WO2001055178A2 - Liv-1 related protein, polynucleotides encoding the same and use thereof for treatment of cancer - Google Patents
Liv-1 related protein, polynucleotides encoding the same and use thereof for treatment of cancer Download PDFInfo
- Publication number
- WO2001055178A2 WO2001055178A2 PCT/US2001/002622 US0102622W WO0155178A2 WO 2001055178 A2 WO2001055178 A2 WO 2001055178A2 US 0102622 W US0102622 W US 0102622W WO 0155178 A2 WO0155178 A2 WO 0155178A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- liv
- antibody
- polypeptide
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/08—Drugs for disorders of the urinary system of the prostate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57515—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5758—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumours, cancers or neoplasias, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides or metabolites
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
Definitions
- compositions and methods tor the treatment ol disorders characterized by the overexpression of a LIV- 1 gene product in tumoi comprise a nucleic acid a polypeptide encoded b ⁇ the nucleic acid, and a compound, preferably an antibody or fragment thereof that binds to the polypeptide preterably binding to the extracellular domain of LIV- 1 polypeptide
- breast cancer is a common and devastating form ot cancer attecting millions ot women per year throughout the world
- Many breast tumors are estrogen sensitive and frequently treatable with compounds that interfere v, ith estrogen binding to estrogen receptors (ERs) expressed on the bieast tumor tissue Detecting the le ⁇ el of ER expression and sensitivity to estrogen stimulation is useful for determining that antihormone-type chemotherapy may succeed in a particular patient
- ERs estrogen receptors
- pS2 also designated pS2
- the pathogenesis of various human malignancies including breast cancer is at tected by proto- oncogenes that encode growth factors and growth factor receptors Human ErbB2 gene (erbBl, also known as her2 or c-erbB-1) which encodes a 185-kd transmembrane glycoprotein receptor (ErbB2 also known as HER2 or
- HFR epidermal growth factor receptor
- Antibodies directed against human erbBl protein products (ant ⁇ -ErbB2 antibodies) and against proteins encoded by the rat equivalent of the erbB2 gene (neu) (ant .ea protein antibodies) down-modulate cell surface expression of pi 85 on B 104- 1 -1 cells (NIH-3T3 cells transfected with the neu proto-oncogene) and inhibit colony formation ot these cells Drebin etal Cell 4 ⁇ 695-706 ( 1985)
- Biological effects of an -neu protein antibodies are reviewed in Myers et al Meth 198 277-290 ( 1991 ) See also W094/22478 published October 1 3 1994
- the anti ErbB2 antibody 4D5 exhibited anti-prohterative effects on the SKDR3 human breast tumor cell e ⁇ bB ⁇ > line, inhibiting cellular proliferation b> approximately 56%, and sensitizing pi 85 " -overexpressing breast tumor cell lines to the cytotoxic effects of TNF- ⁇ See Hudziak et al ,
- ErbB2 overexpression is also linked to sensitivity and/or resistance to hormone therapy and chemotherapeutic regimens, including CMF (cyclophosphamide, methotrexate, and fluoruracil) and anthracychnes (Baselga ef ⁇ / , Oncolog ⁇ 1 l (3 Suppl 1 ) 43-48 [ 1997])
- CMF cyclophosphamide, methotrexate, and fluoruracil
- anthracychnes Baselga ef ⁇ / , Oncolog ⁇ 1 l (3 Suppl 1 ) 43-48 [ 1997]
- the odds of HER2-pos ⁇ t ⁇ ve patients responding clinically to treatment with taxanes were greater than three times those of HER2-negat ⁇ ve patients (Ibid)
- rhuMab HER2 was shown to enhance the activity of pac taxel (TAXOL ® ) and doxorubicm against breast cancer xenografts in nude
- the present invention relates to the discovery of a unique protein LIV-1 -164647, that is overexpressed in some tumor tissues, such as in prostate colon lung, breast, and a population of breast tumors that overexpress LIV- 1-164647, but do not overexpress ErbB2
- the present invention further relates to nucleic acid sequences and amino acid sequences having homology to herein disclosed LIV-1 gene sequence (designated DNA 164647) and the amino acid sequence of LIV-1 protein encoded by DNA 164647 Applicants' discovery that LIV-1 - 164647 is overexpressed in tumor cells led to the additional discoveries of compositions for detection an d treatment of tumor cells and methods of carrying out such detection and treatment
- the present invention relates to a nucleic acid sequence having homology to the nucleic acid sequence of DNA 164647 (SEQ ID NO 3 (coding strand)), or a portion thereof
- the homology is at least approximately 80% homology, more preferably at least approximately 90%, still more preterably at least approximately 95%?.
- the nucleic acid ot the invention encodes an aqueous soluble extracellular domain (ECD) that is at least 80%- homologous to the DNA164647 (SEQ ID NO 3) from approximately nucleic acid 73 to approximately 1060
- ECD aqueous soluble extracellular domain
- the homologous nucleic acid of the invention hybridizes under stringent conditions to a 30 nucleic acid or longer portion of the nucleic acid sequence of DNA 164647 (SEQ ID NO 3) or its complementary sequence preferably hybridizing under stringent conditions to a 30 nucleotide regions from nucleotide 440 to and including nucleotide 470 of SEQ ID NO 3 or its complementary sequence
- the homologous nucleic acid of the invention comprises a nucleic acid sequence comprising a sequence that is at least 50%- preterably at least 80% more preterably at least 90% homologous to the sequence from nucleotide 446 to and including nucleotide 463
- the present invention relates to an isolated polypeptide comprising an amino acid sequence having homology to the amino acid sequence (SEQ ID NO 4) or a fragment thereof encoded bv or within DNA 164647, designated herein as LIV-1 -164647
- the homology is at least approximated 80% homology more preferably at least approximately 90%: still more preferably at least approximately 95% and most preferably at least approximately 97% homology
- a LIV- 1 - 164647 amino acid sequence of the ⁇ n ⁇ ention is an aqueous soluble ECD homologous to amino acid 1 to approximately amino acid 327 or a fragment thereof comprising at least 10 amino acids
- the region ot the ECD is readily determined from a standard hydropathy plot indicating the relatively more hydrophilic region N-terminal of a hydrophobic transmembrane region
- the homologous amino acid sequence ot the invention comprises a sequence from amino acid 126 to and including amino acid 132 of SEQ ID NO 4 (specifically,
- the present invention concerns an antibody which specifically binds a LIV- 1 polypeptide
- the antibody is a monoclonal antibody More preterably the antibody is a human antibody or a humanized antibody
- the antibody reduces activity of overexpressed LIV-1 polypeptide in a cell
- the antibody is a monoclonal antibody which preferably has nonhuman complementarity determining region (CDR) residues and human framework region (FR) residues
- CDR complementarity determining region
- FR human framework region
- the antibody may be labeled and may be immobilized on a solid support
- the antibody is an antibody fragment, a single-chain antibody, or an anti-idiot pic antibody
- a LIV- 1 -binding antibody of the invention binds specifically to a polypeptide having at least approximately 80% homology.
- a LIV- 1 -binding antibody ot the invention binds specifically to a polypeptide having at least 80%- homology more preferably at least approximately 90%- homology. still more preferably at least approximately 95% homology.
- the present invention concerns an isolated antibody which specifically binds a LIV-1 polypeptide encoded by a nucleic acid sequence comprising a nucleic acid sequence having at least 65%- , preferably at least 75%- more preferably at least 85%, still more preterably at least 90% and most preferably at least 96% homology to a sequence from nucleotide 446 to and including nucleotide 463 of SEQ ID NO 3, or the nucleic acid sequence from 2297 to and including 2337 of SEQ ID NO 3, or both nucleic acid sequences
- the present invention concerns an isolated antibody which specifically binds a LIV- 1 polypeptide comprising the amino acid sequence having at least 65%, preferably at least 75%-, more preferably at least 85% .
- the invention concerns an antibody, preterably a monoclonal antibody, that specifically binds the same epitope of LIV-1 , preferably LIV- 1 -1 164647. that is bound by any one of the monoclonal antibodies produced by the hybridoma cell lines deposited with the American Type Culture Collection (ATCC) as disclosed herein
- the invention includes an antibody that binds to a polypeptide comprising a sequence from amino acid 1 to and including amino acid 147 of SEQ ID NO 4
- the antibody binds a polypeptide comprising amino acid 148 to and including amino acid 298 ot SEQ ID NO 4 Pieferably.
- the antibodies are monoclonal antibodies More preferably, the monoclonal antibodies are human antibodies or humanized antibodies
- the invention concerns a composition
- a composition comprising an antibody which binds LIV- 1 polypeptide in an admixture with a phaimaceutically acceptable earner
- the composition compnses a therapeutically effective amount of the antibody
- the composition comprises a further active ingredient which may, tor example be a further antibodv or a cytotoxic or chemotherapeutic agent Pi cferably, the composition is sterile
- the invention conceins a nucleic acid encoding an ant ⁇ -LIV- 1 antibody according to the invention, and vectors and recombinant host cells comprising such nucleic acid
- the invention concerns a method tor producing an ant ⁇ -LIV- 1 antibody by cultu ⁇ ng a host cell transformed with nucleic acid encoding the antibody under conditions such that the antibody is expressed, and recovering the antibody from the cell culture
- the invention further concerns antagonists and agonists ot a LIV- 1 polypeptide which antagonists inhibit one or more of the functions or activities ot the LIV- 1 polypeptide and which agonists mimic one or more ot the functions or activities ot the LIV- 1 polypeptide
- the LIV- 1 polypeptide is the LIV- 1 - 164647 polypeptide whose functions or activities are antagonized or agonized
- the invention concerns a method tor determining the presence oi a LIV- 1 polypeptide or fragment thereof comprising exposing a cell suspected ot containing the LIV- 1 polypeptide to an anti- LIV- 1 antibody of the invention and determining binding ot the antibody to the cell
- the present invention concerns a method of diagnosing tumor in a mammal, comprising detecting the level ot expression of a gene encoding a LIV-1 polypeptide in a test sample of tissue cells obtained from the mammal, and in a control sample ot known normal tissue cells of the same cell type, wherein a higher expression level in the test sample indicates the presence of tumor in the mammal from which the test tissue cells were obtained
- the present invention concerns a method ot diagnosing tumor in a mammal, comprising contacting an ant ⁇ -LIV- 1 antibody with a test sample ot tissue cells obtained from the mammal , and detecting the formation of a complex between the anti-LI V- 1 antibody and the LIV- 1 polypeptide in the test sample
- the detection may be qualitative or quantitative, and may be pertonned in comparison with monitoring the complex formation in a control sample of known normal tissue cells ot the same cell type
- a larger quantity of complexes formed in the test sample indicates the presence ot tumor in the mammal from which the test tissue cells were obtained
- the antibody preterably carries a detectable label Complex formation can be monitored for example by light microscopy, flow cytometry, fluo ⁇ metry or other techniques known in the art
- For the methods of diagnosing the test sample is usually obtained from an individual suspected to have neoplastic cell growth or proliferation (e g cancerous cells)
- the invention involves a method ot diagnosing breast tumor tissue as tissue that overexpresses LIV- 1 protein and expresses normal levels of ErbB2
- the method comprises providing a test sample ot tissue suspected ot being cancerous, contacting the test sample with an antibody to the naturally occurring form of the LIV-1 gene product, contacting the same or duplicate test sample with an ant ⁇ -ErbB2 antibody detecting the relative binding of the antibodies to the test sample compared to a contiol sample where the control may be a positive control, a negative conti ol or both
- a test sample that overexpresses LIV- 1 gene product (relative to normal tissue) but does not overexpress ErbB2 protein (relative to normal tissue) is diagnosed as a member of the population ot breast tumors to be treated by the compositions and methods of the invention
- Useful in the diagnostic assay method of the invention are ant ⁇ -ErbB2 antibodies that bind the extracellulai domain of the E ⁇ bB2 receptor
- the present invention concerns a cancer diagnostic kit, comprising an anti-LIV- 1 - 164647 antibody and a carrier (e g a buffer) in suitable packaging
- a carrier e g a buffer
- the kit preferably contains instructions for using the antibody to detect the LIV-1 polypeptide
- the invention concerns a method for inhibiting the grow th of tumor cells comprising exposing a cell which overexpresses a LIV- 1 polypeptide to an effective amount of an agent inhibiting the expression and/or activity of the LIV-1 polypeptide
- the agent preferably is an anti-LIV- 1 - 164647 antibody, a small organic and inorganic molecule, peptide. phosphopeptide.
- the agent e g anti-LIV- 1 -164647 antibody induces cell death or at least slows cell growth sufficiently to allow other methods of cancer treatment to be administered
- the tumor cells are further exposed to radiation treatment and/or a cytotoxic or chemotherapeutic agent
- the invention concerns a method tor the treatment of a human patient susceptible to or diagnosed with a disorder characterized by overexpression of LIV-1 gene product w ithout overexpression ot ErbB2 receptor
- the method comprises administering a therapeutically effective amount of an anti-LIV- 1 polypeptide antibody, where administration may be intravenous, subcutaneous or other pharmaceutically acceptable method of antibody delivery
- the antibody specifically binds the naturally occurring form of the LIV-1 -164647 polypeptide, wherein the binding is preterably to the extracellular domain or a fragment thereof
- the initial dose (or doses) as well as the subsequent maintenance dose or doses are administered subcutaneously
- the initial dose is administered by intravenous infusion, followed by subcutaneous administration of the maintenance doses it the patient's tolerance tor the antibody is acceptable
- the initial dose or doses is followed by subsequent doses ot equal
- the chemotherapeutic agent in a toxoid including but not limited to, pachtaxel and doxetaxel
- the chemotherapeutic agent is an anthracyhne derivative including, but not limited to doxorubicm and epirubicin
- the chemotherapeutic agent is not administered to the patient simultaneously with the anti-LIV- 1 antibody
- One or more additional chemotherapeutic agents may also be administered to the patient
- the disorder to be treated by a method of the invention preterably is a benign or malignant tumor characterized by the overexpression ot the LIV- 1 gene product
- the malignant cells of the tumor express approximately the same level of ErbB2 (or less) as a non-cancerous cell of the same type
- the disorder to be treated is a cancer, such as breast cancer, lung cancer, and prostate cancer
- one aspect of the invention involves compounds that bind to the LIV- 1 protein and inhibit its activity
- the compounds bind to the extracellular region of the LIV-1 protein and inhibit its activity
- the inhibiting compounds are antibodies specific to the LIV- 1 gene product or fragments thereof
- the inhibiting compounds of the invention bind specifically to the extracellular region of the LIV- 1 protein
- the invention involves compounds that block the binding of an activating ligand of LIV- 1 protein
- Such hgand-blocking compounds include, but are not limited to polypeptides, proteins, antibodies and the like
- the hgand-blocking compounds include, but are
- the invention involves a method tor identifying a compound capable of inhibiting the expression and/or activity of a LIV- 1 polypeptide, comprising contacting a candidate compound ith a LIV-1 polypeptide under conditions and for a time sufficient to allow these two components to interact
- a candidate compound ith a LIV-1 polypeptide under conditions and for a time sufficient to allow these two components to interact
- either the candidate compound or the LIV- 1 polypeptide is immobilized on a solid support
- the non-immobilized component carries a detectable label
- the invention concerns an article of manufacture, comprising a container, a composition within the container comprising an anti-LIV- 1 antibody that binds the LIV- 1 protein (preferably binding to the extracellular domain or a fragment thereof) or binds an activating ligand of the LIV- 1 protein, and optionally a label on or associated with the container that indicates that the composition can be used tor treating a condition characterized by overexpression of LIV-1 without overexpression of ErbB2
- the article of manufacture further includes a package insert comprising instructions to administer the anti-LIV- 1 antibody subcutaneously for at least one of the doses, preferably for all of the subsequent doses following the initial dose, most preferably for all doses
- compositions of the invention comprise an anti-LIV- 1 antibody, which specifically and preferably binds the extracellular domain of a LIV-1 gene product, or a fragment ot the extracellular domain
- the compositions of the invention preferably include a humanized LIV-1 antibody
- the invention further pertains to a composition comprising an antibody that specifically and preterably binds the extracellular domain of LIV- 1 gene product, and pertains to the use of the antibody for treating LIV-l +/ErbB2- expressing cancer in a human, e.g., LIV-1 overexpressing cancer that does not coexpress high levels of ErbB2
- the antibody is a monoclonal antibody e g humanized anti-LIV- 1 monoclonal antibody that binds to the extracellular domain (or a portion of the extracellular domain) of LIV- 1 (hereinatter ant ⁇ -LIV-1 )
- the antibody may be an intact antibody (e g , an intact IgG, antibody) or an antibody tragment (e
- variable light chain and variable heavy chain regions ot humam/ed anti-LIV- 1 antibody
- Figs 1 A- 1 C are the nucleic acid sequence (SEQ ID NO 1 (coding sequence) Fig 1 A-l to 1 A-2) and the amino acid sequence (SEQ ID NO 2 Fig IB) ot the LIV-1 protein
- the dashed overlined portion is predicted to be a signal sequence (approximately amino acids 1 to 20)
- the predicted extracellular domain ot LIV- 1 protein is that portion of the LIV- 1 amino acid sequence underscored by a dashed line (approximately amino acids 24 to 312 )
- the predicted transmembrane domain extends from approximately amino acid 318 to approximately amino acid 367
- the approximate positions of the domains were predicted using a standard hydropathy analysis program
- a nucleic acid sequence (SEQ ID NO 5) encoding a portion of LIV- 1 and useful in microarray analysis is shown in Fig 1 C
- Figs 2A-2B are the nucleic acid sequence and amino acid sequence respectively, corresponding to DNA 164647 Fig 2A 1 -2A5 is the nucleotide sequence of DNA 164647 that is a cDNA encoding a native sequence LIV-1 protein SEQ ID NO 3 is the coding strand of DNA 164647 Fig 2B is the derived amino acid sequence (SEQ ID NO 4) of a native LIV- 1 polypeptide encoded by DNA 164647 Fig 3-1 - 3-1 1 is an alignment ot SEQ ID NO 1 and SEQ ID NO 3 nucleic acid sequences
- Fig 4-1 - 4-3 is an alignment ot SEQ ID NO 2 and SEQ ID NO 4 amino acid sequences The sequences differ in the ECD (near amino acid 130 of SEQ ID NO 4) and C-terminal region beyond about amino acid 740 ot SEQ ID NO 4 A single amino acid difference was found at amino acid 651 ot SEQ ID NO 4
- Fig 5 is a flow chart illustrating the FLIP cloning method up to the restriction digestion selection step, as described herein
- the shaded boxes flanking the vector sequence represent the target gene sequences
- Fig 6 is a graphical representation of a fluorescent activ ated cell sorting (FACS) analysis in which an anti- LIV-1-164647 monoclonal antibody was shown to bind primarily to the surface of 3T3 cells transfected with DNA 164647
- the term "pRK5" refers cells transfected with vector lacking a LIV- 1 - 164647 insert
- the term "pRK5- LIV-1-164647” refers to cells transfected with vector expressing full length LIV- 1 -164647
- Fig 7 is a bar graph demonstrating that the LIV- 1 - 164647 extracellular domain is expressed on the surface of cells transfected with DNA encoding the full-length LIV-1 -164647 protein
- LIV-1 refers to a gene or its encoded protein which gene transcript is detected in above normal levels in some cancer cells More specifically a LIV- 1 gene or protein ot the present invention is one which is encoded by DNA 164647 (SEQ ID NO 3) and has the deduced amino acid sequence of SEQ ID NO 4
- LIV- 1 reters to LIV- 1 -164647 where the disclosure refers to a nucleic acid comprising at least 21 nucleotides of SEQ ID NO 3 or where the disclosure refei s to an amino acid sequence compnsing at least 7 amino acids of SEQ ID NO 4 as disclosed herein
- LIV- 1 - 164647 is expressed in higher than normal amounts in a cell while the gene encoding ErbB2 receptoi is not expressed in higher than normal amounts Such higher than normal expression is termed overexpression' ot a gene or protein
- LIV-1 or LIV- 1 - 164647 may be used to refer to a LIV- 1 gene or its encoded protein Generally where a protein or peptide is contemplated the term 'LIV-1 protein will be used
- LIV-1 gene product or ' LIV- 1 protein ' reteis to the expressed protein product ot the gene preferably a polypeptide or protein form of the gene product
- a polypeptide or protein form of the LIV- 1 gene product includes a soluble form of the gene product (I e the extracellular domain (ECD) of the LIV- 1 gene product), which soluble form is useful as an antigen tor raising anti-LIV- 1 gene product antibodies that bind the extracellular domain of full length LIV-1 gene product and inhibit its activation
- LIV-1 gene product may also refer to the messenger RNA (mRNA) gene product and where appropriate the distinction between protein and mRNA is made
- a LIV- 1 protein according to the invention is encoded by a nucleic acid of the invention comprising a sequence at least 80% homologous to the DNA 164647 (SEQ ID NO 3 or its complement, Fig 2A) preferably at least approximately 90%- homologous more preferably at least approximately 95%-, and most preferably at
- anti-LIV- 1 antibody refers to an antibody which binds specifically to at least a portion ot the extracellular domain ot the LIV-1 -164647 protein having a predicted amino acid sequence of SEQ ID NO 4 (the predicted full length amino acid sequence of LIV- 1 - 164647 gene)
- the antibody binds to the extracellular domain of LIV- 1 gene product more preterably binding to the same epitope as epitopes A B or C to which the monoclonal antibodies disclosed herein bind
- the anti-LIV- 1 - 164647 antibody binds to a polypeptide having at least 65% homology to a sequence from amino acid 1 14 to and including amino acid 135 of SEQ ID NO 4 Preterably.
- an anti-LIV- 1 antibody of the invention is human or humanized when the antibody is to be used to treat a human patient
- the antibody of the invention is preferably one which binds specifically to human LIV- 1 -164647, meaning that it does not significantly cross-react with other proteins
- the extent ot binding of the antibody to proteins other than LIV- 1 gene product will be less than about 10% as determined by fluorescence activated cell sorting (FACS) analysis or radioimmunoprecipitation (RIA)
- antibody is used in the broadest sense and specifically covers for example single anti LIV- 1 monoclonal antibodies (including agonist antagonist and neutralizing antibodies), anti-LIV- 1 antibody compositions with polyepitopic specificity, single chain anti-LIV- 1 antibodies
- monoclonal antibody as used herein refers to an antibody obtained trom a population ot substantially homogeneous antibodies i e , the individual antibodies comprising the population are identical except for possible natui ally-occurnng mutations that may be present in minor amounts
- Antibodies are glycoproteins hav ing the same structural characteristics While antibodies exhibit binding specificity to a specific antigen immunoglobulins include both antibodies and other antibody-like molecules which lack antigen specificity Polypeptides ot the latter kind are. for example, produced at low levels by the lymph system and at increased levels by myelomas
- the term ' antibody is used in the broadest sense and specifically covers, without limitation intact monoclonal antibodies pol clonal antibodies, multispecific antibodies (e ? bispecitic antibodies) formed from at least two intact antibodies, and antibody fragments so long as they exhibit the desired biological activity
- “Native antibodies” and "nativ e immunoglobulins” are usually heterotetrame ⁇ c glycoproteins ot about
- Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number ot disulfide linkages varies among the heavy chains of different immunoglobulin isotypes
- Each heavy and light chain also has regularly spaced intrachain disulfide bridges
- Each heavy chain has at one end a variable domain (V H ) followed by a number of constant domains
- Each light chain has a variable domain at one end (V L ) and a constant domain at its other end.
- the constant domain ot the light chain is aligned with the first constant domain of the heavy chain
- the light-chain variable domain is aligned with the variable domain of the heavy chain
- Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains
- variable refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen
- CDRs complementarity-determining regions
- hypervanable regions both in the light-chain and the heavy-chain v a ⁇ able domains
- FR framework
- the ariable domains of native heavy and light chains each comprise four FR regions, largely adopting a -sheet configuration, connected by three CDRs which form loops connecting and in some cases forming part of.
- the CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site ot antibodies (see Kabat et al . NIH Publ No 91 -3242, Vol I, pages 647-669 ( 1991 ))
- the constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation ot the antibody in antibody-dependent cellular toxicity
- hypervanable region when used herein refers to the amino acid residues of an antibody which are responsible for antigen-binding
- the hypervanable region comprises amino acid residues from a "complementarity determining region" to "CDR" (_ e , residues in the light chain variable domain and residues in the heavy chain variable domain, Kabat et al , Sequences ot Proteins of Immunological Interest. 5th Ed Public Health Service, National Institute of Health, Bethesda, MD [1991 ]) and/or those residues from a "hyper anable loop” (( e , residues in the light chain variable domain and residues in the heavy chain variable domain , Clothia and Lesk. J Mol Biol . 196 901 -917 [ 1987])
- "Framework" or "FR residues are those variable domain residues other than the hypervanable region residues as herein defined
- Antibody fragments' comprise a portion of an intact antibody, preferably the antigen binding or variable region ot the intact antibody
- antibody fragments include Fab. Fab ' F(ab K and F ⁇ fragments, diabodies, linear antibodies (Zapata etal Protein Eng , 8( 10) 1057-1062 [1995]), single-chain ant ⁇ bod ⁇ molecules, and multispecific antibodies formed from antibody fragments
- Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab fragments, each with a single antigen-binding site, and a residual "Fc" fragment whose name reflects its ability to crystallize readily Pepsin treatment yields an F(ab')- > fragment that has two antigen-combining sites and is still capable of cross-linking antigen
- Fv is the minimum antibody fragment which contains a complete antigen-recognition and -binding site This region consists ot a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the V H -V L dimer Collectively the six CDRs confer antigen-binding specificity to the antibody However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site
- the Fab fragment also contains the constant domain of the light chain and the first constant domain (CH 1 ) of the heavy chain Fab fragments differ from Fab' fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH 1 domain including one or more cysteines from the antibody hinge region Fab'-SH is the designation herein for Fab' in which the cysteine res ⁇ due(s) of the constant domains bear a free thiol group F(ab' , antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them Other chemical couplings of antibody fragments are also known
- the "light chains” of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda ( ⁇ ), based on the amino acid sequences of their constant domains
- immunoglobulins can be assigned to different classes There are five major classes of immunoglobulins IgA. IgD. IgE. IgG. and IgM, and several of these may be further divided into subclasses (isotypes), e g , IgGl , IgG2. IgG3. IgG4. IgA. and IgA2
- the heavy-chain constant domains that correspond to the different classes of immunoglobulins are called ⁇ . ⁇ , e, ⁇ , and ⁇ , respectively
- the subunit structures and three-dimensional configurations ot different classes of immunoglobulins are well known
- the term "monoclonal antibody' as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i e . the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts Monoclonal antibodies are highly specific, being directed against a single antigemc site Furthermore, in contrast to co entional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen In addition to their specificity, the monoclonal antibodies aie advantageous in that they are synthesized by the hybridoma culture uncontaminated by other immunoglobulins The moditier monoclonal indicates the charactei of the antibody as being obtained from a substantially homogeneous population ot antibodies, and is not to be construed as requiring production of the antibody by any particular method For example, the monoclonal antibodies to be used in accordance with the present invention may be
- the monoclonal antibodies may also be isolated trom phage antibody libraries using the techniques descnbed in Clackson et al Nature, 352 624-628 [ 1991 ] and Marks et al J Mol Biol . 222 581 -597 ( 1991 ). tor example
- the monoclonal antibodies herein specifically include ' chime ⁇ c" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived trom a particular species or belonging to a particular antibody class or subclass, while the remainder ot the cha ⁇ n(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies so long as they exhibit the desired biological activity (U S Patent No 4.816.567. Morrison etal .
- Chime ⁇ c antibodies of interest herein include human constant region sequences together with antigen binding regions ot rodent (e g murine) origin or "p ⁇ matized" antibodies comprising variable domain antigen-binding sequences derived from a non-human primate (e g Old World Monkey, Ape, macaque, etc ). or antigen binding regions derived trom antibodies generated in other non-human species that have been immunized with the antigen of interest "Humanized" forms ot non-human (e g . rodent) antibodies are chime ⁇ c immunoglobulins immunoglobulin chains or fragments thereof (such as Fv, Fab. Fab'.
- humanized antibodies which contain minimal sequence derived trom non-human immunoglobulin Foi the most part humanized antibodies are human immunoglobulins (recipient antibody) in which residues trom a hypervanable region of the recipient are replaced by residues from a hypervanable region ot a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity
- donor antibody such as mouse, rat or rabbit having the desired specificity, affinity, and capacity
- donor antibody such as mouse, rat or rabbit having the desired specificity, affinity, and capacity
- framework region (FR) residues ot the human immunoglobulin are replaced by corresponding non-human residues
- humanized antibodies may comprise residues which are found neither in the recipient antibody nor in the donor antibody
- the humani/ed antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that ot a human immunoglobulin Foi further details, see. Jones et al . Nati ⁇ e. 321 522-525 ( 1986). Rcichmann et al Nature, 332 323-329 [ 1988], and Presta, Curr Op Struct Biol .
- Single-chain Fv or “sFv” antibody fragments comprise the V H and V L domains ot antibody, wherein these domains are present in a single polypeptide chain
- the Fv polypeptide further comprises a polypeptide linker between the V H and V L domains which enables the sFv to form the desired structure for antigen binding
- the teim diabodies refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (V H ) connected to a light-chain variable domain (V L ) in the same polypeptide chain (V H - V L )
- V H heavy-chain variable domain
- V L light-chain variable domain
- the domains are forced to pair with the complementary domains ot another chain and create two antigen-binding sites
- Diabodies are described more fully in, for example. EP 404 097, WO 93/1 1 161 , and Hol nger et al .
- an "isolated' antibody is one which has been identified and separated and/or recovered trom a component of its natural environment Contaminant components ot its natural environment are materials which would interfere with diagnostic or therapeutic uses tor the antibody, and may include enzymes, hormones and othei proteinaceous or nonproteinaceous solutes
- the antibody will be purified ( 1 ) to greater than 95%- by weight ot antibody as determined by the Lowry method, and most preferably more than 99%- by weight.
- overexpression refers to overexpression of a gene and/or its encoded protein in a cell, such as a cancer cell
- a cancer cell that o ⁇ erexpresses" a protein is one that has significantly higher levels of that protein compared to a noncancerous cell of the same tissue type
- the overexpression ot a protein LIV- 1 protein may be caused by gene amplification or by increased transcription or translation
- Overexpression ot a LIV- 1 protein may be determined
- LIV- 1 erexpression by measuring shed antigen (e g , LIV-1 extracellular domain) in a biological fluid such as serum by contacting the fluid or othei sample with an antibody that binds to a LIV- 1 protein or fragment thereof
- a biological fluid such as serum
- a biological fluid such as serum
- an antibody that binds to a LIV- 1 protein or fragment thereof
- aie available to the skilled practitioner
- e g by external scanning tor radioactivity 01 by analyzing a biopsy taken trom a paiient picviously exposed to the antibody
- a cell that "overexpresses LIV- 1 has significantly higher than normal LIV- 1 nucleic acid levels compared to a noncancerous cell ot the same tissue type
- the cell is a cancer cell, e _? a breast ov arian, prostate stomach, endometnal. salivary gland lung, kidney colon, thyroid, pancreatic or bladder cell
- the cell may also be a cell line such as SKBR3. BT474. Calu 3. MDA-MB-453 MDA-MB-361 or SKOV3
- a cancer that is not characterized by overexpression ot a LI ⁇ - 1 protein oi a LIV- ! gene is one which, in a diagnostic assay, does not express higher than normal levels ot LIV- 1 gene oi LIV- 1 protein compared to a noncancerous cell ot the same tissue type
- cancer and "cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth Examples ot cancer include but are not limited to. carcinoma, lymphoma. blastoma.
- sarcoma and leukemia More particular examples of such cancers include bieast cancer, prostate cancer, colon cancer, squamous cell cancer, small-cell lung cancer, non-small cell lung cancer gastrointestinal cancer, pancreatic cancer, ghoblastoma. cervical cancer, ovarian cancer, liver cancel bladder cancer hepatoma. colorectal cancer, endometnal carcinoma, salivary gland carcinoma, kidnev cancer liver cancer vulval cancer, thyroid cancer, hepatic carcinoma and various types ot head and neck cancer
- gene amplification and “gene duplication” are used interchangeably and reter to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line
- the duplicated region (a stretch ot amplified DNA) is often referred to as "amphcon "
- mRNA messenger RNA
- i e the level of gene expression
- Tumor refers to all neoplastic cell growth and proliferation w hether malignant or benign and all pre-cancerous and cancerous cells and tissues
- Treatment is an intervention performed with the intention ot preventing the development or altering the pathology of a disorder
- treatment' refers to both therapeutic treatment and prophylactic or preventati ve measures
- Those in need ot treatment include those already with the disorder as well as those in which the disorder is to be prevented
- a therapeutic agent may directly decrease the pathology of tumor cells, or render the tumor cells more susceptible to tieatment by other therapeutic agents, e g , radiation and/or chemotherapy
- the "pathology” of cancer includes all phenomena that compromise the ell-being ot the patient This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, etc
- “Mammal” tor purposes ot treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo sports, or pet animals, such as dogs, horses, cats, cattle pigs, sheep, etc Preterably. the mammal is human
- Carriers as used herein include pharmaceutically acceptable carriers, excipients. or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrauons employ ed Often the physiologically acceptable carrier is an aqueous pH buffered solution
- physiologicalK acceptable carriers include butters such as phosphate, citrate, and other organic acids, antioxidants including ascorbic acid, low molecular weight (less than about 10 residues) polypeptide, proteins, such as serum albumin gelatin, or immunoglobulins, hydrophilic polymei s such as polyvinylpyrro done, amino acids such as glycine glutamine, asparagine, arginine or lysine.
- cytotoxic agent refers to a substance that inhibits or prevents the function of cells
- radioactive isotopes e ? . I I Y and
- chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial fungal, plant or animal origin or fragments thereof
- a “chemotherapeutic agent” is a chemical compound useful in the treatment of cancer
- chemotherapeutic agents include ad ⁇ amycin, doxorubicm, epirubicin 5-fluorouracil. cytosine arabinoside (' Ara- C"), cyclophosphamide thiotepa, busulfan, cytoxin, taxoids, e g , pachtaxel (Taxol. Bristol-My ers Squibb Oncology, Princeton, NJ) and doxetaxel (Taxotere, Rh ⁇ ne-Poulenc Rorer, Antony, Rnace). toxotere.
- methotrexate methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, lfostamide, mitomycin C mitoxantrone vmcristme, vinorelbine, carboplatin. temposide, daunomycin, carminomycin, aminoptenn, dactinomycin. mitomycins, esperamicins (see U S Pat No 4.675.187), 5-FU, 6-th ⁇ oguan ⁇ ne 6-mercaptopu ⁇ ne. actinomycin D VP- 16.
- growth inhibitory agent when used herein refers to a compound or composition which inhibits growth of a cell, especially cancer cell overexpressing any ot the genes identified herein, either in ⁇ ⁇ t ⁇ o or in ⁇ ⁇ o
- growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in S phase
- growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce Gl arrest and M-phase arrest
- Classical M-phase blockers include the vincas (vinc ⁇ stine and vinblastine), taxol, and topo II inhibitors such as doxorubicm, epirubicin.
- DNA alkylating agents such as tamoxifen, prednisone. dacarbazine, mechlorethamine, cisplatin. methotrexate, 5- fluorouracil, and ara-C Further information can be found in 77 ⁇ e Molecular Basis of Cancer, Mendelsohn and Israel, eds . Chapter 1 , entitled "Cell cycle regulation, oncogens, and antineoplastic drugs" by Murakami et al , (WB Saunders Philadelphia, 1995), especially p 13
- Doxorubicm is an athracychne antibiotic
- the full chemical name ot doxorubicm is (8S-c ⁇ s)-10-[(3- am ⁇ no-2.3.6-t ⁇ deoxy- ⁇ -L-lyxo-hexopyranosyl)oxy]-7,8.9, 10-tetrahydro-6,8, l l -t ⁇ hydroxy-8-(hydroxyacetyl)- l - methoxy-5.12-naphthacened ⁇ one
- cytokine' is a gene ⁇ c term tor proteins released by one cell population which act on another cell as intercellular mediatoi s
- cytokines are h mphokines, monokines and traditional polypeptide hormones Included among the cytokines are growth hormone such as human growth hormone N-methionyl human growth hormone, and bovine growth hormone parathyroid hormone, thyroxine, insulin, proinsuhn. relaxin. prorelaxin, glycopiotein hormones such as follicle stimulating hormone (FSH). thyroid stimulating hormone (TSH), and luteinizing hormone (LH). hepatic growth factor, tibroblast growth factor, piolactin.
- FSH follicle stimulating hormone
- TSH thyroid stimulating hormone
- LH luteinizing hormone
- TGFs transforming growth factors
- EPO erythropoietin
- CSFs colony stimulating factors
- M-CSF colony stimulating factors
- cytokine includes proteins trom natural sources or from recombinant cell culture and biologically active equi alents ot the native sequence cytokines
- prodrug as used in this application reters to a precursor or derivative form of a pharmaceutically active substance that is less cytotoxic to tumor cells compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form See. e g Wilman, "Prodrugs in Cancer Chemotherapy” Biochemical Society Tiatnactio ⁇ s 14. pp 375-382 615th Meeting Harbor ( 1986) and Stella et al . "Prodrugs A Chemical Approach to Targeted Drug Delivery. " Duected Ding Delneiy Borchardt et al , (ed ).
- the prodrugs of this invention include, but are not limited to phosphate-containing prodrugs. thiophosphate-contaimng prodrugs. sultate-containing pi odrugs, peptide-containing prodrugs. D-amino acid-moditied prodrugs, glycosylated prodrugs. ⁇ -lactam-contaimng prodrugs.
- ot cytotoxic drugs that can be derivatized into a prodrug form for use in this invention include, but are not limited to. those chemotherapeutic agents described above
- an “effective amount” of a polypeptide disclosed herein or an antagonist thereof, in reference to inhibition of neoplastic cell growth, tumor growth or cancer cell growth is an amount capable of inhibiting, to some extent the growth ot target cells
- the term includes an amount capable of invoking a growth inhibitory, cytostatic and/or cytotoxic effect and or apoptosis of the target cells
- An “effective amount” ot a LIV-1 polypeptide antagonist for purposes ot inhibiting neoplastic cell growth, tumor growth or cancer cell gro th may be determined empirically and in a routine manner
- a "therapeutically effective amount' in reference to the treatment of tumor, reters to an amount capable of invoking one or more ot the following ettects ( 1 ) inhibition, to some extent ot tumor growth, including, slowing down and complete growth arrest, (1) reduction in the number ot tumor cells.
- a "therapeutically effective amount of a LIV- 1 polypeptide antagonist for purposes of treatment of tumor may be determined empirically and in a routine manner
- a ' growth inhibitory amount' ot a LIV- 1 antagonist is an amount capable ot inhibiting the growth ot a cell especially tumor, e g . cancer cell, either m n o A ' growth inhibitory amount" of a LIV- 1 antagonist for purposes of inhibiting neoplastic cell growth may be determined empirically and in a routine manner
- a "cytotoxic amount" of a LIV-1 antagonist is an amount capable of causing the destruction of a cell especially tumor, e ⁇ . cancer cell, either in ⁇ ⁇ tro or in ⁇ ⁇ o
- a "cytotoxic amount" of a LIV- 1 antagonist tor purposes of inhibiting neoplastic cell growth may be determined empirically and in a routine manner
- Percent (%-) amino acid sequence homology or identity with respect to the LIV- 1 polypeptide sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in a LIV- 1 sequence, after aligning the sequences and introducing gaps if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity Alignment for purposes ot determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art. tor instance, using publicly available computer software such as BLAST. BLAST-2.
- ALIGN ALIGN, ALIGN-2 or Megahgn (DNASTAR) software
- ALIGN-2 ALIGN, ALIGN-2 or Megahgn (DNASTAR) software
- Those skilled in the art can determine appropriate parameters tor measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length ot the sequences being compared
- howevei % amino acid sequence identity values are obtained as described below by using the sequence comparison computer program ALIGN-2 wherein the complete source code for the ALIGN-2 program was authored by Genentech. Inc , and the source code shown in Figures 20A-Q has been filed with user documentation in the U S Copyright Office. Washington D C . 20559, where it is registered under U S Copyright Registration No TXU510087 and is provided in Table 1
- the ALIGN-2 program is publicly available through Genentech, Inc . South San Francisco. California
- the ALIGN-2 program should be compiled for use on a UNIX operating system, preterably digital UNIX V4 0D
- the % amino acid sequence identity of a given amino acid sequence A to, with, oi against a given amino acid sequence B is calculated as follows 100 times the fraction X/Y where X is the number of amino acid residues scored as identical matches by the sequence alignment piogram ALIGN-2 in that program ' s alignment ot A and B.
- % amino acid sequence homology or identity values used heiein are obtained as described above using the ALIGN-2 sequence comparison computer program However % amino acid sequence identity may also be determined using the sequence comparison piogram NCBI-BLAST2 (Altschul et al , Nucleic Acids Res .
- NCBI-BLAST2 sequence comparison program may be downloaded trom http //www ncbi nlm nih gov
- the % amino acid sequence identity of a given amino acid sequence A to with or against a given amino acid sequence B is calculated as follows 100 times the fraction X Y where X is the number of amino acid residues scored as identical matches by the sequence alignment program NCBI-BLAST2 in that program s alignment of A and B, and where Y is the total number ot amino acid residues in B It will be appreciated that where the length ot amino acid sequence A is not equal to the length of amino acid sequence B. the % amino acid sequence identity ot A to B will not equal the % amino acid sequence identity of B to A
- % amino acid sequence identity value is determined by dividing (a) the number ot matching identical amino acids residues between the amino acid sequence of the LIV- 1 polypeptide ot interest having a sequence derived from the native LIV- 1 polypeptide encoded by DNA 164647 and the comparison amino acid sequence ot interest (/ e .
- the sequence against which the LIV- 1 polypeptide of interest is being compared which may be a LIV-1 variant polypeptide) as determined by WU-BLAST-2 by (b) the total number ot amino acid residues of the LIV- 1 polypeptide of interest
- the amino acid sequence A is the comparison amino acid sequence of interest
- the amino acid sequence B is the amino acid sequence of the LIV- 1 polypeptide of interest
- Percent (%-) nucleic acid sequence homology or identity with respect to the LIV- 1 polypeptide-encoding nucleic acid sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in a LIV- 1 polypeptide-encoding nucleic acid sequence after aligning the sequences and introducing gaps, if necessary to achieve the maximum percent sequence identity Alignment for purposes ot determining percent nucleic acid sequence identity can be achieved in v arious ways that are within the skill in the art. for instance using publicly available computer software such as BLAST. BLAST-2 ALIGN.
- ALIGN-2 or Mega gn (DNASTAR) software Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length ot the sequences being compared For purposes herein, however, % nucleic acid sequence identity values are obtained as described below by using the sequence comparison computer program ALIGN-2.
- sequence comparison computer program ALIGN-2 wherein the complete source code for the ALIGN-2 program is has been filed with user documentation in the U S Copyright Office Washington D C 20559, where it is registered under U S Copyright Registration No TXU510087. and is provided herein in Table 1 as source code
- the ALIGN-2 program is publicly available through Genentech, Inc . South San Francisco California
- the ALIGN-2 program should be compiled tor use on a UNIX operating system, preferably digital UNIX V4 0D All sequence comparison parameters are set by the ALIGN-2 program and do not vary
- l*X"l 0.0.0,0, 0, 0, 0, 0, 0.0, 0, 0.0, 0,_M, 0.0.0, 0, 0.0, 0.0.0, 0, 0 ⁇ . l x Y x l -3.-3, 0.-4, -4, 7,-5, 0,-1, 0,-4,-l.-2,-2._M.-5.-4,-4,-3.-3.0.-2.0, 0,10,-4 ⁇ . l*Z x l 0.1,- -5,2, 3,-5, 0, 2,-2, 0, 0.-2.-1, 1,_M.0.3.0, 0.0, 0.-2.-6.0,-4.4 ⁇
- tile 1 and f ⁇ le2 are two dna or two prote sequences
- Output is in the tile align out x
- the program may create a tmp file in /tmp to hold info about traceback x Original version developed under BSD 4 3 on a ⁇ ax 8650 */
- dumpblockO dump a block of lines with numbers stars pr_ahgn()
- strip path or prefix trom pn return len pr_al ⁇ gn() "/ static st ⁇ pname(pn) stripname char "pn /" tile name (may be path) "/
- cleanupO - cleanup any tmp file getseqO — read in seq, set dna len, maxlen " g_calloc( ) - callocO with error checkin * readjmpsO — get the good jmps.
- trom tmp tile it necessary " writejmpsO — write a tilled array ot jmps to a tmp tile nw( ) */
- the 9c nucleic acid sequence identity ot a given nucleic acid sequence C to with oi against a given nucleic acid sequence D (which can alternatively be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to with or against a given nucleic acid sequence D ⁇ is calculated as follo 100 times the traction W/Z where W is the number of nucleotides scored as identical matches by the sequence alignment program ALIGN-2 in that program ' s alignment of C and D. and where Z is the total number of nucleotides in D It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D.
- 9c nucleic acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al Nucleic Acids Res 25 3389-3402 ( 1997))
- NCBI-BLAST2 sequence comparison progi am may be downloaded from http //www ncbi nlm nih gov
- the 9c nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D is calculated as follows 100 times the fraction W/Z where W is the number of nucleotides scored as identical matches by the sequence alignment program NCBI- BLAST2 in that program's alignment of C and D.
- a 9c nucleic acid sequence identity value is determined by dividing (a) the number of matching identical nucleotides between the nucleic acid sequence of the LIV- 1 polypeptide- encoding nucleic acid molecule ot interest having a sequence derived from the native sequence LIV- 1 polypeptide- encoding nucleic acid and the comparison nucleic acid molecule of interest (i e .
- the sequence against which the LIV-1 polypeptide-encoding nucleic acid molecule ot interest is being compared which may be a variant LIV- 1 polynucleotide) as determined by WU-BLAST-2 by (b) the total number ot nucleotides ot the LIV- 1 polypeptide- encoding nucleic acid molecule of interest
- the nucleic acid sequence A is the comparison nucleic acid molecule ot interest
- the nucleic acid sequence B is the nucleic acid sequence ot the LIV- 1 polypeptide-encoding nucleic acid molecule of interest
- amino acid residues in the sequences compared that are not only identical, but also those that have similar properties Amino acid residues that scoie a positive value to an amino acid residue ol interest are those that are either identical to the amino acid residue of interest or are a preferred substitution (as defined in Table 2 below) ot the amino acid residue ot interest
- Tyr (Y) trp, phe. thr, ser phe Val (V) lie, leu. met, phe, ala, norleucme leu
- Substantial modifications in function or immunological identity ot the polypeptide are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure ot the polypeptide backbone in the area ot the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity ot the molecule at the target site, or (c) the bulk of the side chain Naturally occurring residues are divided into groups based on common side-chain properties
- Non-conserv ati ve substitutions will entail exchanging a member of one of these classes for another class Such substituted residues also may be introduced into the conser ative substitution sites or more preterably. into the remaining (non-conserved) sites
- the variations can be made using methods known in the art such as ohgonucleotide-mediated (site- directed) mutagenesis. alanine scanning, and PCR mutagenesis Site-directed mutagenesis [Carter etal . Nucl Acids Res . 13 4331 ( 1986). Zoller et al , Nucl Acids Res ]0 6487 ( 1987)], cassette mutagenesis [Wells et al Gene 34 315 ( 1985)], restriction selection mutagenesis [Wells etal Philos Trans R Soc London SerA, 317 415 ( 1986)1 or other known techniques can be performed
- the 9c value of positives of a given amino acid sequence A to with, or against a given amino acid sequence B is calculated as follows 100 times the fraction X/Y where X is the number of amino acid residues scoring a positive ⁇ alue as defined above by the sequence alignment program ALIGN-2 m that program's alignment of A and B.
- isolated. when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separated and/or recovered from a component of its natural environment Preterably, the isolated polypeptide is free of association with all components with which it is naturally associated Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses tor the polypeptide.
- the polypeptide will be purified ( 1 ) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or.
- silver stain Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the LIV- 1 natural environment will not be present Ordinarily, however isolated polypeptide will be prepared by at least one purification step
- An "isolated" nucleic acid molecule encoding a LIV- 1 polypeptide or an "isolated nucleic acid encoding an anti-LIV- 1 antibody is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the LIV- 1 -encoding nucleic acid or the anti-LIV- 1 -encoding nucleic acid
- the isolated nucleic acid is free ot association with all components with which it is naturally associated
- An isolated LIV-1 -encoding nucleic acid molecule or an anti- LIV-1 -encoding nucleic acid molecule is other than in the form or setting in which it is found in nature
- control sequences reters to DNA sequences necessary for the expression ot an operably linked coding sequence in a particular host organism
- the control sequences that are suitable tor prokaryotes, tor example. include a promoter optionally an operator sequence and a ribosome binding site
- Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers
- Nucleic acid is ' operably linked" when it is placed into a functional relationship with another nucleic acid sequence
- DNA for a presequence or secretory leader is operably linked to DNA for a poly peptide if it is expressed as a preprotein that participates in the secretion of the polypeptide.
- a promoter or enhancer is operably linked to a coding sequence it it affects the transcription of the sequence, or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation
- Generally operably linked means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase
- enhancers do not have to be contiguous Linking is accomplished by hgation at convenient restriction sites It such sites do not exist, the synthetic o gonucleotide adaptors or linkers are used in accordance with conventional practice
- “Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent while lower temperatures less so For additional details and explanation of stringency of hybridization reactions, see Ausubel et al . Current Protocols in Molecular Biology, Wiley Interscience Publishers. ( 1995)
- Stringent conditions or “high stringency conditions”, as defined herein, may be identified by those that ( 1 ) employ low ionic strength and high temperature for washing for example 0 015 M sodium chlor ⁇ de/0 0015 M sodium c ⁇ trate/0 ⁇ 9c sodium dodecyl sulfate at 50°C, (2) employ during hybridization a denaturing agent, such as formamide.
- washing solution and hybridization conditions e g , temperature, ionic strength and % SDS
- moderately stringent conditions is overnight incubation at 37 l C in a solution comprising 20% formamide.
- Bioactivity in the context ot an antibody or another antagonist molecule that can be identified by the screening assays disclosed herein e g an organic or inorganic small molecule peptide. etc
- Biological activity is used to retei to the ability of such molecules to bind or complex with the polypeptides encoded by the amplified genes identified herein or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins oi otherwise interfere with the transcription or translation of a LIV- 1 polypeptide
- a preferred biological activ lty is growth inhibition ot a target tumor cell
- Another preferred biological activity is cytotoxic act ⁇ lty resulting in the death of the target tumor cell
- biological activity in the context ot a LIV- 1 polypeptide means the ability ot a LIV- 1 polypeptide to induce neoplastic cell growth or uncontrolled cell growth or to act as an indication ot a particular form ot neoplasm that is particularly metastatic
- immunological activity means immunological cross-reactivity with at least one epitope of a LIV- 1 polypeptide
- immunological cross-reactivity means that the candidate polypeptide is capable of competitively inhibiting the qualitativ e biological activity of a LIV- 1 polypeptide having this activity with polyclonal antisera raised against the known active LIV- 1 polypeptide
- Such antisera are prepared in conventional fashion by injecting goats or rabbits, for example, subcutaneously with the known active analogue in complete Freund's adjuvant, followed by booster intraperitoneal or subcutaneous injection in incomplete Freunds
- the immunological cross-reactivity preterably is specific" which means that the binding af finity of the immunologically cross-reactive molecule (e g .
- an antibody identified, to the corresponding LIV- 1 polypeptide is significantly higher (preterably at least about 2-t ⁇ mes, more preterably at least about 4-t ⁇ mes e ⁇ en more preterably at least about 8-t ⁇ mes, most preferably at least about 10-t ⁇ mes higher) than the binding affinity of that molecule to any other known native polypeptide
- antagonist is used in the broadest sense, and includes any molecule that partially or fully blocks inhibits or neutralizes a biological activity ot a native LIV- 1 polypeptide disclosed herein or the tiansc ⁇ ption oi translation thereof Suitable antagonist molecules specifically include antagonist antibodies or antibody fragments fragments, peptides, small organic molecules, anti-sense nucleic acids, etc Included are methods toi identifying antagonists of a LIV- 1 polypeptide with a candidate antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the LIV- 1 polypeptide
- a "small molecule” is defined herein to have a molecular weight below about 500 Daltons
- label when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibodv so as to generate a ' labeled ' antibody
- the label may be detectable by itself (e g . radioisotope labels or fluorescent labels) or in the case ot an enzymatic label may cataly/e chemical altci ation of a substrate compound or composition which is detectable
- Radionuclides that can serve as detectable labels include, tor example. 1- 131 1- 123 1- 125 Y-90 Re- 188 Re- 186. At-21 1.
- Cu-67 B ⁇ -212 and Pd- 109 By ' solid phase ' is meant a non-aqueous matrix to which the antibody ot the present invention can adheie
- solid phases encompassed herein include those formed partially or entirely of glass (e g controlled pore glass), polysaccha ⁇ des (e g agarose) polyacrylamides polystyrene, polyv inyl alcohol and sihcones
- the solid phase can comprise the well ot an assay plate in others it is a purification column (e _? . an affinity chromatography column)
- This term also includes a discontinuous solid phase ot disciete particles, such as those described in U S Patent No 4.275 149
- a ' hposome is a small vesicle composed of various types of pids. phosphohpids and/or surfactant which is useful tor delivery of a drug (such as a LIV- 1 polypeptide or antibody thereto and optionally a chemotherapeutic agent) to a mammal
- a drug such as a LIV- 1 polypeptide or antibody thereto and optionally a chemotherapeutic agent
- the components of the hposome are commonly arranged in a bilayer formation similar to the lipid arrangement of biological membranes
- the term lmmunoadhesin designates antibody-like molecules which combine the binding specificity ot a heterologous protein (an "adhesin ' tor example a receptor, ligand.
- the immunoadhesins comprise a fusion of the adhesin amino acid sequence with the desired binding specificity which is other than the antigen recognition and binding site (antigen combining site) ot an antibody (/ e is "heterologous"), and an immunoglobulin constant domain sequence
- the adhesin part of an lmmunoadhesin molecule typically is a contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand
- the immunoglobulin constant domain sequence in the lmmunoadhesin may be obtained from any immunoglobulin such as IgG-1 , IgG-2 IgG-3 or IgG-4 subtypes IgA (including IgA-1 and IgA-2). IgE IgD or IgM. and any subclass or isotype thereof
- ErbB2 c-Erb-B2 ' are used interchangeably Unless indicated otherwise the terms "ErbB2" "c-Erb-B2" and ' HER2 w hen used herein refer to the human protein, and eibBl ' ' c-erb-Bl.” and “her2” reier to human gene
- the human erbBl gene and ErbB2 protein are, for example described in Semba et al , PNAS (USA) 82 6497-6501 ( 1985) and Yamamoto et al Nature 319 230-234 ( 1986) (Genebank accession number X03363) ErbB2 comprises four domains (Domains 1 -4)
- the "epitope 4D5" is the region in the extracellular domain ot ErbB2 to which the antibody 4D5 (ATCC CRL 10463) binds This epitope is close to the transmembrane region of ErbB2
- epitope mapping can be performed to assess whether the antibody binds to the 4D5 epitope of ErbB2 (/ e any one or more residues in the region from about residue 529 e g about residue 561 to about residue 625 inclusive)
- the "epitope 3H4" is the region in the extracellular domain of ErbB2 to which the antibody 3H4 binds
- This epitope includes residues from about 541 to about 599, inclusive, in the amino acid sequence of ErbB2 extracellular domain
- the "epitope 7C2/7F3" is the region at the N terminus ot the extracellular domain of ErbB2 to which the 7C2 and/or 7F3 antibodies (ATCC HB- 12215 and ATCC HB- 12216 respectively) bind To screen tor antibodies which bind to the 7C2/7F3 epitope. a routine cross-blocking assay such as that described in Antibodies A Laboraton Manual. Cold Spring Harbor Laboratory Ed Harlow and David Lane ( 1988), can be performed Alternatively, epitope mapping can be performed to establish whether the antibody binds to the 7C2/7F3 epitope on ErbB2
- the term "induces cell death” or " capable ot inducing cell death” reters to the ability ot the anti-LIV- 1 gene product antibody, alone or in co-treatment with a chemotherapeutic agent to make a viable cell become non viable
- the "cell ' here is one which expresses the LIV-1 gene product, especially where the cell overexpresses the LIV- 1 gene product
- a cell which "overexpresses" LIV- 1 has significantly higher than normal LIV-1 mRNA and/or LIV-1 protein levels compared to a noncancerous cell ot the same tissue type
- the invention does not also overexpress ErbB2 0 e the cell expresses ErbB2 at a level that is approximately the same or less than a normal, non-cancerous cell of the same cell or tissue type)
- the cell is a cancer cell, e g a breast, lung, or prostate cell
- the cell may be from a cell line transformed with L
- the phrase "induces apoptosis” or “capable ot inducing apoptosis” reters to the ability of the antibody to induce programmed cell death as determined by binding of annexin V, fragmentation of DNA, cell shrinkage, dilation of endoplasmic reticulum, cell fragmentation, and/or formation of membrane vesicles (called apoptotic bodies)
- the cell is one which overexpresses the LIV-1 gene product
- the "cell” is a tumor cell, e g a breast, lung, or prostate cell In vitio, the cell may be trom a cell line transformed with LIV-1 DNA.
- the antibody which induces apoptosis is one which results in about 2 to 50 fold, preferably about 5 to 50 fold, and most preferably about 10 to 50 fold induction of annexin binding relative to untreated cell in an ' annexin binding assay using cells ' (sec below)
- the term "salvage receptor binding epitope” reters to an epitope ot the Fc region ot an IgG molecule (e g , IgG j , IgG 2 , IgG 3 , or IgG 4 ) that is responsible for increasing the in vno serum halt-
- a disorder " ' is any condition that would benefit trom treatment with the anti-LIV- 1 gene product antibody This includes chronic and acute disorders or diseases including those pathological conditions which predispose the mammal to the disorder in question
- Non-hmiting examples ot disorders to be treated herein include benign and malignant tumors ot breast, lung, and prostate tissue
- the term "package insert” is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration contraindications and/or warnings concerning the use ot such therapeutic products
- serum concentration refers to the concentration of a drug in the blood serum of an animal or human patient being treated with the drug Serum concentration of antibody, tor example, is preferably determined by immunoassay
- the immunoassay is ELISA according to the procedure disclosed herein
- peak serum concentration refers to the maximal serum drug concentration shortly after delivery ot the drug into the animal or human patient, after the drug has been distributed throughout the blood system, but before significant tissue distribution, metabolism or excretion of drug by the body has occurred
- trough serum concentration refers to the serum drug concentration at a time after delivery of a previous dose and immediately prior to delivery of the next subsequent dose of drug in a series of doses
- the trough serum concentration is a minimum sustained efficacious drug concentration in the series of drug administrations
- the trough serum concentration is frequently targeted as a minimum serum concentration for efficacy because it represents the serum concentration at which another dose of drug is to be administered as part of the treatment regimen
- the trough serum concentration is most preterably attained within 1 day of a front loading initial drug deli ery
- the peak serum concentration is preferably attained in 3 da s or less
- the trough serum concentration is preferably attained in 4 weeks or less, preterably 3 weeks or less, more preferably 2 weeks or less, most preferably in 1 week or less, including 1 day or less using any ot the drug delivery methods disclosed herein
- intravenous infusion refers to introduction ot a drug into the vein of an animal or human patient over a period ot time greater than approximately 5 minutes, preferably between approximately 30 to 90 minutes, although, according to the invention, intravenous infusion is alternatively administered for 10 hours or less
- intravenous bolus or “intravenous push” reters to drug administration into a vein of an animal or human such that the body receives the drug in approximately 15 minutes or less, preferably 5 minutes or less
- subcutaneous administration reters to introduction of a drug under the skin ot an animal or human patient, preferable within a pocket between the skin and underlying tissue, by relatively slow sustained delivery from a drug receptacle
- the pocket may be created by pinching or drawing the skin up and a ay from underlying tissue
- subcutaneous infusion refers to introduction of a drug under the skin ot an animal or human patient preferably within a pocket between the skin and underlying tissue by relat ⁇ ⁇ _l ⁇ slow sustained deliver, from a drug receptacle foi a penod ot time including but not limited to 30 minutes or less or 90 minutes or less
- the infusion may be made by subcutaneous implantation of a di ug deliv er ⁇ pump implanted under the skin of the animal or human patient wherein the pump deliv ers a predetermined amount ot drug for a predetermined period of time such as 30 minutes 90 minutes or a time period spanning the length ot the treatment regimen
- subcutaneous bolus refers to drug administration beneath the skin of an animal oi human patient where bolus drug delivery is pteterably less than approximately 15 minutes moie preferably less than 5 minutes and most preterably less than 60 seconds Administration is preterably within a pocket between the skin and underlying tissue where the pocket is created for example by pinching or drawing the skin up and a av horn underlying tissue
- front loading when referring to drug administration is meant to desL ⁇ be an initially higher dose followed by the same or lower doses at interv als
- the initial higher dose or doses are meant to more rapidl v increase the animal or human patient s serum drug concentration to an efficacious target serum concentration
- a form ot breast cancer in w hich the cells overexpress the LIV- 1 gene product (e g LI ⁇ - 1 - 164647 mRNA) but do not overexpress ErbB2 has been discovered and is uniquely disclosed herein Detection of the tumor type was made using microarrav technology Using nucleic acid microarrays test and control mRN ⁇ samples trom test and control tissue samples are reverse transcribed and labeled to genei ate cDN A probes The cDN A probes are then hybridized to an array of nucleic acids immobilized on a solid support The array is configured such that the sequence and position ot each member ot the array is known Hybridization of a labeled probe with a particular array member indicates that the sample from which the probe was derived expresses that gene Ii the hybridization signal ot a probe trom a test (disease tissue) sample is greater than hybridization signal ot a probe from a control (normal tissue) sample, the
- Tumor cells were grossly dissected trom surrounding, non-cancerous cells in breast tumor tissue Hematoxy n and eosin staining of the cells confirmed that the excised cells were trom tumor
- the mRNA of the tumor cells was converted to cDNA by RT/PCR methodology, labeled with fluorescent tags, and allowed to hybridize to the ESTs arrayed on a glass slide
- An imaging device detected and measured the tluoiescence ot each sample on the slide where fluorescence represents a labeled messenger trom the test cells identifiable due to its hybridization with a known nucleic acid sequence (an EST) at a known position on the slide
- Relative fluorescence indicated relative activity ot a gene with strong flourescence indicating an active gene expressing a relative large amount ot messenger Little or no tlourescence indicated that no labeled messenger hybridized to the ESTs Detection of tluorescently labeled probes
- the nucleic acid of the inv ention comprises a sequence having at least 65 %, preterably at least 75% more preferably at least 85%, still more preferably at least 90%, and most preterably at least 96% homologous to a sequence trom approximately nucleotide 412 to and including nucleotide 477 ot SEQ ID NO 3 or its complementary sequence
- the nucleic acid of the inv ention comprises a sequence having at least 65 %, preterably at least 75% more preferably at least 85%, still more preferably at least 90%, and most preterably at least 96% homologous to a sequence trom approximately nucleotide 412 to and including nucleotide 477 ot SEQ ID NO 3 or its complementary sequence
- the nucleic acid of the inv ention comprises a sequence having at least 65 %, preterably at least 75% more preferably at least 85%, still more preferably at least 90%, and most preterably at least 96% homologous to
- the isolated polypeptide of the invention comprises an amino acid sequence from amino acid 126 to and including amino acid 132 ot SEQ ID NO 4 Example 2.
- LIV-1 A previously unknown LIV-1 gene and its encoded protein are uniquely disclosed herein
- the nucleic acid sequence of LIV-1 (DNA164647, SEQ ID NO 3 and its complement) and amino acid sequence of LIV- 1 encoded therein (SEQ ID NO 4) are uniquely disclosed herein
- This example describes the preparation and isolation of the presently disclosed LIV-1 protein encoded by DNA 164647 Subsequent examples describe the tissue expression profile of LIV-1 and its partial exposure at the cell surface
- the LIV- 1 gene is disclosed herein to be expressed in various tumor tissues including breast, lung, prostate, and colon Cell surface expression of this tumor-associated protein makes LIV-1 a useful target tor cancer detection and treatment
- the LIV-1 described by DNA 164647 has a unique nucleic acid sequence and unique amino acid sequence
- the presently disclosed LIV- 1 differs in nucleic acid sequence and amino acid sequence from another form of LI V- 1 protein previously described by Green et al (see Green, C et al direct submission GenBank Accession Nos U41060 (nucleic acid sequence) and AAA96258 (amino acid sequence))
- the nucleic acid sequence of AAA96258 LIV-1 (SEQ ID NO 1 (coding sequence)) is shown in Fig 1A
- the predicted amino acid sequence ( AAA96258, SEQ ID NO 2) encoded by nucleic acid sequence U41061 (SEQ ID NO 1 ) is shown in Fig IB Included in the diagram are predictions for sequences encoding a signal sequence extracellular domain and transmembrane domain
- the presently disclosed LIV 1 differs in predicted extracellular domain region
- the present invention provides methods for using DNA 164647 encoding LIV-1 polypeptide for the production ot compounds
- FLIP is a very rapid and high-throughput method of isolating an entire clone vector plus insert, of a specific nucleic acid molecule trom any nucleic acid library which was propagated in a host cell that methylates the nucleic acid library
- the FLIP cloning method amplifies a target gene or nucleotide sequence and generates a highly purified population of the target gene
- Fig 5 is a flow diagram of a FLIP cloning process DNA 164647 was isolated by FLIP methodology using the following primers and probe
- a human LIV- 1 gene (Genbank Accession* U41060) has been sequenced by C Green et al (direct submission November 21 1995) The sequence is 3461 bp (SEQ ID NO 1 , Fig 1 A) and includes the an open reading frame (ORF) Using the FLIP methodology and the primers and probe disclosed above a cDNA clone was isolated from a pool of fifty human cDNAs trom cDNA libraries representing various tissues (Genentech cDNA libraries Genentech, Inc , So San Francisco, CA) The isolated cDNA clone includes a LIV 1 gene comprising a variant nucleic acid sequence (DNA164647, SEQ ID NO 3 (coding sequence) and its complementary sequence) and a variant deduced amino acid sequence (SEQ ID NO 4) The total length of the isolated LIV-1 DNA 164674 nucleic acid is 2776 bp, the vector pRK5D used was 5 1 kb, thus adding to a total length of 7 9 kb of the DNA
- DNA 164647 isolation was perto ⁇ ned according to the follow ing proceduie Two ad]acent 5 'phosphorylated primers.
- LIV l -INV5 ' and LIV l -INV3 were designed on opposite strands These primers.
- SEQ ID NO 6 and SEQ ID NO 7, were used in an inverse PCR reaction
- a 50ul reaction the following reagents were added 50ng of a bone marrow cDN A library in a modified pRK5D vector, which was propagated in a methylation positive bacteria, 50 picomoles ot each PCR primer; lOnmoles ot each deoxynucleotide t ⁇ phosphate 5ul of Ptu lOx butter (Stratagene, La Jolla CA ). and l ul of Ptu Turbo (Stratagenc.
- the plasmid v ector pRK5 (4.661 bp) has been described (EP 307.247 published 15 March 1989)
- the modilied pRK5 vector (pRK5 tk neo) is a derivative of pRK5 in which the neomycin resistance gene is inserted thereby allo ing for selection of G418- resistant clones
- PCR cycle conditions ere one cycle at 94 C for 3m ⁇ nutes. then 94 ' C tor 30 seconds 65 C for 30 seconds, 72 "C for 13 minutes tor 20 cycles PCR conditions may, ot course, be modified to meet specific needs of amplification
- the PCR reaction generated a linear 5 " phosphorylated amphcon that contained the LIV- 1 cDNA insert plus the pRK5D vector
- l Oul of the completed PCR reaction was ligated in a l OOul reaction containing the following other reagents l Oul lOx T4 DNA gase buffer (New England BioLabs. Beverly, MA ) 4ul T4 DNA gase (New England BioLabs, Beverly. MA), 76ul H 2 0
- the hgation was allowed to incubate at ambient temperature for 1 hour on the bench top
- Transformation was done by electroporation into DH 10B electromax competent bacteria (Life Technologies. Rockville, MD) The transformed bacteria were plated on Luna broth agar plates and colonies allowed to grow overnight at 37 "C
- LIV-1 Polypeptide Production The description below relates primarily to production of LIV-1 polypeptides by cultunng cells transtormed or transfected with a vector containing LIV- 1 -encoding nucleic acid It is, of course, contemplated that alternative methods which are well known in the art mav be employed to prepare LIV-1 polypeptides For instance the LIV- 1 polypeptide sequence or poi tions theieot.
- LIV- 1 poly peptide may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length LIV- 1 l Alternatu e Methods tor Synthesis or Isolation ot LIV- 1 - encoding DNA
- DNA encoding LIV- 1 - 164647 polypeptide homologues variants or portions thereof may be produced by direct DNA synthesis using standard nucleic acid synthetic techniques [see. e g Gait M J , Oligonucleotide S ⁇ nthes ⁇ s, IRL Press, Oxford 1984] DNA synthesis in ⁇ ⁇ tro may be performed using manual techniques or by automation Automated ohogonucleotide synthesis may be accomplished, for instance, using standard techniques Various portions of the LIV- 1 -encoding nucleic acid sequence may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length LIV-1 -encoding sequence Alternatively, DNA encoding LIV- 1 may be obtained from a cDNA library prepared trom tissue believed to possess the LIV- 1 mRNA and to express it at a detectable level Accordingly human LIV-1 DNA can be conveniently obtained trom a cDNA library prepared trom human tissue, such as described in the Examples The LIV- 1
- Probes such as antibodies to the LIV- 1 polypeptide or oligonucleotides of at least about 20-80 bases
- Screening the cDNA or genomic library ith the selected piobe may be conducted using standard procedures such as described in Sambrook et al Molecular Cloning A Laboratory Manual (New Yoik Cold Spring Harboi Laboratory Press 1989)
- An alternative means to isolate the gene encoding LIV- 1 is to use PCR methodology [Sambrook et al upi Dietfenbach et al . PCR Primer A Laboratory Manual (Cold Spring Harbor Laboratory Press 1995)]
- the ohgonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized
- Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and av ailable public databases such as GenBank or other private sequence databases
- Sequence identity (at either the amino acid or nucleotide level ) within def ined regions of the molecule or across the full-length sequence can be determined through sequence alignment using computer software programs such as ALIGN, DNAstar. and INHERIT which employ various algorithms to measuie homology
- Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time, and it necessary using conventional primer extension procedures as described in Sambrook et al supia to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA n Selection and Transformation of Host Cells
- Host cells are transfected or transformed with expression or cloning vectors described herein for LIV- 1 production and cultured in conventional nutrient media modified as appropriate tor inducing promoters, selecting transtormants, or amplifying the genes encoding the desired sequences
- the culture conditions such as media temperature, pH and the like, can be selected by the skilled artisan without undue experimentation
- protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology aPractical Approach. M Butler ed (IRLPress 1991 ) and Sambrook et al .
- Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote. yeast, or higher eukaryote cells
- Suitable prokaryotes include, but are not limited to, eubacte ⁇ a, such as Gram-negative or Gram-positive organisms, tor example. Enterobacte ⁇ aceae such as E coli
- E coli strains are publicly available, such as £ coli Kl 2 strain MM294 (ATCC 31 ,446), E coli XI 776 (ATCC 31.537), E coli strain W31 10 (ATCC 27,325) and K5 772 (ATCC 53,635)
- eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for LIV- 1 -encoding vectors Saccharoim ces vacuoae is a commonly used lower eukaryotic host microorganism
- Suitable host cells for the expression of LIV-1 are derived from multicellular organisms
- invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9 as well as plant cells
- ot useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells More specific examples include monkey kidney CV 1 line transformed by S V40 (COS-7, ATCC CRL 1651 ).
- human embry omc kidney line (293 or 293 cells subcloned for growth in suspension culture Graham et al J Gen Virol .
- the selection of the appropriate host cell is deemed to be within the skill in the art in Selection and Use of a Rephcable Vector
- the nucleic acid (e g , cDNA or genomic DNA) encoding LIV-1 may be inserted into a rephcable vector tor cloning (amplification of the DNA) or for expression
- a rephcable vector tor cloning amplification of the DNA
- Various vectors are publicly available
- the vector may tor example, be in the form of a plasmid, cosmid viral particle, or phage
- the appropriate nucleic acid sequence may be inserted into the vector by a variety ot procedures In general.
- Vector components generally include but are not limited to, one or more of a signal sequence an origin of replication, one or more marker genes an enhancer element, a promoter, and a transcription termination sequence Construction of suitable vectors containing one or more of these components employs standard hgation techniques which are known to the skilled artisan
- the LIV-1 polypeptide may be produced recombinantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide
- the signal sequence may be a component of the vector, or it may be a part of the LIV- 1 -encoding DNA that is inserted into the vector
- the signal sequence may be a prokaryotic signal sequence selected for example, from the group of the alkaline phosphatase penicilhnase lpp or heat-stable enterotoxin II leaders
- the signal sequence may be, e g , the yeast in ertase leader, alpha factor leader (including Saccharonnces and Kluweronnces ⁇ -f actor leaders, the latter described in U S Patent No 5,010, 182), or acid phosphatase leader, the C ⁇ //x .w.
- Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells Such sequences are well known for a variety of bacteria, yeast, and viruses
- the origin of replication trom the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2u plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma. adenovirus VSV or BPV) are useful tor cloning vectors in mammalian cells
- Selection genes will typically contain a selection gene, also termed a selectable marker
- Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins e g ampicil n neomycin. methotrexate, or tetracyc ne, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e g .
- suitable selectable markers tor mammalian cells are those that enable the identification ot cells competent to take up the LIV 1 encoding nucleic acid such as DHFR or thvmidine kinase
- An appropriate host cell when wild type DHFR is employed is the CHO cell line deficient in DHFR activity ptepared and propagated as described bv Urlaub et al Proc Nail Acad Sci USA 77 4216 ( 1980 »
- a suitable selection gene tor use in yeast is the t ⁇ p ⁇ gene present in the yeast plasmid YRp7 [Stinchcomb et al Nature 282 39 ( 1979) Kingsman et al Gene 7 141 ( 1979 ) Tschemper et a! Gene 10 157 ( 1980)]
- the tip] gene provides a selection marker tor a mutant strain ot yeast lacking the ability to grow in tryptophan tor example ATCC No 44076 or PEP4 1
- Expiession and cloning vectors usually contain a promoter operably linked to the LIV 1 encoding nucleic acid sequence to ditect mRNA synthesis
- Promoters recognized by a variety of potential host cells are well known Promoters suitable for use with prokarvotic hosts include the ⁇ -lactamase and lactose promoter systems [Chang et al Nature 275 615 ( 1978) Goeddel et al Nature 281 544 ( 1979)] alkaline phosphatase a tryptophan (trp) promoter system [Goeddel Nucleic Acids Res 8 4057 ( 1980) EP 36 776] and hvb ⁇ d promoters such as the tac piomoter [deBoer et al Proc Natl A ad Sci USA 80 21 25 ( 1983)] Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S D i sequence operably linked to the DNA encoding LIV 1
- suitable promoting sequences tor use with yeast hosts include the promoters foi 3 phosphoglycerate kinase [Hitzeman et al J Biol Chem 255 2073 ( 1980)] or other glycolytic enzymes [Hess et al J Adv Enzyme Reg 7 149 ( 1968 ) Holland Biochemistry J 4900 ( 1978)] such as enolase glyceraldehyde 3 phosphate dehydrogenase hexokinase pyruvate decarboxylase phosphotructokinase glucose-6 phosphate isomerase 3 phosphoglycerate mutase pyruvate kinase t ⁇ osephosphatc isomerase phosphoglucose isomerase and glucokinase
- yeast promoters which are inducible promoters having the additional advantage ot transcription controlled by growth conditions are the promoter regions tor alcohol dehydrogenase 2 isocytochrome C acid phosphatase degradative enzymes associated with nitrogen metabolism metallothionein glyceraldehyde 3-phos phate dehydrogenase and enzymes responsible for maltose and galactose utilization Suitable vectors and promoters for use in yeast expression are further described in EP 73 657
- LIV- 1 Transcription of LIV- 1 from vectors in mammalian host cells is controlled tor example by promoters obtained from the genomes of viruses such as polyoma vn us fowlpox virus (UK 2 21 1 504 published 5 July 1989) adenovirus (such as Adenovirus 2) bovine papilloma virus avian sarcoma virus cv tomegaiovirus a retrovirus hepatitis B virus and Simian Virus 40 (SV40) from heterologous mammalian promoters e g the actin promoter or an immunoglobulin promoter and trom heat shock promoters provided such promoters are compatible with the host cell systems
- viruses such as polyoma vn us fowlpox virus (UK 2 21 1 504 published 5 July 1989) adenovirus (such as Adenovirus 2) bovine papilloma virus avian sarcoma virus cv tomegaiovirus a retrovirus
- Enhancers aie cis-acting elements ot DNA usually about from 10 to 300 bp that act on a promoter to increase its transcription
- enhancer sequences are now known from mammalian genes (globin elastase albumin -tetoprotein and insulin)
- a eukaryotic cell virus examples include the SV40 enhancer on the late side of the replication origin (bp 100 270) the cytomegalovirus eai ly promoter enhancer, the polyoma enhancer on the late side ot the iep cation origin, and adenovirus enhancers
- the enhancer may be spliced into the vectoi at a position 5 ' or 3 " to the LIV- 1 coding sequence, but is preferably located at a site 5 tiom the
- Expression vectors used in eukaryotic host cells will also contain sequences necessary tor the termination ot transcription and for stabilizing the mRNA Such sequences are commonly available from the 5 ' and. occasionally 3 ' . untranslated regions ot eukaryotic or viral DNAs or cDNAs These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion ot the mRNA encoding LIV-1
- Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting.
- Northern blotting to quantitate the transcription of mRNA [Thomas, Proc Natl Acad Sci USA. 77 5201 -5205 ( 1980)] dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein Alternatively, antibodies may be employed that can recognize specific- duplexes, including DNA duplexes.
- RNA duplexes and DNA-RNA hybrid duplexes or DNA-protein duplexes
- the antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected
- Gene expression alternatively, may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay ot cell culture or body fluids, to quantitate directly the expression of gene product
- Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal.
- the antibodies may be prepared against a native sequence LIV- 1 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to LIV-1 DNA and encoding a specific antibody epitope v Production and Isolation of LIV- 1 Polypeptide trom Host Cells
- This example illustrates preparation of a LIV- 1 polypeptide by recombinant expression in mammalian cells
- the vector, pRK5 (see EP 307,247. published March 15, 1989), is employed as the expression vector
- the LIV-1 DNA 164647 is ligated into pRK5 with selected restriction enzymes to allow insertion of the LIV-1 DNA using hgation methods such as described in Sambrook et al , supra
- the resulting vector is called pRK5-DNA 164647
- the selected host cells may be 293 cells Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue culture plates in medium such as DMEM supplemented with tetal calf serum and optionally, nutrient components and/or antibiotics
- About 10 ⁇ g pRK5-DNA 164647 DNA is mixed with about 1 ⁇ g DNA encoding the VA RNA gene [Thimmappaya et al Cell 3J_ 543 ( 1982)] and dissolved ⁇ n 500 ⁇ l ot 1 M Tns-HCl 0 1 mM EDTA 0 227
- culture medium is removed and replaced with culture medium (alone) or culture medium containing 200 ⁇ Ci/ml S-cysteine and 200 ⁇ Ci/ml S-methiomne After a
- the conditioned medium is collected concentrated on a spin filter and loaded onto a 15% SDS gel
- the processed gel may be dried and exposed to film for a selected period ot time to reveal the presence of LI V- 1 polypeptide
- the cultures containing transfected cells may undergo further incubation (in serum tree medium) and the medium is tested in selected bioassays
- LIV-1 DNA 164647 may be introduced into 293 cells transiently using the dextran sultate method described by Somparyrac et al Proc Natl Acad Sci J_2 7575 ( 1981 ) 293 cells are grown to maximal density in a spinner flask and 700 ⁇ g pRK5-DNA 164647 DNA is added The cells are first concentrated from the spinner flask by cent ⁇ fugation and washed with PBS The DNA-dextran precipitate is incubated on the cell pellet tor four hours The cells are treated with 20% glycerol tor 90 seconds washed with tissue culture medium and re-introduced into the spinner flask containing tissue culture medium, 5 ⁇ g/ml bovine insulin and 0 1 ⁇ g/ml bovine transter ⁇ n After about four days, the conditioned media is cent ⁇ tuged and filtered to remove cells and debris The sample containing expressed LIV- 1 can then be concentrated and purified by any selected method such as dialysis and
- LIV-1 can be expressed in CHO cells following PCR amplification the DNA 164647 is subcloned in a CHO expression vector using standard techniques as described in Ausubel et al Current Protocols of Moleculai B ⁇ olog ⁇ , Unit 3 1 John Wiley and Sons ( 1997) CHO expression vectors aie constructed to have compatible restriction sites 5 and 3' of the DNA of interest to allow the convenient shuttling of cDNA's
- the vector uses expression in CHO cells is as described in Lucas et al Nucl Acids Res 24 9 ( 1774-1779 ( 1996). and uses the SV40 early promoter/enhancer to drive expression of the cDNA of interest and dihydrofolate reductase (DHFR) DHFR expression permits selection tor stable maintenance of the plasmid following transtection
- the ampules containing the plasmid DNA are thawed by placement into a water bath and mixed by vortexing
- the contents are pipetted into a centrifuge tube containing 10 mLs of media and cent ⁇ f uged at 1000 rpm for 5 minutes
- the supernatant is aspirated and the cells are resuspended in 10 mL of selective media (0 2 ⁇ m filtered PS20 with 5% 0 2 ⁇ m diafiltered fetal bovine serum)
- the cells are then ahquoted into a 100 mL spinner containing 90 mL of selective media
- a 250 L 500 mL and 2000 mL spinners are seeded with 3 x 10 cells/mL
- the cell media is exchanged with fresh media by centntugation and resuspension in production medium
- any suitable CHO media
- pH is adjusted as necessary to maintain a pH of about 7 2 After 10 days, or until viability dropped below 70%, the cell culture is harvested by centritugtion and tillering through a 0 22 ⁇ m filter The filtrate is either stored at 4°C or immediately loaded onto columns for purification
- the proteins are purified using a Ni-NTA column ( Qiagen) Before purification, imidazole is added to the conditioned media to a concentration of 5 mM The conditioned media is pumped onto a 6 ml Ni-NTA column equilibrated in 20 mM Hepes, pH 7 4, butter containing 0 3 M NaCl and 5 mM imidazole at a flow rate of 4-5 ml/min at 4°C After loading, the column is washed w ith additional equilibration butter and the protein eluted with equilibration buffer containing 0 25 M imidazole The highly purified protein is subsequently desalted into a storage buffer containing 10 mM Hepes. 0 14 M NaCl and 4% mannitol, pH 6 8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -80°C
- LIV-1 may be produced by transient or stable expression in a host cell, such as COS cells using standard techniques Expression of LIV-1 in Yeast
- yeast expression vectors are constructed tor intracellular production or secretion of LIV- 1 from the ADH2/GAPDH promoter DNA 164647 encoding a LIV-1 and the promoter is inserted into suitable restriction enzyme sites in the selected plasmid to direct intracellular expression of LIV- 1 For secretion.
- DNA encoding LIV- 1 can be cloned into the selected plasmid, together with DNA encoding the ADH2/GAPDH promoter a signal peptide. such as a mammalian signal peptide or. for example, a yeast alpha-factor or inv ertase secretory signal/leader sequence, and linker sequences (if needed) tor expression ot LIV-1
- yeast cells such as yeast strain AB 1 10. can then be transformed with the expression plasmids described above and cultured in selected fermentation media
- the transformed yeast supernatants can be analyzed by precipitation with 10% tnchloroacetic acid and separation by SDS-PAGE. followed by staining of the gels with Coomassie Blue stain
- Recombinant LIV-1 can subsequently be isolated and purified by removing the yeast cells from the fermentation medium by centntugation and then concentrating the medium using selected cartridge filters
- the concentrate containing LIV-1 may further be purified using selected column chromatography resins Expiession ot LI ⁇ 1 in Baculovirus-Inlectcd Insect Cells
- the sequence coding tor LIV- 1 is fused upstream ot an epitope tag contained within a baculovirus expression vector
- epitope tags include poly-His tags and immunoglobulin tags (like Fc regions of IgG)
- a variety ot plasmids may be employed including plasmids derived from commercial 1 ⁇ available plasmids such as pVLl 393 (Novagen) Briefly, a nucleic acid sequence encoding LIV- 1 oi the desired portion ot the coding sequence of LIV-1 (such as the sequence encoding the extracellular domain ot a tiansmembrane protein or the sequence encoding the mature protein it the protein is extracellular) is amplified by PCR with primers complementary to the 5 and 3 regions The 5 " p ⁇ mer incorporate f lanking (selected) restriction enzv me sites The product is then digested with those selected restriction enzymes and subcloned into the expression v ector
- Recombinant baculovirus is generated by co-transtecting the above plasmid and BaculoGold 1 virus DNA (Pha ⁇ ningcn) into Spodoptera fi sipei da ("SI9 ') cells (ATCC CRL 171 1 ) using hpofectin (commercially available trom GIBCO-BRL) After 4 - 5 days of incubation at 28 C, the released v lruses are harvested and used for further amplifications Viral infection and protein expression are performed as described by 0 " Re ⁇ lley et al Baculovirus expression vectors A Laboratory Manual, Oxford Oxford Universitv Press ( 1994)
- Expressed poly-His tagged LIV- 1 can then be purified, for example by Ni -chelate affinity chromatography as follows Extracts are prepared from recombinant virus-inf ected St 9 cells as described by Rupei t et al . Nature, 362 175-179 ( 1993) Briefly, S19 cells are washed resuspended in somcation buffer (25 mL Hepes. pH 7 9, 12 5 mM MgCl,, 0 1 M EDTA.
- somcation buffer 25 mL Hepes. pH 7 9, 12 5 mM MgCl,, 0 1 M EDTA.
- LIV- 1 is also expressed as an IgG construct (lmmunoadhesin), in which the protein extracellular region is fused to an IgG 1 constant region sequence containing the hinge, C H 2 and C H 3 domains and/or in poly-His tagged torms
- baculovirus expression vector pb PH IgG tor IgG fusions and pb PH His c tor poly-His tagged proteins
- Baculogold® baculovirus DNA (Phaimingen) is co-transfected into ⁇ 05 Spo ⁇ dopte ⁇ afm ⁇ > ⁇ pe>da ( "Sf9 ) cells (ATCC CRL 171 1 ) using Lipofectin (Gibco BRL)
- pb PH IgG and pb PH His are modifications of the commercially available baculovirus expression v ector pVL1393 (Pharmingen) with modified polyhnker regions to include the His or Fc tag sequences
- the cells are grown in Hink's TNM-FH medium supplemented with 10% FBS (Hyclone) Cells are incubated tor 5 days at 28 °C The supernatant is harvested and
- the first viral amplification supernatant is used to infect a spinner culture (500 mL) of Sf9 cells grown in ESF-921 medium (Expression Systems LLC) at an approximate MOI ot 0 1 Cells are incubated tor 3 days at 28 °C The supernatant is harvested and filtered Batch binding and SDS-PAGE analysis is repeated as necessary, until expression of the spinner culture is confirmed
- the conditioned medium from the transfected cells (0 5 to 3 L) is harvested by centntugation to remove the cells and filtered through 0 22 micron filters
- the protein construct are puntied using a Ni-NTA column (Qiagen) Before purif ication imidazole is added to the conditioned media to a concentration ot 5 mM
- the conditioned media are pumped onto a 6 mL Ni-NTA column equilibrated in 20 mM Hepes, pH 7 4.
- LIV-1 polypeptides may be recovered trom culture medium or from host cell lysates If membrane-bound, it can be released from the membrane using a suitable detergent solution (e g T ⁇ ton-X 100) or by enzymatic cleavage Cells employed in expression of LIV- 1 can be disrupted by various physical or chemical means, such as treeze-thaw cycling, sonication, mechanical disruption or cell lysing agents It may be desired to purify LIV- 1 trom recombinant cell proteins or polypeptides The f ollowing procedures are exemplary ot suitable purification procedures by tractionation on an ion-exchange column, ethanol precipitation, reverse phase HPLC.
- a soluble form ot the extracellular domain of LIV-1 -164647 or a portion thereof, containing an anitgemc epitope The extracellular domain region is indicated in Fig 1
- cells expressing LIV- 1 at their cell surface can be used to generate antibodies (e NIH-3T3 cells transformed to overexpress LIV-1 )
- Other forms ot LIV-1 useful for generating antibodies will be apparent to those skilled in the art (/) Po clonal antibodies
- Polyclonal antibodies are preferably raised in animals by multiple subcutaneous (sc) or intraperitoneal ( ) injections of the relevant antigen and an adjuvant It may be useful to conjugate the relevant antigen to a protein that is immunogenic in the species to be immunized e g . keyhole limpet hemocya n, serum albumin, bovine thyroglobuhn. or soybean trypsin inhibitor using a bifunctional or denvatizing agent for example maleimidobenzoyl sulfosuccimmide ester (conjugation through cysteine residues), N-hydroxysuccinimide (through lysine residues), glutaraldehyde, succinic anhydride.
- Animals are immunized against the antigen immunogenic conjugates or derivatives by combining e g 100 ⁇ g or 5 ⁇ of the protein or conjugate (for rabbits or mice, respectively) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermally at multiple sites One month later the animals are boosted with 1/5 to 1/10 the original amount ot peptide or conjugate in Freund's complete adjuvant by subcutaneous injection at multiple sites Seven to 14 days later the animals are bled and the serum is assayed for antibody titer Animals are boosted until the titer plateaus Preferably, the animal is boosted with the conjugate of the same antigen, but conjugated to a different protein and/or through a different cross-linking reagent Conjugates also can be made in recombinant cell culture as protein fusions Also, aggregating agents such as alum are suitably used to enhance the immune response
- Monoclonal antibodies are obtained from a population ot substantially homogeneous antibodies J e the individual antibodies comprising the population are identical except tor possible naturallv occurring mutations that may be present in minor amounts Thus, the modifier ' monoclonal" indicates the character of the antibody as not being a mixtuie of discrete antibodies
- the monoclonal antibodies may be made using the hybridoma method first described by
- hybridoma a mouse or other appropriate host animal, such as a hamster is immunized as hereinabove described to elicit lymphocytes that produce or are capable ot producing antibodies that ill specifically bind to the protein used for immunization
- lymphocytes may be immunized in Lymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol. to form a hybridoma cell (Goding, Monoclonal Antibodies Principles and Practice, pp 59-103 [Academic Press, 1986] )
- the hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells
- a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells
- the parental myeloma cells lack the enzyme hypoxanthine guanine phospho ⁇ bosyl transterase (HGPRT or HPRT)
- the culture medium tor the hyb ⁇ domas typically will include hypoxanthine. aminopte ⁇ n and thvmidine
- HGPRT medium which substances prevent the growth of HGPRT-deticient cells
- Preferred myeloma cells are those that fuse efficiently, support stable high-level production ot antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium
- preferred myeloma cell lines are murine myeloma lines, such as those derived trom MOPC-21 and MPC- 1 1 mouse tumors available trom the Salk Institute Cell Distribution Center, San Diego. California USA, and SP-2 or X63- Ag8-653 cells available from the American Type Culture Collection, 10801 University Boulevard Manassas.
- VA 201 10-2209 Human myeloma and mouse-human heteromyeloma cell lines also have been described tor the production ot human monoclonal antibodies (Kozbor, J Immunol , 133 3001 ( 1984). Brodeur et al Monoclonal Ant ⁇ bod ⁇ Production Techniques and Applications, pp 51 -63 [Marcel Dekker. Inc .
- the binding affinity of the monoclonal antibody can, tor example, be determined by the Scatchard analy sis of Munson et al , Anal Biochem , 107 220 ( 1980)
- the clones may be subcloned by limiting dilution procedures and grown by standard methods (Goding
- Suitable culture media tor this purpose include, tor example, D-MEM or RPMI- 1640 medium
- the hybridoma cells may be grow n in as ascites tumors in an animal
- the monoclonal antibodies secreted by the subclones are suitably separated from the culture medium ascites fluid, or serum by conventional immunoglobulin purification procedures such as. tor example, protein A- Sepharose. hydioxylapatite chromatography gel electrophoresis, dialysis or affinity chromatography
- DNA encoding the monoc lonal antibodies is readily isolated and sequenced using conventional procedures (e g by using ohgonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies)
- the hy bridoma cells sei ve as a prefei red source ot such DNA Once isolated, the DNA may be placed into expression vectors which are then transfected into host cells such as E coli cells, simian COS cells.
- antibodies or antibody fragments can be isolated from antibody phage libraries generated using the techniques described in McCaf f erty et al , Natui e, 348 552-554 ( 1990 ) Clackson et al Natiii e, 352 624-628 ( 1991 ) and Marks etal J Mol Biol . 121 581-597 ( 1991 ( describe the isolation ot murine and human antibodies, respectively, using phage libraries Subsequent publications describe the production ot high aftimty (nM range) human antibodies by chain shuffling (Marks et al .
- the DNA also may be modified for example, by substituting the coding sequence tor human heavy- and light-chain constant domains in place ot the homologous murine sequences (U S Patent No 4 816,567. Morrison, etaf Pioc NatlAcad Sci USA, 8 ⁇ 6851 [ 1984]). or by covalentlyjoining to the immunoglobulin coding sequence all or part of the coding sequence tor a non-immunoglobuhn polypeptide
- non-immunoglobuhn polypeptides are substituted for the constant domains ot an antibody, or they are substituted for the variable domains ot one antigen-combining site of an antibodv to create a chime ⁇ c bivalent antibody comprising one antigen-combining site having specificity for an antigen and another antigen- combining site having specificity for a different antigen
- an ant ⁇ -LIV-1 monoclonal antibody is prepared as follows ⁇ n ant ⁇ -LIV-1 IgG, murine monoclonal antibody, preferably specific for the extracellular domain of LIV- 1 - 164647 protein is produced using procedures like those described in Fendly et al .
- LIV- 1 -expressing cells preferably cells expressing LIV- 1 encoded by DNA164647 are harvested with phosphate buttered saline (PBS) containing 25mM EDTA and used to immunize BALB/c mice
- PBS phosphate buttered saline
- the mice are given injections l p of 10 cells in 0 5 ml PBS on weeks, 0, 2 5 and 7, for example
- the treatment is performed with a humanized version of the murine anti-LIV- 1 antibody
- the humanized antibody is engineered by inserting the complementarity determining regions ot the mui ine anti-LIV- 1 antibody into the framework ot a consensus human immunoglobulin IgG, (IgG ] ) (see tor example the process used in Cartel et al . Pioc Natl Acad Sci USA 89 4285-4289 [ 1992])
- the resulting humam/ed anti-LIV- 1 monoclonal antibody preterably has high affinity tor the extracellular domain of LIV- 1 protein and inhibits m vino and in v ivo and in human xenografts.
- the anti-LIV- 1 antibodies of the invention inhibit tumor cell growth greater than 20%, most preferably greater than 50% , in ⁇ ⁇ t ⁇ o
- the preferred anti-LIV- 1 monoclonal antibody of the invention is also clinically active as a single agent or in combination with a cytotoxic or other cell growth-inhibiting agent, in patients with LIV- 1 -overexpressing metastatic breast cancers or lung prostate or other cancers
- Anti-LIV- 1 monoclonal antibody is produced by a genetically engineered Chinese Hamster Ovary (CHO) cell line, grown in large scale, that secretes the antibody into the culture medium The antibody is purified from the CHO culture media using standard chromatographic and filtration methods Each lot ot antibody is assayed to verity identity purity and potency, as well as to meet Food and Drug Administration requirements tor sterility and safety
- the antibodies When used to kill human cancer cells in vitro tor diagnostic purposes or to test the potency of a lot of antibodies, the antibodies will typically be added to a culture of LIV- 1 -ov erexpressmg cells particularly cancerous cells, that do not also overexpress ErbB2 As a control, the antibodies will also be added to a culture of cells that do not overexpress LIV- 1
- the antibodies are added to the cell culture medium at a concentration ot at least approximately 10 nM
- the formulation and mode of administration tor in vitro use are not critical Aqueous formulations that are compatible with the culture or perfusion medium ill normally be used Cvtotoxicity may be read by conventional techniques to determine the presence or degree ot cancer
- Cytotoxic radiopharmaceuticals tor treating cancer may be made by conjugating radioactive isotopes (e g I, Y, Pr) to the antibodies
- the term "cytotoxic moiety" as used herein is intended to include such isotopes
- liposomes are filled with a cytotoxic drug and the liposomes are coated with antibodies specifically binding a growth factor receptor Since there are many receptro sites this method permits delivery ot large amounts of drug to the correct cell type
- Antibody dependent cellular cytotoxicity is contemplated as a method ot targeting cytotoxic effects to cancerous cells overexpressing LIV- 1 protein
- the present ⁇ n ⁇ ention involves a method based on the use of antibodies withic are (a) directed against the extracellular domain of LIV-1 protein, and (b) belong to a subclass or isotype that is capable of mediating the lysis of tumor cells to which the antibody molecule binds More specifically, these antibodies should belong to a subclass or isotype that upon complexing with growth factor receptors, activates serum complement and/or mediates antibody dependent cellular cytotoxicity (ADCC) by activating effector cells such as natural killer cells or macrophages
- the present invention is also directed to the general use ot these antibodies, in their native torm, tor therapy of human tumors that overexpress the LIV- 1 protein
- many IgG2a and IgG3 mouse antibodies which bind tumor-associated cell surface antigens can be used in vivo tor tumor therapy In tact
- a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human
- These non-human amino acid residues are often reterred to as import residues which are typically taken trom an ' import variable domain
- Huma zation can be essentially performed following the method of Winter and co- workers (Jones et al Natuie, 321 522-525 (1986).
- rodent hypervanable regions e g CDRs or CDR sequences tor the corresponding sequences of a human antibody
- rodent hypervanable regions e g CDRs or CDR sequences tor the corresponding sequences of a human antibody
- rodent hypervanable regions e g CDRs or CDR sequences tor the corresponding sequences of a human antibody
- rodent hypervanable regions e g CDRs or CDR sequences tor the corresponding sequences of a human antibody
- rodent hypervanable regions e g CDRs or CDR sequences tor the corresponding sequences of a human antibody
- the choice of human variable domains, both light and heavy to be used in making the humanized antibodies is very important to reduce antigenicity
- the sequence ot the variable domain of a rodent antibody is screened against the entire library of known human variable-domain sequences
- the human sequence which is closest to that ot the rodent is then accepted as the human framework region (FR) for the humanized antibody (Sims et al , _/ Immunol , 151 2296 ( 1993), Chothia et al , J Mol Biol 196 901 [1987])
- Another method uses a particular framework region derived trom the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains
- the same framework may be used tor several ditf erent humanized antibodies (Carter etal , Proc Natl Acad Sci USA 89 4285 ( 1992), Presta er ⁇ / , J Immnol 151 2623 [ 1993])
- humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three- dimensional models ot the parental and humanized sequences
- Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art
- Computer programs are available which illustrate and display probable three-dimensional contormational structures of selected candidate immunoglobulin sequences Inspection of these displays permits analysis ot the likely role of the residues in the functioning oi the candidate immunoglobulin sequence, i e , the analysis ot residues that influence the ability of the candidate immunoglobulin to bind its antigen
- FR residues can be selected and combined trom the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target ant ⁇ gen(s) is achieved
- the CDR residues are directly and most substantially involved in influencing antigen binding
- transge c animals e g , mice
- transge c animals e g , mice
- J H antibody heavy-chain joining region
- Human antibodies can also be derived trom phage-display libraries (Hoogenboom et al J Mol Biol 227 381 ( 1991 ) Maiks et al J Mol Biol 222 581 -597 ( 1991 ])
- F(ab ) ⁇ fragments can be isolated directly from recombinant host cell culture
- Other techniques for the production of antibody fragments will be apparent to the skilled practitioner
- the antibody of choice is a single chain Fv fragment (scFv) See WO 93/16185
- Bispecitic antibodies are antibodies that have binding specificities tor at least two different epitopes
- Exemplary bispecitic antibodies may bind to two different epitopes of the LIV-1 protein
- one arm may bind a first epitope in the extracellular domain of LIV- 1 protein while the other may bind a different LIV-1 epitope
- an anti-LIV 1 arm may be combined with an arm which binds to a t ⁇ ggenng molecule on a leukocyte such as a T-cell receptor molecule (e g CD2 orCD3) or Fc receptors for IgG (Fc /R) such as Fc ⁇ RI (CD64) Fc ⁇ RII (CD32) and Fc ⁇ RIII (CD16) so as to focus cellular defense mechanisms to the ErbB2 expressing cell
- Bispecitic antibodies may also be used to localize cytotoxic agents to cells which express LI ⁇ 1 by binding to the extracellular domain ot the LIV 1 gene product These antibodies possess a LIV-1 extracellular
- immunoglobulin constant domain sequences are fused to immunoglobulin constant domain sequences
- the fusion preterably is with an immunoglobulin heavy chain constant domain comprising at least part ot the hinge CH2 and CH3 regions
- This prov ides tor great flexibility in adjusting the mutual proportions ot the three polypeptide fragments in embodiments when unequal ratios ot the three polypeptide chains used in the consti uction provide the optimum yields
- the bispecific antibodies are composed ot a hybrid immunoglobulin heavy chain with a tirst binding specificity in one arm. and a hybrid immunoglobulin heavy chain- light chain pair (providing a second binding specificity) in the other arm It was found that this asymmetric structure facilitates the separation of the desired bispecif ic compound from unwanted immunoglobulin chain combinations as the presence of an immunoglobulin light chain in only one halt of the bispecitic molecule provides tor a facile way ot separation This approach is disclosed in WO 94/04690 For further details ot generating bispecific antibodies see. tor example. Suresh et al Methods in 121 210 ( 1986)
- the interface between a pair ot antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered trom recombinant cell culture
- the preferred interface comprises at least a part ot the C H 3 domain of an antibody constant domain
- one or more small amino acid side chains trom the interface of the tirst antibody molecule are replaced with larger side chains (e g tyrosine or tryptophan)
- Compensatory ' cavities ot identical or similar size to the large side cha ⁇ n(s) are created on the interface ot the second antibody molecule by replacing large ammo acid side chains with smaller ones (e g ala ne or threonine)
- Bispecitic antibodies include cross-linked or "heteroconjugate ' antibodies Foi example one ot the antibodies in the heteroconjugate can be coupled to avidin. the other to biotin Such antibodies have tor example been proposed to target immune system cells to unwanted cells (US Patent No 4.676 980) and tor ti eatment ot HIV infection (WO 91/00360, WO 92/200373 and EP 03089) Heteroconjugate antibodies may be made using any convenient cross-linking methods Suitable cross-linking agents are well known in the art and are disclosed in US Patent No 4,676,980, along with a number of cross-linking techniques Techniques for generating bispecitic antibodies trom antibody fragments ha ⁇ e also been described in the literature For example, bispecific antibodies can be prepared using chemical linkage Brennan ef ⁇ / Science, 229 81 ( 1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab ) 2 fragments These fragments are reduced in
- bispecitic antibodies have been produced using leucine zippers Kostelny et al , J Immunol 148(5) 1547-1553 ( 1992)
- the leucine zipper peptides trom the Fos and Jun proteins were linked to the Fab portions ot two different antibodies by gene fusion
- the antibody homodimers were reduced at the hinge region to torm monomers and then re-oxidized to form the antibody heterodimers
- This method can also be utilized tor the production of antibody homodimers
- the " diabody technology described by HoUinger et al , Proc Natl Acad Sci USA 90 6444-6448 ( 1993) has provided an alternative mechanism toi making bispecific antibody fragments
- the fragments comprise a heavy-chain variable domain (V H ) connected to a light-chain variable domain (V L ) by a linker which is too short to allow pairing between the two domains on the same chain Accordingly
- t ⁇ specitic antibodies can be prepared ⁇ xAi et al J Immunol 147 60 ( 1991 )
- BT474 cells which can be obtained trom the American Type Culture Collection [Manassas VA] are cultured in Dulbecco ' s Modified Eagle Medium (D-MEM) Ham' s F- 12 (50 50) supplemented with 10% heat-inactivated FBS (Hyclone) and 2 mM L-glutamine (Thus, the assay is performed in the absence ot complement and immune effector cells)
- D-MEM Dulbecco ' s Modified Eagle Medium
- F- 12 50
- Thus the assay is performed in the absence ot complement and immune effector cells
- the BT474 cells are seeded at a density of 3 x 10 per dish in 100 x 20 mm dishes and allowed to attach overnight
- the medium is then removed and replaced with tiesh medium alone or medium containing 1 O ⁇ g/ml ot the appropriate M Ab
- the cells are incubated tor a 3 day
- BT474 cells are cultured and seeded in dishes as discussed in the preceding paragraph
- the medium is then removed and replaced with tresh medium alone or medium containing lO ⁇ g/ml of the MAb
- monolayers are washed with PBS and detached by trypsinization Cells are then cent ⁇ tuged, resuspended in Ca ⁇ binding buffer and ahquoted into tubes as discussed above tor the cell death assay Tubes then receive labeled annexin (e g annexin V-FTIC) ( 1 ⁇ g/ml)
- Samples may be analyzed using a FACSCANTM flow cytometer and FACSCONVERTTM CellQuest software (Becton Dickinson)
- Those antibodies which induce statistically significant levels ot annexin binding relative to control are selected as apoptosis-induc
- a "DNA staining assay using BT474 cells' is available In order to perform this assay.
- BT474 cells which have been treated with the antibody ot interest as described in the preceding two paragraphs are incubated with 9 ⁇ g/ml HOECHST 33342TM tor 2 hr at 37"C.
- Antibodies which induce a change in the percentage of apoptotic cells which is 2 told or greater (and preterably 3 fold or greater) than untreated cells (up to 100% apoptotic cells) may be selected as pro-apoptotic antibodies using this assay
- a routine cross-blocking assay such as that described in Antibodies, A Laboiaton Manual, Cold Spring Harbor Laboratory, Ed Harlow and David Lane ( 1988)
- epitope mapping can be performed by methods known in the art (see, for example, methods used for the epitope-mapping ot the extracellular domain of ErbB2 as determined by truncation mutant analysis and site-directed mutagenesis (Nakamura ef ⁇ / J ofVirologv 67( 10)
- an assay can be performed generally as follows LIV-1 -expressing cells are grown in a 1 1 mixture ot FI 2 and DMEM medium supplemented with 10% fetal bovine serum, glutamine and penicilhnstreptomycin The LIV- 1 - expressing cells are plated at 20,000 cells in a 35mm cell culture dish (2 mls/35 mm dish) 2 5 ⁇ g/ml of the anti-LIV- 1 antibody is added per dish After six days, the number of cells, compared to untreated cells are counted using an electronic COULTERTM cell counter Those antibodies which inhibit growth of the LIV-1 -expressing cells by 50- 100% are selected tor combination with the apoptotic antibodies as desired
- effector function engineering It may be desirable to modify the antibody ot the invention with respect to effector function, so as to enhance the effectiveness of the antibody in treating cancer tor example
- cysteine res ⁇ due(s) may be introduced in the Fc region thereby allowing interchain disulfide bond formation in this region
- the homodime ⁇ c antibody thus generated may have improved internalization capability and or increased complement- mediated cell k ⁇ lhng and ant ⁇ body-dependentcellularcytotox ⁇ c ⁇ ty (ADCC) See Caron e/ ⁇ / J Exp Med 176 1 191 - 1 195 ( 1992) and Shopes B J Immunol 148 2918-2922 ( 1992)
- Homodime ⁇ c antibodies with enhanced anti-tumor activity may also be prepared using heterobitunctional cross-linkers as described in Woltf et al Cancel Research 53 2560-2565 ( 1993)
- an antibody can be engineered which has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities See Stevenson
- the invention also pertains to immunoconjugates comprising the antibody described herein conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e g an enzymatically active toxin of bacterial fungal, plant or animal origin or fragments thereof) or a radioactive isotope (i e , a radioconjugate)
- a cytotoxic agent such as a chemotherapeutic agent, toxin (e g an enzymatically active toxin of bacterial fungal, plant or animal origin or fragments thereof) or a radioactive isotope (i e , a radioconjugate)
- chemotherapeutic agent e g an enzymatically active toxin of bacterial fungal, plant or animal origin or fragments thereof
- i e e a radioactive isotope
- Chemotherapeutic agents useful in the generation of such immunoconjugates have been described above
- radioconjugated ant ⁇ -ErbB2 antibodies examples include Bi, I, In Y and Re
- Conjugates of the antibody and cytotoxic agent are made using a variety of bitunctional protein coupling agents such as N-succ ⁇ n ⁇ m ⁇ dyl-3-(2-py ⁇ dyld ⁇ th ⁇ ol) propionate (SPDP), lminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate) aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine) bis-diazonium derivatives (such as b ⁇ s-(p-d ⁇ azon ⁇ umbenzoyl)-ethylened ⁇ am ⁇ ne), dnsocyanates (such as tolyene 2 6-d ⁇ socyanate) and bis-active fluorine compounds (such as 1 ,5-d ⁇ fluoro-2,4-d ⁇ n ⁇ t
- Liposomes with enhanced cnculation time are disclosed in U S Patent No 5 01 3 556
- Particularly useful liposomes can be generated by the leverse phase ev aporation method with a lipid composition comprising phosphatidv lchohne, cholesterol and PEG-de ⁇ atized phosphatidylethanolamine (PEG-PE) Liposomes are extruded through filters ot defined pore size to yield liposomes w ith the desned diameter Fab fragments ot the antibody of the present invention can be conjugated to the liposomes as described in Martin et al J Biol Chem 257 286-288 ( 1982) via a disulfide interchange reaction A chemotherapeutic agent is optionally contained within the hposome See Gabizon et al J National Cancer Inst 81 ( 19)
- the antibodies ot the piesent invention may also be used in ADEPT by conjugating the antibody to a prodrug-activating enzyme which converts a prodrug (e g a peptidyl chemotherapeutic agent see WO81/01 145) to an active anti-cancer drug See tor example.
- a prodrug e g a peptidyl chemotherapeutic agent see WO81/01 1405
- the enzyme component ot the immunoconjugate useful f r ADEPT includes any enzvme capable ot acting on a prodrug in such a way so as to covert it into its more active cytotoxic form
- Enzymes that are useful in the method oi this invention include, but are not limited to alkaline phosphatase useiul tor converting phosphate-containing prodrugs into tree drugs, arylsultatase useful tor converting sultate- containing prodrugs into tree drugs, cytosine deaminase useful tor converting non-toxic 5-tluorocytos ⁇ ne into the anti-cancer drug.5-tluorourac ⁇ l proteases, such as serratia protease thermolysin, subtihsin carboxypeptidases and cathepsins (such as cathepsins B and L), that are useful for converting peptide-contaimng prodrugs into free drugs,
- D-alanylcarboxypeptidases useful tor converting prodrugs that contain D-amino acid substituents, carbohydrate - cleaving enzymes such as ⁇ -galactosidase and neuraminidase useiul for converting glycosv lated prodrugs into tree drugs, ⁇ -lactamase useful tor converting drugs derivatized with ⁇ -lactams into tree diugs and penicillin amidases, such as penicillin V amidase or penicillin G amidasc, useful for converting drugs de ⁇ v atized at their amine nitrogens with phenoxyacetyl or phenylacety l groups, respectively, into tree drugs Alternatively, antibodies with enzymatic activity, also known in the art as abzymes".
- Antibody-abzyme conjugates can be prepared as described herein tor delivery of the abzyme to a tumor cell population
- the enzymes of this inv ention can be covalently bound to the anti-LIV- 1 antibodies by techniques well known in the art such as the use of the heterobifunctional cross nking reagents discussed above Alternatively fusion proteins comprising at least the antigen binding region of an antibody of the invention linked to at least a functionally active portion of an enzyme of the invention can be constructed using recombinant DNA techniques well known in the art (see, e g . Neuberger et al , Nature, 312 604-608 [ 1984])
- an antibody fragment rather than an intact antibody, to increase tumor penetration, for example
- it may be desirable to modify the antibody fragment in order to increase its serum halt life This may be achieved for example by incorporation ot a salvage receptor binding epitope into the antibody fragment (e g by mutation ot the appropriate region in the antibody fragment or by incorporating the epitope into a peptide tag that is then fused to the antibody fragment at either end or in the middle c ? by DNA or peptide svnthesis)
- a systematic method tor preparing such an antibodv v ariant having an increased in v ivo half lit comprises several steps The first involves identifying the sequence and contonnation of a salvage receptor binding epitope of an Fc region ot an IgG molecule Once this epitopc is identified the sequence of the antibody ot interest is modified to include the sequence and conformation ot the identified binding epitope After the sequence is mutated the antibody variant is tested to see if it has a longer in o halt lite than that ot the original antibodv It the antibody variant does not have a longer in v o halt lite upon testing its sequence is further altered to include the sequence and conformation of the identified binding epitope The altered antibody is tested tor longer in ⁇ ⁇ o halt lite and this process is continued until a molecule is obtained that exhibits a longer m i n o half-lite
- the salvage receptor binding epitope being thus incoiporated into the antibody of interest is any suitable such epitop
- the epitope preterably constitutes a region wherein any one or more amino acid lesidues trom one or two loops of a Fc domain are transferred to an analogous position of the antibody fragment Even more preterably three or more residues from one or two loops ot the Fc domain are transferred Still more pieferred the epitope is taken from the C H 2 domain of the Fc region (e g ot an IgG) and transferred to the C H 1 C H 3 or V H region or more than one such region of the antibody Alternatively the epitope is taken from the C H 2 domain ot the Fc region and transferred to the C L region or V ⁇ region or both of the antibody fragment (xu) Pur ification of anti-LIV I antibodv When using recombinant techniques the antibody can be produced intracellularly in the pe ⁇ plasmic space or directly secreted into the medium It the antibody is produced intracellularly as a first step the particulate debris either host cells or lysed fragments is removed tor example by centntuga
- the mixture comprising the antibody of interest and contaminants may be subjected to low pH hydrophobic interaction chromatography using an elution buffer at a pH between about 2 5-4 5, preferably performed at low salt concentrations (e ? trom about 0-0 25M salt) Example 4.
- LIV-1 is expressed on the cell surface
- a polypeptide comprising the extracellular domain of LIV- 1 was expressed in £ coli after first constructing a nucleic acid vector encoding the LIV-1 extracellular domain operably linked to an amino acid leader sequence The following procedures were used to prepare the nucleic acid construct and express the encoded protein
- DNA coding for amino acids 1-298, encoding the extracellular domain ot mature LIV- 1 was prepared by standard PCR techniques from a tul! length cDNA clone using the primers 5 - CAACATCAAATGCATCAACTTCATGAACTAAAAGCAGCTGCT-3 (SEQ ID NO 9) and 5 - GAGCTCGAGCGGCCGCTTAGGTCTTTGGAGGGATTTCAGCCTT-3' (SEQ ID NO 10) The PCR reaction was divided in two one half was digested with Ns-il and Sacl while the other half was digested with Sad and Notl The Nsil-Sacl DNA fragment encoding amino acids 1 - 166 and the Sacl-Notl fragment encoding amino acids 167- 298 were isolated and ligated into the previously digested expression vector pST239 a pBR322-de ⁇ ved vectoi containing an N-terminal polyhis leader at the 3' end of which is an Nsil restriction site The resulting LIV
- the LIV- 1 expression plasmid was transformed into the £ coli strain 58F3 (fhuA ⁇ (tonA ⁇ ) lon ⁇ galE rpoHts(htpRts) ⁇ clpP laclq ⁇ ompT ⁇ (nmpc-fepE) ⁇ slyD)
- Transtormants were initially cultured in Luna broth at 30 C ern ⁇ ght and then diluted 100-fold into a phosphate-limiting media to induce the alkaline phosphatase promoter Alter 24 hours at 30 °C with shaking the cultures were cent ⁇ fuged and the cell pastes frozen until the start of purification
- mice (Charles River Laboratories Wilmington DE) were hype ⁇ mmunized with recombinant polyhistidine-tagged human LIV- 1 isolated from pE164647-transformed £ coli as described herein The tagged
- mice demonstrating high anti-LIV 1 antibody titers were fused with mouse mv eloma cells (X63 Ag8 653 American Type Culture Collection Rockville MD) using a modified protocol analogous to one previously described (Kohlei G and Milstein. C Natuie 256 495-497 ( 1975 ) Hongo J S et l Hybridoma J4 253-260 ( 1995))
- Each ot the 16 antibodies listed in Table 3 was examined tor binding to the ECD ot LIV- 1 - 164647 and tound to bind specifically
- the antibodies were characterized to have the properties listed in Table 3
- Epitope characterization involved determination as to whether a test antibody can compete tor binding to the same epitope as the epitope bound by an anti-LIV- 1 - 164647 antibody of the present invention including the antibodies produced by the hyb ⁇ domas deposited with the ATCC, using a cross-blocking (e a competitn e ELISA assay) can be performed In an exemplary competitive ELISA assay.
- LIV-1 - 167647 or its ECD ( or other tragment) coated on the wells of a microtiter plate is pre-incubated with or without candidate competing antibodv and then the biotin- labeled anti-LIV- 1 - 164647 antibody ot the invention is added
- the amount ot labeled anti-LIV- 1 - 164647 antibody bound to the LIV-1 antigen in the wells is measured using avidin-peroxidase conjugate and appropriate substrate
- the antibody can be labeled with a radioactive or fluorescent label or some other detectable and measurable label
- the amount of labeled anti-LIV- 1 antibody bound to the antigen has an indirect co ⁇ elation to the ability ot the candidate competing antibody (test antibody) to compete for binding to the same epitope ( i e .
- a candidate competing antibody is considered an antibody that binds substantial to the same epitope or that competes for binding to the same epitope as an anti-LIV- 1 antibody of the invention it the candidate antibody can block binding of the LIV- 1 antibody by at least 20%, preterably by at least 20-50%.
- ECD monoclonal antibody 2983 isolated trom hybridoma 2983 3G9 1 D4 1 D7. ATCC .
- the cells were then washed with ice cold PBS, incubated for 20 minutes at 4 °C with a Biotin-conjugated Goat anti- human IgG second antibody (Jackson Immunoreagents, West Grove.
- endogenous LIV- 1 is expressed on the surface of cells ot the MCF-7 breast tumor cell line (ATCC HTB-22. for example)
- Anti-LIV- 1 monoclonal antibody 2945 from hybridoma
- Antibody Cell Line Isotype Group (3T3-LIV- 1/3T3) N- or C-terminal
- N- or C-terminal refers to binding of the tested antibody to the N-terminal or C-terminal fragment of the LIV- 1 - 164647 ECD. where the N-terminal fragment was amino acid 1 - 147 of SEQ ID NO 4 and the C-terminal fragment was amino acids 148-298 of SEQ ID NO 4
- Example 5 LIV-1 Expression in Tumor Tissue Examined by RNA in situ Hybridization
- This example provides methods used in the preparation of tissue arrays for the determination of LIV- 1 expression in various human tissues (see, for example, Kononen, J , et al Nature Medicine 4 844-847 (1998))
- a tissue microarray, or tissue array is a paraffin block containing several individual tissue samples
- a typical tissue microarray may contain 1000 or more samples
- Tissue microarrays allow the examination ot a large series of specimens while maximizing efficient utilization of technician time, reagents, and valuable tissue resources
- Tissue microarrays are constructed by tirst removing small cores (0 6mm diameter 3-4 mm height) trom "donor" tissue biopsy samples embedded in parattin blocks using a tissue array instrument (Beecher Instruments Silver Spring, MD, USA) Using the same instrument, each core sample is then re-embedded, together ith other biopsy cores, in a single ' recipient " block to form an array
- each tissue is sampled in triplicate Thin slices (4 - 8 ⁇ m thick) of a recipient block were mounted on glass slides
- Visualization and screening may be performed by histological methods including, but not limited to, standard hematoxy lm and eosin staining tor morphological analysis
- In situ hybridization is a powerful and versatile technique tor the detection and localization ot nucleic acid sequences within cell or tissue preparations It may be useful, for example, to identify sites of gene expression, analyze the tissue distribution of transcription, identify and localize viral infection follow changes in specific mRNA synthesis and aid in chromosome mapping
- In situ hybridization was performed following an optimized version ot the protocol by Lu and Gillett, Cell Vision 1 169-176 (1994). using PCR-generated P-labeled ⁇ boprobes Briefly, tormalin-fixed, paraffin-embedded human tissues were sectioned, deparatti zed, deproteinated in proteinase K (20 ⁇ g/ml) for 15 minutes at 37 C .
- DNA 164647 LIV- 1-164647 nucleic acid sequence from nucleotide 1690 - nucleotide 2240 (SEQ ID NO 3, see Fig 2A) having the following sequence was amplified for use as template DNA 5 -TGCCATTCAC ATTTCCACGA TACACTCGGC CAGTCAGACG ATCTCATTCA CC ⁇ CCATCAT GACTACCATC ATATTCTCCA TCATCACCAC CACCAAAACC ACCATCCTCA CAGTCACAGC CAGCGCTACT CTCGGGAGGA GCTGAAAGAT GCCGGCGTCG CCACTTTGGC CTGGATGGTG ATAATGGGTG ATGGCCTGCA CAATTTCAGC GATGGCCTAG CAATTGGTGC TGCTTTTACT GAAGGCTTAT CAAGTGGTTT AAGTACTTCT GTTGCTGTGT TCTGTCATGA GTTGCCTCAT GAATTAGGTG ACTTTGCTGT TCTACTAAAG GCTGACATGA CCGTTAAGCA GGCTGT
- the Advantage cDNA polymerase mix trom Clonetech (8417- 1 ) was used according to the manufacturer s directions with slight modifications Briefly. 316 ⁇ l SQ water (highly purified RNase-tree w ater), 40 ⁇ l 10 X PCR butter, 16 ⁇ l 10 mM dNT) 8 ⁇ l p ⁇ mei SEQ ID NO 13, 8 ⁇ l pnmer SEQ ID NO 14 were combined to form a master mixture From the mastei mixture 97 ⁇ l were a quoted into a PCR tube followed by the addition of 2 ⁇ 1 ot template DNA and 1 ⁇ I of Adv antage cDNA polymerase Using a Perkin-Elmer Cctus 9600 thermocvcler cycle conditions were as follows
- the PCR product was filter through a M ⁇ crocon-50TM filter unit to remove primers and excess buffer
- Hybridization 2 0 x 10 6 cpm probe and 2 0 ⁇ l tRNA ( 100 mg/ml stock) per slide were heated at 95 C for 3 minutes The slides were cooled on ice and hybridization butter was added to make a tinal volume
- RNA in situ hybndization For comparative analysis of LIV- 1 and ErbB2 expression by RNA in situ hybndization a ⁇ boprobe complementary to an ErbB2 nucleic acid sequence was prepared As a control expiession of ⁇ -actin was also monitored using a ⁇ boprobe complementary to the RNA ot that gene
- the ErbB2 ⁇ boprobe was synthesized by transcription trom a DNA template having the following sequence 5 - TGGTCGTGGT CTTGGGGGTG GTCTTTGGGA TCCTCATCAA GCGACGGCAG CAGAAGATCC GGAAGTACAC GATGCGGAGA CTGCTGCAGG AAACGGAGCT GGTGGAGCCG CTGACACCTA GCGGAGCGAT GCCCAACCAG GCGCAGATGC GGATCCTGAA AGAGACGGAG CTGAGGAAGG TGAAGGTGCT TGGATCTGGC GCTTTTGGCA CAGTCTACAA GGGCATCTGG ATCCCTGATG GGGAGAATGT GAAAATTCCA GTGGCCATCA AAGTGTTGAG GGAAAACACA TCCCCCAAAG CCAACAAAGA AATCTTAGAC GAAGCATACG TGATGGCTGG TGTGGGCTCC CCATAT
- the ⁇ -actin ⁇ boprobe was synthesized by transcription trom a DNA template having the following sequence 5'-GCTGCCTGAC GGCCAGGTCA TCACCATTGG CAATGAGCGG TTCCGCTGCC CTGAGGCACTCTTCCAGCCT TCCTTCCTGG GCATGGAGTC CTGTGGCATC CACGAAACTA CCTTCAACTC CATCATGAAG TGTGACTGTG ACATCCGCAA AGACCTGTAC GCCAACACAG TGCTGTCTGG CGGCACCACC ATGTACCCTG GCATTGCCGA CAGGATGCAG AAGGAGATCA CTGCCCTGGC ACCCAGCACA ATGAAGATCA AGATC ATTGC TCCTCTGAGC GCA AGTACTC-3 (SEQ ID NO 16) and its complement
- the template included a T3 promoter
- the resultant ⁇ -actin-specific antisense ⁇ boprobe was designated " 1 17 AS "
- Tumor Block 3 H2000-165 20 764 AS Lung Tumor TM A H I 999-637 764 AS + Expression in one carcinoma and low level expression observed in normal bi onchial epithelium
- section Misc 02 contained normal (i.e non-cancerous) kidney, bladder, lung, and end stage renal disease ( non-cancerous)
- Tumor block 3 (H2000-165 20) contained chondrosarcoma, osteosarcoma. renal cell carcinoma liposarcoma gastric adenocarcinoma, squamous carcinoma, and brain tumor Human NMA (H2000-2) contained samples of pancreas, adrenal, heart, eye. small intestine, kidney, spleen, lymph node, tonsil, skin, breast, lung, biain. colon, liver, aorta.
- RNA in situ hyb ⁇ dization confirms elevated expression of LIV-1 in some breast cancers relative to normal breast expression was elevated in 5 of 1 3 breast cancers in a TMA High expression was also seen in benign breast disease, specifically fibroadenomas and scierosing adenosis Strong expression was observed in normal prostatic epithelium as well as in prostate cancers Expression was seen in epithelium ot a number ot other tumor types including squamous lung, transitional endometnal. o arian carcinomas and melanoma With regard to expression in normal tissue.
- LIV- 1 is moderately to highly expressed in normal squamous epithelium (e g chimp and human breast skin) Strong expression was observed over normal prostatic epithelium, focal low level expression over normal renal tubules Liver, lung gall bladder, spleen, heart, and pancreas were all negative tor LIV-1 RNA expression In fetus expression was seen in fetal kidney epithelium as well as in developing spinal ganglia including enteric plexuses and tetal brain
- Detection of LIV- 1 - 164647 expression in a cell may be performed by in situ hybridization where the probe for detecting is derived trom the ECD of LIV- 1 - 164647 and is a cDNA oi a RNA having a sequence that hybridizes under stringent conditions to a sequence trom nucleotide 412 to and including nucleotide 477 of SEQ ID NO 3 or its complementary sequence Preterably the probe hybridizes to a sequence trom nucleotide 446 to and including nucleotide 464 of SEQ ID NO 3 or its complementary sequence
- Hybridization protocols useful for this method ot detection are standard in the relevant literature
- a non-limiting RNA in situ hybridization technique useful tor detecting LIV-1 -164647 expression is disclosed herein
- relative expression of LIV-1 and ErbB2 is performed by contacting an anti-LIV- 1 -164647 antibody ot the invention that specifically binds to the extracellular domain of LIV- 1 - 164647 protein and comparing the amount of detectable binding with control cells that do not express LIV-1 - 164647 protein, with cells (such as SKBR3 cells) that overexpress ErbB2, but do not overexpress LIV-1 -164647, and with cells (such as cells expressing LIV-1 or DNA164647) that overexpress LIV-1- 164647 but do not overexpress ErbB2 wherein overexpression is determined as at least 1 5-fold greater expression in a cell from tumor tissue relative to expression in a cell from non-cancerous tissue
- the techniques for binding anti-LIV- 1 antibody and/or ant ⁇ -ErbB2 antibody are readily determined based on disclosure provided herein coupled with ordinary skill in the art of cell surface protein detection
- an LIV-1 polypeptide binds to a polypeptide comprising an amino acid sequence from amino acid 1 14 to and including amino acid 135 of SEQ ID NO 4. more preferably comprising a sequence trom amino acid 126 to and including 132 of SEQ ID NO 4
- Antibodies useful tor practicing this method are described herein and include without limitation the monoclonal antibodies produced by one or more of the hyb ⁇ domas ATCC (LIV-1 2945 2G 1 1 C7 2F10).
- ATCC (LIV-1.2982 4A12 1E8 1 C4), ATCC (LIV-1 2983 3G9 1D4 1 D7), ATCC (LIV- 1.2984 6D6 1 H10 2C1 ), ATCC (LIV-1 2985 4F3 2D6 1D7), ATCC (LIV-1 2987 1 D8 1C 1 1 2B7), and ATCC (LIV-1 2988 1A7 1F2 1H7) Techniques useful for performing antibody binding studies are disclosed herein and are found in the relevant literature
- Antibodies specifically binding a LIV-1 polypeptide of the invention, or a fragment ot the LIV- 1 polypeptide, such as the ECD, which may be identified by the screening assays disclosed herein can be administered for the treatment ot tumors, including cancers, in the form ot pharmaceutical compositions Where antibody fragments are used the smallest inhibitory tragment which specifically binds to the binding domain of the target protein is preferred
- peptide molecules can be designed which retain the ability to bind the target protein sequence
- Such peptides can be synthesized chemically and or produced by recombinant DNA technology (see e s> Marasco et al Proc Natl Acad Sci USA 90, 7889-7893 [ 19931) If the antibody that binds a LIV-1 protein binds to an intracellular portion, and whole antibodies or fragments are used as inhibitors, internalizing the antibodies is preferred Lipofections or liposomes can be used to deliver the antibody, or
- Therapeutic formulations ot the antibodies used in accordance with the present invention are prepared for storage by mixing an antibody having the desired degree of purity with optional pharmaceutical lv acceptable carriers, excipients or stabilizers (Remington 's Phai maceutical Sciences 16th edition Osol, A Ed [ 1980]) in the form of lyophihzed formulations or aqueous solutions Acceptable carriers, excipients.
- buffers such as phosphate citrate, and other organic acids, antioxidants including ascorbic acid and methionine, preservatives (such as octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkomum chloride, benzethonium chloride, phenol butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol.
- buffers such as phosphate citrate, and other organic acids
- antioxidants including ascorbic acid and methionine
- preservatives such as octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkomum chloride, benzethonium chloride, phenol butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol.
- polypeptides such as serum albumin, gelatin, or immunoglobulins
- proteins such as serum albumin, gelatin, or immunoglobulins
- hydrophilic polymers such as polyvinylpyrrohdone.
- amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine, monosaccha ⁇ des, disaccha ⁇ des, and other carbohydrates including glucose, mannose, or dext ⁇ ns.
- chelating agents such as EDTA, sugars such as sucrose, mannitol trehalose or sorbitol, salt-torming counter-ions such as sodium, metal complexes (e g Zn-protein complexes ), and/or non- lonic surfactants such as TWEENTM, PLURONICSTM or polyethylene glycol (PEG)
- the formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adv ersely affect each other
- VEGF vascular endothelial factor
- the composition may comprise a cytotoxic agent, cytokine or growth inhibitory agent, provided that the cytotoxic agent is other than an anthracychne derivative, e g doxorubicm or epirubicin
- cytotoxic agent is other than an anthracychne derivative, e g doxorubicm or epirubicin
- Such molecules are suitably present in combination in amounts that are effective tor the purpose intended
- the active ingredients may also be entrapped in microcapsules prepared for example, bv coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly- (methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example liposomes. albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions Such techniques are disclosed in Remington 's Pharmaceutical Sciences 16th edition, Osol, A Ed ( 1980)
- the formulations to be used for in vivo administration must be sterile This is readily accomplished by filtration through sterile filtration membranes
- sustained-release preparations may be prepared Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form ot shaped articles, e ? f ilms, or microcapsules
- ot sustained-release matrices include polyesters, hydrogels (tor example poly (2-hy d ⁇ oxyethyl-methacrylate) or poly(v ⁇ nylalcohol)).
- poly lactides U S Pat No 3.773.919
- copolymers ot L-glutamic acid and ⁇ ethyl-L-glutamate non-degradable ethylene-vinyl acetate degradable lactic acid-gly colic acid copolymers such as the LUPRON DEPOTTM (lniectable microspheres composed ot lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydrox butyric acid
- polymers such as ethylene-v myl acetate and lactic acid-glycolic acid enable release ot molecules for over 100 days
- certain hydrogels release proteins tor shorter time periods When encapsulated antibodies remain in the body tor a long time, they may denature or aggregate as a result ot exposure to moisture at 37 °C.
- an article of manufacture containing materials useful for the diagnosis or treatment of the disorders described above comprises a container and a label Suitable containers include, tor example, bottles, vials, syringes and test tubes
- the containers may be formed trom a variety of materials such as glass or plastic
- the container holds a composition which is effective for detecting (e g .
- the acttv e agent in the composition is usually an anti-tumor agent capable ot interfering with the activity ot a gene product identified herein, e g an antibody
- the label on, or associated with, the container indicates that the composition is used tor diagnosing or treating the condition of choice
- the article ot manufacture may further comprise a second container comprising a pharmaceutically-acceptable butter, such as phosphate- buffered saline. Ringer's solution and dextrose solution It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use
- tumor diagnostics or prognostics While cell surface proteins, such as growth receptors overexpressed in certain tumors are excellent targets for drug candidates or tumor (e g cancer) treatment, the same proteins along with secreted proteins encoded by the genes amplified in tumor cells find additional use in the diagnosis and prognosis ot tumors.
- antibodies directed against the proteins products of genes amplified in tumor cells can be used as tumor diagnostics or prognostics
- antibodies can be used to qualitatively or quantitatively detect the expression ot proteins encoded by the amplified genes ("marker gene products")
- the antibody preferably is equipped with a detectable, e g fluorescent label, and binding can be monitored by light microscopy, flow cytometry. fluo ⁇ metry. or other techniques known in the art These techniques are particularly suitable, if the amplified gene encodes a cell surface protein e g a growth factor Such binding assays are performed essentially as described herein
- In situ detection ot antibody binding to the marker gene products can be pertoimcd tor example by immunofluorescence or immunoelectron microscopy
- a histological specimen is removed from the patient and a labeled antibody is applied to it. preterably by overlaying the antibody on a biological sample This procedure also allows tor determining the distribution of the marker gene product in the tissue examined It will be apparent tor those skilled in the art that a wide variety of histological methods are readily available for in situ detection
- Example 10 Determination of LIV-1 in tissue or body fluid Described heiein are serological methods tor determining the presence ot LIV-1 gene product (e g LIV-
- the processes ot this embodiment of the invention comprise incubating or otherwise exposing a sample ot body fluid potentially containing LIV- 1 - 164647 extracellular domain or fragments thereof to anti-LIV- 1 -164647 monoclonal antibodies and detecting the presence ot a reaction product Those skilled in the art will recognize that there are many variations of these basic procedures These include, tor example.
- the monoclonal antibodies are appropriately labeled tor detection Labels useful in the practice ot the invention include, but are not limited to moieties, such as enzymes that must be reacted or derivatized to be detected
- the enzyme label can be detected by any of the currently utilized colo ⁇ met ⁇ c spectrophotomet ⁇ c, fluorospectrophotmet ⁇ c or gasomet ⁇ c techniques
- the enzyme is combined with the antibody with bridging molecules such as carbodnmides, pe ⁇ odate, dnsocyanates glutaraldehyde and the like Many enzymes which can be used in these procedures are known and can be utilized Examples are peroxidase.
- the antibodies may be tagged with such labels by known methods For instance, coupling agents such as aldehydes, carbodnmides. dimaleimide. lmidates. succimmides. bid-diazotized benzadme and the like may be used to tag the antibodies with the above-described fluorescent, chemiluminescent and enzyme labels Various labeling techniques are described in Morrison. Methods in Enzymology 32b 103 [ 1974], Syvanen et al , J Biol
- 99 14 131 can be detected by any of the currently available counting procedures
- Preferred isotope labels are Tc, C, I
- the following non-hmiting assay is useful for detei mining the presence of and to quantitate the amount ot specific anti-LIV- 1 monoclonal antibody (preferably specific to the extracellular domain ot the LIV- 1 -164647 gene product or a portion ot the extracellular domain) in a body fluid ot a mammal
- the body fluid may include but is not limited to serum amniotic fluid milk umbilical cord serum, ocular aqueous and vitreous liquids and ocular vitreous gel
- the method oi assaying anti-LIV- 1 antibody described herein is meant as an example ot such a method and is not meant to be limiting
- a standardized preparation ot ant ⁇ -LIV-1 antibody, preterably specific to the extracellular domain of the LIV- 1-167647 gene product, controls and serum samples are diluted with Assay Diluent (PBS/0 5% BSA/0 05% Polysorbate 20/0 01 % Thimerosal)
- Assay Diluent PBS/0 5% BSA/0 05% Polysorbate 20/0 01 % Thimerosal
- the dilutions of standardized anti-LIV- 1 antibody are prepared to span a range of concentrations useful tor a standard curve
- the samples are diluted to tall within the standard curve
- Coat Antigen in Coating buffer (anti-LIV- 1 -164647 antibody in 0 05 M sodium carbonate buffer) is added to each well of a microtiter plate and incubated at 2-8 °C tor 12-72 hours The coating solution is removed and each well is washed six times with water then blotted to remove excess water An aliquot ot Assay Diluent is added to each well and incubated for 1 -2 hours at ambient temperatuie with agitation The wells are washed as in the previous step Ahquots of diluted standard, control and sample solutions are added to the wells and incubated at ambient temperature for 1 hour with agitation to allow binding of the antibody to the coating antigen The wells are washed again with water as in previous steps
- Horse radish peroxidase-conjugate (HRP-conjugate, Goat anti-human IgG Fc conjugated to horseradish peroxidase, (Organon Teknika catalog #55253 or equivalent) is diluted with Assay Diluent to yield an appropriate optical density range between the highest and lowest standards An aliquot of the HRP-conjugate solution is added to each well and incubated at ambient temperature for 1 hour with agitation The wells are washed with water as in previous steps
- the anti-LIV- 1 antibodies or other LIV-1 activity-blocking molecules may be used to treat various conditions characterized by overexpression and/or activation of the LIV-1 gene product with or without coexpression of ErbB2 above the ErbB2 expression tound in healthy, nonmahgnant cells
- Exemplary conditions or disorders to be treated with such antibodies and other compounds including, but not limited to, small organic and inorganic molecules, peptides, antisense molecules etc include benign or malignant tumors (e g breast, prostate, lung, and colon as well as renal, liver, kidney, bladder gastric, ovarian, colorectal, pancreatic, vulval, thyroid, hepatic carcinomas, sarcomas, ghoblastomas.
- an antibody is used to treat an LIV-1 overexpression -related disorder, the antibody is preferably an anti-LIV- 1 -164647 antibody, more preferably a humanized antibody which binds to a polypeptide comprising an amino acid sequence from amino acid 1 14 to and including amino acid 135 of SEQ ID NO:4.
- the anti-tumor agents of the present invention are administered to a mammal, preferably a human, in accord with known methods, such as intravenous administration as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerobrospinal. subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical, or inhalation routes. Intravenous administration of the antibody is preferred.
- chemotherapeutic agents may be administered to the patient. Preparation and dosing schedules for such chemotherapeutic agents may be used according to manufacturers' instructions or as determined empirically by the skilled practitioner. Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy ServiceEd., M.C. Perry, Williams & Wilkins. Baltimore, MD ( 1992).
- the chemotherapeutic agent may precede, or follow administration of the anti-tumor agent, e.g. antibody, or may be given simultaneously therewith.
- the antibody may be combined with an anti-oestrogen compound such as tamoxifen or an anti-progesterone such as onapristone (see, EP 616812) in dosages known for such molecules.
- antibodies against other tumor associated antigens such as antibodies which bind to the ErbB2, EGFR. ErbB3, ErbB4, or vascular endothelial factor (VEGF).
- VEGF vascular endothelial factor
- two or more antibodies binding the same or two or more different antigens disclosed herein may be co- administered to the patient.
- the antibodies herein are co-administered with a growth inhibitory agent.
- the growth inhibitory agent may be administered first, followed by an antibody of the present invention.
- simultaneous administration or administration of the antibody of the present invention first is also contemplated.
- Suitable dosages for the growth inhibitory agent are those presently used and may be lowered due to the combined action (synergy) of the growth inhibitory agent and the antibody herein.
- the combined administration includes co-administration in either order, wherein preferably there is a time period while both (or all ) active agents simultaneously exert their biological activities.
- Preparation and dosing schedules for such chemotherapeutic agents may be used according to manufacturers' instructions or as determined empirically by the skilled practitioner. Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy Service Ed.. M.C. Perry, Williams & Wilkins, Baltimore, MD ( 1992).
- the chemotherapeutic agent may precede, or follow administration of the antibody or may be given simultaneously therewith.
- the antibody may be combined with an anti-estrogen compound such as tamoxifen or an anti-progesterone such as onapristone (sec EP 616812) in dosages known tor such molecules
- VEGF vascular endothelial factor
- two or more anti-LIV- 1 antibodies may be co-administered to the patient
- the ant ⁇ -LIV- 1 antibody may be co-administered with a growth inhibitory agent
- the growth inhibitory agent may be administered first followed by the anti-LIV- 1 antibody
- simultaneous administration or administration ot the ant ⁇ -LIV-1 antibody first is also contemplated Suitable dosages for the growth inhibitory agent are those presently used and may be lowered due to the combined action (synergy) ot the growth inhibitory agent and anti-LIV- 1 antibody
- the patient may be subjected to surgical removal of cancer cells and/or radiation therapy
- ot antibody is an initial candidate dosage for administration to the patient, whether, tor example by one or more separate administrations, or by continuous infusion
- a typical daily dosage might range trom about 1 ⁇ g/kg to 100 mg/kg or more depending on the factors mentioned above
- the treatment is sustained until a desired suppression ot disease symptoms occurs
- other dosage regimens may be useful The progress of this therapy is easily monitored by conventional techniques and assays Example 12.
- the results of the gene amplification study can be further verified by antibody binding studies, in which the ability ot anti-LIV- 1 - 164647 antibodies to detect the presence ot oi to inhibit the effect ot the LIV-1 polypeptides on tumor (cancer) cells is tested
- Exemplary antibodies include polyclonal monoclonal, humanized bispecitic. and heteroconjugate antibodies, the preparation ot which will be described hereinbelow
- Antibody binding studies may be carried out in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and lmmunoprecipitation assays Zola.
- Competitiv e binding assays rely on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody
- the amount of target protein (encoded by a gene amplified in a tumor cell) in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies
- the antibodies preferably are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated trom the standard and analyte which remain unbound
- Sandwich assays involve the use ot two antibodies each capable ot binding to a different immunogenic portion, or epitope of the protein to be detected
- the lest sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex
- the second antibody may itself be labeled with a detectable moiety (direct sandwich assay s) or may be measured using an anti-immunoglobuhn antibody that is labeled with a detectable moiety (indirect sandwich assay )
- one type ot sandw ich assay is an ELISA assay in which case the detectable moiety is an enzyme
- the tumor sample may be fresh or tiozen or may be embedded in paraff in and tixed with a preservative such as formalin tor example Example 13.
- a preservative such as formalin tor example Example 13.
- Cell-based assays and animal models for tumors can be used to verify the findings ot the gene amplification assay, and further understand the relationship between the genes identified herein and the development and pathogenesis of neoplastic cell growth
- the role ot gene products identified herein in the development and pathology ot tumor or cancer can be tested by using primary tumor cells or cells lines that have been identified to amplify the genes herein Such cells include, tor example the breast and prostate cancer cells and cell lines listed above
- Suitable cells include for example stable tumor cells lines such as.
- the B 104-1 - 1 cell line stable NIH-3T3 cell line transfected w ith the neu protooncogene
- / ⁇ s-transfected NIH-3T3 cells which can be transfected with the desired gene, and monitored tor tumorogenic growth
- Such transfected cell lines can then be used to test the ability of poly- or monoclonal antibodies or antibody compositions to inhibit tumorogenic cell growth by exerting cytostatic or cytotoxic activity on the growth of the transformed cells or by mediating antibody-dependent cellular cytotoxicity (ADCC)
- ADCC antibody-dependent cellular cytotoxicity
- animal models can be used to further understand the role ot the genes identified herein in the development and pathogenesis ot tumors and to test the efficacy of candidate therapeutic agents including antibodies, and other antagonists of the native polypeptides, including small molecule antagonists
- the in vivo nature ot such models makes them particularly predictive of responses in human patients
- Animal models of tumors and cancers e g breast cancer, colon cancer, prostate cancer, lung cancer, etc
- Non-recombinant animal models include, for example, rodent e g .
- Such models can be generated by introducing tumor cells into syngeneic mice using standard techniques, e g subcutaneous injection, tail vein injection, spleen implantation, intraperitoneal implantation, implantation under the renal capsule or orthopin implantation, e g colon cancer cells implanted in colonic tissue (See, e g PCT publication No WO 97/33551 , published September 18 1997)
- nude mice Probably the most often used animal species in oncological studies are immunodeticient mice and in particular, nude mice
- the observation that the nude mouse with hypo/aplasia could successfully act as a host tor human tumor xenografts has lead to its widespread use for this purpose.
- the autosomal recessive nu gene has been introduced into a very large number of distinct congenic strains of nude mouse, including, for example. AS W. A/He.
- AKR BALB/c
- B 10.LP C17, C3H.
- the cells introduced into such animals can be derived from known tumor/cancer cell lines, such as. any of the above-listed tumor cell lines, and. for example, the B 104-1 - 1 cell line (stable NIH-3T3 cell line transfected with the neu protooncogene); ra_?-transfected NIH-3T3 cells; Caco-2 (ATCC HTB-37); a moderately well- differentiated grade II human colon adenocarcinoma cell line. HT-29 (ATCC HTB-38). or from tumors and cancers.
- B 104-1 - 1 cell line stable NIH-3T3 cell line transfected with the neu protooncogene
- ra_?-transfected NIH-3T3 cells Caco-2 (ATCC HTB-37); a moderately well- differentiated grade II human colon adenocarcinoma cell line.
- HT-29 ATCC HTB-38
- Tumor cells can be introduced into animals, such as nude mice, by a variety of procedures.
- the subcutaneous (s.c.) space in mice is very suitable for tumor implantation.
- Tumors can be transplanted s.c. as solid blocks, as needle biopsies by use of a trochar. or as cell suspensions.
- tumor tissue fragments of suitable size are introduced into the s.c. space.
- Cell suspensions are freshly prepared from primary tumors or stable tumor cell lines, and injected subcutaneously. Tumor cells can also be injected as subdermal implants. In this location, the inoculum is deposited between the lower part of the dermal connective tissue and the s.c. tissue.
- Animal models of breast cancer can be generated, for example, by implanting rat neuroblastoma cells (from which the neu oncogen was initially isolated), or neu -transformed NIH-3T3 cells into nude mice, essentially as described by Drebin et al. PNAS USA 83, 9129-9133 ( 1986).
- animal models of colon cancer can be generated by passaging colon cancer cells in animals, e.g. nude mice, leading to the appearance of tumors in these animals.
- An orthotopic transplant model of human colon cancer in nude mice has been described, for example, by Wang et al, Cancer Research 54. 4726-4728 ( 1994) and
- Tumors that arise in animals can be removed and cultured in vitro. Cells from the in vitro cultures can then be passaged to animals. Such tumors can serve as targets for further testing or drug screening. Alternatively, the tumors resulting from the passage can be isolated and RNA from pre-passage cells and cells isolated after one or more rounds of passage analyzed for differential expression of genes of interest. Such passaging techniques can be performed with any known tumor or cancer cell lines.
- Meth A, CMS4. CMS5. CMS21 , and WEHI-164 are chemically induced fibrosarcomas of
- mice (DeLeo et al. J. Exp. Med. 146, 720 [ 1977]). which provide a highly controllable model system for studying the anti-tumor activities of various agents (Palladino et al, J. Immunol. 138. 4023-4032
- tumor cells are propagated in vitro in cell culture. Prior to injection into the animals, the cell lines are washed and suspended in buffer at a cell density of about 10x10 to 10x 10 cells/ml The animals are then intected subcutaneously with 10 to 100 ⁇ l of the cell suspension, allowing one to three weeks for a tumor to appear
- the Lew is lung (3LL) carcinoma ot mice which is one of the most thoroughly studied experimental tumors can be used as an investigational tumor model
- Efficacy in this tumor model has been correlated with beneficial effects in the treatment ot human patients diagnosed with small cell carcinoma ot the lung (SCCL)
- This tumor can be introduced in normal mice upon injection of tumor fragments from an affected mouse or of cells maintained in culture (Zupi et al Br J Cancer 41 suppl 4 309 ( 1980] ) and e idence indicates that tumors can be started trom injection of even a single cell and that a very high proportion of infected tumor cells survive For further information about this tumor model see Zachar
- Recombinant (transge c) animal models can be engineered by introducing the coding portion of the genes identified herein into the genome ot animals of interest using standard techniques tor producing transgemc animals
- Animals that can serve as a target tor transgemc manipulation include without limitation mice, rats rabbits, guinea pigs sheep, goats pigs and non-human primates, e g baboons chimpanzees and monkeys
- Techniques known in the art to introduce a transgene into such animals include pronucleic m ⁇ cro ⁇ n]ect ⁇ on (Hoppe and Wanger, U S Patent No 4 873, 191 ), retrovirus-mediated gene transfer into germ lines (e g Van der Putten et al Proc Natl Acad Sci USA 82 6148 615 [ 1985]), gene targeting in embryonic stemcells (Thompson etal Cell 56, 313-321 [1989]).
- transgemc animals include those that carry the transgene only in part of their cells ("mosaic animals ')
- the transgene can be integrated either as a single transgene or in concatamers, e g , head-to-head or head-to-tail tandems
- Selective introduction of a transgene into a particular cell type is also possible by following for example, the technique of Lasko et al Proc Natl Acad Sci L SA 89 6232 636 (1992)
- transgene expression in transgemc animals can be monitored by standard techniques For example. Southern blot analysis or PCR amplification can be used to verify the integration ot the transgene The level ot mRNA expression can then be analyzed using techniques such as in situ hyb ⁇ di/ation. Noithern blot analysis. PCR. or immunocytochemistry The animals are further examined tor signs of tumor or cancel development
- knock out animals can be constructed w htch have a detective or altered gene encoding a LIV- 1 - 164647 polypeptide identified herein, as a result of homologous recombination between the endogenous gene encoding the polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell ot the animal
- cDNA encoding a particular LIV- 1 polypeptide can be used to clone genomic DNA encoding that polypeptide in accordance with established techniques
- a portion of the genomic DNA encoding a particular LIV- 1 polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration
- sev eral kilobases ot unaltered flanking DNA are included in the vector [see e g .
- the vector is introduced into an embryonic stem cell line (e g . by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see e g . Li et al , Cell, 69 915 ( 1992)] The selected cells are then injected into a blastocyst ot an animal (e . a mouse or rat) to form aggregation chimeras [see e g .
- a chime ⁇ c embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal
- Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA
- Knockout animals can be characterized for instance by their ability to defend against certain pathological conditions and by their development of pathological conditions due to absence of the LIV- 1 polypeptide
- SCC feline oral squamous cell carcinoma
- Feline oral SCC is a highly invasive, malignant tumor that is the most common oral malignancy of cats, accounting for over 60% of the oral tumors reported in this species It rarely metastasizes to distant sites, although this low incidence of metastasis may merely be a reflection of the short survival times for cats with this tumor
- SCC feline oral squamous cell carcinoma
- Screening assays tor drug candidates are designed to identity compounds that bind or complex with the polypeptides encoded by the genes identified herein, or otherwise interfere with the interaction ot the encoded polypeptides with other cellular proteins
- Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable tor identifying small molecule drug candidates
- Small molecules contemplated include synthetic organic or inorganic compounds, including peptides, preferably soluble peptides, (poly)pept ⁇ de- ⁇ mmunoglobuhn fusions, and in particulai .
- antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chime ⁇ c or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments
- the assays can be perlormed in a variety ot formats, including protein-protein binding assays biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art
- the polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e g on a microtiter plate, by covalent or non-covalent attachments
- a solid phase e g on a microtiter plate
- Non- covalent attachment generally is accomplished by coating the solid surface with a solution ot the polypeptide and drying
- an immobilized antibody e g a monoclonal antibody, specific for the polypeptide to be immobilized can be used to anchor it to a solid surface
- the assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e g the coated surface containing the anchored component
- candidate compound interacts with but does not bind to a particular LIV- 1 polypeptide encoded by a nucleic acid sequence described herein
- its interaction with that polypeptide can be assayed by methods well known for detecting protein-protein interactions
- assays include traditional approaches, such as, cross- linking, co-immunoprecipitation.
- yeast-based genetic system described by Fields and co- workers [Fields and Song, Nature (London) 340, 245-246 ( 1989), Chien et ⁇ l Pioc Natl Acad Sci USA 88, 9578- 9582 ( 1991 )] as disclosed by Chevrav and Nathans [Pi c Natl Acad Sci USA 89 5789-5793 ( 1991 )]
- Many transcriptional activators such as yeast GAL4 consist of two physically disci ete modular domains one acting as the DNA-binding domain, while the other one functioning as the transcription activ ation domain
- yeast expression system described in the foregoing publications (generally referred to as the two-hybrid system ) takes advantage ot this property, and employ s two hybrid proteins one in which the target protein is fused to the DNA- binding domain of GAL4, and another in which candidate activating proteins are fused to the activation domain
- a reaction mixture is prepared containing the product of the amplified gene and the intra- or extracellular component under conditions and for a time allowing tor the interaction and binding of the two products
- a placebo may be added to a third reaction mixture, to serve as positive control
- the binding (complex formation) between the test compound and the intra- or extracellular component present in the mixture is monitored as described hereinabove
- the formation ot a complex in the control react ⁇ on(s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner
- compositions useful in the treatment ot tumors associated with the amplification ot the genes identified herein include, without limitation, antibodies, small organic and inorganic molecules, peptides phosphopeptides, antisense and ⁇ bozyme molecules, triple helix molecules, etc that inhibit the expression and/or activity of the target gene product
- antisense RNA and RNA molecule act to directly block the translation ot mRNA by hybridizing to targeted mRNA and preventing protein translation
- antisense DNA ohgodeoxy ⁇ bonucleotides derived trom the translation initiation site, e g between about - 10 and + 10 positions of the target gene nucleotide sequence, are preferred
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleav age of RNA Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage Specific ⁇ bozyme cleavage sites within a potential RNA target can be identified by known techniques For further details see, e g. Rossi, Current Biology 4 469-471 ( 1994), and PCT publication No WO 97/33551 (published September 18, 1997)
- Nucleic acid molecules in triple helix formation used to inhibit transcription should be single-stranded and composed of deoxynucleotides
- the base composition of these oligonucleotides is designed such that it promotes P1S03RM
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Genetics & Genomics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Hematology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Analytical Chemistry (AREA)
- Toxicology (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Plant Pathology (AREA)
- Oncology (AREA)
- Reproductive Health (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA002395832A CA2395832A1 (en) | 2000-01-25 | 2001-01-25 | Liv-1 related protein, polynucleotides encoding the same and use thereof for treatment of cancer |
| JP2001561030A JP2003523207A (ja) | 2000-01-25 | 2001-01-25 | Liv−1関連タンパク質、それをコードするポリヌクレオチド、及び癌の治療へのその利用 |
| MXPA02007190A MXPA02007190A (es) | 2000-01-25 | 2001-01-25 | Proteina relacionada a liv-1, polinucleotidos que codifican para la misma y uso de la misma para el tratamiento de cancer. |
| AU34584/01A AU3458401A (en) | 2000-01-25 | 2001-01-25 | Compositions and methods for treatment of cancer |
| KR1020027009510A KR20020073181A (ko) | 2000-01-25 | 2001-01-25 | Liv-1 관련 단백질, 이를 코딩하는 폴리뉴클레오티드및 암의 치료를 위한 그의 용도 |
| US10/182,033 US7285382B2 (en) | 2000-01-25 | 2001-01-25 | Compositions and methods for treatment of cancer |
| IL15059201A IL150592A0 (en) | 2000-01-25 | 2001-01-25 | Liv-1 related protein, polynucleotides encoding the same and use thereof for treatment of cancer |
| EP01906709A EP1263780A2 (en) | 2000-01-25 | 2001-01-25 | Liv-1 related protein, polynulceotides encoding the same and use thereof for treatment of cancer |
| US11/538,881 US7691566B2 (en) | 2000-01-25 | 2006-10-05 | Compositions and methods for treatment of cancer |
| IL202332A IL202332A0 (en) | 2000-01-25 | 2009-11-25 | Liv-1 related protein, polynucleotides encoding the same and use thereof for treatment of cancer |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US17795100P | 2000-01-25 | 2000-01-25 | |
| US60/177,951 | 2000-01-25 | ||
| US19576100P | 2000-04-10 | 2000-04-10 | |
| US60/195,761 | 2000-04-10 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10182033 A-371-Of-International | 2001-01-25 | ||
| US11/538,881 Continuation US7691566B2 (en) | 2000-01-25 | 2006-10-05 | Compositions and methods for treatment of cancer |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2001055178A2 true WO2001055178A2 (en) | 2001-08-02 |
| WO2001055178A3 WO2001055178A3 (en) | 2002-03-07 |
| WO2001055178A9 WO2001055178A9 (en) | 2002-04-04 |
Family
ID=26873811
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2001/002622 Ceased WO2001055178A2 (en) | 2000-01-25 | 2001-01-25 | Liv-1 related protein, polynucleotides encoding the same and use thereof for treatment of cancer |
Country Status (10)
| Country | Link |
|---|---|
| US (3) | US7285382B2 (https=) |
| EP (1) | EP1263780A2 (https=) |
| JP (1) | JP2003523207A (https=) |
| KR (1) | KR20020073181A (https=) |
| AU (1) | AU3458401A (https=) |
| CA (1) | CA2395832A1 (https=) |
| IL (2) | IL150592A0 (https=) |
| MX (1) | MXPA02007190A (https=) |
| WO (1) | WO2001055178A2 (https=) |
| ZA (1) | ZA200205191B (https=) |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6762020B1 (en) | 1999-03-15 | 2004-07-13 | Protein Design Labs, Inc. | Methods of diagnosing breast cancer |
| WO2004067564A3 (en) * | 2003-01-29 | 2005-02-17 | Protein Design Labs Inc | Compositions against cancer antigen liv-1 and uses thereof |
| WO2005048938A2 (en) | 2003-11-13 | 2005-06-02 | California Pacific Medical Center | Anti-pecam therapy for metastasis suppression |
| WO2004066933A3 (en) * | 2003-01-27 | 2006-03-02 | Biogen Idec Inc | Compositions and methods for treating cancer using igsf9 and liv-1 |
| WO2006069403A3 (en) * | 2004-12-22 | 2006-09-28 | Genentech Inc | Methods for producing soluble multi-membrane-spanning proteins |
| EP1709976A4 (en) * | 2003-12-26 | 2007-10-17 | Toshio Hirano | EMT-INDUCING MEDIUM |
| WO2007120787A3 (en) * | 2006-04-13 | 2009-04-30 | Novartis Vaccines & Diagnostic | Methods of treating, diagnosing or detecting cancers associated with liv-1 overexpression |
| US8198052B2 (en) | 2002-02-20 | 2012-06-12 | Sysmex Corporation | Primers for nucleic acid amplification in detecting β-actin and test method using these primers |
| US8313745B2 (en) | 1999-03-15 | 2012-11-20 | Abbott Biotherapeutics Corp. | Compositions against cancer antigen LIV-1 and uses thereof |
| US8323906B2 (en) * | 2001-06-21 | 2012-12-04 | Millennium Pharmaceuticals, Inc. | Compositions, kits, and methods for identification, assessment, prevention and therapy of breast and ovarian cancer |
| USRE48959E1 (en) | 2010-12-06 | 2022-03-08 | Seagen Inc. | Humanized antibodies to LIV-1 and use of same to treat cancer |
| US11325980B2 (en) | 2016-03-15 | 2022-05-10 | Seagen Inc. | Combination therapy using a LIV1-ADC and a chemotherapeutic |
Families Citing this family (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2863275B1 (fr) * | 2003-12-09 | 2007-08-10 | Biomerieux Sa | Procede pour le diagnostic/pronostic du cancer du sein |
| US7767792B2 (en) * | 2004-02-20 | 2010-08-03 | Ludwig Institute For Cancer Research Ltd. | Antibodies to EGF receptor epitope peptides |
| JPWO2005095942A1 (ja) * | 2004-03-30 | 2008-02-21 | 独立行政法人理化学研究所 | レーザーアブレーションを用いた生体試料の分析方法およびその装置 |
| US20090258005A1 (en) * | 2007-05-29 | 2009-10-15 | Trubion Pharmaceuticals Inc. | Therapeutic compositions and methods |
| US20090304590A1 (en) * | 2007-05-29 | 2009-12-10 | Wyeth | Therapeutic compositions and methods |
| US8097423B2 (en) * | 2007-07-30 | 2012-01-17 | Institute Of Virology | MN/CA IX and breast cancer therapy |
| US20100092894A1 (en) * | 2008-10-14 | 2010-04-15 | Weihong Liu | Bottom Antireflective Coating Compositions |
| EP2496601B1 (en) | 2009-11-05 | 2017-06-07 | F. Hoffmann-La Roche AG | Methods and composition for secretion of heterologous polypeptides |
| WO2012024612A1 (en) * | 2010-08-20 | 2012-02-23 | Pangea Biosciences, Inc. | Cancer diagnostic and cancer therapeutic |
| WO2013112881A1 (en) | 2012-01-27 | 2013-08-01 | Thomas Jefferson University | Mct protein inhibitor-related prognostic and therapeutic methods |
| US10022372B2 (en) | 2013-04-19 | 2018-07-17 | Thomas Jefferson University | Caveolin-1 related methods for treating glioblastoma with temozolomide |
| AU2015229035B2 (en) | 2014-03-14 | 2021-08-05 | Genentech, Inc. | Methods and compositions for secretion of heterologous polypeptides |
Family Cites Families (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP3040121B2 (ja) * | 1988-01-12 | 2000-05-08 | ジェネンテク,インコーポレイテッド | 増殖因子レセプターの機能を阻害することにより腫瘍細胞を処置する方法 |
| US5720937A (en) * | 1988-01-12 | 1998-02-24 | Genentech, Inc. | In vivo tumor detection assay |
| DE69031120T2 (de) | 1989-05-19 | 1998-01-15 | Genentech, Inc., South San Francisco, Calif. | Her2 extrazellulare domäne |
| CA2132500A1 (en) * | 1994-09-20 | 1996-03-21 | David Lockwood Manning | Methods for predicting the behaviour of breast tumours |
| US5731168A (en) | 1995-03-01 | 1998-03-24 | Genentech, Inc. | Method for making heteromultimeric polypeptides |
| NZ334148A (en) | 1996-08-12 | 2001-12-21 | Celgene Corp | 3-Substituted phenyl-ethyl or ethenyl derivatives terminated with a nitrile, alkane, carboxyl or carbamoyl group useful to reduce cytokine levels |
| KR20060079258A (ko) | 1996-10-18 | 2006-07-05 | 제넨테크, 인크. | 항-ErbB2 항체 |
| US5860935A (en) | 1996-10-29 | 1999-01-19 | Novid Inc. | Game apparatus and method for monitoring psycho-physiological responses to questions |
| WO2001018022A1 (en) | 1999-09-03 | 2001-03-15 | Human Genome Sciences, Inc. | 52 human secreted proteins |
| CA2289116A1 (en) | 1997-05-06 | 1998-11-12 | Human Genome Sciences, Inc. | Enterococcus faecalis polynucleotides and polypeptides |
| WO1999006673A1 (en) | 1997-07-30 | 1999-02-11 | Eg & G Sealol, Inc. | Improved brush seal and method of making same |
| ZA9811162B (en) | 1997-12-12 | 2000-06-07 | Genentech Inc | Treatment with anti-ERBB2 antibodies. |
| DE19813839A1 (de) | 1998-03-20 | 1999-09-23 | Metagen Gesellschaft Fuer Genomforschung Mbh | Menschliche Nukleinsäuresequenzen aus Brusttumorgewebe |
| WO1999048527A1 (en) | 1998-03-27 | 1999-09-30 | Genentech, Inc. | Apo-2 ligand-anti-her-2 antibody synergism |
| ATE386804T1 (de) | 1998-10-15 | 2008-03-15 | Novartis Vaccines & Diagnostic | Gene mit veränderter expression in metastatischen brust- oder dickdarm- krebszellen |
| US6579973B1 (en) | 1998-12-28 | 2003-06-17 | Corixa Corporation | Compositions for the treatment and diagnosis of breast cancer and methods for their use |
| CA2296792A1 (en) | 1999-02-26 | 2000-08-26 | Genset S.A. | Expressed sequence tags and encoded human proteins |
| AU3395900A (en) | 1999-03-12 | 2000-10-04 | Human Genome Sciences, Inc. | Human lung cancer associated gene sequences and polypeptides |
| US6762020B1 (en) * | 1999-03-15 | 2004-07-13 | Protein Design Labs, Inc. | Methods of diagnosing breast cancer |
| US6649342B1 (en) * | 1999-03-15 | 2003-11-18 | Eos Biotechnology, Inc. | Methods of diagnosing breast cancer, compositions, and methods of screening for breast cancer modulators |
| US20040141983A1 (en) * | 1999-03-15 | 2004-07-22 | Protein Design Labs, Inc. | Compositions against cancer antigen LIV-1 and uses thereof |
| EP1159619A2 (en) | 1999-03-15 | 2001-12-05 | EOS Biotechnology, Inc. | Methods of diagnosing and treating breast cancer |
| JP2002539816A (ja) | 1999-03-26 | 2002-11-26 | ヒューマン ジノーム サイエンシーズ, インコーポレイテッド | 50個のヒト分泌タンパク質 |
| US6780586B1 (en) * | 1999-11-29 | 2004-08-24 | Protein Design Labs, Inc. | Methods of diagnosing breast cancer |
| US6750013B2 (en) * | 1999-12-02 | 2004-06-15 | Protein Design Labs, Inc. | Methods for detection and diagnosing of breast cancer |
| AU2001283463A1 (en) * | 2000-08-18 | 2002-03-04 | Eos Biotechnology, Inc. | Methods of diagnosis of cancer and screening for cancer modulators |
| JP2005503760A (ja) * | 2001-01-24 | 2005-02-10 | プロテイン デザイン ラブス, インコーポレイテッド | 乳癌の診断方法、組成物および乳癌のモジュレーターのスクリーニング方法 |
| WO2004067564A2 (en) | 2003-01-29 | 2004-08-12 | Protein Design Labs, Inc. | Compositions against cancer antigen liv-1 and uses thereof |
-
2001
- 2001-01-25 MX MXPA02007190A patent/MXPA02007190A/es not_active Application Discontinuation
- 2001-01-25 EP EP01906709A patent/EP1263780A2/en not_active Withdrawn
- 2001-01-25 KR KR1020027009510A patent/KR20020073181A/ko not_active Ceased
- 2001-01-25 US US10/182,033 patent/US7285382B2/en not_active Expired - Fee Related
- 2001-01-25 AU AU34584/01A patent/AU3458401A/en not_active Abandoned
- 2001-01-25 JP JP2001561030A patent/JP2003523207A/ja not_active Withdrawn
- 2001-01-25 WO PCT/US2001/002622 patent/WO2001055178A2/en not_active Ceased
- 2001-01-25 CA CA002395832A patent/CA2395832A1/en not_active Abandoned
- 2001-01-25 IL IL15059201A patent/IL150592A0/xx unknown
-
2002
- 2002-06-27 ZA ZA200205191A patent/ZA200205191B/xx unknown
-
2005
- 2005-05-02 US US11/120,399 patent/US7982015B2/en not_active Expired - Fee Related
-
2006
- 2006-10-05 US US11/538,881 patent/US7691566B2/en not_active Expired - Fee Related
-
2009
- 2009-11-25 IL IL202332A patent/IL202332A0/en unknown
Non-Patent Citations (11)
| Title |
|---|
| DATABASE EMBL [Online] EUROPEAN BIOINFORMATICS INSTITUTE; Acc. No. AE000299, 29 January 1999 (1999-01-29) BLATTNER FR ET AL.: "The complete genome sequence of Escherichia coli K-12" XP002175108 * |
| DATABASE EMBL [Online] EUROPEAN INSTITUTE FOR BIOINFORMATICS; ACC. NO. AF062400, 12 November 1998 (1998-11-12) DEHESH, K: "Cuphea hookeriana thioesterase FatB1-1" XP002175109 * |
| DATABASE EMBL [Online] EUROPEAN MOLECULAR BIOLOGY LABORATORIES; ACC. NO. AP001158, 15 February 2000 (2000-02-15) HATTORI, M ET AL.: "Homo sapiens 160,170 genomic DNA of 18q12." XP002175110 * |
| DATABASE ENTREZ NULCEOTIDE [Online] NCBI; Acc. No. U41060 (Version 1; GI:1256000), 6 April 1996 (1996-04-06) GREEN, C ET AL.: "Human Breast Cancer, estrogen regulated LIV-1 protein (LIV-1) mRNA, partial cds." XP002175106 cited in the application -& DATABASE ENTREZ NUCLEOTIDE [Online] NCBI; Acc. No. U41060 (Version 2; GI:12711792), 8 February 2001 (2001-02-08) GREEN, C ET AL.: "Human Breast Cancer, estrogen regulated LIV-1 protein (LIV-1) mRNA, complete cds." XP002175107 * |
| EL-TANANI M K K ET AL: "Interaction between estradiol and CAMP in the regulation of specific gene expression." MOLECULAR AND CELLULAR ENDOCRINOLOGY, vol. 124, no. 1-2, 1996, pages 71-77, XP001013445 ISSN: 0303-7207 * |
| EL-TANANI MOHAMMED K K ET AL: "Interaction between estradiol and growth factors in the regulation of specific gene expression in MCF-7 human breast cancer cells." JOURNAL OF STEROID BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 60, no. 5-6, 1997, pages 269-276, XP001013443 ISSN: 0960-0760 * |
| MANNING D L ET AL: "Oestrogen-regulated genes in breast cancer: Association of pLIV1 with lymph node involvement." EUROPEAN JOURNAL OF CANCER, vol. 30A, no. 5, 1994, pages 675-678, XP001018910 ISSN: 0959-8049 * |
| MANNING D L ET AL: "The role of four oestrogen-responsive genes, pLIV1, pS2, pSYD3 and pSYD8, in predicting responsiveness to endocrine therapy in primary breast cancer." EUROPEAN JOURNAL OF CANCER, vol. 29A, no. 10, 1993, pages 1462-1468, XP001018909 ISSN: 0959-8049 * |
| TAYLOR K M ET AL: "LIV-1 breast cancer protein belongs to a new family of histidine-rich transmembrane proteins with potential to control intracellular Zn++." CLINICAL & EXPERIMENTAL METASTASIS, vol. 17, no. 9, 1999, page 758 XP001013451 VIII International Congress of the Metastasis Research Society;London, UK; September 24-27, 2000 ISSN: 0262-0898 * |
| TAYLOR K M ET AL: "The LIV-1 gene, implicated in metastatic breast cancer, codes for a histidine-rich transmembrane protein." BRITISH JOURNAL OF CANCER, vol. 80, no. SUPPL. 2, July 1999 (1999-07), page 24 XP001013344 Joint Meeting of the British Association for Cancer Research, the British Oncological Association, the Association of Cancer Physicians and the Royal College of Radiologists;Edinburgh, Scotland, UK; July 11-14, 1999 ISSN: 0007-0920 * |
| TAYLOR K M: "LIV-1 breast cancer protein belongs to new family of histidine-rich membrane proteins with potential to control intracellular Zn2+ homeostasis." IUBMB LIFE, vol. 49, no. 4, April 2000 (2000-04), pages 249-253, XP001012651 ISSN: 1521-6543 * |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6762020B1 (en) | 1999-03-15 | 2004-07-13 | Protein Design Labs, Inc. | Methods of diagnosing breast cancer |
| US8313745B2 (en) | 1999-03-15 | 2012-11-20 | Abbott Biotherapeutics Corp. | Compositions against cancer antigen LIV-1 and uses thereof |
| US8323906B2 (en) * | 2001-06-21 | 2012-12-04 | Millennium Pharmaceuticals, Inc. | Compositions, kits, and methods for identification, assessment, prevention and therapy of breast and ovarian cancer |
| US8198052B2 (en) | 2002-02-20 | 2012-06-12 | Sysmex Corporation | Primers for nucleic acid amplification in detecting β-actin and test method using these primers |
| WO2004066933A3 (en) * | 2003-01-27 | 2006-03-02 | Biogen Idec Inc | Compositions and methods for treating cancer using igsf9 and liv-1 |
| JP2006520194A (ja) * | 2003-01-27 | 2006-09-07 | バイオジェン・アイデック・エムエイ・インコーポレイテッド | Igsf9およびliv−1を使用して癌を処置するための組成物および方法 |
| WO2004067564A3 (en) * | 2003-01-29 | 2005-02-17 | Protein Design Labs Inc | Compositions against cancer antigen liv-1 and uses thereof |
| US8906342B2 (en) | 2003-01-29 | 2014-12-09 | Abbvie Biotherapeutics Inc. | Compositions against cancer antigen LIV-1 and uses thereof |
| US8591863B2 (en) | 2003-01-29 | 2013-11-26 | Abbvie Biotherapeutics Inc. | Compositions against cancer antigen LIV-1 and uses thereof |
| WO2005048938A2 (en) | 2003-11-13 | 2005-06-02 | California Pacific Medical Center | Anti-pecam therapy for metastasis suppression |
| US7572443B2 (en) | 2003-11-13 | 2009-08-11 | California Pacific Medical Center | Anti-PECAM therapy for metastasis suppression |
| EP1709976A4 (en) * | 2003-12-26 | 2007-10-17 | Toshio Hirano | EMT-INDUCING MEDIUM |
| WO2006069403A3 (en) * | 2004-12-22 | 2006-09-28 | Genentech Inc | Methods for producing soluble multi-membrane-spanning proteins |
| EP2290086A3 (en) * | 2004-12-22 | 2011-10-19 | Genentech, Inc. | Methods for producing soluble multi-membrane-spanning proteins |
| EP2290087A3 (en) * | 2004-12-22 | 2011-06-15 | Genentech, Inc. | Methods for producing soluble multi-membrane-spanning proteins |
| EP2290088A1 (en) * | 2004-12-22 | 2011-03-02 | Genentech, Inc. | Methods for producing soluble multi-menbrane-spanning proteins |
| US8323902B2 (en) | 2004-12-22 | 2012-12-04 | Genentech, Inc. | Methods for producing soluble membrane-spanning proteins |
| US7829684B2 (en) | 2004-12-22 | 2010-11-09 | Genentech, Inc. | Methods for producing soluble membrane-spanning proteins |
| US7691989B2 (en) | 2004-12-22 | 2010-04-06 | Genentech, Inc. | Methods for producing soluble membrane-spanning proteins |
| WO2007120787A3 (en) * | 2006-04-13 | 2009-04-30 | Novartis Vaccines & Diagnostic | Methods of treating, diagnosing or detecting cancers associated with liv-1 overexpression |
| USRE48959E1 (en) | 2010-12-06 | 2022-03-08 | Seagen Inc. | Humanized antibodies to LIV-1 and use of same to treat cancer |
| US11325980B2 (en) | 2016-03-15 | 2022-05-10 | Seagen Inc. | Combination therapy using a LIV1-ADC and a chemotherapeutic |
Also Published As
| Publication number | Publication date |
|---|---|
| AU3458401A (en) | 2001-08-07 |
| IL150592A0 (en) | 2003-02-12 |
| US20030215457A1 (en) | 2003-11-20 |
| JP2003523207A (ja) | 2003-08-05 |
| WO2001055178A9 (en) | 2002-04-04 |
| MXPA02007190A (es) | 2003-02-12 |
| US7982015B2 (en) | 2011-07-19 |
| US20080138345A1 (en) | 2008-06-12 |
| US20070264267A1 (en) | 2007-11-15 |
| KR20020073181A (ko) | 2002-09-19 |
| US7285382B2 (en) | 2007-10-23 |
| ZA200205191B (en) | 2003-07-28 |
| EP1263780A2 (en) | 2002-12-11 |
| IL202332A0 (en) | 2011-08-01 |
| CA2395832A1 (en) | 2001-08-02 |
| WO2001055178A3 (en) | 2002-03-07 |
| US7691566B2 (en) | 2010-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2001055178A2 (en) | Liv-1 related protein, polynucleotides encoding the same and use thereof for treatment of cancer | |
| AU768230B2 (en) | Methods and compositions for inhibiting neoplastic cell growth | |
| AU2008202957A1 (en) | Compositions and methods for the diagnosis and treatment of inflammatory bowel disorders | |
| EP1578364A2 (en) | Compositions and methods for the treatmentof immune related diseases | |
| AU2002351505A1 (en) | Compositions and methods for the diagnosis and treatment of inflammatory bowel disorders | |
| EP1185648A2 (en) | Methods and compositions for inhibiting neoplastic cell growth | |
| WO2000075327A1 (en) | Methods and compositions for inhibiting neoplastic cell growth | |
| ZA200103885B (en) | Methods and compositions for inhibiting neoplastic cell growth. | |
| EP1135491A2 (en) | Methods and compositions for inhibiting neoplastic cell growth | |
| EP1244784A2 (en) | Methods and compositions for inhibiting neoplastic cell growth | |
| MXPA05002287A (es) | 2 polipeptidos similares a achaete-scute y acidos nucleicos de codificacion, y metodos para el diagnostico y tratamiento de tumores. | |
| AU2003247806B2 (en) | Compositions and methods for the treatment of immune related diseases | |
| WO2000075316A1 (en) | Methods and compositions for inhibiting neoplastic cell growth | |
| IL142088A (en) | Use of a pro172 polypeptide in the preparation of pharmaceutical compositions for inhibiting neoplastic cell growth | |
| WO2000053751A1 (en) | Methods and compositions for inhibiting neoplastic cell growth | |
| AU2003204815B2 (en) | Methods and compositions for inhibiting neoplastic cell growth | |
| WO2000055319A1 (en) | Methods and compositions for inhibiting neoplastic cell growth | |
| WO2004024069A2 (en) | Novel compositions and methods for the treatment of immune-related diseases | |
| ZA200103883B (en) | Method and compositions for inhibiting neoplastic cell growth. | |
| MXPA01005418A (en) | Methods and compositions for inhibiting neoplastic cell growth |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| AK | Designated states |
Kind code of ref document: C2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: C2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| COP | Corrected version of pamphlet |
Free format text: PAGES 1/29-29/29, DRAWINGS, REPLACED BY NEW PAGES 1/26-26/26; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2395832 Country of ref document: CA Ref document number: 519770 Country of ref document: NZ Ref document number: 34584/01 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002/05191 Country of ref document: ZA Ref document number: 200205191 Country of ref document: ZA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 150592 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2001906709 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2002/007190 Country of ref document: MX Ref document number: 1020027009510 Country of ref document: KR |
|
| ENP | Entry into the national phase |
Ref document number: 2001 561030 Country of ref document: JP Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020027009510 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10182033 Country of ref document: US |
|
| WWP | Wipo information: published in national office |
Ref document number: 2001906709 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |