WO2001049836A1 - Nouveau polypeptide, glycophosphotransferase pep (phospho- enolpyruvate)- dependante 9, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, glycophosphotransferase pep (phospho- enolpyruvate)- dependante 9, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001049836A1
WO2001049836A1 PCT/CN2000/000649 CN0000649W WO0149836A1 WO 2001049836 A1 WO2001049836 A1 WO 2001049836A1 CN 0000649 W CN0000649 W CN 0000649W WO 0149836 A1 WO0149836 A1 WO 0149836A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
sugar phosphotransferase
sequence
dependent sugar
Prior art date
Application number
PCT/CN2000/000649
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Fudan University
Shanghai Bio Door Gene Technology Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University, Shanghai Bio Door Gene Technology Ltd. filed Critical Fudan University
Priority to AU24988/01A priority Critical patent/AU2498801A/en
Publication of WO2001049836A1 publication Critical patent/WO2001049836A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, enolpropionate phosphate-dependent sugar phosphotransferase 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.
  • the enolpyruvate phosphate-dependent sugar phosphotransferase system is a major sugar transport system in bacteria. This system plays a vital role in regulating a variety of global metabolic pathways, and also involves the regulation of many metabolic and translation processes. It consists of two protein-enzyme I (EI) involved in energy metabolism, a thermostable phosphoryl carrier protein (HPr), and a sugar-specific permease-enzyme I I complex. PTS can catalyze the transport and transfer of sugar and the accompanying sugar phosphorylation process. In different kinds of E. coli, PTS permease is composed of different numbers of polypeptide chains. In certain cases, some sugar-specific proteins will fuse to form domains with EI and / or HPr energy coupling functions. There is evidence that the entire EI I complex is required for sugar transport and phosphorylation.
  • permease has at least three easy-to-recognize functional domains: a hydrophobic transmembrane domain capable of binding and transporting sugar substrates; a hydrophilic ⁇ similar domain Has a first phosphorylation site (always a histamine); a second hydrophilic protein or protein domain has a second phosphorylation site.
  • This site is either a cysteamide residue corresponding to most homologous PTS permease, or a histamine residue of the three permease enzymes described below.
  • subt il is, and sorbose in K. pneumoniae.
  • These three lack sequences sufficiently similar to most other permeases to establish homology, but there is a clear homology relationship between them. Sequence comparisons between different permeases revealed that during their evolution, different hydrophobic and hydrophilic domains fused with each other in different orders and recombined or combined with each other to form unique polypeptide chains. In some cases, the degree of sequence similarity between permease enzymes is independent of the integration of a particular permease complex. In body or part, it is not enough to constitute homology.
  • ⁇ is considered to be an important constituent protein of PTS, which is involved in transmembrane formation, forming membrane transfer channels and providing sugar binding sites.
  • EII usually consists of two cytoplasmic domains ⁇ , ⁇ B and a transmembrane domain I IC.
  • ⁇ contains the first permease-specific phosphorylation site, which is a histidine, which can be phosphorylated by phosphorylated HPr.
  • ⁇ B contains a second phosphorylation site and is phosphorylated by ⁇ A, which is phosphorylated depending on permease. Finally, the phosphoryl group is transferred from ⁇ B to the sugar as a substrate.
  • ⁇ and ⁇ B can be linked by a polypeptide rich in alanine and proline to form a stable dimer structure ⁇ .
  • the secondary structure of ⁇ is usually an antiparallel ⁇ -sheet consisting of five chains with a helix at both ends.
  • Histidine which serves as a phosphorylation site, is located in a shallow crack at the end of the third ⁇ -sheet chain with a hydrophobic surface composed of hydrophobic residues.
  • there is a histidine near the histidine which is the phosphorylation site (approximately 15 amino acid positions near the N-terminus), which can also interact with the phosphoryl group after it is phosphorylated.
  • the difference between the structural changes before and after phosphorylation is relatively small.
  • the enolpyruvate phosphate-dependent sugar phosphotransferase 9 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more of these processes
  • the enol pyruvate phosphate-dependent sugar phosphotransferase 9 protein identifies the amino acid sequence of this protein. Isolation of the neoenol pyruvate phosphate-dependent sugar phosphotransferase 9 protein encoding gene also provides the basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important. Object of the invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding an enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • Another object of the present invention is to provide a phosphate-dependent sugar phosphotransferase 9 containing enol pyruvate Polynucleotide Genetically Engineered Host Cells.
  • Another object of the present invention is to provide a method for producing an enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, enolpyruvate phosphate-dependent sugar phosphate transferase 9.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of enolpyruvate phosphate-dependent sugar phosphotransferase 9. Summary of invention
  • the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • polynucleotide sequences of (c) and (a) or (b) have at least 70 8 /. Identical polynucleotides.
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1263 to 1508 in SEQ ID NO: 1; and (b) a sequence having 1-1883 in SEQ ID NO: 1 Sequence of bits.
  • the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Preparation of host cells and recovery of expression products.
  • a vector in particular an expression vector, containing the polynucleotide of the invention
  • a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell
  • a method comprising culturing said Preparation of host cells and recovery of expression products.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of enolpyruvate phosphate-dependent sugar phosphotransferase 9 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of enolpyruvate phosphate-dependent sugar phosphotransferase 9 protein in vitro, which comprises detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the present invention also relates to a pharmaceutical composition, which contains the polypeptide of the present invention or a mimic, activator, antagonist Antibiotics or inhibitors and pharmaceutically acceptable carriers.
  • the present invention also relates to the preparation of a medicament of the polypeptide and / or polynucleotide of the present invention for the treatment of cancer, developmental disease or immune disease or other diseases caused by abnormal expression of enolpyruvate phosphate-dependent sugar phosphotransferase 9 the use of.
  • Figure 1 is a comparison of the amino acid sequence homology of the enol pyruvate phosphate-dependent sugar phosphotransferase 9 of the present invention at 51 to 23 amino acids in the 23-73 domain.
  • the upper sequence is the enolpyruvate phosphate-dependent sugar phosphotransferase 9 and the lower sequence is the enolpropionate phosphate-dependent sugar phosphotransferase family protein domain.
  • ⁇ "and”: "and”. "Indicate that the probability of the same amino acid appearing between the two sequences decreases in sequence.
  • Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • 9kDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. Such changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the absence of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. Missed.
  • Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
  • An "agonist” refers to a molecule that, when combined with enolpyruvate phosphate-dependent sugar phosphotransferase 9, causes a change in the protein to regulate the activity of the protein.
  • An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind an enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • Antagonist refers to a biological activity that blocks or regulates enol pyruvate phosphate-dependent sugar phosphotransferase 9 when combined with enol pyruvate phosphate-dependent sugar phosphotransferase 9.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • enolpyruvate phosphate-dependent sugar phosphotransferase 9 refers to a change in the function of enolpyruvate phosphate-dependent sugar phosphotransferase 9, including an increase or decrease in protein activity, a change in binding characteristics, and any of the enolpyruvate phosphate-dependent sugar phosphotransferase 9 Changes in other biological, functional or immune properties.
  • Substantially pure ' means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can use standard protein purification techniques to purify enolpyruvate phosphate-dependent sugar phosphates. Transferase 9. Essentially pure enolpyruvate-acid-dependent sugar phosphotransferase 9 produces a single main band on a non-reducing polyacrylamide gel. Enolpyruvate phosphate-dependent sugar phosphotransferase 9 The purity of the polypeptide can be analyzed by amino acid sequence.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T
  • the complementarity between two single-stranded molecules can be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity. It can be partially homologous or completely homologous. "Partial homology” refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require the binding of two sequences to each other to be specific Or selective interaction.
  • Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). 0 The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, D. G, and PM Sharp (1988) Gene 73: 237-244) 0 The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences, such as sequence A and sequence B, is calculated by the following formula: Number of residues that match between the sequence
  • Number of sequence residues-sequence ⁇ (number of intermediate residues-number of interval residues in sequence ⁇ x can also be determined by Clus ter method or using methods known in the art such as Jotun Hein. J (1990) Methods in enzymology 183: 625-645) 0
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
  • the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
  • Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode to retain the main biological properties of natural molecules
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ) 2 and? ⁇ It can specifically bind to the epitope of enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
  • a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not its natural environment The ingredients, they are still separated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
  • isolated enolpyruvate phosphate-dependent sugar phosphotransferase 9 means that enolpyruvate phosphate-dependent sugar phosphotransferase 9 is substantially free of other proteins, lipids, and sugars naturally associated with it. Or other substances. Those skilled in the art can purify enolpyruvate phosphate-dependent sugar phosphotransferase 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the enol pyruvate phosphate-dependent sugar phosphotransferase 9 peptide can be analyzed by amino acid sequences.
  • the present invention provides a novel polypeptide, enolpyruvate phosphate-dependent sugar phosphotransferase 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the invention can be naturally purified products, products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques.
  • polypeptides of the invention may be glycosylated, or they may be non-glycosylated.
  • the polypeptides of the invention may also include or exclude the initial methionine residue.
  • the invention also includes fragments, derivatives and analogs of enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • fragment refers to a polypeptide that substantially retains the same biological function or activity of the enolpyruvate phosphate-dependent sugar phosphotransferase 9 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ ) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify this polypeptide or protein sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes a nucleoside of SEQ ID NO: 1 Acid sequence.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1883 bases, and its open reading frame (1263-1508) encodes 81 amino acids.
  • This polypeptide has a characteristic sequence of an enolpyruvate phosphate-dependent sugar phosphotransferase family protein, and it can be deduced that the enolpyruvate phosphate-dependent sugar phosphotransferase 9 has an enolpyruvate phosphate-dependent sugar phosphotransferase family protein Structure and function represented.
  • the polynucleotide of the present invention may be in the form of DM 'or RNA.
  • DM forms include cDNA, genomic DNA or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • the DM can be a coding chain or a non-coding chain.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant” refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
  • These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
  • "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /.
  • the polypeptide encoded by the hybridizable polynucleotide is identical to the mature polypeptide shown in SEQ ID NO: 2 Biological function and activity.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate a polynucleotide encoding an enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence encoding the enolpyruvate phosphate-dependent sugar phosphotransferase 9 of the present invention can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the polypeptide ⁇ double-stranded DM.
  • genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice.
  • the more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction. Kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the enol pyruvate phosphate-dependent sugar phosphotransferase 9 transcription (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • the protein product of the enolpyruvate phosphate-dependent sugar phosphotransferase 9 gene can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.
  • -Amplification of DM / RNA by PCR are preferred for obtaining the genes of the invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using an enolpyruvate phosphate-dependent sugar phosphotransferase 9 coding sequence, and produced by recombinant technology A method of a polypeptide according to the invention.
  • a polynucleotide sequence encoding an enolpyruvate phosphate-dependent sugar phosphotransferase 9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct recombinant expression vectors.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • an expression vector containing a DNA sequence encoding a pyruvate pyruvate phosphate-dependent sugar phosphotransferase 9 and appropriate transcription / translation regulatory elements can be used to construct an expression vector containing a DNA sequence encoding a pyruvate pyruvate phosphate-dependent sugar phosphotransferase 9 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mole Molecular Cloning, a Labora tory Manua, Coll Spring Harbor Labora tory. New York, 1989).
  • the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of an enhancer sequence into the vector will Its transcription is enhanced in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
  • the expression vector preferably contains one or more selectable markers, which provide phenotypic traits for the host cells that are selected for transformation, such as dihydrofolate reductase for eukaryotic cell culture, new mold Resistance and green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • selectable markers such as dihydrofolate reductase for eukaryotic cell culture, new mold Resistance and green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding an enolpyruvate phosphate-dependent sugar phosphotransferase 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a gene containing the polynucleotide or the recombinant vector.
  • Engineered host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
  • coli Streptomyces
  • bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells such as fly S2 or Sf 9
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote, such as E. coli
  • competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
  • the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant enolpyruvate phosphate-dependent sugar phosphotransferase 9 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
  • polynucleotide (or variant) encoding human enolpyruvate phosphate-dependent sugar phosphotransferase 9 of the present invention, or a suitable host cell is transformed or transduced with a recombinant expression vector containing the polynucleotide ;
  • the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When host cells grow to proper After inducing the cell density, the appropriate promoter (such as temperature conversion or chemical induction) is used to induce the selected promoter, and the cells are cultured for a period of time.
  • the appropriate promoter such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
  • the enol pyruvate phosphate-dependent sugar phosphotransferase system is a sugar transport system. This system plays a vital role in regulating a variety of global metabolic pathways, and also involves the regulation of many metabolic and translation processes. It consists of two protein-enzyme I (EI) involved in energy metabolism and a thermostable phosphoryl carrier protein (HPr), and a sugar-specific permease-enzyme II complex. The entire ⁇ complex is required for sugar transport and phosphorylation. It is considered to be an important constituent protein of PTS, participates in transmembrane, forms membrane transfer channels and provides sugar binding sites. ⁇ usually consists of two cytoplasmic domains IIIA, IIIB, and a transmembrane domain IIC.
  • the polypeptide of the present invention is a novel enzyme IIA protein in PTS, which is very important for sugar transportation and metabolism and phosphorylation of substances. Its specific conserved sequence is required to form its active mot if.
  • the abnormal function of the polypeptide containing the specific mot if of the present invention will lead to abnormal sugar transportation and metabolism, abnormal phosphorylation of metabolites, and produce related diseases such as disorders related to glucose metabolism disorders, tumors, and embryo development disorders. , Growth and development disorders.
  • the abnormal expression of the enolpyruvate phosphate-dependent sugar phosphotransferase 9 of the present invention will produce various diseases, especially diseases related to glucose metabolism disorders, tumors, embryonic development disorders, and growth and development disorders. These diseases include but are not Limited to:
  • Organic acidemia Propionic acidemia, methylmalonic aciduria, isovalerate, combined carboxylase deficiency, glutaric acid type I, congenital carbohydrate digestion and absorption Defects such as congenital lactose intolerance, hereditary fructose intolerance, monosaccharide metabolism defects such as galactosemia, fructose metabolism defects, glycogen metabolism diseases such as glycogen storage disease, mucopolysaccharidosis
  • Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney disease, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, Hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, open ductus arteriosus, neural tube defects, congenital hydrocephalus, iris defect, congenital glaucoma or cataract, congenital deafness
  • Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects, stunting, dwarfism, sexual retardation
  • Tumors of various tissues gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, tracheal tumor, fibroma, Fibrosarcoma, lipoma, liposarcoma, leiomyoma
  • the abnormal expression of the enolpyruvate phosphate-dependent sugar phosphotransferase 9 of the present invention will also cause certain hereditary, hematological and immune system diseases.
  • the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially diseases related to glucose metabolism disorders, tumors, embryo development disorders, growth and development disorders, and some Hereditary, hematological and immune system diseases.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • Agonists increase enolpyruvate phosphate-dependent sugar phosphotransferase 9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing enol pyruvate phosphate-dependent sugar phosphotransferase 9 can be cultured with labeled enol pyruvate phosphate-dependent sugar phosphotransferase 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Enol pyruvate phosphate-dependent sugar phosphotransferase 9 antagonists include antibodies, compounds, receptor deletions, and the like that have been screened.
  • An antagonist of enolpyruvate phosphate-dependent sugar phosphotransferase 9 can bind to and eliminate its function, or inhibit the production of the polypeptide, or the activity of the polypeptide Site binding prevents the polypeptide from performing its biological function.
  • enolpyruvate phosphate-dependent sugar phosphotransferase 9 can be added to the bioanalytical assay. The effect of this interaction is used to determine whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
  • Polypeptide molecules capable of binding to enolpyruvate phosphate-dependent sugar phosphotransferase 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase.
  • Enol Nine molecules of ketophosphate-dependent sugar phosphotransferase were labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
  • the present invention also provides antibodies against an enol pyruvate phosphate-dependent sugar phosphotransferase 9 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by enol pyruvate phosphate-dependent sugar phosphotransferase 9 directly by immunizing animals (such as rabbits, mice, rats, etc.).
  • immunizing animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including It is not limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies to enolpyruvate phosphate-dependent sugar phosphotransferase 9 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human B -Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
  • the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • Antibodies against enolpyruvate phosphate-dependent sugar phosphotransferase 9 can be used in immunohistochemical techniques to detect enolpyruvate phosphate-dependent sugar phosphotransferase 9 in biopsy specimens.
  • Monoclonal antibodies that bind to enolpyruvate phosphate-dependent sugar phosphotransferase 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • enolpyruvate phosphate-dependent sugar phosphotransferase 9 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This hybrid antibody can be used to kill enol pyruvate phosphate-dependent sugar phosphate Transferase 9 positive cells.
  • the antibodies of the present invention can be used to treat or prevent diseases related to enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • Administration of an appropriate dose of the antibody can stimulate or block the production or activity of enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • the invention also relates to a diagnostic test method for quantitative and localized detection of enolpyruvate phosphate-dependent sugar phosphotransferase 9 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of enolpyruvate phosphate-dependent sugar phosphotransferase 9 detected in the test can be used to explain the importance of enolpyruvate phosphate-dependent sugar phosphotransferase 9 in various diseases and to diagnose enolacetone Diseases where acid phosphate-dependent sugar phosphotransferase 9 functions.
  • the polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding enolpyruvate phosphate-dependent sugar phosphotransferase 9 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated enolpyruvate phosphate-dependent sugar phosphotransferase 9 to inhibit endogenous enolpyruvate phosphate-dependent sugar phosphotransferase 9 activity.
  • a variant enolpyruvate phosphate-dependent sugar phosphotransferase 9 may be a shortened enolpyruvate phosphate-dependent sugar phosphotransferase 9 that lacks a signaling domain, although it may interact with downstream substrates. Binding, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for the treatment of diseases caused by abnormal expression or activity of glycopyruvate phosphate-dependent sugar phosphotransferase 9.
  • Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc.
  • polynucleotide encoding an enol pyruvate phosphate-dependent sugar phosphotransferase 9 can be used to transfer a polynucleotide encoding an enol pyruvate phosphate-dependent sugar phosphotransferase 9 into a cell .
  • Methods for constructing recombinant viral vectors carrying a polynucleotide encoding an enolpyruvate phosphate-dependent sugar phosphotransferase 9 can be found in the existing literature (Sambrook, et al.).
  • the polynucleotide encoding the enol pyruvate phosphate 'acid-dependent sugar phosphotransferase 9 can be packaged into liposomes and transferred into cells.
  • Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Oligonucleotides including antisense RM and DM
  • ribozymes that inhibit enolpyruvate phosphate-dependent sugar phosphotransferase 9 raRNA are also within the scope of the present invention.
  • a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
  • Antisense RNA, DNA and ribozymes can be obtained by any existing RM or DM synthesis technology, such as the solid-phase phosphate amide chemical synthesis method to synthesize oligonucleotides has been widely used.
  • Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the MA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
  • Polynucleotides encoding enol pyruvate phosphate-dependent sugar phosphotransferase 9 can be used to diagnose diseases related to enol pyruvate phosphate-dependent sugar phosphotransferase 9.
  • Polynucleotide encoding enol pyruvate phosphate-dependent sugar phosphotransferase 9 can be used to detect enol pyruvate phosphate-dependent sugar phosphotransferase 9 Expression or Abnormal Expression of Enol Pyruvate Phosphate-dependent Sugar Phosphotransferase 9 in Disease Conditions
  • the DNA sequence encoding enolpyruvate phosphate-dependent sugar phosphotransferase 9 can be used to hybridize biopsy specimens to determine the expression of enolpyruvate phosphate-dependent sugar phosphotransferase 9.
  • Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Enol pyruvate phosphate-dependent sugar phosphotransferase 9 specific primers for RM-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the enol pyruvate phosphate-dependent sugar phosphotransferase 9 transcription products.
  • Detection of mutations in the enol pyruvate phosphate-dependent sugar phosphotransferase 9 gene can also be used to diagnose enol pyruvate phosphate-dependent sugar phosphotransferase 9-related diseases.
  • Enol pyruvate phosphate-dependent sugar phosphotransferase 9 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type enol pyruvate phosphate-dependent sugar phosphotransferase 9 DM sequence Wait. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared according to cDM, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
  • PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
  • these appliances there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminds them that the government agencies that manufacture, use, or sell permit their administration on the human body.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds. '
  • the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Enolpyruvate phosphate-dependent sugar phosphotransferase 9 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and dose range of enolpyruvate phosphate-dependent sugar phosphotransferase 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
  • RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Poly (A) mRNA was isolated from total RM using Quik mRM Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • Smar t cDM cloning kit purchased from Clontech ⁇ cDNA fragment was inserted into the multi-cloning site of pBSK (+) vector (Clontech)) to transform DH5 ⁇ to form a cDNA library.
  • Dye terminate cycle react ion sequencing Kit Perkin-Elmer
  • ABI 377 automatic sequencer Perkin-Elmer
  • the determined cDNA sequence is compared with the existing public DNA sequence database (Genebank).
  • Genebank public DNA sequence database
  • a series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions.
  • the sequence of the enolpyruvate phosphate-dependent sugar phosphotransferase 9 of the present invention and the protein sequence encoded by the enolpyruvate phosphate-dependent sugar phosphotransferase 9 were performed using the prof i le scan program (Basic local al ignment search tool) in GCG [Al tschul, SF et al J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed in a database such as Proste.
  • the enolpyruvate phosphate-dependent sugar phosphotransferase 9 of the present invention is homologous with the domain enolpyruvate phosphate-dependent sugar phosphotransferase family proteins at 23-73.
  • Example 3 Cloning of a gene encoding enolpyruvate phosphate-dependent sugar phosphotransferase 9 by RT-PCR method.
  • the total RM of fetal brain cells was used as a template, and ol-igo-dT was used as a primer for reverse transcription reaction to synthesize cDNA. After purification of the kit, PCR amplification was performed with the following primers:
  • Pr imer 1 5'- CGGAGTCTCACTCTGTCACCCAGG -3 '(SEQ ID NO: 3)
  • Pr imer2 5'- TCAGTACTGATGTCCTTGGAAATC -3 '(SEQ ID NO: 4)
  • Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
  • Amplification reaction conditions 50 ⁇ l reaction volume containing 50 ⁇ l / L KCl, 10 mmol / L Tri s-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
  • the reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
  • ⁇ -act in was set as a positive control and template blank was set as a negative control.
  • the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
  • the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as l-1883bp shown in SEQ ID NO: 1.
  • Example 4 Northern blot analysis of the expression of enolpyruvate phosphate-dependent sugar phosphotransferase 9 gene:
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The obtained MA precipitate was washed with 70% ethanol, dried and dissolved in water.
  • a 32 P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which MA was transferred at 42 ° C overnight in a solution containing 50% formamide-25 mM KH 2 P0 4 (pH7. 4)-5 x SSC- 5 x Denhardt's solution and 20 g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC- 0.1% SDS at 55 ° C. 30min. Then, Phosphor Imager was used for analysis and quantification.
  • Example 5 In vitro expression, isolation, and purification of recombinant enolpyruvate phosphate-dependent sugar phosphotransferase 9
  • Pr imer 3 5'- CCCCATATGATGTGCCACCACACCCGGCTAATTT -3, (Seq ID No: 5)
  • Pr imer4 5'- CATGGATCCTCATTCCAAAGAAAATGGGGAAAAA -3 '(Seq ID No: 6)
  • These two primers contain Ndel and BamHI digestion respectively Site, followed by the coding sequences of the 5 ,, and 3 'ends of the gene of interest, respectively.
  • the restriction sites for Mel and BamHI correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site.
  • PCR reaction was performed using the pBS-0820h06 plasmid containing the full-length target gene as a template.
  • PCR reaction conditions are: total volume 50 ⁇ 1 Contains 10 pg of pBS-0820h06 plasmid, Primer-3 and Primer-4 are 1 Opmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
  • the amplified product and plasmid pET-28 (+) were double-digested with Mel and BamHI, respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E.
  • Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
  • the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to Identifying whether it contains the polynucleotide sequence of the present invention and detecting a homologous polynucleotide sequence, further The probe is used to detect whether the expression of the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in cells of normal tissues or pathological tissues is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
  • the preferred range of probe size is 18-50 nucleotides
  • the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 853 ⁇ 4 or there are more than 15 consecutive bases, the primary probe should not be used in general;
  • Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
  • Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • PBS phosphate buffered saline
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membrane nitrocellulose membrane
  • the sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardt> s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the bag, shake at 68 ° C for 2 hours.
  • 3-1 Omg pre-hybridization solution (1 OxDenhardt> s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un nouveau polypeptide, une glycophosphotransférase PEP- dépendante 9, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des tumeurs malignes, de l'hémopathie, de l'infection par VIH, de maladies immunitaires et de diverses inflammations. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour la glycophosphotransférase PEP- dépendante 9.
PCT/CN2000/000649 1999-12-29 2000-12-25 Nouveau polypeptide, glycophosphotransferase pep (phospho- enolpyruvate)- dependante 9, et polynucleotide codant pour ce polypeptide WO2001049836A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU24988/01A AU2498801A (en) 1999-12-29 2000-12-25 A new polypeptide-enolpyruvate phosphate-dependent glycophosphotransferase 9 andthe polynucleotide encoding it

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN99127223A CN1301860A (zh) 1999-12-29 1999-12-29 一种新的多肽——烯醇丙酮酸磷酸依赖的糖磷酸转移酶9和编码这种多肽的多核苷酸
CN99127223.4 1999-12-29

Publications (1)

Publication Number Publication Date
WO2001049836A1 true WO2001049836A1 (fr) 2001-07-12

Family

ID=5284811

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2000/000649 WO2001049836A1 (fr) 1999-12-29 2000-12-25 Nouveau polypeptide, glycophosphotransferase pep (phospho- enolpyruvate)- dependante 9, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1301860A (fr)
AU (1) AU2498801A (fr)
WO (1) WO2001049836A1 (fr)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CLAVERIE J.M. AND MAKALOWSKI W.: "Alu alert", NATURE, vol. 371, no. 6500, 1994, pages 752 *
CLAVERIE J.M.: "Identifying coding exons by similarity search: alu-dericed and other potentially misleading protein sequences", GENOMICS, vol. 12, no. 4, 1992, pages 838 - 841 *
QUENTIN Y.: "The Alu family developed through successive waves of fixation closely connected with primate lineage history", J. MOL. EVOL., vol. 27, no. 3, 1988, pages 194 - 202 *

Also Published As

Publication number Publication date
CN1301860A (zh) 2001-07-04
AU2498801A (en) 2001-07-16

Similar Documents

Publication Publication Date Title
WO2002051867A1 (fr) Nouveau facteur 8.8 polypeptidique liberant de la corticotrophine et polynucleotide codant ledit polypeptide
WO2002026972A1 (fr) Nouveau polypeptide, proteine humaine 20.13 de liaison de l'acide polyadenylique, et polynucleotide codant ce polypeptide
WO2001090169A1 (fr) Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide
WO2001047968A1 (fr) Nouveau polypeptide, hexokinase 12, et polynucleotide codant pour ce polypeptide
WO2001083780A1 (fr) Nouveau polypeptide, methylthioadenosine phosphorylase humaine 37, et polynucleotide codant pour ce polypeptide
WO2001049836A1 (fr) Nouveau polypeptide, glycophosphotransferase pep (phospho- enolpyruvate)- dependante 9, et polynucleotide codant pour ce polypeptide
WO2001085903A2 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier de p5cr, et polynucleotide codant pour ce polypeptide
WO2001094591A1 (fr) Nouveau polypeptide, glyceraldehyde-3-phosphate deshydrogenase 10, et polynucleotide codant ce polypeptide
WO2001090369A1 (fr) Nouveau polypeptide, n-acetylgalactosamine transferase 28, et polynucleotide codant ce polypeptide
WO2001048159A1 (fr) Nouveau polypeptide, dihydroorotase 9, et polynucleotide codant pour ce polypeptide
WO2001048173A1 (fr) Nouveau polypeptide, aminoacyl-arnt synthetase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001073068A1 (fr) Nouveau polypeptide, l1-12, et polynucleotide codant pour ce polypeptide
WO2001072790A1 (fr) Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide
WO2001070956A1 (fr) Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide
WO2001081391A1 (fr) Nouveau polypeptide, proteine 29 semblable a g-beta, et polynucleotide codant pour ce polypeptide
WO2001047994A1 (fr) Nouveau polypeptide, proteine 10 utilisant pep, et polynucleotide codant pour ce polypeptide
WO2002012305A1 (fr) Nouveau polypeptide, avidine 9, et polynucleotide codant ce polypeptide
WO2001081381A1 (fr) Nouveau polypeptide, proteine humaine 9 contenant un fragment de sequence particulier d'une recombinase specifique au site, et polynucleotide codant pour ce polypeptide
WO2001047997A1 (fr) Nouveau polypeptide, stathmine 8, et polynucleotide codant pour ce polypeptide
WO2002012494A1 (fr) Nouveau polypeptide, proteine receptrice de sperme 12, et polynucleotide codant ce polypeptide
WO2001090373A1 (fr) Nouveau polypeptide, sous-unite de regulation 37 de la proteine phosphatase 4, et polynucleotide codant ce polypeptide
WO2001049723A1 (fr) Nouveau polypeptide, atp synthetase 9, et polynucleotide codant pour ce polypeptide
WO2002000830A2 (fr) Nouveau polypeptide, sucre phosphotransferase phosphoenolpyruvate-dependante 12, et polynucleotide codant ce polypeptide
WO2001047988A1 (fr) Nouveau polypeptide, proteine de reparation 11 de l'adn, et polynucleotide codant pour ce polypeptide
WO2002012323A1 (fr) Nouveau polypeptide, proteine secretrice 11 de la famille des hlyd, et polynucleotide codant ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP