or pathological tissue.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous to the gene fragment of SEQ ID NO: 1 Or complementary (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (OxDenhardt's; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution OxDenhardt's; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DM)
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data Analysis in order to achieve the purpose of fast, efficient and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After the purified amplified product was purified, the concentration was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed by Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain Fetal lung and fetal heart.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU72298/01A AU7229801A (en) | 2000-05-09 | 2001-05-08 | A novel polypeptide, a human tyrosine kinase 14 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115618 CN1322829A (zh) | 2000-05-09 | 2000-05-09 | 一种新的多肽——人酪氨酸激酶14和编码这种多肽的多核苷酸 |
CN00115618.7 | 2000-05-09 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001088147A1 true WO2001088147A1 (fr) | 2001-11-22 |
Family
ID=4585064
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000715 WO2001088147A1 (fr) | 2000-05-09 | 2001-05-08 | Polypeptide de tyrosine kinase 14 humaine et polynucleotide le codant |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1322829A (zh) |
AU (1) | AU7229801A (zh) |
WO (1) | WO2001088147A1 (zh) |
-
2000
- 2000-05-09 CN CN 00115618 patent/CN1322829A/zh active Pending
-
2001
- 2001-05-08 AU AU72298/01A patent/AU7229801A/en not_active Abandoned
- 2001-05-08 WO PCT/CN2001/000715 patent/WO2001088147A1/zh active Application Filing
Non-Patent Citations (4)
Title |
---|
DATABASE GENBANK [online] 1 August 1998 (1998-08-01), Database accession no. AC005363 * |
DATABASE GENBANK [online] 1 December 1999 (1999-12-01), Database accession no. AC009509 * |
DATABASE GENBANK [online] 21 December 1999 (1999-12-21), Database accession no. AC005231 * |
DATABASE GENBANK [online] 7 January 1999 (1999-01-07), Database accession no. AC006271 * |
Also Published As
Publication number | Publication date |
---|---|
CN1322829A (zh) | 2001-11-21 |
AU7229801A (en) | 2001-11-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001074879A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001096560A1 (fr) | Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide | |
WO2001088147A1 (fr) | Polypeptide de tyrosine kinase 14 humaine et polynucleotide le codant | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2001047975A1 (en) | A novel polypeptide-protein 10 containing chromo domain and the polynucleotide encoding said polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001087972A1 (fr) | Nouveau polypeptide, proteine dpc4 humaine 9 du facteur d'inhibition de la croissance tumorale, et polynucleotide codant ce polypeptide | |
WO2002026791A1 (fr) | Nouveau polypeptide, serine kinase 212.98 specifique d'une proteine sr, et polynucleotide codant ce polypeptide | |
WO2001066578A1 (fr) | Nouveau polypeptide, adn polymerase 10, et polynucleotide codant pour ce polypeptide | |
WO2001075101A1 (fr) | Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide | |
WO2001046244A1 (fr) | Nouveau polypeptide, adn polymerase 17, et polynucleotide codant pour ce polypeptide | |
WO2001049727A1 (fr) | Nouveau polypeptide, transducteur de signal 9 a effet chemotactique de bacteries, et polynucleotide codant pour ce polypeptide | |
WO2001094402A1 (fr) | Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001048160A1 (fr) | Nouveau polypeptide, proteine tyrosine phosphatase 12, et polynucleotide codant pour ce polypeptide | |
WO2001083683A2 (fr) | Nouveau polypeptide, proteine pax humaine 11.3, et polynucleotide codant pour ce polypeptide | |
WO2002000698A1 (fr) | Nouveau polypeptide, proteine humaine 12 de transport de l'acide phosphorique, et polynucleotide codant ce polypeptide | |
WO2001068692A1 (fr) | Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide | |
WO2001070784A1 (fr) | Nouveau polypeptide, proteine humaine 17 contenant un domaine de structure chromo, et polynucleotide codant pour ce polypeptide | |
WO2001083544A1 (fr) | Nouveau polypeptide, proteine pax humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001083542A1 (en) | A novel polypeptide, human p18 protein 21 and the polynucleotide encoding said polypeptide | |
WO2001075027A2 (fr) | Nouveau polypeptide, helicase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001094595A1 (fr) | Nouveau polypeptide, proteine humaine 15 de liaison a un octamere, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |