WO2001073061A1 - Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001073061A1 WO2001073061A1 PCT/CN2001/000275 CN0100275W WO0173061A1 WO 2001073061 A1 WO2001073061 A1 WO 2001073061A1 CN 0100275 W CN0100275 W CN 0100275W WO 0173061 A1 WO0173061 A1 WO 0173061A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- protein
- polynucleotide
- human
- retinoma
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4736—Retinoblastoma protein
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human retinoma protein 22, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide. Background technique
- Retinoma (RB) protein plays an important role in the proliferation and differentiation of normal cells. Cell division requires cells to go through multiple stages in the cell cycle. RB is considered to inhibit cell division by maintaining cells in the G1 and GO phases of the cell cycle [Weintraub SJ et al. Nature 1995;
- RB can control cell growth. For some tissues that have stopped growing due to the effect of RB, this feature can be used to stimulate their growth. For example: Myocardial tissue loses function due to cell death and can be repaired by the proliferation of living cells. Therefore, blocking the cellular control function of RB can help induce tissue repair in the event of cardiac or neuronal cell death [Wiman KG. FASEB J 1993; 7: 841-5].
- RB is a widely studied tumor suppressor gene.
- This inactivation can be caused by a mutation, or it can be caused by a combination of a viral proto-oncoprotein (a product of a pro-oncovirus).
- This inactivation occurs in a specific region of the RB protein, which is important for growth control and is called the "RB pocket region".
- Many factors, including the toxic proto-oncoprotein, can be combined with the RB pocket region to control the function of the RB protein.
- the discovery of protein-binding factors that bind to RBs can help find new ways to control RB-mediated cell proliferation and differentiation in disease states, including (but not limited to) loss of heart and nerve function or the occurrence of malignant tumors. Therefore, it is necessary to find new protein factors that bind and regulate RB.
- the expression profile of the polypeptide of the present invention is very similar to the expression profile of the retinoma protein, so their functions may be similar.
- the invention is named human retinoma protein 22.
- the human retinoma protein 22 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes.
- Human retinoma protein 22 protein especially identifying this Amino acid sequence of several proteins. Isolation of the new human retinoma protein 22 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for disease 1 and it is therefore important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human retinoma protein 22.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human retinoma protein 22.
- Another object of the present invention is to provide a method for producing human retinoma protein 22.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human retinoma protein 22.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human retinoma protein 22.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human retinoma protein 22.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 268-861 in SEQ ID NO: 1; and (b) a sequence having 1-1677 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human retinoma protein 22 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human retinoma protein 22 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample.
- the amount or biological activity of a polypeptide of the invention comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of malignant tumors, hematological diseases, developmental disorders, HIV infection and immune diseases, and various types of inflammation or other diseases due to abnormal expression of human retinoma protein 22 Use of drugs that cause disease.
- Nucleic acid sequence refers to oligonucleotides, nucleotides or polynucleotides and fragments or parts thereof, and may also refer to genomic or synthetic DNA or RNA, which may be single-stranded or double-stranded, representing the sense strand Or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similar The term “immunologically active” refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind to specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human retinoma protein 22, causes the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human retinoma protein 22.
- Antagonist refers to a molecule that, when combined with human retinoma protein 22, can block or regulate the biological or immunological activity of human retinoma protein 22.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human retinoma protein 22.
- retinoma protein 22 refers to a change in the function of human retinoma protein 22, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human retinoma protein 22.
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human retinoma protein 22 using standard protein purification techniques.
- Substantially pure human retinoma protein 22 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of the human retinoma protein 22 peptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sou thern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Me thods in emzumo l ogy 183: 625-645) 0 "Similarity” refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitutions may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to 22 human retinoblastoma protein antigen determinant.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state.
- isolated human retinoma protein 22 means that human retinoma protein 22 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human retinoma protein 22 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human retinoma protein 22 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human retinoma protein 22, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human retinoma protein 22.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human retinoma protein 22 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence)
- fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1677 bases, and its open reading frame 268-861 encodes 197 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to that of retinal protein, and it can be inferred that the human retinal protein 22 has a similar function to that of retinal protein.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DM can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1
- degenerate variants refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturing agents during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 More than nucleotides.
- Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human retinoma protein 22.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human retinoma protein 22 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolation of double-stranded DNA from genomic DNA Sequence; 2) chemically synthesize a DM sequence to obtain double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or loss of marker gene function; (3) measuring the level of human retinoprotein 22 transcripts; Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of the human retinoma protein 22 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- the RACE method RACE-rapid cDNA end rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising a polynucleotide of the present invention, and a vector or a direct use of the vector of the present invention.
- a polynucleotide sequence encoding human retinoma protein 22 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human retinoma protein 22 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetic engineering containing the polynucleotide or the recombinant vector.
- Host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS, or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl ⁇ i, the steps used are well known in the art. Alternatively, M g C l 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human retinoma protein 22 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- FIG. 1 is a comparison diagram of gene chip expression profiles of human retinoma protein 22 and retinoma protein according to the present invention.
- the upper figure is a graph of the expression profile of human retinoma protein 22, and the sequence below is a table of retinoma protein Daphism chart.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human retinoma protein 22.
- 22KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5ot. The bacteria formed a cDNA library.
- the Dye terminate cycle reaction sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0147 b 07 was a new DM.
- the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5,-GAGGAGATGATTTCTAACTTTTTC -3, (SEQ ID NO: 3)
- Priraer2 5'- GACGGAGTTTCACTCTATCACCCA -3, (SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Conditions for the amplification reaction 50 mmol / L C1, 10 mmol / L Tris- CI, (pH8.5), 1.5mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-1677bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human retinoma protein 22 gene expression:
- RNA was synthesized by electrophoresis on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-lniM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane.
- the DNA probe used was the PCR amplified human retinoma protein 22 coding region sequence (268bp to 861bp) shown in FIG. 1.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25raM H 2 P0. (pH7.4) -5 x SSC- 5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager Analysis and quantification Example 4: In vitro expression, isolation and purification of recombinant human retinoma protein 22
- Primer3 5'- CCCCATATGATGTTCCTCCATTCACTTAATGAA -3, (Seq ID No: 5)
- Primer4 5'- CATGGATCCTTATCTCCCACCAGGTCCCTCCCA -3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
- the Ndel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
- the PCR reaction was performed using the pBS-G147b07 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-0147b07 plasmid, Primer-3 and Primer-4 in a total volume of 50 ⁇ 1, and 1 J was 10 pmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 Loop. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the colibacillus DH5 ⁇ by the calcium chloride method.
- NH2-Met-Phe-Leu-His-Ser-Leu-Asn-Glu-Thr-Lys-Ser-Thr-Ser-Leu-Thr- C00H (SEQ ID NO: 7).
- the peptide is coupled to hemocyanin and bovine serum albumin to form a complex.
- Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to the genome or xDNA library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this example is to select a suitable oligonucleoside from the polynucleotide SEQ ID NO: 1 of the present invention
- the acid fragment is used as a hybridization probe, and the membrane hybridization method is used to identify whether some tissues contain the polynucleotide sequence of the present invention or a homologous polynucleotide sequence.
- Filter hybridization methods include dot blotting, Sou thern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when the GC content is exceeded;
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41 Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID D NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 14 Resuspend the DNA pellet in a small volume of TE or water.
- the following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared after the collection solutions of the first peak are combined.
- the sample membrane was placed in a plastic bag, and 3- 10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ral) was added.
- CT DNA (calf thymus DNA).
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ ! . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DNA on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP 5— Amino-propargy 2'—deoxyuridine 5'—triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- propargy 1-2'- deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
- Cy3dUTP 5— Amino-propargy 2'—deoxyuridine 5'—triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia
- Probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000.
- the instrument purchased from General Scanning Company, USA
- the scanned images were analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv 304 cell line, and non-starved L02 cell line , Arsenic stimulated L02 cell line and prostate tissue for 1 hour.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Retinoma (RB) protein plays an important role in the proliferation and differentiation of normal cells. RB is thought to inhibit cell division by maintaining cells at the G1 and G O stages of the cell cycle. For some tissues that have stopped growing due to the effect of RB, this feature can be used to stimulate their growth. For example: Blocking the cellular control function of RB can help induce tissue repair in the event of cardiac or nerve cell death.
- inactivation of RB can cause abnormal growth of cancer cells, which is a tumor suppressor gene that has been widely studied. This inactivation can be caused by a mutation, or it can be inactivated by binding to a viral proto-oncoprotein (a product of a proto-oncovirus).
- a viral proto-oncoprotein a product of a proto-oncovirus
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human retinal tumor (RB) protein, and both have similar biological functions. It regulates cell proliferation and differentiation in vivo, and its abnormal expression is closely related to the occurrence of growth retardation, overgrowth, division, cancer, etc., and produces related diseases.
- RB retinal tumor
- the abnormal expression of the human retinoma protein 22 of the present invention will produce various diseases, especially various tumors, embryonic developmental disorders, growth disorders, inflammation, and immune diseases. These diseases include, but are not limited to:
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, embryonic developmental disorders Symptoms: Congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital hearing loss
- Growth and development disorders mental retardation, brain development disorders, skin, fat and muscle dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the human retinoma protein 22 of the present invention will also produce certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, immunity Sexual diseases, certain hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human retinoma protein 22.
- Agonists enhance biological functions such as human retinoma protein 22 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human retinoma protein 22 can be cultured with labeled human retinoma protein 22 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human retinoma protein 22 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human retinoma protein 22 can bind to human retinoma protein 22 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- human retinoma protein 22 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human retinoma protein 22 and its receptor.
- Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human retinoma protein 22 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human retinoma protein 22 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against the human retinoma protein 22 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human retinoma protein 22 directly into immunized animals (such as rabbits, small Rat, rat, etc.), a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to human retinoma protein '22 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human retinoma protein 22.
- Anti-human retinoma protein 22 antibodies can be used in immunohistochemical techniques to detect human retinoma protein 22 in biopsy specimens.
- Monoclonal antibodies that bind to human retinoma protein 22 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human retinoma protein 22 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP, and toxin is bound to the antibody through the exchange of disulfide bonds.
- SPDP thiol cross-linking agent
- This hybrid antibody can be used to kill human retinoprotein 22-positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human retinoma protein 22.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human retinoma protein 22.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human retinoma protein 22 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the human retinoma protein 22 levels detected in the test can be used to explain the importance of human retinoma protein 22 in various diseases and to diagnose diseases in which human retinoma protein 22 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human retinoma protein 22 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human retinoma protein 22.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human retinoma protein 22 to inhibit endogenous human retinoma protein 22 activity.
- a mutant human retinoma protein 22 may be a shortened human retinoma protein 22 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity.
- the vector can be used to treat diseases caused by abnormal expression or activity of human retinoma protein 22.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human retinoma protein 22 into cells.
- Methods for constructing a recombinant viral vector carrying a polynucleotide encoding human retinoma protein 22 can be found in existing literature
- a recombinant polynucleotide encoding human retinoma protein 22 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human retinoma protein 22 mRM are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human retinoma protein 22 is useful for the diagnosis of diseases related to human retinoma protein 22.
- the polynucleotide encoding human retinoma protein 22 can be used to detect the expression of human retinoma protein 22 or the abnormal expression of human retinoma protein 22 in a disease state.
- a DNA sequence encoding human retinoma protein 22 can be used to hybridize biopsy specimens to determine the expression of human retinoma protein 22.
- Hybridization techniques include Sou thern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
- Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- a microarray Microray
- a DNA chip also known as a "gene chip”
- Human retinoma protein 22 specific primers can also be used to detect human retinoma protein 22 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
- Detection of mutations in the human retinoma protein '22 gene can also be used to diagnose human retinoma protein 22-related diseases.
- Human retinoma protein 22 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human retinoma protein 22 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations can be Can affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers Liquid, glycerin and their combinations.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human retinoma protein 22 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human retinoma protein 22 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU87276/01A AU8727601A (en) | 2000-03-02 | 2001-02-26 | Novel polypeptide- a human retinoblastoma protein 22 and polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00111844.7 | 2000-03-02 | ||
CN 00111844 CN1311232A (zh) | 2000-03-02 | 2000-03-02 | 一种新的多肽——人视网膜瘤蛋白22和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001073061A1 true WO2001073061A1 (fr) | 2001-10-04 |
Family
ID=4581740
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000275 WO2001073061A1 (fr) | 2000-03-02 | 2001-02-26 | Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1311232A (zh) |
AU (1) | AU8727601A (zh) |
WO (1) | WO2001073061A1 (zh) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH06321993A (ja) * | 1991-03-12 | 1994-11-22 | Takeshi Sato | 血管内皮細胞増殖抑制因子及びその製造方法 |
US6133309A (en) * | 1997-11-12 | 2000-10-17 | Hoffmann-La Roche Inc. | Treatment of T-helper cell type 2-mediated immune disease by retinoid antagonists |
-
2000
- 2000-03-02 CN CN 00111844 patent/CN1311232A/zh active Pending
-
2001
- 2001-02-26 AU AU87276/01A patent/AU8727601A/en not_active Abandoned
- 2001-02-26 WO PCT/CN2001/000275 patent/WO2001073061A1/zh active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH06321993A (ja) * | 1991-03-12 | 1994-11-22 | Takeshi Sato | 血管内皮細胞増殖抑制因子及びその製造方法 |
US6133309A (en) * | 1997-11-12 | 2000-10-17 | Hoffmann-La Roche Inc. | Treatment of T-helper cell type 2-mediated immune disease by retinoid antagonists |
Also Published As
Publication number | Publication date |
---|---|
AU8727601A (en) | 2001-10-08 |
CN1311232A (zh) | 2001-09-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001068689A1 (fr) | Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide | |
WO2001068688A1 (fr) | Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide | |
WO2001074869A1 (fr) | Nouveau polypeptide, proteine humaine de choc thermique 15, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001079423A2 (en) | A novel polypeptide, human bcr protein 10 and the polynucleotide encoding said polypeptide | |
WO2001073061A1 (fr) | Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide | |
WO2001068873A1 (fr) | Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001090376A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide | |
WO2001073008A1 (fr) | Nouveau polypeptide, nucleoproteine humaine 13 associee aux tumeurs, et polynucleotide codant pour ce polypeptide | |
WO2001074892A1 (fr) | Nouveau polypeptide, proteine antigene prostatique specifique membranaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001079491A1 (fr) | Nouveau polypeptide, canal ionique humain 12 pour le chlore, et polynucleotide codant pour ce polypeptide | |
WO2001081395A1 (fr) | Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001081392A1 (fr) | Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001075079A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001081537A2 (fr) | Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001064867A1 (en) | A novel polypeptide, a human reverse transcription relative factor 33 and the polynucleotide encoding the polypeptide | |
WO2001071000A1 (fr) | Nouveau polypeptide, znt-1-22, et polynucleotide codant pour ce polypeptide | |
WO2001074995A2 (en) | A novel polypeptide - human ataxia-telangiectasia mutant protein 15 and a polynucleotide encoding the same | |
WO2001072795A1 (fr) | Nouveau polypeptide, quinine reductase humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001066581A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s4-19, et polynucleotide codant pour ce polypeptide | |
WO2001081592A1 (fr) | Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide | |
WO2001075002A2 (fr) | Nouveau polypeptide, gène de regulation du cycle cellulaire humain 28, et polynucléotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |