WO2002026791A1 - Nouveau polypeptide, serine kinase 212.98 specifique d'une proteine sr, et polynucleotide codant ce polypeptide - Google Patents

Nouveau polypeptide, serine kinase 212.98 specifique d'une proteine sr, et polynucleotide codant ce polypeptide Download PDF

Info

Publication number
WO2002026791A1
WO2002026791A1 PCT/CN2001/001069 CN0101069W WO0226791A1 WO 2002026791 A1 WO2002026791 A1 WO 2002026791A1 CN 0101069 W CN0101069 W CN 0101069W WO 0226791 A1 WO0226791 A1 WO 0226791A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
polynucleotide
serine kinase
specific serine
Prior art date
Application number
PCT/CN2001/001069
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Shanghai Biowindow Gene Development Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Biowindow Gene Development Inc. filed Critical Shanghai Biowindow Gene Development Inc.
Priority to AU2002214911A priority Critical patent/AU2002214911A1/en
Publication of WO2002026791A1 publication Critical patent/WO2002026791A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424—Serine endopeptidases (3.4.21)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide SR protein-specific serine kinase 212.98, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
  • Mammalian cell precursor mRNA splicing occurs in a multi-component splicing complex that includes two types of splicing factors: Ul, U2, U5 and U4 / 6 small nuclear ribonucleoproteins (snRNPs) and non-snRNP splicing factors [Kramer, A. 1996. Annu. Rev. Biochem. 65: 367-409].
  • snRNPs small nuclear ribonucleoproteins
  • non-snRNP splicing factors [Kramer, A. 1996. Annu. Rev. Biochem. 65: 367-409].
  • a series of reactions that occur between the precursor mRNA and snRNPs are critical to the selection of splice sites, and more importantly, select a catalytic core for splicing reactions that occur in the splicing complex.
  • snRNP factors are regulated by non-snRNP factors, of which the best understood snRNP factor is the arginine / serine-rich (RS) domain containing the splicing factor [Fu, XD., 1995. RNA.1: 663 -680].
  • RS protein family are characterized by two RNA recognition domains at the N-terminus, an RS domain at the C-terminus, and an RS domain at other peptides.
  • the RNA recognition domain is responsible for recognizing and binding to RNA, while the RS domain may act as a protein-protein response model involved in regulating a collection of splicing complexes.
  • SPPK1 RS protein-specific serine kinase 1
  • Clk / Sty can phosphorylate the SR splicing factor family.
  • SPPK1 is a highly specific kinase of the RS domain that contains splicing factors because it recognizes only arginine, not lysine, and only phosphorylates serine, not threonine.
  • Clk / Sty is a kinase that was later discovered that also responds to the RS domain containing splicing factors and can efficiently catalyze the phosphorylation of splicing factors in vivo.
  • the kinase domains of SPPK1 and Clk / StY are 32% identical, and both contain a signature amino acid sequence LA that allows the ER domain [Colwill,., T. Pawson. B. Andrews, J. Prasd, JL et al., 1996. EMBO J. 15: 265-275].
  • SPPK1 and SPPK2 are very similar in terms of amino acid sequence, enzyme activity, and substrate specificity.
  • the expression of these two proteins in different human tissues is very different, and each kinase has its own unique characteristic sequence, which is related to their different specific functions in vivo. Therefore, mammalian cells may have many different kinases involved in regulating RNA splicing. These RS protein kinases It may itself be a regulated target protein.
  • SPPK2 kinase has several interesting structural features, one of which is a proline-rich domain at the N-terminus, which includes several binding sites common to the SH3 domain.
  • the proline-rich domain can also be used as a target protein for loop domain-containing proteins [Macias, MJ, M. Hyvonen, E. Baraldi, J. et al. 1996. Nature.382: 646-649], WW Domains have been found in more and more structural, regulatory, and signaling molecules.
  • the SR protein-specific serine kinase 212.98 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these
  • the SR protein-specific serine kinase 212.98 protein of the process identifies the amino acid sequence of this protein.
  • the isolation of the new SR protein-specific serine kinase 212.98 protein-coding gene also provides the basis for research to determine the role of the protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding for DM.
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a SR protein-specific serine kinase 212.98.
  • Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a SR protein-specific serine kinase 212.98.
  • Another object of the present invention is to provide a method for producing SR protein-specific serine kinase 212.98.
  • Another object of the present invention is to provide a polypeptide specific to the present invention ⁇ SR protein-specific serine stimulation Antibody to enzyme 212. 98.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the SR protein-specific serine kinase 212. 98 of the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to the abnormality of SR protein-specific serine kinase 212.98. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 316-672 in SEQ ID NO: 1; and (b) a sequence having 1-2410 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of SR protein-specific serine kinase 212.
  • 98 protein which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of SR protein-specific serine kinase 212.98 protein, comprising detecting mutations in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of cancer, developmental disease or immune disease or other diseases caused by abnormal expression of SR protein-specific serine kinase 212.98.
  • Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.
  • FIG. 1 is a comparison diagram of gene chip expression profiles of SR protein-specific serine kinase 212. 98 and SR protein-specific serine kinase 2 of the present invention.
  • the top graph is a SR protein-specific serine kinase 212.
  • 98 expression profile fold graph is an SR protein-specific serine kinase 2 expression profile histogram.
  • Figure 1 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated SR protein-specific serine kinase 212.98. 1 3 kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with the SR protein-specific serine kinase 212.98, can cause the protein to change, thereby regulating the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to the SR protein-specific serine kinase 212.98.
  • Antagonist refers to a molecule that can block or regulate the biological or immunological activity of SR protein-specific serine kinase 212.998 when combined with SR protein-specific serine kinase 212.98.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the SR protein-specific serine kinase 212.98.
  • SR protein-specific serine kinase 212.98 refers to a change in the function of SR protein-specific serine kinase 212.98, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of SR protein-specific serine kinase 212.98. Or changes in immune properties.
  • Substantially pure means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated.
  • Those skilled in the art can purify SR protein-specific serine kinase 212. 98 using standard protein purification techniques. The essentially pure SR protein-specific serine kinase 212. 98 produces a single main band on non-reducing polyacrylamide gels. The purity of SR protein-specific serine kinase 212. 98 polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Perfect identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
  • the MEGALIGN program can compare two or more sequences (H i gg ins, D. G. and
  • the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in enzymology 183: 625-645) ⁇ "similarity" It refers to the degree of the same or conservative substitution of amino acid residues at corresponding positions when the amino acid sequences are aligned.
  • negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab,) 2 and Fv, which can specifically bind to the SR protein-specific serine kinase 212. 98 antigenic determinant.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated means that the substance is separated from its original environment (if it is natural Natural material, the original environment is the natural environment).
  • natural Natural material the original environment is the natural environment.
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated SR protein-specific serine kinase 212. 98 means SR protein-specific serine kinase 212. 98 is substantially free of other proteins, lipids, carbohydrates, or other substances that are naturally associated with it. Those skilled in the art can purify SR protein-specific serine kinase 212. 98 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the SR protein-specific serine kinase 212. 98 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide ⁇ SR protein-specific serine kinase 212. 98, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
  • the invention also includes fragments, derivatives, and analogs of the SR protein-specific serine kinase 212.98.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the SR protein-specific serine kinase 212.98 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2410 bases in total length and its open reading frames 316-672 encode 118 amino acids.
  • the polynucleotide of the present invention may be in the form of DNA or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the present invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add a denaturant during hybridization, such as 50% ( ⁇ / ⁇ ) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences
  • the hybridization occurs only when the identity between them is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 and Active.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides.
  • Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding SR protein-specific serine kinase 212.98.
  • the polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • polynucleotide sequence encoding the SR protein-specific serine kinase 212.98 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the D-sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mR from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene).
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of a marker gene function; (3) determination of the transcript level of the SR protein-specific serine kinase 212.98; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the SR protein-specific serine kinase 212.98 gene.
  • a method of amplifying DNA / RNA by PCR is preferably used to obtain the gene of the present invention. Especially difficult to get from the library
  • the RACE method RACE-rapid cDNA end rapid amplification method
  • the primers used for PCR can be appropriately selected according to the polynucleotide sequence information of the present invention disclosed herein, and conventional methods can be used synthesis.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the SR protein-specific serine kinase 212.98 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.
  • a polynucleotide sequence encoding the SR protein-specific serine kinase 212.98 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • an expression vector containing a DNA sequence encoding the SR protein-specific serine kinase 212.98 and appropriate transcription / translation regulatory elements can be used to construct an expression vector containing a DNA sequence encoding the SR protein-specific serine kinase 212.98 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM. Often about 10 to 300 base pairs, which act on a promoter to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding a SR protein-specific serine kinase 212.98 or a recombinant vector containing the polynucleotide can be transformed or transferred into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector cell.
  • the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: Treatment 1 2, steps well known in the art with alternative is MgC l 2
  • transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and lipid Body packaging, etc.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant SR protein-specific serine kinase 212. 98 (Sc ience, 1984; 224: 1431). Generally speaking, there are the following steps:
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art.
  • These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
  • Mammalian precursor mRNA splicing occurs in a multi-component splicing complex that includes two types of splicing factors: Ul, U2, U5, and U4 / 6 small nuclear ribonucleoproteins (snRNPs) and non-snRNP splicing factors .
  • Ul small nuclear ribonucleoproteins
  • snRNPs small nuclear ribonucleoproteins
  • the series of reactions that occur between the precursor mRNA and snRNPs are critical to the selection of the splice site, and more importantly, to select a catalytic core for the splicing reactions that occur in the splicing complex.
  • the arginine / serine-rich (RS) domain containing splicing factors is a well-known snRNP factor.
  • RNA recognition domains are responsible for recognizing and binding to RNA, while the RS domain may be involved in regulating the assembly of various splicing complexes as a protein-protein response model.
  • SPPK1 RS protein-specific serine kinase 1
  • Clk / Sty Two kinases, RS protein-specific serine kinase 1 (SPPK 1) and Clk / Sty, can phosphorylate the SR splicing factor family.
  • SPPK1 is a highly specific kinase in the RS domain that contains splicing factors because it recognizes only arginine, not lysine, and only phosphorylates serine, not threonine.
  • SPPK2 and SPPK2 are very similar in amino acid sequence in enzyme activity and substrate specificity.
  • each kinase has its own unique characteristic sequence, which is related to their different specific functions in the body. Therefore, mammalian cells may have many different kinases involved in the regulation of RNA splicing, and these RS protein kinases may themselves be regulated target proteins.
  • SPPK2 kinase contains binding sites common to several SH 3 domains and can also be used as a target protein for WW domain-containing proteins.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human SR protein-specific serine kinase 1, and both have similar biological functions.
  • the polypeptide of the present invention can phosphorylate the SR splicing factor family in vivo, and the SR splicing factor participates in precursor mRNA splicing as a multi-component splicing complex component. It can be seen that the abnormal expression of the polypeptide of the present invention will cause the splicing error of the precursor mRNA, thereby causing the protein translation process to occur.
  • the errors are closely related to the abnormal expression or function of some proteins, which cause pathological processes such as tumorigenesis, embryonic developmental disorders, growth and development disorders, inflammatory abnormalities, and immune response disorders, and related diseases.
  • the abnormal expression of the SR protein-specific serine kinase 212.98 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include But not limited to:
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
  • Abnormal expression of the SR protein-specific serine kinase 212. 98 of the present invention will also produce certain hereditary, hematological diseases and the like.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
  • the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) SR protein-specific serine kinase 212.98.
  • Agonists increase SR protein-specific serine kinases 212. 98 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
  • mammalian cells or a membrane preparation expressing an SR protein-specific serine kinase 212.98 can be cultured with a labeled SR protein-specific serine kinase 212.98 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of SR protein-specific serine kinase 212.98 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of SR protein-specific serine kinase 212.98 can bind to and eliminate the function of SR protein-specific serine kinase 212.98, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
  • SR protein-specific serine kinase 212. 98 can be added to the bioanalytical assay by determining the effect of the compound on the interaction between SR protein-specific serine kinase 212. 98 and its receptor. Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to the SR protein-specific serine kinase 212. 98 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the SR protein-specific serine kinase 212.98 molecule should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the invention also provides antibodies directed against the SR protein-specific serine kinase 212.98 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by direct injection of SR protein-specific serine kinase 212.98 into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
  • Techniques for preparing monoclonal antibodies of SR protein-specific serine kinase 212.98 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human B -Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morri son et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against SR protein-specific serine kinase 212.98.
  • Antibodies against SR protein-specific serine kinase 212. 98 can be used in immunohistochemical techniques to detect SR protein-specific serine kinase 212. 98 in biopsy specimens.
  • Monoclonal antibodies that bind to SR protein-specific serine kinase 212. 98 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to use a thiol crosslinker such as SPDP.
  • the antibodies of the present invention can be used to treat or prevent diseases related to the SR protein-specific serine kinase 212.98.
  • Administration of an appropriate dose of antibody can stimulate or block the production or activity of SR protein-specific serine kinase 212.98.
  • the present invention also relates to a diagnostic test method for quantitatively and locally detecting the level of SR protein-specific serine kinase 212.98.
  • These tests are well known in the art and include FISH assays and radioimmunoassays.
  • 98 The level of SR protein-specific serine kinase 212. 98 detected in the test can be used to explain the importance of SR protein-specific serine kinase 212. 98 in various diseases and to diagnose SR protein-specific serine kinase 212. 98 A working disease.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • the polynucleotide encoding the SR protein-specific serine kinase 212. 98 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of SR protein-specific serine kinase 212.98. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated SR protein-specific serine kinase 212. 98 to inhibit endogenous SR protein-specific serine kinase 212. 98 activity.
  • a variant SR protein-specific serine kinase 212.98 may be a shortened SR protein-specific serine kinase 212.98 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signal transduction. active. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of SR protein-specific serine kinase 212.98.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding SR protein-specific serine kinase 212.98 into cells.
  • a method for constructing a recombinant viral vector carrying a polynucleotide encoding a SR protein-specific serine kinase 212.98 can be found in the existing literature (Sambrook, et al.).
  • a polynucleotide encoding the SR protein-specific serine kinase 212. 98 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RNA and DNA
  • ribozymes that inhibit SR protein-specific serine kinase 212.98 mRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme that specifically breaks down specific RNA Like RNA molecules, the mechanism of action is that the ribozyme molecule specifically hybridizes to a complementary target R to perform endonucleation.
  • Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
  • Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • the polynucleotide encoding SR protein-specific serine kinase 212. 98 can be used for the diagnosis of diseases related to SR protein 0-specific serine kinase 2 12.98.
  • the polynucleotide encoding SR protein-specific serine kinase 212. 98 can be used to detect the expression of SR protein-specific serine kinase 21 2. 98 or the abnormal expression of SR protein-specific serine kinase 212. 98 in a disease state.
  • a DNA sequence encoding SR protein-specific serine kinase 212. 98 can be used to hybridize biopsy specimens to determine the expression of SR protein-specific serine kinase 2 12.
  • Hybridization techniques include Sout hern blotting, Nor t hern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
  • Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Mic Roa ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and Genetic diagnosis.
  • 98 specific primers can also be used to detect the transcription products of SR protein-specific serine kinase 212.
  • SR protein-specific serine kinase 212.98 mutations can also be used to diagnose SR protein-specific serine kinase 212.98-related diseases.
  • SR protein-specific serine kinase 212.98 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type SR protein-specific serine kinase 212.98 DNA sequence. Mutations can be detected using existing techniques such as Souter hern imprinting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, the Nort Hern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
  • PCR primers (preferably 1-35 bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only Heterozygous cells that contain human genes corresponding to the primers produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • SR protein-specific serine kinase 212. 98 to effectively treat The amount is administered and / or prevented for a specific indication.
  • the amount and dosage range of SR protein-specific serine kinase 212.98 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smar t cDNA cloning kit (purchased from CI ontech) will be used. The 0 fragment was inserted into the multicloning site of the pBSK (+) vector (Clontech) and transformed into DH5 cc. The bacteria formed a cDNA library.
  • the sequences at the 5 'and 3' ends of all clones were determined using a Dye terminate cycle reaction ionizing kit (Perkin-Elmer) and an ABI 377 automatic sequencer (Perkin-Elmer).
  • the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0186d07 was a new D.
  • the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
  • RNA of fetal brain cells was used as a template, and oligo-dT was used as a primer to perform reverse transcription reaction to synthesize cDNA, and purified using Qiagene's kit. Afterwards, the following primers were used for PCR amplification:
  • Pr imerl 5'- AGCAAGGGTCAGCCACATTCTCTC -3 '(SEQ ID NO: 3)
  • Pr iraer2 5'- CACATTTTCGTTGACTTTGGTCCC -3 '(SEQ ID NO: 4)
  • Pr iraerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l of ol / L KCl, 10 mmol / L Tris HCl in 50 ⁇ 1 reaction volume pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, 1 Opmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified with a kit from QIAGEN, and connected to a PCR vector with a TA cloning kit (Invi trogen).
  • TA cloning kit Invi trogen.
  • Human DNA sequence analysis showed that the DNA sequence of the PCR product was 1-241 shown in SEQ ID NO: 1 Obp is exactly the same.
  • Example 3 Analysis of the expression of SR protein-specific serine kinase 212. 98 gene by Nor thern blotting method Total RM was extracted in one step [Ana l. Biochem 1987, 162, 156-159] This method includes acidic thiocyanate Guanidine phenol-chloroform extraction.
  • the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • the 32P-labeled probe (approximately 2 x 10 6 cpm / ml) Hybridize the RNA-transferred nitrocellulose membrane at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH 7. 4)-5 x SSC-5 x Denhardt's solution and 20 ( ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1 ° /. SDS at 55 ° C for 30 min. Then, the Phosphor Imager was used for analysis and quantification.
  • Example 4 Recombinant SR protein In vitro expression, isolation, and purification of specific serine kinase 212.98 A pair of specific amplification primers were designed based on the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, and the sequences are as follows:
  • Pr imer3 5'-CCCCATATGATGACTGCCCCAGAACCTGGCTCC-3 '(Seq ID No: 5)
  • Pr imer4 5'-CCCGAATTCTCACCTCCCCCCAGCCTCGGCGGAGG-3' (Seq ID No: 6)
  • Ndel and EcoRI digestion sites respectively Points, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and EcoRI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • PCR was performed using the PBS-0186d07 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0186d07 plasmid, primers Primer-3 and Primer-4 were 1 Opmol, Advantage po lymerase Mi x (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • Ligation products were transformed by the calcium chloride method Escherichia bacteria DH5 a, the (final concentration of 30 ⁇ ⁇ / ⁇ 1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced. A positive clone (pET-0186d07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • a peptide synthesizer (product of PE company) was used to synthesize the following SR protein-specific serine kinase 212. 98 specific peptides:
  • the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6:43. Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex and complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex and incomplete Freund's adjuvant were used to boost immunity once.
  • a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
  • Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose.
  • the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
  • the immunoprecipitation method proved that the purified antibody could specifically bind to SR protein-specific serine kinase 212.98.
  • Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
  • the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
  • Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
  • the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • prehybridization solution 10xDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see the references DeRi si, JL, Lyer, V.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA). The distance is 280 P m. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
  • Probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) for 16 hours, washed with a washing solution (1 ⁇ SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
  • Scanner purchased from General Scanning Company, USA
  • Imagene software Biodiscovery, USA
  • the above specific tissues are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblast, growth factor stimulation, 1024NT, scar formation fc Growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer plant cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn ( Figure 1). It can be seen from the figure that the expression profile of SR protein-specific serine kinase 212.98 and SR protein-specific serine kinase 2 according to the present invention are very similar.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une sérine kinase 212.98 spécifique d'une protéine SR, et un polynucléotide codant ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de troubles du développement, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant la sérine kinase 212.98 spécifique d'une protéine SR.
PCT/CN2001/001069 2000-06-30 2001-06-29 Nouveau polypeptide, serine kinase 212.98 specifique d'une proteine sr, et polynucleotide codant ce polypeptide WO2002026791A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002214911A AU2002214911A1 (en) 2000-06-30 2001-06-29 A novel polypeptide-sr protein specificity serine kinase 212.98 and polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00116940.8 2000-06-30
CN 00116940 CN1331319A (zh) 2000-06-30 2000-06-30 一种新的多肽——sr蛋白特异性丝氨酸激酶212.98和编码这种多肽的多核苷酸

Publications (1)

Publication Number Publication Date
WO2002026791A1 true WO2002026791A1 (fr) 2002-04-04

Family

ID=4586339

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/001069 WO2002026791A1 (fr) 2000-06-30 2001-06-29 Nouveau polypeptide, serine kinase 212.98 specifique d'une proteine sr, et polynucleotide codant ce polypeptide

Country Status (3)

Country Link
CN (1) CN1331319A (fr)
AU (1) AU2002214911A1 (fr)
WO (1) WO2002026791A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8440820B2 (en) 2008-04-18 2013-05-14 Reata Pharmaceuticals, Inc. Antioxidant inflammation modulators: oleanolic acid derivatives with saturation in the C-ring

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1257538A (zh) * 1997-05-21 2000-06-21 儿童医疗中心有限公司 选择性调节丝氨酸/苏氨酸激酶活性的短肽

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1257538A (zh) * 1997-05-21 2000-06-21 儿童医疗中心有限公司 选择性调节丝氨酸/苏氨酸激酶活性的短肽

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TANG HUA ET AL.: "Dynamic changes of two seine protein kinases in subcellular fraction during the development of chemical induced hepatocarcinoma", CHINESE BIOCHEMICAL JOURNAL, vol. 10, no. 6, December 1994 (1994-12-01), pages 722 - 726 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8440820B2 (en) 2008-04-18 2013-05-14 Reata Pharmaceuticals, Inc. Antioxidant inflammation modulators: oleanolic acid derivatives with saturation in the C-ring

Also Published As

Publication number Publication date
CN1331319A (zh) 2002-01-16
AU2002214911A1 (en) 2002-04-08

Similar Documents

Publication Publication Date Title
WO2002026791A1 (fr) Nouveau polypeptide, serine kinase 212.98 specifique d'une proteine sr, et polynucleotide codant ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001066730A1 (fr) Nouveau polypeptide, proteine humaine rs3 12, et polynucleotide codant pour ce polypeptide
WO2002006471A1 (fr) Nouveau polypeptide, nucleophosmine 9.68, et polynucleotide codant ce polypeptide
WO2001075023A2 (fr) Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide
WO2001090177A1 (fr) Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide
WO2001092286A1 (fr) Nouveau polypeptide, proteine humaine 48 de liaison oct, et polynucleotide codant ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001070796A1 (fr) Nouveau polypeptide, proteine humaine a doigt de zinc 78, et polynucleotide codant pour ce polypeptide
WO2001068873A1 (fr) Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide
WO2001079432A2 (fr) Nouveau polypeptide, facteur humain de transcription de la differentiation cellulaire 58, et polynucleotide codant pour ce polypeptide
WO2001083539A1 (fr) Nouveau polypeptide, kinase mitotique ask1-26, et polynucleotide codant pour ce polypeptide
WO2001096568A1 (fr) Nouveau polypeptide, proteine humaine de liaison 51 d'une proteine precurseur de l'amyloide, et polynucleotide codant ce polypeptide
WO2002000698A1 (fr) Nouveau polypeptide, proteine humaine 12 de transport de l'acide phosphorique, et polynucleotide codant ce polypeptide
WO2001088147A1 (fr) Polypeptide de tyrosine kinase 14 humaine et polynucleotide le codant
WO2001090380A1 (fr) Nouveau polypeptide, proteine humaine 11.99 du gene transducteur-2-beta, et polynucleotide codant ce polypeptide
WO2002026971A1 (fr) Nouveau polypeptide, facteur de transcription humain lcr-f112.1, et polynucleotide codant ce polypeptide
WO2001083542A1 (fr) Nouveau polypeptide, proteine humaine p18 21, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001072802A1 (fr) Nouveau polypeptide, proteine humaine de liaison 14 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001075024A2 (fr) Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide
WO2001090181A1 (fr) Nouveau polypeptide, proteine tyrosine kinase humaine 13 de cellules b, et polynucleotide codant ce polypeptide
WO2001077165A1 (fr) Nouveau polypeptide, proteine humaine de liaison 12 d'une proteine precurseur de l'amyloide, et polynucleotide codant pour ce polypeptide
WO2001070960A1 (fr) Nouveau polypeptide, proteine humaine de reparation 13 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2002026952A1 (fr) Nouveau polypeptide, serine/threonine proteine kinase humaine 11.22, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP