WO2001083538A1 - Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001083538A1 WO2001083538A1 PCT/CN2001/000643 CN0100643W WO0183538A1 WO 2001083538 A1 WO2001083538 A1 WO 2001083538A1 CN 0100643 W CN0100643 W CN 0100643W WO 0183538 A1 WO0183538 A1 WO 0183538A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human
- protein
- oncogene protein
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/82—Translation products from oncogenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human K-ras proto-oncogene protein 36, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- Ras protein is the transcription and expression product of ras gene. It is covalently bonded to isopentenyl to anchor it on the cytoplasmic side of the plasma membrane, and then activate a series of related protein activities to conduct various in vivo Signal molecules regulate cell development and growth. Ras protein is not a protein kinase. It acts as a molecular switch in the body and binds to guanylic acid, especially to GDP and GTP to exert its biological activity. Ras activates Ras when combined with GTP, and inactivates Ras when combined with GDP.
- Raf protein is a silk / threonine protein kinase that catalyzes the phosphorylation of protein silk / threonine sites.
- Ras protein When Ras protein is activated, Raf protein located in the cytosol tends to the inner side of the plasma membrane and binds to Ras protein. Ras protein activates Raf protein activity in vivo. After activation of Raf protein, many mitochondria / threonine residue phosphorylation cascades are involved in the process of transmitting downstream signals.
- Ras-activated protein kinase The most important one is mitogen-activated protein kinase. These kinases are activated by numerous extracellular signals that induce cell proliferation and differentiation to regulate various physiological processes in the body. Recent studies have found that in some tumor cells, the point mutation of the abnormal Ras protein at residues 12 or 61 of its protein sequence will inhibit the protein and GTPase activity stimulated by GAP, that is, Ras- GTP is transformed into Ras-GDP, which causes Ras protein to remain active in the body for a long time, and continuously sends signals to downstream, which causes abnormal proliferation of cells in the body.
- Ras protein family Many different members of the Ras protein family have been cloned from different organisms.
- Kahn et al. Cloned a new member of the Ras protein family, cK-ras proto-oncogene, from humans. Mutants of this gene were expressed in a variety of human tumor cells, and they were formed in tumors. Before and after deterioration, various stages play an important regulatory role. From this, the cK- ra S original
- the protein encoded by the oncogene is closely related to the occurrence of tumors and malignant diseases in a variety of tissues and cells in vivo. Mutations or abnormal expression of this protein will cause abnormal development and differentiation of relevant tissues and cells in the organism.
- One of the main causes of tumors and cancers [Kahn S., Yamamo to F. etal., 1987, Ant i cancer Res, 7: 639-652].
- the protein encoded by the c-K-ras proto-oncogene is a new member of the Ras protein family.
- This protein acts as a molecular switch in the body to regulate the expression of related genes in the body, and then affects cell differentiation and proliferation.
- the mutation or abnormal expression of the protein will lead to abnormal function of the protein in the body, and then affect the progress of related biological processes.
- the protein is usually closely related to the occurrence of various developmental disorders, tumors of related tissues, and cancer in the body.
- the protein can also be used to diagnose and treat various related diseases mentioned above.
- the human K-ras proto-oncogene protein 36 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
- the separation of the new human K-ras proto-oncogene protein 36 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding DM.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human K-ras proto-oncogene protein 36.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human K-ras proto-oncogene protein 36.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human-ras proto-oncogene protein 36.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human K-ras proto-oncoprotein 36. Summary of invention
- the present invention relates to an isolated polypeptide.
- the polypeptide is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 74-1063 in SEQ ID NO: 1; and (b) a sequence having 1-1571 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human K-ras proto-oncogene protein 36 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human K-ras proto-oncogene protein 36 protein in vitro, which comprises detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the polypeptides and / or polynucleotides of the present invention in the preparation for the treatment of malignant tumors, blood Fluid disease, developmental disorder, HIV infection, immune disease and various kinds of inflammation or other medicines caused by abnormal expression of human K-ras proto-oncogene protein 36.
- FIG. 1 is a comparison diagram of gene chip expression profiles of K-ras proto-oncogene protein 36 and human K-ras pro-oncogene protein according to the present invention.
- the upper graph is a graph of the human K-ras proto-oncogene protein 36 expression profile
- the lower graph is the human K-ras proto-oncogene protein expression profile.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA-
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 is the prostate
- 21 is the fetal heart
- 22 is the heart
- 23 is the muscle
- 24 is the testis
- 25 is the fetal thymus
- 26 is the thymus.
- FIG. 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human K-ras proto-oncogene protein 36.
- 36KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to the genome or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human K-ras proto-oncogene protein 36, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human K-ras proto-oncogene protein 36.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human K-ras proto-oncogene protein 36 when combined with human K-ras pro-oncogene protein 36 .
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human K-ras proto-oncogene protein 36.
- Regular refers to changes in the function of human K-ras proto-oncogene protein 36, including an increase or decrease in protein activity, changes in binding characteristics, and any other biological properties and functions of human K-ras pro-oncogene protein 36 Or changes in immune properties.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human K-ras proto-oncogene protein 36 using standard protein purification techniques.
- the substantially pure human K-ras proto-oncogene protein 36 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of human K-ras proto-oncogene protein 36 polypeptide can be analyzed by amino acid sequence analysis.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding because conditions with reduced stringency require two sequences Mutual binding is specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences.
- the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.).
- the MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244).
- the Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged into clusters. Each cluster is then allocated in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RM sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (') 2 and?, Which specifically bind to the epitope of human K-ras proto-oncogene protein 36.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human K-ras proto-oncogene protein 36 means human K-ras pro-oncogene protein 36 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human K-ras proto-oncogene protein 36 using standard protein purification techniques. Essentially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human K-ras proto-oncogene protein 36 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, ⁇ -ras proto-oncogene protein 36, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of the human K-ras proto-oncogene protein 36.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human K-ras proto-oncogene protein 36 of the present invention.
- a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotides of the present invention are found from a cMA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1571 bases, and its open reading frame 74-1063 encodes 329 amino acids.
- this peptide is similar to human K-ras proto-oncogene protein Expression profile, it can be deduced that the human K-ras proto-oncogene protein 36 has a similar function to the human K-ras pro-oncogene protein.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DM forms include cDNA, genomic DM, or synthetic DM.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 »/.
- SDS, 6 (TC; or (2) hybridization with denaturant, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc .; or ( 3) Hybridization occurs only when the identity between the two sequences is at least 95%, more preferably 97%, and the polypeptide encoded by the hybridizable polynucleotide is mature as shown in SEQ ID NO: 2 Polypeptides have the same biological function and activity.
- denaturant such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc .
- Hybridization occurs only when the identity between the two sequences is at least 95%, more preferably 97%, and the polypeptide encoded by the hybridizable polynucleotide is mature as shown in SEQ ID NO: 2 Polypeptides have the same biological function and activity.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human K-ras proto-oncogene protein 36.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human K-ras proto-oncogene protein 36 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DM sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DM of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDM of interest is to isolate inRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua 1, Cold Spoon Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of the transcript of human K-ras proto-oncogene protein 36 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of human K-ras proto-oncogene protein 36 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- a method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-cDM terminal rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein To select and use Regulation method synthesis.
- the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various D fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human K-ras proto-oncogene protein 36 coding sequence, and the recombinant technology to produce the described Polypeptide method.
- a polynucleotide sequence encoding human K-ras proto-oncogene protein 36 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
- promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include CMV.
- Enhancers are cis-acting factors for D expression, usually about 10 to 300 base pairs that act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, and polyomas on the late side of the origin of replication Enhancers and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as digas folate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as digas folate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP Fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human K-ras proto-oncogene protein 36 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetic engineering incorporating the polynucleotide or the recombinant vector.
- Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells insect cells
- fly S2 or Sf 9 animal cells
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human K-ra s proto-oncogene protein 36 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include But not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic lysis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography , High performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Ras protein family is a family of proteins that interact with activated tyrosine kinase receptors to transmit signals into the nucleus to regulate the expression of related genes, and then affect cell proliferation and differentiation.
- Ras protein is the transcription and expression product of ras gene. It is not a protein kinase in the body, but acts as a molecular switch that binds to guanylic acid, especially to GDP and GTP to exert its biological activity. When it is combined with GTP, Has activates, and when combined with GDP, it inactivates Ras activity.
- the c- -ras proto-oncogene is a new member of the Ras protein family. Mutants of the cK-ras pro-oncogene are expressed in a variety of human tumor cells, and they are more common in tumor formation, before and after deterioration. This stage plays an important regulatory role.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human c-K-ras proto-oncogene protein, and both have similar biological functions. It regulates the physiological process of cell preparation in vivo and often involves abnormal cell proliferation. Its abnormal expression is usually closely related to tumorigenesis, embryonic development, growth and development disorders, and related diseases.
- the abnormal expression of the human K-ras proto-oncogene protein 36 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include But not limited to:
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
- Fetal developmental disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness, growth and development disorders: mental development Retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome, sexual retardation Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, 'cervicitis Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the human K-ras proto-oncogene protein 36 of the present invention will also produce certain hereditary, bloody diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human K-ras proto-oncogene protein 36.
- Agonists enhance human K-ras proto-oncoprotein 36 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human K-ras proto-oncogene protein 36 can be cultured with labeled human K-ras pro-oncogene protein 36 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human K- ra S proto-oncogene protein 36 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human K-ras proto-oncogene protein 36 can bind to human K-ras pro-oncogene protein 36 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
- human K-ras proto-oncogene protein 36 can be added to bioanalytical assays by measuring the effect of compounds on the interaction between human K-ras pro-oncogene protein 36 and its receptors. Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Peptide molecules capable of binding to human K-ras proto-oncogene protein 36 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 36 molecules of human K-ras proto-oncogene protein should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against the human K-ras proto-oncogene protein 36 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human K-ras oncogene protein 36 directly into immunized animals (such as rabbits, mice, rats, etc.).
- a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
- Techniques for preparing monoclonal antibodies to human K-ras proto-oncogene protein 36 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human K-ras proto-oncogene protein 36.
- Anti-human K-ras proto-oncogene protein 36 antibodies can be used in immunohistochemical techniques to detect human K-ras pro-oncogene protein 36 in biopsy specimens.
- Monoclonal antibodies that bind to human K-ras proto-oncogene protein 36 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human K-ras proto-oncogene protein 36 high-affinity monoclonal antibody can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human K-ras proto-oncogene protein 36 Positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to the human K-ras proto-oncogene protein 36.
- Administration of appropriate doses of antibodies can stimulate or block the production or activity of human K-ras proto-oncogene protein 36.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human K-ras proto-oncogene protein 36 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human K-ras proto-oncogene protein 36 detected in the test can be used to explain the importance of human K-ras pro-oncogene protein 36 in various diseases and to diagnose human K-ras pro-oncogene protein 36 A working disease.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human K-ras proto-oncogene protein 36 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human K-ras proto-oncogene protein 36. Recombinant gene therapy vectors (such as viral vectors) can be set The human K-ras proto-oncogene protein 36 was used to express the mutation to inhibit the endogenous human K-ras pro-oncogene protein 36 activity. For example, a variant human K-ras proto-oncogene protein 36 may be shortened and lack the signal transduction domain of human K-ras pro-oncogene protein 36.
- the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human K-ras oncogene protein 36.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human K-ras proto-oncogene protein 36 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human K-ras proto-oncogene protein 36 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human K-ras proto-oncogene protein 36 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RM and DM
- ribozymes that inhibit human K-ras proto-oncogene protein 36 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target MA to perform endonucleation.
- Antisense RM, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis techniques, such as solid-phase phosphoramidite chemical synthesis for oligonucleotide synthesis.
- Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the R. This DNA sequence is integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human K-ras proto-oncogene protein 36 can be used for diagnosis of diseases related to human K-ras pro-oncogene protein 36.
- the polynucleotide encoding human K-ras proto-oncogene protein 36 can be used to detect the expression of human K-ras pro-oncogene protein 36 or the abnormal expression of human K-ras pro-oncogene protein 36 in a disease state.
- the DNA sequence encoding human K-ras proto-oncogene protein 36 can be used to hybridize biopsy specimens to determine the expression of human K-ras pro-oncogene protein 36.
- Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- Human K-ras proto-oncogene protein 36 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human K-ras Transcription product of proto-oncogene protein 36.
- Detection of mutations in the human K-ras proto-oncogene 36 gene can also be used to diagnose human K-ras pro-oncogene 36-related diseases.
- Human K-ras proto-oncoprotein 36 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human K-ras pro-oncogene protein 36 DNA sequence. Mutations can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing diseased and unaffected individuals usually involves first looking for structural changes in the chromosome, such as defects visible at the chromosomal level or detectable by cDNA sequence-based PCR Missing or transposing. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human K-ras proto-oncogene protein 36 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human K-ras proto-oncoprotein 36 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRM Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5 ⁇ . The bacteria formed a CDM library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and one of the clones was found.
- 0594 ⁇ 1's cDM sequence is a new DM.
- a series of primers were synthesized to perform bidirectional determination of the inserted CDM fragments contained in this clone.
- the 0594 ⁇ 1 clone contained a full-length cDNA of 1571bp (as shown in Seq ID NO: 1), and a 990bp open reading frame (0RF) from 74bp to 1063bp, encoding a new protein (such as Seq ID NO : Shown in 2).
- This clone pBS-0594 ⁇ 1 and the encoded protein was named human K-ras proto-oncogene protein 36.
- Example 2 Cloning of a gene encoding human K-ras proto-oncogene protein 36 by RT-PCR
- CDM was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed with the following primers:
- Primerl 5'- GGTTGCCAGGCGCGGGCCCAGTGG -3 '(SEQ ID NO: 3)
- Primer2 5,-ACGTTAAACATCTCTAAAATATTT _3, (SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer 2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification reaction conditions 50 mmol / L KCl, 1 (kraol / L Tri s-HCl pH 8. 5, 1. 5 ol / L MgCl 2 , 2 (mol / L dNTP, l Opmol) Primer, 1U Taq DNA polymerase (product of Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min During RT-PCR, ⁇ -act in was set as a positive control and template blank was used as a negative control.
- RNA containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH7.0) -5mM sodium acetate-ImM EDTA-2.2M formaldehyde on a 1.2% agarose gel for electrophoresis. Then transferred to a nitrocellulose membrane A- 32 P dATP was used to prepare a 32 P-labeled DM probe by a random primer method.
- the DM probe used was the PCR-encoded human K-ras proto-oncogene protein 36 coding region sequence (74bp) shown in Figure 1 To 1063bp).
- Pr imer 3 5, one CCCCATATGATGGAGATGTCGGGACTCAGCTTT -3, (Seq ID No: 5)
- Pr imer 4 5,-CATGGATCCTCAAACTTGGTCCCCAGTTCCACT -3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and BamHI digestion respectively Sites, followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
- PCR was performed using the pBS-0594fll plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-0594fll-containing plasmid in a total volume of 50 ⁇ 1, primers Primer-3 and Primer- 4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. the positive clones with the correct sequence ( ⁇ -0594 ⁇ 1) the recombinant plasmid by the calcium chloride method to transform E. coli BL21 (DE3) plySs (Nova g en products).
- the host bacteria BL21 (pET-0594f 11) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to a final concentration of 1 ol / L, and the culture was continued for 5 hours.
- the cells were collected by centrifugation, and broken by ultrasound The supernatant was collected by centrifugation, and purified using an affinity chromatography column His.
- Bind Quick Cartridge (product of Novagen) capable of binding 6 histidines (6His-Tag) to obtain purified human protein K-ras. Proto-oncogene protein 36.
- a peptide synthesizer (product of PE company) was used to synthesize the following human K-ras proto-oncogene protein 36-specific peptides: NH2-Met-Glu-Met-Ser-Gly-Leu-Ser-Phe-Ser-Glu-Met- Glu-Gly-Cys-Arg-C00H (SEQ ID NO: 7).
- the peptide was coupled with hemocyanin and bovine serum albumin to form a complex. For the method, see: Avrameas, et al.
- the probes can be used to hybridize to the genome or cMA library of normal tissues or pathological tissues from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the total amount of GC is 30% -70%, and the non-specific hybridization increases when it exceeds; 3. There should be no complementary regions inside the probe;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements for homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or more than 15 consecutive bases are completely the same, the primary probe should generally not be used;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 ( 4 lNt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when pollution must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
- prehybridization solution 10xDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)
- Gene chip or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method of this step has been reported in the literature.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the light test also J Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5 '-triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech Company) labeled mRM of human mixed tissue, using the fluorescent reagent Cy5dUTP (5-Amino -propargyl— 2′—deoxyuridine 5′-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) of the body, and probes were prepared after purification.
- Cy3dUTP 5-Amino-propargyl-2'-deoxyur idine 5 '-triphate coupled to Cy3 f luorescent dye
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Oncology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU67286/01A AU6728601A (en) | 2000-04-29 | 2001-04-28 | A novel polypeptide, a human k-ras gene protein 36 and the polynucleotide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115526 CN1321661A (zh) | 2000-04-29 | 2000-04-29 | 一种新的多肽——人K-ras原癌基因蛋白36和编码这种多肽的多核苷酸 |
CN00115526.1 | 2000-04-29 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001083538A1 true WO2001083538A1 (fr) | 2001-11-08 |
Family
ID=4584972
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000643 WO2001083538A1 (fr) | 2000-04-29 | 2001-04-28 | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1321661A (zh) |
AU (1) | AU6728601A (zh) |
WO (1) | WO2001083538A1 (zh) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AU2003255095A1 (en) * | 2002-08-07 | 2004-05-04 | Neworgen Limited | Human protein for promoting transformation of 3t3 cell and its coding sequence |
CN102010894B (zh) * | 2010-03-09 | 2013-04-24 | 上海源奇生物医药科技有限公司 | 检测人K-ras基因外显子12、13突变的核苷酸序列、方法及试剂盒 |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB2328689A (en) * | 1997-08-27 | 1999-03-03 | Norsk Hydro As | Peptides based on the p21 ras proto-oncogene protein for the treatment of cancer |
-
2000
- 2000-04-29 CN CN 00115526 patent/CN1321661A/zh active Pending
-
2001
- 2001-04-28 WO PCT/CN2001/000643 patent/WO2001083538A1/zh active Application Filing
- 2001-04-28 AU AU67286/01A patent/AU6728601A/en not_active Abandoned
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB2328689A (en) * | 1997-08-27 | 1999-03-03 | Norsk Hydro As | Peptides based on the p21 ras proto-oncogene protein for the treatment of cancer |
Non-Patent Citations (3)
Title |
---|
LI JIAN ET AL.: "Expression of ras protein in human esophageal cancerous and precancerous lesions", CHINESE CANCER CLINIC AND RESTORATION, vol. 6, no. 1, 1999, pages 11 - 12 * |
LI JIAN ET AL.: "Study on ras protein in human esophageal squamous cell carcinoma in northern China", HENAN MEDICAL RESEARCH, vol. 8, no. 2, June 1999 (1999-06-01), pages 97 - 99 * |
ZHANG HELONG ET AL.: "Detection of the mutation of p53 and K-kas genes and their expression products", J. FOURTH MIL. MED. UNIV., vol. 20, no. 9, 1999, pages 769 - 771 * |
Also Published As
Publication number | Publication date |
---|---|
AU6728601A (en) | 2001-11-12 |
CN1321661A (zh) | 2001-11-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001074879A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s3-12, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001092514A1 (fr) | Nouveau polypeptide, interleukine humaine 13 (il-13), et polynucleotide codant ce polypeptide | |
WO2001088084A2 (fr) | Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide | |
WO2001083688A2 (fr) | Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2001075023A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001079423A2 (en) | A novel polypeptide, human bcr protein 10 and the polynucleotide encoding said polypeptide | |
WO2001074876A1 (fr) | Nouveau polypeptide, phosphatidylinositol-3 kinase humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001079432A2 (en) | A novel polypeptide, a human cell differentiation transcription factor 58 and the polynucleotide encoding the polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001083542A1 (en) | A novel polypeptide, human p18 protein 21 and the polynucleotide encoding said polypeptide | |
WO2001087950A1 (fr) | Nouveau polypeptide, recepteur cannabinoide humain 11, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001083676A2 (en) | A novel polypeptide human strip-riched phosphatase 10 and the polynucleotide encoding said polypeptide | |
WO2001048160A1 (fr) | Nouveau polypeptide, proteine tyrosine phosphatase 12, et polynucleotide codant pour ce polypeptide | |
WO2001088147A1 (fr) | Polypeptide de tyrosine kinase 14 humaine et polynucleotide le codant | |
WO2001083685A2 (fr) | Nouveau polypeptide, proteine cap 10, et polynucleotide codant pour ce polypeptide | |
WO2001083683A2 (fr) | Nouveau polypeptide, proteine pax humaine 11.3, et polynucleotide codant pour ce polypeptide | |
WO2002026952A1 (fr) | Nouveau polypeptide, serine/threonine proteine kinase humaine 11.22, et polynucleotide codant ce polypeptide | |
WO2001064868A1 (fr) | Nouveau polypeptide, recepteur humain de cytokine 12, et polynucleotide codant pour ce polypeptide | |
WO2001068872A1 (en) | Novel polypeptide---a human vacuolar h+ acyladenosine triphosphatase c subunit 22 and polynucleotide encoding it | |
WO2001072807A1 (fr) | Nouveau polypeptide, neuropeptide humain 11, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |